#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM29	11086	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	175897585	175897585	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr4:175897585T>A	ENST00000359240.3	+	5	1579	c.909T>A	c.(907-909)ttT>ttA	p.F303L	ADAM29_ENST00000514159.1_Missense_Mutation_p.F303L|ADAM29_ENST00000404450.4_Missense_Mutation_p.F303L|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000445694.1_Missense_Mutation_p.F303L	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	303	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TAGGAGCTTTTAGAGGAATGT	0.433																																					p.F303L	Ovarian(140;1727 1835 21805 25838 41440)	.											.	ADAM29	729	0			c.T909A						.						147.0	145.0	146.0					4																	175897585		2203	4300	6503	SO:0001583	missense	11086	exon4			AGCTTTTAGAGGA	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.909T>A	4.37:g.175897585T>A	ENSP00000352177:p.Phe303Leu	Somatic	241.0	1.0		WXS	Illumina HiSeq	Phase_I	215.0	64.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	T	10.37	1.332693	0.24167	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.08102	3.13;3.13;3.13;3.13	4.13	-3.09	0.05331	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	6.110550	0.00947	U	0.002916	T	0.02380	0.0073	N	0.01202	-0.96	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.34750	-0.9816	9	.	.	.	.	0.8784	0.01229	0.1633:0.298:0.1683:0.3705	.	303	Q9UKF5	ADA29_HUMAN	L	303	ENSP00000352177:F303L;ENSP00000414544:F303L;ENSP00000384229:F303L;ENSP00000423517:F303L	.	F	+	3	2	ADAM29	176134160	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.017000	0.03630	-0.357000	0.08175	-1.130000	0.01982	TTT	.		0.433	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
AIM1	202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106968959	106968959	+	Silent	SNP	G	G	T	rs199971648		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr6:106968959G>T	ENST00000369066.3	+	2	3139	c.2652G>T	c.(2650-2652)ccG>ccT	p.P884P		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AGGGTGCCCCGCCCTGTGGTT	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19501	0.0		0.001	False		,,,				2504	0.0				p.P884P		.											.	AIM1	139	0			c.G2652T						.	G		0,4406		0,0,2203	72.0	77.0	75.0		2652	-1.0	1.0	6		75	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AIM1	NM_001624.2		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		884/1724	106968959	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	202	exon2			TGCCCCGCCCTGT	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2652G>T	6.37:g.106968959G>T		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	29.0	NM_001624	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	37	CCDS34506.1																																																																																			G|0.999;T|0.000		0.473	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AKAP11	11215	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	42872928	42872928	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr13:42872928A>G	ENST00000025301.2	+	7	786	c.611A>G	c.(610-612)aAt>aGt	p.N204S		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	204					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AAGCCATACAATGATGGTTTG	0.333																																					p.N204S		.											.	AKAP11	227	0			c.A611G						.						79.0	73.0	75.0					13																	42872928		2203	4299	6502	SO:0001583	missense	11215	exon7			CATACAATGATGG	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.611A>G	13.37:g.42872928A>G	ENSP00000025301:p.Asn204Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	22.0	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	A	9.749	1.166961	0.21621	.	.	ENSG00000023516	ENST00000025301	T	0.13420	2.59	6.07	-2.64	0.06114	.	0.868046	0.10272	N	0.694688	T	0.11410	0.0278	L	0.54323	1.7	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.35624	-0.9781	10	0.29301	T	0.29	.	6.4947	0.22136	0.4416:0.2254:0.333:0.0	.	204	Q9UKA4	AKA11_HUMAN	S	204	ENSP00000025301:N204S	ENSP00000025301:N204S	N	+	2	0	AKAP11	41770928	0.004000	0.15560	0.004000	0.12327	0.005000	0.04900	0.208000	0.17415	-0.324000	0.08589	-0.912000	0.02778	AAT	.		0.333	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
APOH	350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	64210647	64210647	+	Silent	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr17:64210647A>G	ENST00000205948.6	-	7	943	c.906T>C	c.(904-906)aaT>aaC	p.N302N		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	302	Sushi-like.				blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			TCTTTTCCTTATTTTTGCAGA	0.388																																					p.N302N	Melanoma(155;624 1882 16869 48804 51309)	.											.	APOH	90	0			c.T906C						.						170.0	152.0	158.0					17																	64210647		2203	4300	6503	SO:0001819	synonymous_variant	350	exon7			TTCCTTATTTTTG		CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.906T>C	17.37:g.64210647A>G		Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	187.0	37.0	NM_000042	B2R9M3|Q9UCN7	Silent	SNP	ENST00000205948.6	37	CCDS11663.1																																																																																			.		0.388	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446926.1	NM_000042	
ARMC9	80210	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	232209780	232209780	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:232209780G>A	ENST00000349938.4	+	21	2166	c.1972G>A	c.(1972-1974)Ggc>Agc	p.G658S	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	658						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CACCCCCGGCGGCCACAGAAA	0.527																																					p.G658S		.											.	ARMC9	91	0			c.G1972A						.																																			SO:0001583	missense	80210	exon21			CCCGGCGGCCACA	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1972G>A	2.37:g.232209780G>A	ENSP00000258417:p.Gly658Ser	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	6.0	NM_025139	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273407	0.40194	.	.	ENSG00000135931	ENST00000349938;ENST00000359743	T	0.15952	2.38	5.01	4.01	0.46588	.	0.279259	0.35772	N	0.002993	T	0.07548	0.0190	N	0.08118	0	0.27636	N	0.947867	B	0.25048	0.117	B	0.15870	0.014	T	0.23547	-1.0185	10	0.22706	T	0.39	-11.6607	9.4346	0.38630	0.0:0.0:0.7373:0.2627	.	658	Q7Z3E5	ARMC9_HUMAN	S	658	ENSP00000258417:G658S	ENSP00000258417:G658S	G	+	1	0	ARMC9	231918024	0.999000	0.42202	0.986000	0.45419	0.625000	0.37756	3.257000	0.51500	2.483000	0.83821	0.563000	0.77884	GGC	.		0.527	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	
ATP1A4	480	hgsc.bcm.edu;bcgsc.ca	37	1	160136811	160136811	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:160136811G>T	ENST00000368081.4	+	9	1771	c.1300G>T	c.(1300-1302)Ggc>Tgc	p.G434C		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	434					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCGAATCGCTGGCCTCTGCAA	0.493																																					p.G434C		.											.	ATP1A4	94	0			c.G1300T						.						74.0	78.0	76.0					1																	160136811		2203	4300	6503	SO:0001583	missense	480	exon9			ATCGCTGGCCTCT	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1300G>T	1.37:g.160136811G>T	ENSP00000357060:p.Gly434Cys	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_144699	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	CCDS1197.1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.137748	0.37728	.	.	ENSG00000132681	ENST00000368081	D	0.96802	-4.13	4.42	3.51	0.40186	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.169650	0.50627	D	0.000102	D	0.93268	0.7855	N	0.16862	0.45	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.93482	0.6828	10	0.87932	D	0	.	6.6593	0.23004	0.208:0.0:0.792:0.0	.	434	Q13733	AT1A4_HUMAN	C	434	ENSP00000357060:G434C	ENSP00000357060:G434C	G	+	1	0	ATP1A4	158403435	0.289000	0.24334	0.780000	0.31762	0.923000	0.55619	1.953000	0.40352	1.096000	0.41439	0.650000	0.86243	GGC	.		0.493	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
AXIN1	8312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	396951	396951	+	Silent	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr16:396951C>A	ENST00000262320.3	-	2	446	c.75G>T	c.(73-75)gtG>gtT	p.V25V	AXIN1_ENST00000354866.3_Silent_p.V25V|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	25					activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CCTCACCAGGCACTGGGGGTC	0.562																																					p.V25V		.											.	AXIN1	684	0			c.G75T						.						49.0	54.0	53.0					16																	396951		2203	4300	6503	SO:0001819	synonymous_variant	8312	exon2			ACCAGGCACTGGG	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.75G>T	16.37:g.396951C>A		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	33.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Silent	SNP	ENST00000262320.3	37	CCDS10405.1																																																																																			.		0.562	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
B2M	567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	45007635	45007635	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr15:45007635C>T	ENST00000558401.1	+	2	152	c.82C>T	c.(82-84)Cag>Tag	p.Q28*	B2M_ENST00000559916.1_Nonsense_Mutation_p.Q28*|B2M_ENST00000544417.1_Nonsense_Mutation_p.Q28*|B2M_ENST00000559220.1_Intron	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	28	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCCAAAGATTCAGGTTTACTC	0.418																																					p.Q28X		.											.	B2M	93	0			c.C82T						.						152.0	152.0	152.0					15																	45007635		2198	4298	6496	SO:0001587	stop_gained	567	exon2			AAGATTCAGGTTT	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.82C>T	15.37:g.45007635C>T	ENSP00000452780:p.Gln28*	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	55.0	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Nonsense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676633	0.67928	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	.	.	.	5.82	5.82	0.92795	.	0.732245	0.13730	N	0.366742	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.5992	0.76611	0.0:1.0:0.0:0.0	.	.	.	.	X	28	.	ENSP00000340858:Q28X	Q	+	1	0	B2M	42794927	0.995000	0.38212	0.616000	0.29078	0.072000	0.16883	3.989000	0.56958	2.752000	0.94435	0.655000	0.94253	CAG	.		0.418	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
BCAR1	9564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	75263466	75263466	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr16:75263466C>A	ENST00000162330.5	-	7	2682	c.2556G>T	c.(2554-2556)gaG>gaT	p.E852D	BCAR1_ENST00000542031.2_Missense_Mutation_p.E850D|BCAR1_ENST00000538440.2_Missense_Mutation_p.E852D|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000546196.1_Missense_Mutation_p.E823D|BCAR1_ENST00000420641.3_Missense_Mutation_p.E870D|RP11-331F4.4_ENST00000489723.1_RNA|BCAR1_ENST00000393422.2_Missense_Mutation_p.E870D|BCAR1_ENST00000418647.3_Missense_Mutation_p.E898D|BCAR1_ENST00000393420.6_Missense_Mutation_p.E870D|BCAR1_ENST00000535626.2_Missense_Mutation_p.E704D	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	852					actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGTGGCCCAGCTCCTTGACCC	0.706																																					p.E898D		.											.	BCAR1	1145	0			c.G2694T						.						23.0	19.0	21.0					16																	75263466		2193	4297	6490	SO:0001583	missense	9564	exon8			GCCCAGCTCCTTG	AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.2556G>T	16.37:g.75263466C>A	ENSP00000162330:p.Glu852Asp	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	5.0	NM_001170714	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	ENST00000162330.5	37	CCDS10915.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284630	0.23392	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92	4.88	2.91	0.33838	CAS family, DUF3513 (1);	0.060220	0.64402	D	0.000005	T	0.23094	0.0558	N	0.16478	0.41	0.44531	D	0.997486	P;B;P;P;P;P;B;P;B	0.49635	0.926;0.216;0.926;0.909;0.909;0.861;0.445;0.926;0.257	D;B;D;P;P;P;B;D;B	0.65773	0.938;0.095;0.938;0.897;0.897;0.725;0.135;0.938;0.09	T	0.27365	-1.0076	10	0.07990	T	0.79	-43.4182	5.086	0.14682	0.0:0.523:0.2886:0.1884	.	870;704;898;850;870;870;852;852;642	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945;B3KWE2	.;.;.;.;.;.;.;BCAR1_HUMAN;.	D	852;870;870;852;898;704;870;850;823	ENSP00000162330:E852D;ENSP00000377074:E870D;ENSP00000392708:E870D;ENSP00000443841:E852D;ENSP00000391669:E898D;ENSP00000440370:E704D;ENSP00000377072:E870D;ENSP00000440415:E850D;ENSP00000442161:E823D	ENSP00000162330:E852D	E	-	3	2	BCAR1	73820967	0.992000	0.36948	1.000000	0.80357	0.994000	0.84299	0.297000	0.19101	1.183000	0.42943	0.467000	0.42956	GAG	.		0.706	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269017.1	NM_014567	
C21orf33	8209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45553649	45553649	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr21:45553649G>A	ENST00000291577.6	+	1	163	c.70G>A	c.(70-72)Ggc>Agc	p.G24S	C21orf33_ENST00000493883.1_3'UTR|C21orf33_ENST00000348499.5_Missense_Mutation_p.G24S|C21orf33_ENST00000427803.2_Missense_Mutation_p.G24S	NM_004649.6	NP_004640	P30042	ES1_HUMAN	chromosome 21 open reading frame 33	24						mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)		CCTGTCCCCCGGCGGTCGGAC	0.716																																					p.G24S		.											.	C21orf33	91	0			c.G70A						.						29.0	25.0	26.0					21																	45553649		2193	4292	6485	SO:0001583	missense	8209	exon1			TCCCCCGGCGGTC	Y07572	CCDS33580.1, CCDS33581.1	21q22.3	2008-07-29			ENSG00000160221	ENSG00000160221			1273	protein-coding gene	gene with protein product		601659				9150728, 8975701	Standard	NM_004649		Approved	KNP-Ia, GT335, ES1, HES1, D21S2048E, KNPI, KNPH, KNP-I	uc002zec.4	P30042	OTTHUMG00000086916	ENST00000291577.6:c.70G>A	21.37:g.45553649G>A	ENSP00000291577:p.Gly24Ser	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	9.0	NM_198155	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000291577.6	37	CCDS33580.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.541740	0.27563	.	.	ENSG00000160221	ENST00000291577;ENST00000427803;ENST00000348499	T;T;T	0.31769	1.98;1.48;1.96	2.84	-5.5	0.02576	.	1.369470	0.04982	N	0.465762	T	0.17959	0.0431	L	0.29908	0.895	0.09310	N	1	B;B	0.17465	0.022;0.007	B;B	0.08055	0.003;0.002	T	0.18209	-1.0344	10	0.40728	T	0.16	0.0316	3.4514	0.07499	0.4881:0.0:0.1913:0.3206	.	24;24	P30042-2;P30042	.;ES1_HUMAN	S	24	ENSP00000291577:G24S;ENSP00000396655:G24S;ENSP00000344901:G24S	ENSP00000291577:G24S	G	+	1	0	C21orf33	44378077	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.220000	0.01217	-1.349000	0.02202	-0.339000	0.08088	GGC	.		0.716	C21orf33-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195824.1	NM_004649	
ERMARD	55780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	170159125	170159125	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr6:170159125G>T	ENST00000366773.3	+	6	602	c.569G>T	c.(568-570)tGg>tTg	p.W190L	ERMARD_ENST00000392095.4_Missense_Mutation_p.W64L|ERMARD_ENST00000366772.2_Missense_Mutation_p.W190L|ERMARD_ENST00000418781.3_Missense_Mutation_p.W190L|ERMARD_ENST00000588451.1_Missense_Mutation_p.W64L	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	190					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											AACGTCTTATGGCATGGGTTT	0.373																																					p.W190L		.											.	C6orf70	91	0			c.G569T						.						210.0	188.0	195.0					6																	170159125		2203	4300	6503	SO:0001583	missense	55780	exon6			TCTTATGGCATGG	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.569G>T	6.37:g.170159125G>T	ENSP00000355735:p.Trp190Leu	Somatic	261.0	0.0		WXS	Illumina HiSeq	Phase_I	287.0	77.0	NM_018341	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	ENST00000366773.3	37	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587054	0.66105	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095	T;T	0.60920	0.15;0.26	5.28	5.28	0.74379	.	0.000000	0.50627	D	0.000117	T	0.72382	0.3453	M	0.76002	2.32	0.43503	D	0.995756	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.76124	-0.3074	10	0.87932	D	0	.	17.7022	0.88298	0.0:0.0:1.0:0.0	.	190;190;190	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	L	190;190;190;64	ENSP00000355735:W190L;ENSP00000375945:W64L	ENSP00000355734:W190L	W	+	2	0	C6orf70	169901050	1.000000	0.71417	0.996000	0.52242	0.368000	0.29767	5.941000	0.70195	2.469000	0.83416	0.655000	0.94253	TGG	.		0.373	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043238.2	NM_018341	
CACTIN	58509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3623771	3623771	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr19:3623771C>A	ENST00000429344.2	-	2	609	c.557G>T	c.(556-558)gGc>gTc	p.G186V	CACTIN_ENST00000248420.5_Missense_Mutation_p.G186V|CACTIN_ENST00000221899.3_Missense_Mutation_p.G118V	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	186					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CTCACCCCAGCCCATCTTCTC	0.632																																					p.G186V		.											.	.	.	0			c.G557T						.						47.0	56.0	53.0					19																	3623771		2125	4233	6358	SO:0001583	missense	58509	exon2			CCCCAGCCCATCT	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.557G>T	19.37:g.3623771C>A	ENSP00000415078:p.Gly186Val	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	40.0	NM_021231	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	CCDS45920.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808013	0.90707	.	.	ENSG00000105298	ENST00000429344;ENST00000248420;ENST00000221899	.	.	.	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.80037	0.4550	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82028	-0.0660	9	0.49607	T	0.09	.	16.8032	0.85619	0.0:1.0:0.0:0.0	.	186	Q8WUQ7	CS029_HUMAN	V	186;186;118	.	ENSP00000221899:G118V	G	-	2	0	C19orf29	3574771	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.721000	0.84768	2.204000	0.70986	0.561000	0.74099	GGC	.		0.632	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
CADM1	23705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	115085403	115085403	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr11:115085403C>A	ENST00000452722.3	-	7	939	c.919G>T	c.(919-921)Gat>Tat	p.D307Y	CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000536727.1_Missense_Mutation_p.D307Y|CADM1_ENST00000331581.6_Missense_Mutation_p.D307Y|CADM1_ENST00000542447.2_Missense_Mutation_p.D307Y|CADM1_ENST00000537058.1_Missense_Mutation_p.D307Y	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		GTACCATTATCTGTTTTGTTT	0.443																																					p.D307Y		.											.	CADM1	92	0			c.G919T						.						261.0	226.0	238.0					11																	115085403		2201	4296	6497	SO:0001583	missense	23705	exon7			CATTATCTGTTTT	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.919G>T	11.37:g.115085403C>A	ENSP00000395359:p.Asp307Tyr	Somatic	546.0	0.0		WXS	Illumina HiSeq	Phase_I	477.0	131.0	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.60|14.60	2.584062|2.584062	0.46110|0.46110	.|.	.|.	ENSG00000182985|ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581|ENST00000545380	D;D;D;D;D|.	0.81821|.	-1.54;-1.54;-1.54;-1.54;-1.54|.	5.62|5.62	5.62|5.62	0.85841|0.85841	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.053540|.	0.85682|.	D|.	0.000000|.	D|D	0.86431|0.86431	0.5931|0.5931	M|M	0.92026|0.92026	3.265|3.265	0.58432|0.58432	D|D	0.999994|0.999994	B;B;B;B;B|.	0.21753|.	0.001;0.001;0.003;0.06;0.025|.	B;B;B;B;B|.	0.37346|.	0.003;0.004;0.007;0.247;0.01|.	D|D	0.88726|0.88726	0.3233|0.3233	10|5	0.42905|.	T|.	0.14|.	.|.	19.6764|19.6764	0.95936|0.95936	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	307;307;308;307;307|.	Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1|.	.;.;.;CADM1_HUMAN;.|.	Y|I	307;307;307;307;266;307|305	ENSP00000439176:D307Y;ENSP00000395359:D307Y;ENSP00000439817:D307Y;ENSP00000440322:D307Y;ENSP00000329797:D307Y|.	ENSP00000329797:D307Y|.	D|R	-|-	1|2	0|0	CADM1|CADM1	114590613|114590613	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.946000|5.946000	0.70234|0.70234	2.660000|2.660000	0.90430|0.90430	0.655000|0.655000	0.94253|0.94253	GAT|AGA	.		0.443	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46792623	46792623	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr22:46792623C>A	ENST00000262738.3	-	13	5721	c.5722G>T	c.(5722-5724)Gtg>Ttg	p.V1908L		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1908	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CAGGCATCCACACAGTTTATT	0.592																																					p.V1908L		.											.	CELSR1	525	0			c.G5722T						.						52.0	41.0	45.0					22																	46792623		2202	4300	6502	SO:0001583	missense	9620	exon13			CATCCACACAGTT	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.5722G>T	22.37:g.46792623C>A	ENSP00000262738:p.Val1908Leu	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	27.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.460286	0.26248	.	.	ENSG00000075275	ENST00000262738	T	0.69175	-0.38	4.45	3.42	0.39159	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.205114	0.31134	U	0.008197	T	0.52980	0.1768	L	0.42529	1.33	0.80722	D	1	B;B	0.27765	0.188;0.012	B;B	0.25614	0.062;0.013	T	0.46345	-0.9198	10	0.30078	T	0.28	.	7.5245	0.27647	0.1637:0.7498:0.0:0.0865	.	229;1908	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	L	1908	ENSP00000262738:V1908L	ENSP00000262738:V1908L	V	-	1	0	CELSR1	45171287	0.871000	0.30034	0.764000	0.31436	0.405000	0.30901	1.640000	0.37186	1.014000	0.39417	0.561000	0.74099	GTG	.		0.592	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
CFTR	1080	ucsc.edu;bcgsc.ca	37	7	117176688	117176688	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr7:117176688G>T	ENST00000003084.6	+	7	962	c.830G>T	c.(829-831)tGg>tTg	p.W277L	CFTR_ENST00000454343.1_Missense_Mutation_p.W277L	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	277	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GCATACTGCTGGGAAGAAGCA	0.308									Cystic Fibrosis																												p.W277L		.											.	CFTR	518	0			c.G830T						.						87.0	86.0	87.0					7																	117176688		2203	4299	6502	SO:0001583	missense	1080	exon7	Familial Cancer Database	CF	ACTGCTGGGAAGA	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.830G>T	7.37:g.117176688G>T	ENSP00000003084:p.Trp277Leu	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_000492	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744099	0.89663	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.89270	-2.49;-2.49;-2.49	5.1	5.1	0.69264	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95156	0.8430	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95681	0.8732	10	0.87932	D	0	-8.0914	18.8935	0.92414	0.0:0.0:1.0:0.0	.	277	P13569	CFTR_HUMAN	L	277;277;247	ENSP00000003084:W277L;ENSP00000403677:W277L;ENSP00000389119:W247L	ENSP00000003084:W277L	W	+	2	0	CFTR	116963924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.304000	0.96190	2.543000	0.85770	0.655000	0.94253	TGG	.		0.308	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
CSMD3	114788	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	113651094	113651094	+	Missense_Mutation	SNP	G	G	C	rs145905619		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr8:113651094G>C	ENST00000297405.5	-	21	3601	c.3357C>G	c.(3355-3357)gaC>gaG	p.D1119E	CSMD3_ENST00000455883.2_Missense_Mutation_p.D1015E|CSMD3_ENST00000343508.3_Missense_Mutation_p.D1079E|CSMD3_ENST00000352409.3_Missense_Mutation_p.D1119E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1119	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D1119D(1)|p.D1079D(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCAGTAAGTAGTCATGATGGT	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.D1119E		.											.	CSMD3	1132	2	Substitution - coding silent(2)	lung(2)	c.C3357G						.						111.0	105.0	107.0					8																	113651094		2203	4300	6503	SO:0001583	missense	114788	exon21			TAAGTAGTCATGA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3357C>G	8.37:g.113651094G>C	ENSP00000297405:p.Asp1119Glu	Somatic	108.0	1.0		WXS	Illumina HiSeq	Phase_I	159.0	98.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516832	0.85495	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.15	4.28	0.50868	CUB (5);	0.000000	0.85682	D	0.000000	T	0.66257	0.2771	H	0.97682	4.055	0.34819	D	0.738495	B;B;P	0.39847	0.145;0.175;0.691	B;B;P	0.58454	0.101;0.162;0.839	T	0.78311	-0.2253	10	0.27785	T	0.31	.	13.4786	0.61322	0.0759:0.0:0.9241:0.0	.	1015;1119;1079	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	1079;1119;459;1015;1119	ENSP00000345799:D1079E;ENSP00000297405:D1119E;ENSP00000341558:D459E;ENSP00000412263:D1015E;ENSP00000343124:D1119E	ENSP00000297405:D1119E	D	-	3	2	CSMD3	113720270	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.855000	0.62925	1.188000	0.43014	0.491000	0.48974	GAC	G|1.000;A|0.000		0.403	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	G	rs121913416|rs121913400		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr3:41266101C>G	ENST00000349496.5	+	3	378	c.98C>G	c.(97-99)tCt>tGt	p.S33C	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26C|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33C	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33C	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0	CTNNB1	24361	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98G						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>G	3.37:g.41266101C>G	ENSP00000344456:p.Ser33Cys	Somatic	306.0	0.0		WXS	Illumina HiSeq	Phase_I	287.0	76.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381716	0.82792	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	C	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26C;ENSP00000385604:S33C;ENSP00000412219:S33C;ENSP00000379486:S33C;ENSP00000344456:S33C;ENSP00000411226:S26C;ENSP00000379488:S33C;ENSP00000409302:S33C;ENSP00000401599:S33C	ENSP00000344456:S33C	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DIDO1	11083	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61512904	61512904	+	Silent	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr20:61512904C>A	ENST00000266070.4	-	16	4729	c.4404G>T	c.(4402-4404)gcG>gcT	p.A1468A	DIDO1_ENST00000395343.1_Silent_p.A1468A	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1468					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GGGAGGGCGTCGCAGCCCCGG	0.582																																					p.A1468A	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1	96	0			c.G4404T						.						78.0	85.0	83.0					20																	61512904		2203	4300	6503	SO:0001819	synonymous_variant	11083	exon16			GGGCGTCGCAGCC	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4404G>T	20.37:g.61512904C>A		Somatic	154.0	1.0		WXS	Illumina HiSeq	Phase_I	167.0	74.0	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	ENST00000266070.4	37	CCDS33506.1																																																																																			.		0.582	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
EBF3	253738	hgsc.bcm.edu;bcgsc.ca	37	10	131676057	131676057	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr10:131676057delT	ENST00000355311.5	-	7	683	c.611delA	c.(610-612)aacfs	p.N204fs	EBF3_ENST00000368648.3_Frame_Shift_Del_p.N204fs			Q9H4W6	COE3_HUMAN	early B-cell factor 3	204	Interaction with DNA. {ECO:0000250}.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		ATCTCGAGGGTTGCCTGCATT	0.363																																					p.N204fs		.											.	EBF3	91	0			c.611delA						.						120.0	107.0	112.0					10																	131676057		2203	4300	6503	SO:0001589	frameshift_variant	253738	exon7			CGAGGGTTGCCTG		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.611delA	10.37:g.131676057delT	ENSP00000347463:p.Asn204fs	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	23.0	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Frame_Shift_Del	DEL	ENST00000355311.5	37																																																																																				.		0.363	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
DPYSL4	10570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	10	134012417	134012417	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr10:134012417C>A	ENST00000338492.4	+	8	917	c.753C>A	c.(751-753)taC>taA	p.Y251*	DPYSL4_ENST00000368627.1_Nonsense_Mutation_p.Y151*|DPYSL4_ENST00000368629.1_Nonsense_Mutation_p.Y151*	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	251					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.Y251Y(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		GCCCGCTGTACGTCACCAAGG	0.667																																					p.Y251X		.											.	DPYSL4	514	1	Substitution - coding silent(1)	lung(1)	c.C753A						.						87.0	72.0	77.0					10																	134012417		2203	4300	6503	SO:0001587	stop_gained	10570	exon8			GCTGTACGTCACC	AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.753C>A	10.37:g.134012417C>A	ENSP00000339850:p.Tyr251*	Somatic	247.0	1.0		WXS	Illumina HiSeq	Phase_I	189.0	84.0	NM_006426	B2RMQ1|D3DRG5|O00240|Q5T0Q7	Nonsense_Mutation	SNP	ENST00000338492.4	37	CCDS7665.1	.	.	.	.	.	.	.	.	.	.	C	10.42	1.346524	0.24426	.	.	ENSG00000151640	ENST00000338492;ENST00000368629;ENST00000368627	.	.	.	3.94	-7.88	0.01178	.	0.071166	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.1874	17.5002	0.87728	0.0:0.2251:0.0:0.7749	.	.	.	.	X	251;151;151	.	ENSP00000339850:Y251X	Y	+	3	2	DPYSL4	133862407	0.000000	0.05858	0.020000	0.16555	0.113000	0.19764	-2.192000	0.01245	-1.992000	0.00975	-0.477000	0.04895	TAC	.		0.667	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2		
ELF1	1997	hgsc.bcm.edu;bcgsc.ca	37	13	41525513	41525513	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr13:41525513G>T	ENST00000239882.3	-	4	627	c.313C>A	c.(313-315)Ctc>Atc	p.L105I	ELF1_ENST00000442101.1_Missense_Mutation_p.L105I|ELF1_ENST00000498824.1_5'UTR	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	105					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		ATATTGAGGAGTGCCTCAGCA	0.378																																					p.L105I		.											.	ELF1	227	0			c.C313A						.						110.0	100.0	103.0					13																	41525513		2203	4300	6503	SO:0001583	missense	1997	exon3			TGAGGAGTGCCTC	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.313C>A	13.37:g.41525513G>T	ENSP00000239882:p.Leu105Ile	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_001145353	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	37	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115596	0.77323	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.62498	0.02;0.02	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000001	T	0.66147	0.2760	M	0.62266	1.93	0.51767	D	0.999938	B;B	0.29162	0.235;0.235	B;B	0.33568	0.166;0.166	T	0.65792	-0.6082	10	0.62326	D	0.03	.	19.7468	0.96255	0.0:0.0:1.0:0.0	.	105;105	E9PDQ9;P32519	.;ELF1_HUMAN	I	105	ENSP00000405580:L105I;ENSP00000239882:L105I	ENSP00000239882:L105I	L	-	1	0	ELF1	40423513	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	8.977000	0.93446	2.678000	0.91216	0.563000	0.77884	CTC	.		0.378	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373	
EPB41L4B	54566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	112004035	112004035	+	Intron	SNP	G	G	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr9:112004035G>A	ENST00000374566.3	-	15	1927				EPB41L4B_ENST00000374557.4_Silent_p.D488D	NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B						actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAAAATGGCTGTCATCTCCAC	0.453																																					p.D488D		.											.	EPB41L4B	92	0			c.C1464T						.						233.0	225.0	228.0					9																	112004035		1992	4185	6177	SO:0001627	intron_variant	54566	exon16			ATGGCTGTCATCT	AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1409+1862C>T	9.37:g.112004035G>A		Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	78.0	NM_018424	Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Silent	SNP	ENST00000374566.3	37	CCDS43859.1																																																																																			.		0.453	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053592.1	NM_018424	
EPHA7	2045	ucsc.edu;mdanderson.org	37	6	93982124	93982124	+	Missense_Mutation	SNP	G	G	T	rs345713	byFrequency	TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr6:93982124G>T	ENST00000369303.4	-	6	1525	c.1341C>A	c.(1339-1341)agC>agA	p.S447R		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	447	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TCATTACTCCACTCACTTGCG	0.448																																					p.S447R		.											.	EPHA7	1453	0			c.T1341A						.						149.0	143.0	145.0					6																	93982124		2203	4299	6502	SO:0001583	missense	2045	exon6			TACTCCACTCACT	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1341C>A	6.37:g.93982124G>T	ENSP00000358309:p.Ser447Arg	Somatic	191.0	0.0		WXS	Illumina HiSeq	.	208.0	63.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1																																																																																			G|0.910;A|0.090		0.448	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
EPS8L1	54869	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	55598089	55598089	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr19:55598089C>G	ENST00000201647.6	+	18	1841	c.1785C>G	c.(1783-1785)ttC>ttG	p.F595L	EPS8L1_ENST00000586329.1_Intron|EPS8L1_ENST00000540810.1_Missense_Mutation_p.F531L|EPS8L1_ENST00000588359.1_Missense_Mutation_p.F281L|EPS8L1_ENST00000245618.5_Missense_Mutation_p.F468L	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	595					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CAGAGAAATTCTCCCAGATGC	0.746																																					p.F595L	Ovarian(149;255 1863 3636 27051 29647)	.											.	EPS8L1	115	0			c.C1785G						.						11.0	12.0	12.0					19																	55598089		2154	4213	6367	SO:0001583	missense	54869	exon18			GAAATTCTCCCAG	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.1785C>G	19.37:g.55598089C>G	ENSP00000201647:p.Phe595Leu	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	10.0	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	ENST00000201647.6	37	CCDS12914.1	.	.	.	.	.	.	.	.	.	.	C	8.366	0.834156	0.16820	.	.	ENSG00000131037	ENST00000201647;ENST00000540810;ENST00000245618;ENST00000539118	T;T;T	0.05258	3.71;3.49;3.47	4.13	0.543	0.17179	.	5.188460	0.00931	N	0.002708	T	0.07188	0.0182	L	0.43152	1.355	0.40159	D	0.97704	B;B;B	0.21606	0.058;0.01;0.017	B;B;B	0.22880	0.042;0.005;0.006	T	0.43114	-0.9411	10	0.11485	T	0.65	-15.6465	7.2393	0.26088	0.0:0.6868:0.0:0.3132	.	374;468;595	Q8TE68-4;Q8TE68-2;Q8TE68	.;.;ES8L1_HUMAN	L	595;531;468;281	ENSP00000201647:F595L;ENSP00000437541:F531L;ENSP00000245618:F468L	ENSP00000201647:F595L	F	+	3	2	EPS8L1	60289901	0.922000	0.31269	0.986000	0.45419	0.727000	0.41649	0.917000	0.28665	0.098000	0.17522	0.305000	0.20034	TTC	.		0.746	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
EVPL	2125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74006234	74006234	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr17:74006234C>G	ENST00000301607.3	-	22	3305	c.3052G>C	c.(3052-3054)Gag>Cag	p.E1018Q	EVPL_ENST00000586740.1_Missense_Mutation_p.E1040Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1018	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TGGGTGACCTCCTTGGTCAGC	0.667																																					p.E1018Q		.											.	EVPL	93	0			c.G3052C						.						64.0	69.0	67.0					17																	74006234		2203	4299	6502	SO:0001583	missense	2125	exon22			TGACCTCCTTGGT	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3052G>C	17.37:g.74006234C>G	ENSP00000301607:p.Glu1018Gln	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	73.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.212595	0.79240	.	.	ENSG00000167880	ENST00000301607	T	0.68624	-0.34	5.04	5.04	0.67666	.	0.104139	0.64402	D	0.000005	D	0.82912	0.5140	M	0.83223	2.63	0.58432	D	0.999992	P;D	0.89917	0.924;1.0	P;D	0.67103	0.505;0.949	D	0.85308	0.1077	10	0.62326	D	0.03	-43.8629	18.7358	0.91753	0.0:1.0:0.0:0.0	.	1040;1018	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	1018	ENSP00000301607:E1018Q	ENSP00000301607:E1018Q	E	-	1	0	EVPL	71517829	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.776000	0.85560	2.501000	0.84356	0.491000	0.48974	GAG	.		0.667	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
EXOC5	10640	broad.mit.edu;ucsc.edu;mdanderson.org	37	14	57713485	57713485	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr14:57713485G>A	ENST00000413566.2	-	3	573	c.214C>T	c.(214-216)Cag>Tag	p.Q72*	EXOC5_ENST00000556911.1_5'UTR|EXOC5_ENST00000340918.7_Nonsense_Mutation_p.Q72*	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	72					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						GCTTCTTTCTGACATTGTTGC	0.343																																					p.Q72X		.											.	EXOC5	137	0			c.C214T						.						141.0	140.0	141.0					14																	57713485		1828	4087	5915	SO:0001587	stop_gained	10640	exon3			CTTTCTGACATTG	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.214C>T	14.37:g.57713485G>A	ENSP00000389934:p.Gln72*	Somatic	122.0	1.0		WXS	Illumina HiSeq	Phase_I	125.0	39.0	NM_006544	B2R6C5	Nonsense_Mutation	SNP	ENST00000413566.2	37	CCDS45111.1	.	.	.	.	.	.	.	.	.	.	G	40	7.993720	0.98599	.	.	ENSG00000070367	ENST00000413566;ENST00000340918;ENST00000556318	.	.	.	5.17	5.17	0.71159	.	0.109289	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-7.2522	19.0528	0.93052	0.0:0.0:1.0:0.0	.	.	.	.	X	72;72;17	.	ENSP00000342100:Q72X	Q	-	1	0	EXOC5	56783238	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.554000	0.98121	2.561000	0.86390	0.650000	0.86243	CAG	.		0.343	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79166410	79166410	+	Silent	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr4:79166410C>T	ENST00000325942.6	+	4	680	c.240C>T	c.(238-240)gcC>gcT	p.A80A	FRAS1_ENST00000264899.6_Silent_p.A80A|FRAS1_ENST00000264895.6_Silent_p.A80A	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	80	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AAATAGCTGCCAACCAATGCT	0.438																																					p.A80A		.											.	FRAS1	68	0			c.C240T						.						92.0	87.0	89.0					4																	79166410		1958	4170	6128	SO:0001819	synonymous_variant	80144	exon4			AGCTGCCAACCAA	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.240C>T	4.37:g.79166410C>T		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	47.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	C	3.466	-0.108881	0.06924	.	.	ENSG00000138759	ENST00000502446	.	.	.	5.47	4.63	0.57726	.	.	.	.	.	T	0.69637	0.3133	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68838	-0.5303	4	.	.	.	.	13.6055	0.62046	0.0:0.9236:0.0:0.0764	.	.	.	.	L	9	.	.	P	+	2	0	FRAS1	79385434	0.998000	0.40836	0.998000	0.56505	0.228000	0.25075	0.656000	0.24948	1.438000	0.47492	0.655000	0.94253	CCA	.		0.438	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
FBXW7	55294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	153253841	153253841	+	Missense_Mutation	SNP	G	G	T	rs112892452		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr4:153253841G>T	ENST00000281708.4	-	6	2121	c.892C>A	c.(892-894)Ccc>Acc	p.P298T	FBXW7_ENST00000296555.5_Missense_Mutation_p.P180T|FBXW7_ENST00000263981.5_Missense_Mutation_p.P218T|FBXW7_ENST00000603548.1_Missense_Mutation_p.P298T|FBXW7_ENST00000393956.3_Missense_Mutation_p.P122T|FBXW7_ENST00000603841.1_Missense_Mutation_p.P298T	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	298	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.P298S(2)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AGGTCTTTGGGTTCCAGGAAT	0.348			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.P298T		.		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,rectum,adenoma,0	FBXW7	6296	3	Substitution - Missense(2)|Unknown(1)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)	c.C892A						.						61.0	61.0	61.0					4																	153253841		2203	4300	6503	SO:0001583	missense	55294	exon6			CTTTGGGTTCCAG	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.892C>A	4.37:g.153253841G>T	ENSP00000281708:p.Pro298Thr	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	36.0	NM_033632	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373299	0.82573	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	6.16	6.16	0.99307	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.091827	0.85682	D	0.000000	T	0.76314	0.3970	M	0.67569	2.06	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.997;0.997	D;D;D;D	0.72625	0.97;0.978;0.95;0.963	T	0.73975	-0.3813	10	0.52906	T	0.07	-10.96	20.8598	0.99761	0.0:0.0:1.0:0.0	.	122;298;180;218	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	T	298;180;218;122	ENSP00000281708:P298T;ENSP00000296555:P180T;ENSP00000263981:P218T;ENSP00000377528:P122T	ENSP00000263981:P218T	P	-	1	0	FBXW7	153473291	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.793000	0.99091	2.937000	0.99478	0.650000	0.86243	CCC	G|0.500;A|0.500		0.348	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
GAD1	2571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	171700595	171700595	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:171700595C>A	ENST00000358196.3	+	7	1229	c.679C>A	c.(679-681)Caa>Aaa	p.Q227K	GAD1_ENST00000429023.1_3'UTR	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	227					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CCTCATGGAACAAATAACACT	0.368																																					p.Q227K		.											.	GAD1	91	0			c.C679A						.						210.0	217.0	215.0					2																	171700595		2203	4300	6503	SO:0001583	missense	2571	exon7			ATGGAACAAATAA		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.679C>A	2.37:g.171700595C>A	ENSP00000350928:p.Gln227Lys	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	42.0	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.002856	0.54254	.	.	ENSG00000128683	ENST00000358196	T	0.37058	1.22	6.17	6.17	0.99709	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.25754	0.0627	N	0.10733	0.035	0.80722	D	1	B	0.20459	0.045	B	0.21546	0.035	T	0.06552	-1.0820	10	0.33940	T	0.23	-11.5566	20.8794	0.99867	0.0:1.0:0.0:0.0	.	227	Q99259	DCE1_HUMAN	K	227	ENSP00000350928:Q227K	ENSP00000350928:Q227K	Q	+	1	0	GAD1	171408841	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.424000	0.80242	2.941000	0.99782	0.655000	0.94253	CAA	.		0.368	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
GPAM	57678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	113935464	113935464	+	Nonsense_Mutation	SNP	C	C	A	rs368640883		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr10:113935464C>A	ENST00000348367.4	-	6	504	c.307G>T	c.(307-309)Gga>Tga	p.G103*	GPAM_ENST00000423155.1_Nonsense_Mutation_p.G103*|GPAM_ENST00000369425.1_Nonsense_Mutation_p.G103*			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	103					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.G103*(1)		breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GCAAGCCATCCGCGGTGTCTG	0.408																																					p.G103X	Ovarian(161;1017 2606 18293 52943)	.											.	GPAM	92	1	Substitution - Nonsense(1)	lung(1)	c.G307T						.						92.0	84.0	87.0					10																	113935464		2203	4300	6503	SO:0001587	stop_gained	57678	exon6			GCCATCCGCGGTG	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.307G>T	10.37:g.113935464C>A	ENSP00000265276:p.Gly103*	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	29.0	NM_020918	Q5VW51|Q86TA3	Nonsense_Mutation	SNP	ENST00000348367.4	37	CCDS7570.1	.	.	.	.	.	.	.	.	.	.	C	39	7.508122	0.98325	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-21.0003	17.4284	0.87532	0.0:1.0:0.0:0.0	.	.	.	.	X	103	.	ENSP00000265276:G103X	G	-	1	0	GPAM	113925454	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.935000	0.75886	2.554000	0.86153	0.650000	0.86243	GGA	.		0.408	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
GRM5	2915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	88330465	88330465	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr11:88330465C>T	ENST00000305447.4	-	5	1599	c.1450G>A	c.(1450-1452)Gtt>Att	p.V484I	GRM5_ENST00000305432.5_Missense_Mutation_p.V484I|GRM5_ENST00000393297.1_Missense_Mutation_p.V484I|GRM5_ENST00000455756.2_Missense_Mutation_p.V484I|GRM5_ENST00000418177.2_Missense_Mutation_p.V484I	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	484					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	CAACTTCCAACGTTGATATAA	0.323																																					p.V484I		.											.	GRM5	949	0			c.G1450A						.						164.0	138.0	147.0					11																	88330465		2201	4299	6500	SO:0001583	missense	2915	exon6			TTCCAACGTTGAT	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1450G>A	11.37:g.88330465C>T	ENSP00000306138:p.Val484Ile	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	50.0	NM_000842	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126877	0.56721	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49;-2.49	5.4	5.4	0.78164	.	0.055747	0.64402	D	0.000001	D	0.92512	0.7622	L	0.46157	1.445	0.52501	D	0.999951	D;B	0.61697	0.99;0.003	D;B	0.74023	0.982;0.009	D	0.91393	0.5137	9	.	.	.	.	19.1637	0.93544	0.0:1.0:0.0:0.0	.	484;484	P41594-2;P41594	.;GRM5_HUMAN	I	484	ENSP00000402912:V484I;ENSP00000405690:V484I;ENSP00000305905:V484I;ENSP00000306138:V484I;ENSP00000376975:V484I	.	V	-	1	0	GRM5	87970113	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.098000	0.50259	2.539000	0.85634	0.650000	0.86243	GTT	.		0.323	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
HAPLN1	1404	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82937472	82937472	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr5:82937472C>A	ENST00000274341.4	-	5	1758	c.908G>T	c.(907-909)cGc>cTc	p.R303L		NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	303	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	CGCATCACAGCGGTCATATCC	0.557																																					p.R303L		.											.	HAPLN1	580	0			c.G908T						.						124.0	128.0	126.0					5																	82937472		2203	4300	6503	SO:0001583	missense	1404	exon5			TCACAGCGGTCAT		CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.908G>T	5.37:g.82937472C>A	ENSP00000274341:p.Arg303Leu	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	269.0	66.0	NM_001884	B2R9A9	Missense_Mutation	SNP	ENST00000274341.4	37	CCDS4061.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.343143	0.61073	.	.	ENSG00000145681	ENST00000274341	T	0.26660	1.72	5.22	4.35	0.52113	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	L	0.45581	1.43	0.80722	D	1	D	0.69078	0.997	D	0.74348	0.983	T	0.24764	-1.0151	10	0.46703	T	0.11	.	14.0672	0.64837	0.0:0.9273:0.0:0.0727	.	303	P10915	HPLN1_HUMAN	L	303	ENSP00000274341:R303L	ENSP00000274341:R303L	R	-	2	0	HAPLN1	82973228	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	6.031000	0.70911	1.326000	0.45319	0.655000	0.94253	CGC	.		0.557	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239256.2	NM_001884	
HERC6	55008	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89318063	89318063	+	Silent	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr4:89318063A>G	ENST00000264346.7	+	7	1007	c.948A>G	c.(946-948)ccA>ccG	p.P316P	HERC6_ENST00000380265.5_Silent_p.P316P|HERC6_ENST00000273960.3_Intron	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	316					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		GTCATGGACCAAGTGACACAA	0.463																																					p.P316P		.											.	HERC6	658	0			c.A948G						.						182.0	172.0	175.0					4																	89318063		1974	4175	6149	SO:0001819	synonymous_variant	55008	exon7			TGGACCAAGTGAC	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.948A>G	4.37:g.89318063A>G		Somatic	166.0	2.0		WXS	Illumina HiSeq	Phase_I	176.0	57.0	NM_017912	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Silent	SNP	ENST00000264346.7	37	CCDS47098.1																																																																																			.		0.463	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2		
IGDCC3	9543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65623843	65623843	+	Missense_Mutation	SNP	C	C	T	rs148656626		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr15:65623843C>T	ENST00000327987.4	-	8	1554	c.1303G>A	c.(1303-1305)Gtg>Atg	p.V435M	IGDCC3_ENST00000559231.1_5'UTR	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	435	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GTGGAAGACACAGAGACTGCC	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17703	0.0		0.0	False		,,,				2504	0.0				p.V435M		.											.	IGDCC3	93	0			c.G1303A						.	C	MET/VAL	11,4391	16.8+/-37.8	0,11,2190	39.0	37.0	38.0		1303	3.0	0.2	15	dbSNP_134	38	0,8598		0,0,4299	yes	missense	IGDCC3	NM_004884.3	21	0,11,6489	TT,TC,CC		0.0,0.2499,0.0846	possibly-damaging	435/815	65623843	11,12989	2201	4299	6500	SO:0001583	missense	9543	exon8			AAGACACAGAGAC	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1303G>A	15.37:g.65623843C>T	ENSP00000332773:p.Val435Met	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	30.0	NM_004884	O95215	Missense_Mutation	SNP	ENST00000327987.4	37	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472610	0.26423	0.002499	0.0	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.60171	0.21	4.92	3.01	0.34805	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.228496	0.38217	N	0.001762	T	0.65544	0.2701	M	0.64630	1.985	0.32780	N	0.502599	P	0.48294	0.908	P	0.58454	0.839	T	0.69525	-0.5122	10	0.29301	T	0.29	-12.1032	10.2322	0.43262	0.0:0.7888:0.1366:0.0746	.	435	Q8IVU1	IGDC3_HUMAN	M	435;298	ENSP00000332773:V435M	ENSP00000332773:V435M	V	-	1	0	IGDCC3	63410896	0.779000	0.28652	0.179000	0.23059	0.019000	0.09904	1.376000	0.34306	0.452000	0.26830	0.655000	0.94253	GTG	C|0.999;T|0.001		0.652	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
IKZF2	22807	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	213914450	213914450	+	Silent	SNP	G	G	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:213914450G>A	ENST00000434687.1	-	6	870	c.561C>T	c.(559-561)ctC>ctT	p.L187L	IKZF2_ENST00000421754.2_Silent_p.L161L|IKZF2_ENST00000374327.4_Intron|IKZF2_ENST00000457361.1_Silent_p.L187L|IKZF2_ENST00000374319.4_Silent_p.L161L|IKZF2_ENST00000342002.2_Silent_p.L193L|IKZF2_ENST00000413091.3_Silent_p.L187L|IKZF2_ENST00000451136.2_Silent_p.L161L			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	187					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		AATGGGTCCTGAGGTGTCCTG	0.428																																					p.L187L		.											.	IKZF2	226	0			c.C561T						.						100.0	90.0	94.0					2																	213914450		2203	4300	6503	SO:0001819	synonymous_variant	22807	exon5			GGTCCTGAGGTGT	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.561C>T	2.37:g.213914450G>A		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	30.0	NM_016260	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Silent	SNP	ENST00000434687.1	37	CCDS2395.1																																																																																			.		0.428	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260	
JAK2	3717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5072525	5072525	+	Missense_Mutation	SNP	A	A	C	rs35668020		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr9:5072525A>C	ENST00000381652.3	+	13	2169	c.1675A>C	c.(1675-1677)Att>Ctt	p.I559L	JAK2_ENST00000539801.1_Missense_Mutation_p.I559L|JAK2_ENST00000544510.1_Missense_Mutation_p.I410L	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	559	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TTTTACAAAGATTTTTAAAGG	0.358		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.I559L		.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2	75307	0			c.A1675C						.						56.0	58.0	57.0					9																	5072525		2202	4300	6502	SO:0001583	missense	3717	exon13	Familial Cancer Database		ACAAAGATTTTTA		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1675A>C	9.37:g.5072525A>C	ENSP00000371067:p.Ile559Leu	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	22.0	NM_004972	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	A	31	5.090264	0.94149	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.35048	1.33;1.33;1.33	5.73	5.73	0.89815	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.045126	0.85682	D	0.000000	T	0.51007	0.1649	L	0.50919	1.6	0.58432	D	0.999996	D	0.59767	0.986	P	0.59056	0.851	T	0.51116	-0.8746	10	0.59425	D	0.04	-18.6877	16.0085	0.80380	1.0:0.0:0.0:0.0	.	559	O60674	JAK2_HUMAN	L	559;559;410	ENSP00000440387:I559L;ENSP00000371067:I559L;ENSP00000443103:I410L	ENSP00000371067:I559L	I	+	1	0	JAK2	5062525	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.152000	0.77419	2.185000	0.69588	0.477000	0.44152	ATT	.		0.358	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
JAK3	3718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17947999	17947999	+	Silent	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr19:17947999C>T	ENST00000527670.1	-	12	1754	c.1725G>A	c.(1723-1725)ttG>ttA	p.L575L	JAK3_ENST00000526008.1_5'Flank|JAK3_ENST00000458235.1_Silent_p.L575L|JAK3_ENST00000534444.1_Silent_p.L575L			P52333	JAK3_HUMAN	Janus kinase 3	575	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CTTGGCTCATCAAGCTCGCTG	0.587		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.L575L		.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	JAK3	2418	0			c.G1725A						.						45.0	34.0	37.0					19																	17947999		2200	4293	6493	SO:0001819	synonymous_variant	3718	exon13			GCTCATCAAGCTC	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1725G>A	19.37:g.17947999C>T		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	26.0	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Silent	SNP	ENST00000527670.1	37	CCDS12366.1																																																																																			.		0.587	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
KIAA1841	84542	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61324923	61324923	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:61324923G>T	ENST00000402291.1	+	12	1542	c.1301G>T	c.(1300-1302)gGc>gTc	p.G434V	KIAA1841_ENST00000356719.2_Missense_Mutation_p.G434V|KIAA1841_ENST00000453873.1_Missense_Mutation_p.G434V|KIAA1841_ENST00000295031.5_Missense_Mutation_p.G434V	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	434										breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			AATACTGTTGGCACTGGAATT	0.383																																					p.G434V		.											.	KIAA1841	90	0			c.G1301T						.						149.0	142.0	144.0					2																	61324923		2203	4300	6503	SO:0001583	missense	84542	exon12			CTGTTGGCACTGG	BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1301G>T	2.37:g.61324923G>T	ENSP00000385579:p.Gly434Val	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	43.0	NM_032506	Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	ENST00000402291.1	37	CCDS46296.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.640613	0.87859	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.73401	0.3582	M	0.69823	2.125	0.80722	D	1	P;P	0.49635	0.909;0.926	P;P	0.51895	0.555;0.683	T	0.71279	-0.4640	9	0.39692	T	0.17	-8.8888	20.32	0.98661	0.0:0.0:1.0:0.0	.	434;434	Q6NSI8-2;Q6NSI8	.;K1841_HUMAN	V	434	.	ENSP00000295031:G434V	G	+	2	0	KIAA1841	61178427	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	4.950000	0.63603	2.799000	0.96334	0.579000	0.79373	GGC	.		0.383	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325477.1	NM_032506	
KDM3A	55818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	86709144	86709144	+	Silent	SNP	G	G	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:86709144G>A	ENST00000409556.1	+	18	2969	c.2604G>A	c.(2602-2604)acG>acA	p.T868T	KDM3A_ENST00000542128.1_Silent_p.T816T|KDM3A_ENST00000312912.5_Silent_p.T868T|KDM3A_ENST00000409064.1_Silent_p.T868T			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	868					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						TCCTCCATACGTTTAACAGCA	0.388																																					p.T868T	NSCLC(96;1150 1523 6936 46253 49736)	.											.	KDM3A	291	0			c.G2604A						.						153.0	145.0	148.0					2																	86709144		2203	4300	6503	SO:0001819	synonymous_variant	55818	exon17			CCATACGTTTAAC	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2604G>A	2.37:g.86709144G>A		Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	54.0	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	ENST00000409556.1	37	CCDS1990.1																																																																																			.		0.388	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
KIR3DX1	90011	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55047101	55047101	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr19:55047101G>T	ENST00000335056.3	+	4	684	c.646G>T	c.(646-648)Gtg>Ttg	p.V216L	KIR3DX1_ENST00000482404.1_3'UTR			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	216						extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		CCTGGACATTGTGATCACAGG	0.542																																					.	Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)	.											.	KIR3DX1	91	0			.						.						66.0	68.0	68.0					19																	55047101		2185	4294	6479	SO:0001583	missense	90011	.			GACATTGTGATCA	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.646G>T	19.37:g.55047101G>T	ENSP00000335388:p.Val216Leu	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	19.0	.	B7WNL0|Q8N0S4	RNA	SNP	ENST00000335056.3	37		.	.	.	.	.	.	.	.	.	.	G	7.306	0.614105	0.14129	.	.	ENSG00000104970	ENST00000335056	T	0.11712	2.75	2.15	-1.9	0.07665	.	1.934250	0.04644	U	0.405935	T	0.09158	0.0226	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35151	-0.9800	7	0.87932	D	0	.	0.9962	0.01467	0.1633:0.2644:0.3711:0.2012	.	.	.	.	L	216	ENSP00000335388:V216L	ENSP00000221567:V216L	V	+	1	0	KIR3DX1	59738913	0.000000	0.05858	0.000000	0.03702	0.183000	0.23260	-1.179000	0.03090	-0.303000	0.08856	0.655000	0.94253	GTG	.		0.542	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000140800.2	NR_026716	
KLC1	3831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	104153537	104153537	+	Intron	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr14:104153537A>G	ENST00000348520.6	+	13	1969				KLC1_ENST00000554280.1_Silent_p.P581P|KLC1_ENST00000347839.6_Silent_p.P581P|RP11-73M18.6_ENST00000602827.1_RNA|KLC1_ENST00000555836.1_Silent_p.P581P|KLC1_ENST00000452929.2_Silent_p.P590P|KLC1_ENST00000557450.1_Intron|KLC1_ENST00000334553.6_Silent_p.P590P|KLC1_ENST00000246489.7_Silent_p.P590P	NM_182923.3	NP_891553.2	Q07866	KLC1_HUMAN	kinesin light chain 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|stress granule disassembly (GO:0035617)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|growth cone (GO:0030426)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)|motor activity (GO:0003774)		KLC1/ALK(2)	NS(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	12		Melanoma(154;0.155)|all_epithelial(191;0.19)				AGAGTGAGCCAAAGAACCCCG	0.572																																					p.P590P		.											.	KLC1	90	0			c.A1770G						.						74.0	63.0	67.0					14																	104153537		692	1591	2283	SO:0001627	intron_variant	3831	exon14			TGAGCCAAAGAAC	AF267530	CCDS32165.1, CCDS41996.1, CCDS45168.1	14q32.3	2013-01-10	2007-03-09	2007-03-09	ENSG00000126214	ENSG00000126214		"""Tetratricopeptide (TTC) repeat domain containing"""	6387	protein-coding gene	gene with protein product		600025	"""kinesin 2 60/70kDa"", ""kinesin 2"""	KNS2		8274221, 11106729	Standard	NM_005552		Approved	KNS2A, KLC, hKLC1S, hKLC1N, hKLC1P, hKLC1G, hKLC1R, hKLC1J, hKLC1B	uc010tyf.2	Q07866	OTTHUMG00000169227	ENST00000348520.6:c.1650+7655A>G	14.37:g.104153537A>G		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	18.0	NM_001130107	A6NF62|F8VTM4|Q7RTM2|Q7RTM3|Q7RTM5|Q7RTP9|Q7RTQ3|Q7RTQ5|Q7RTQ6|Q86SF5|Q86TF5|Q86V74|Q86V75|Q86V76|Q86V77|Q86V78|Q86V79|Q96H62	Silent	SNP	ENST00000348520.6	37	CCDS41996.1	.	.	.	.	.	.	.	.	.	.	A	9.069	0.996517	0.19043	.	.	ENSG00000126214	ENST00000537046	.	.	.	5.44	-10.9	0.00192	.	.	.	.	.	T	0.57533	0.2060	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72268	-0.4343	4	.	.	.	.	14.081	0.64922	0.1478:0.6079:0.2442:0.0	.	.	.	.	E	221	.	.	K	+	1	0	KLC1	103223290	0.295000	0.24389	0.030000	0.17652	0.982000	0.71751	-0.028000	0.12350	-3.054000	0.00259	-0.408000	0.06270	AAA	.		0.572	KLC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402947.2	NM_005552	
KLHDC4	54758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	87788861	87788861	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr16:87788861C>T	ENST00000270583.5	-	4	366	c.308G>A	c.(307-309)aGa>aAa	p.R103K	KLHDC4_ENST00000347925.5_Missense_Mutation_p.R103K|KLHDC4_ENST00000353170.5_Missense_Mutation_p.R46K	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	103										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		GGTGTCCTTTCTGGTATTGTA	0.493																																					p.R103K		.											.	KLHDC4	182	0			c.G308A						.						193.0	178.0	183.0					16																	87788861		2198	4300	6498	SO:0001583	missense	54758	exon4			TCCTTTCTGGTAT	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.308G>A	16.37:g.87788861C>T	ENSP00000270583:p.Arg103Lys	Somatic	238.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	67.0	NM_001184856	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Missense_Mutation	SNP	ENST00000270583.5	37	CCDS10963.1	.	.	.	.	.	.	.	.	.	.	C	5.638	0.302437	0.10678	.	.	ENSG00000104731	ENST00000270583;ENST00000347925;ENST00000353170	T;T;T	0.64991	1.1;1.1;-0.13	5.12	2.11	0.27256	Kelch-type beta propeller (1);	0.265537	0.42964	N	0.000624	T	0.32315	0.0825	N	0.10733	0.035	0.37504	D	0.916887	B;B;B	0.11235	0.001;0.004;0.001	B;B;B	0.14023	0.002;0.01;0.007	T	0.30995	-0.9959	10	0.02654	T	1	-12.9156	7.8256	0.29313	0.0:0.6769:0.0:0.3231	.	46;103;103	Q8TBB5-2;Q8TBB5-3;Q8TBB5	.;.;KLDC4_HUMAN	K	103;103;46	ENSP00000270583:R103K;ENSP00000325717:R103K;ENSP00000262530:R46K	ENSP00000270583:R103K	R	-	2	0	KLHDC4	86346362	0.981000	0.34729	0.073000	0.20177	0.067000	0.16453	1.371000	0.34250	0.193000	0.20303	0.561000	0.74099	AGA	.		0.493	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
KLHL6	89857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183209982	183209982	+	Silent	SNP	C	C	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr3:183209982C>G	ENST00000341319.3	-	7	1634	c.1599G>C	c.(1597-1599)ccG>ccC	p.P533P		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	533					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TGTCTTCCAGCGGGCTGTAGG	0.632																																					p.P533P		.											.	KLHL6	93	0			c.G1599C						.						24.0	24.0	24.0					3																	183209982		2200	4299	6499	SO:0001819	synonymous_variant	89857	exon7			TTCCAGCGGGCTG	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1599G>C	3.37:g.183209982C>G		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	38.0	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	ENST00000341319.3	37	CCDS3245.2																																																																																			.		0.632	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
KPNA2	3838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	66038335	66038335	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr17:66038335A>G	ENST00000537025.2	+	5	1057	c.437A>G	c.(436-438)aAc>aGc	p.N146S	KPNA2_ENST00000330459.3_Missense_Mutation_p.N146S			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	146	NLS binding site (major). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCACTCACTAACATTGCTTCT	0.473																																					p.N146S		.											.	KPNA2	560	0			c.A437G						.						199.0	192.0	194.0					17																	66038335		2203	4298	6501	SO:0001583	missense	3838	exon5			TCACTAACATTGC	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.437A>G	17.37:g.66038335A>G	ENSP00000438483:p.Asn146Ser	Somatic	169.0	1.0		WXS	Illumina HiSeq	Phase_I	137.0	95.0	NM_002266	B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	ENST00000537025.2	37	CCDS32713.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.864378	0.71949	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	D;D	0.83506	-1.73;-1.73	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	D	0.90686	0.7078	H	0.94808	3.585	0.80722	D	1	P	0.36683	0.565	P	0.44673	0.457	D	0.92305	0.5853	10	0.87932	D	0	.	15.9965	0.80250	1.0:0.0:0.0:0.0	.	146	P52292	IMA2_HUMAN	S	146	ENSP00000332455:N146S;ENSP00000438483:N146S	ENSP00000332455:N146S	N	+	2	0	KPNA2	63468797	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.230000	0.95299	2.174000	0.68829	0.460000	0.39030	AAC	.		0.473	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266	
NRROS	375387	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	196387716	196387719	+	Frame_Shift_Del	DEL	TGGG	TGGG	-			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	TGGG	TGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr3:196387716_196387719delTGGG	ENST00000328557.4	+	3	1405_1408	c.1202_1205delTGGG	c.(1201-1206)ctgggcfs	p.LG401fs		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	401					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GCCAGCTGCCTGGGCAGCCTGCGC	0.652																																					p.401_402del		.											.	LRRC33	92	0			c.1202_1205del						.																																			SO:0001589	frameshift_variant	375387	exon3			GCTGCCTGGGCAG	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1202_1205delTGGG	3.37:g.196387716_196387719delTGGG	ENSP00000328625:p.Leu401fs	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	27.0	NM_198565		Frame_Shift_Del	DEL	ENST00000328557.4	37	CCDS3319.1																																																																																			.		0.652	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
NRROS	375387	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	196387720	196387721	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr3:196387720_196387721insA	ENST00000328557.4	+	3	1409_1410	c.1206_1207insA	c.(1207-1209)agcfs	p.S403fs		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	403					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GCTGCCTGGGCAGCCTGCGCTT	0.649																																					p.G402fs		.											.	LRRC33	92	0			c.1206_1207insA						.																																			SO:0001589	frameshift_variant	375387	exon3			CCTGGGCAGCCTG	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1207dupA	3.37:g.196387721_196387721dupA	ENSP00000328625:p.Ser403fs	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	28.0	NM_198565		Frame_Shift_Ins	INS	ENST00000328557.4	37	CCDS3319.1																																																																																			.		0.649	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85441061	85441061	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr12:85441061A>G	ENST00000393217.2	+	6	552	c.491A>G	c.(490-492)gAa>gGa	p.E164G		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	164	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGTGAAGTGGAAGAAAAATGT	0.333																																					p.E164G		.											.	LRRIQ1	95	0			c.A491G						.						73.0	80.0	78.0					12																	85441061		2203	4299	6502	SO:0001583	missense	84125	exon6			AAGTGGAAGAAAA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.491A>G	12.37:g.85441061A>G	ENSP00000376910:p.Glu164Gly	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	23.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.6|21.6	4.175993|4.175993	0.78564|0.78564	.|.	.|.	ENSG00000133640|ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393212;ENST00000393217|ENST00000533414	T;T|.	0.77098|.	0.78;-1.07|.	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	0.171337|.	0.43919|.	D|.	0.000515|.	T|T	0.65565|0.65565	0.2703|0.2703	L|L	0.61218|0.61218	1.895|1.895	0.34664|0.34664	D|D	0.722984|0.722984	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.996;0.998|.	T|T	0.74423|0.74423	-0.3670|-0.3670	10|5	0.87932|.	D|.	0|.	.|.	13.4199|13.4199	0.60992|0.60992	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	164;164;164|.	Q96JM4-2;Q96JM4;C9JI57|.	.;LRIQ1_HUMAN;.|.	G|E	164|62	ENSP00000376906:E164G;ENSP00000376910:E164G|.	ENSP00000256007:E164G|.	E|K	+|+	2|1	0|0	LRRIQ1|LRRIQ1	83965192|83965192	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	5.313000|5.313000	0.65798|0.65798	1.911000|1.911000	0.55334|0.55334	0.477000|0.477000	0.44152|0.44152	GAA|AAG	.		0.333	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
MAB21L1	4081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36049768	36049768	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr13:36049768T>A	ENST00000379919.4	-	1	1064	c.508A>T	c.(508-510)Atc>Ttc	p.I170F	NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	170					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GCCGGCGTGATCTGCACCACG	0.597																																					p.I170F		.											.	MAB21L1	92	0			c.A508T						.						73.0	76.0	75.0					13																	36049768		2203	4300	6503	SO:0001583	missense	4081	exon1			GCGTGATCTGCAC	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.508A>T	13.37:g.36049768T>A	ENSP00000369251:p.Ile170Phe	Somatic	231.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	42.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	37	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001112	0.74818	.	.	ENSG00000180660	ENST00000379919	T	0.08193	3.12	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	M	0.75085	2.285	0.80722	D	1	D	0.57257	0.979	D	0.67900	0.954	T	0.00827	-1.1550	10	0.44086	T	0.13	-31.8933	15.8843	0.79232	0.0:0.0:0.0:1.0	.	170	Q13394	MB211_HUMAN	F	170	ENSP00000369251:I170F	ENSP00000369251:I170F	I	-	1	0	MAB21L1	34947768	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.164000	0.68074	0.533000	0.62120	ATC	.		0.597	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
MANBA	4126	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	103590162	103590162	+	Silent	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr4:103590162A>G	ENST00000226578.4	-	10	1374	c.1275T>C	c.(1273-1275)gaT>gaC	p.D425D	MANBA_ENST00000505239.1_Silent_p.D368D	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	425					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		GGAAGCCCTGATCAGTTGGAT	0.378																																					p.D425D		.											.	MANBA	91	0			c.T1275C						.						67.0	60.0	62.0					4																	103590162		2203	4300	6503	SO:0001819	synonymous_variant	4126	exon10			GCCCTGATCAGTT		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1275T>C	4.37:g.103590162A>G		Somatic	152.0	1.0		WXS	Illumina HiSeq	Phase_I	127.0	35.0	NM_005908	Q96BC3|Q9NYX9	Silent	SNP	ENST00000226578.4	37	CCDS3658.1																																																																																			.		0.378	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
MAP4K4	9448	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	102480445	102480445	+	Intron	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:102480445A>G	ENST00000347699.4	+	17	1866				MAP4K4_ENST00000350198.4_Intron|MAP4K4_ENST00000456652.1_Intron|MAP4K4_ENST00000413150.2_Intron|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000425019.1_Intron|MAP4K4_ENST00000324219.4_Missense_Mutation_p.K677E|MAP4K4_ENST00000350878.4_Missense_Mutation_p.K572E	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4						intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						CTCTGACTCTAAGTCAGAGGC	0.537																																					p.K592E		.											.	MAP4K4	547	0			c.A1774G						.						105.0	106.0	106.0					2																	102480445		1929	4121	6050	SO:0001627	intron_variant	9448	exon16			GACTCTAAGTCAG	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.1867-947A>G	2.37:g.102480445A>G		Somatic	151.0	1.0		WXS	Illumina HiSeq	Phase_I	148.0	43.0	NM_001242560	O75172|Q9NST7	Missense_Mutation	SNP	ENST00000347699.4	37	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.932988	0.52866	.	.	ENSG00000071054	ENST00000324219;ENST00000350878;ENST00000418101	T;T;T	0.48201	0.82;0.82;0.82	5.87	5.87	0.94306	.	0.267345	0.35772	N	0.002998	T	0.39809	0.1092	L	0.34521	1.04	0.40466	D	0.980294	B;B;P	0.48089	0.131;0.131;0.905	B;B;B	0.42522	0.039;0.039;0.39	T	0.20438	-1.0275	10	0.19590	T	0.45	.	16.2713	0.82622	1.0:0.0:0.0:0.0	.	572;592;677	B7Z388;B7Z3V5;G5E948	.;.;.	E	677;572;212	ENSP00000313644:K677E;ENSP00000343658:K572E;ENSP00000414766:K212E	ENSP00000313644:K677E	K	+	1	0	MAP4K4	101846877	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.110000	0.71535	2.232000	0.73038	0.528000	0.53228	AAG	.		0.537	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	NM_004834	
MIR892A	100126342	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	145078746	145078746	+	RNA	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chrX:145078746T>A	ENST00000401124.1	-	0	0				MIR892B_ENST00000401279.1_RNA|MIR888_ENST00000401186.1_RNA|MIR890_ENST00000401256.1_RNA	NR_030584.1				microRNA 892a																		AAGGAGCCAGTGACATAAAAT	0.517																																					.		.											.	.	.	0			.						.						41.0	35.0	36.0					X																	145078746		1567	3578	5145			100126307	.			AGCCAGTGACATA			Xq27.3	2011-09-12		2008-12-18	ENSG00000215943	ENSG00000215943		"""ncRNAs / Micro RNAs"""	33639	non-coding RNA	RNA, micro				MIRN892A			Standard	NR_030584		Approved	hsa-mir-892a	uc022cfq.1				X.37:g.145078746T>A		Somatic	226.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	107.0	.		RNA	SNP	ENST00000401124.1	37																																																																																				.		0.517	MIR892A-201	KNOWN	basic	miRNA	miRNA		NR_030584	
MKI67	4288	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	129904790	129904790	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr10:129904790T>A	ENST00000368654.3	-	13	5689	c.5314A>T	c.(5314-5316)Agg>Tgg	p.R1772W	MKI67_ENST00000368653.3_Missense_Mutation_p.R1412W	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1772	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GTTTGTTTCCTAAATGCTAAA	0.483																																					p.R1772W		.											.	MKI67	519	0			c.A5314T						.						190.0	173.0	179.0					10																	129904790		2203	4300	6503	SO:0001583	missense	4288	exon13			GTTTCCTAAATGC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.5314A>T	10.37:g.129904790T>A	ENSP00000357643:p.Arg1772Trp	Somatic	201.0	1.0		WXS	Illumina HiSeq	Phase_I	238.0	47.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	11.57	1.677573	0.29783	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02446	4.29;4.29	3.12	0.519	0.17035	.	0.654681	0.13396	N	0.391011	T	0.09069	0.0224	L	0.54323	1.7	0.09310	N	1	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.83275	0.926;0.996;0.986	T	0.17623	-1.0363	10	0.66056	D	0.02	.	6.6716	0.23072	0.0:0.207:0.0:0.793	.	1771;1412;1772	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	W	1772;1412;1771	ENSP00000357643:R1772W;ENSP00000357642:R1412W	ENSP00000357642:R1412W	R	-	1	2	MKI67	129794780	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.288000	0.08377	-0.017000	0.14103	-0.360000	0.07572	AGG	.		0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
MN1	4330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	28193384	28193384	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr22:28193384T>A	ENST00000302326.4	-	1	4102	c.3148A>T	c.(3148-3150)Agc>Tgc	p.S1050C		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	1050					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						TAGCTCGTGCTCACCTCGTCC	0.637			T	ETV6	"""AML, meningioma"""																																p.S1050C		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1	993	0			c.A3148T						.						57.0	64.0	61.0					22																	28193384		2135	4227	6362	SO:0001583	missense	4330	exon1			TCGTGCTCACCTC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.3148A>T	22.37:g.28193384T>A	ENSP00000304956:p.Ser1050Cys	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	16.0	NM_002430	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.269105	0.59540	.	.	ENSG00000169184	ENST00000302326	T	0.54866	0.55	4.2	3.13	0.36017	.	0.110152	0.64402	D	0.000015	T	0.49201	0.1543	N	0.19112	0.55	0.30925	N	0.727574	D	0.65815	0.995	P	0.60415	0.874	T	0.50841	-0.8780	10	0.45353	T	0.12	-21.8263	8.8101	0.34963	0.0:0.094:0.0:0.906	.	1050	Q10571	MN1_HUMAN	C	1050	ENSP00000304956:S1050C	ENSP00000304956:S1050C	S	-	1	0	MN1	26523384	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.196000	0.58407	1.750000	0.51863	0.379000	0.24179	AGC	.		0.637	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108204062	108204062	+	Silent	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr3:108204062G>T	ENST00000273353.3	-	12	1106	c.1050C>A	c.(1048-1050)atC>atA	p.I350I		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	350	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GAAAGCCCAAGATGTCCATGG	0.458																																					p.I350I		.											.	MYH15	73	0			c.C1050A						.						147.0	136.0	140.0					3																	108204062		1924	4143	6067	SO:0001819	synonymous_variant	22989	exon12			GCCCAAGATGTCC	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1050C>A	3.37:g.108204062G>T		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	66.0	NM_014981		Silent	SNP	ENST00000273353.3	37	CCDS43127.1																																																																																			.		0.458	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
NET1	10276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5488742	5488742	+	Intron	SNP	A	A	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr10:5488742A>T	ENST00000355029.4	+	4	397				NET1_ENST00000542715.1_Intron|NET1_ENST00000380359.3_Missense_Mutation_p.D5V	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1						apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						GTGGCACATGATGAGACTGGA	0.478																																					p.D5V		.											.	NET1	290	0			c.A14T						.						134.0	125.0	128.0					10																	5488742		2203	4300	6503	SO:0001627	intron_variant	10276	exon1			CACATGATGAGAC	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.256-5051A>T	10.37:g.5488742A>T		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	10.0	NM_005863	Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	ENST00000355029.4	37	CCDS41483.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.842753	0.91197	.	.	ENSG00000173848	ENST00000449083;ENST00000380359;ENST00000380337	T;T	0.19938	2.11;2.37	5.8	5.8	0.92144	.	.	.	.	.	T	0.28632	0.0709	L	0.43152	1.355	0.80722	D	1	D	0.61697	0.99	P	0.50570	0.644	T	0.01198	-1.1421	9	0.52906	T	0.07	.	14.9738	0.71254	1.0:0.0:0.0:0.0	.	5	Q5SQI7	.	V	5	ENSP00000403101:D5V;ENSP00000369717:D5V	ENSP00000369694:D5V	D	+	2	0	NET1	5478742	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	6.568000	0.73987	2.218000	0.71995	0.377000	0.23210	GAT	.		0.478	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	
NFASC	23114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204937427	204937427	+	Missense_Mutation	SNP	G	G	A	rs535350909		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:204937427G>A	ENST00000401399.1	+	8	956	c.757G>A	c.(757-759)Gcg>Acg	p.A253T	NFASC_ENST00000539706.1_Missense_Mutation_p.A264T|NFASC_ENST00000403080.1_Missense_Mutation_p.A253T|NFASC_ENST00000360049.4_Missense_Mutation_p.A264T|NFASC_ENST00000338586.6_Missense_Mutation_p.A253T|NFASC_ENST00000338515.6_Missense_Mutation_p.A253T|NFASC_ENST00000367171.4_Missense_Mutation_p.A253T|NFASC_ENST00000367169.4_Missense_Mutation_p.A253T|NFASC_ENST00000339876.6_Missense_Mutation_p.A253T|NFASC_ENST00000513543.1_Missense_Mutation_p.A264T|NFASC_ENST00000404907.1_Missense_Mutation_p.A264T|NFASC_ENST00000404076.1_Missense_Mutation_p.A247T|NFASC_ENST00000367172.4_Missense_Mutation_p.A253T|NFASC_ENST00000367170.4_Missense_Mutation_p.A253T			O94856	NFASC_HUMAN	neurofascin	253	Ig-like C2-type 3.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCAGGGCACCGCGAGCAGCCA	0.582													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20359	0.0		0.0	False		,,,				2504	0.0				p.A264T		.											.	NFASC	139	0			c.G790A						.						128.0	110.0	116.0					1																	204937427		2203	4300	6503	SO:0001583	missense	23114	exon9			GGCACCGCGAGCA	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.757G>A	1.37:g.204937427G>A	ENSP00000385637:p.Ala253Thr	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	30.0	NM_015090	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	G	9.661	1.144147	0.21205	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000446412;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.72167	-0.04;-0.1;-0.03;-0.04;-0.03;-0.05;-0.01;0.0;-0.03;-0.63;-0.51;-0.09;-0.03;-0.01;0.0;0.01	5.29	-1.47	0.08772	.	0.430805	0.19615	N	0.110051	T	0.37679	0.1012	N	0.04297	-0.235	0.09310	N	0.999999	B;B;B;B;P;B;B	0.36378	0.004;0.062;0.019;0.033;0.55;0.025;0.17	B;B;B;B;B;B;B	0.22880	0.002;0.003;0.011;0.008;0.014;0.008;0.042	T	0.34700	-0.9818	10	0.21014	T	0.42	.	11.9988	0.53219	0.0:0.084:0.1395:0.7765	.	264;264;349;253;253;264;253	O94856-11;O94856-8;B4DRH7;F8W791;O94856-9;O94856-3;O94856-2	.;.;.;.;.;.;.	T	253;253;253;253;253;253;264;264;264;253;253;253;247;253;264;264;240	ENSP00000356140:A253T;ENSP00000356139:A253T;ENSP00000356138:A253T;ENSP00000342128:A253T;ENSP00000344786:A253T;ENSP00000343509:A253T;ENSP00000438614:A264T;ENSP00000353154:A264T;ENSP00000356137:A253T;ENSP00000412161:A253T;ENSP00000384875:A253T;ENSP00000385676:A247T;ENSP00000385637:A253T;ENSP00000384061:A264T;ENSP00000425908:A264T;ENSP00000415031:A240T	ENSP00000295776:A264T	A	+	1	0	NFASC	203204050	0.000000	0.05858	0.058000	0.19502	0.898000	0.52572	0.122000	0.15687	-0.135000	0.11495	-0.188000	0.12872	GCG	.		0.582	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
NFU1	27247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	69642381	69642381	+	Silent	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:69642381T>A	ENST00000410022.2	-	5	625	c.420A>T	c.(418-420)acA>acT	p.T140T	NFU1_ENST00000394305.1_5'UTR|NFU1_ENST00000462320.1_5'UTR|NFU1_ENST00000303698.3_Silent_p.T116T|NFU1_ENST00000471185.1_5'UTR	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	140					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						AGTCCATGATTGTTGCATAAA	0.368																																					p.T140T		.											.	NFU1	90	0			c.A420T						.						96.0	94.0	94.0					2																	69642381		2203	4300	6503	SO:0001819	synonymous_variant	27247	exon5			CATGATTGTTGCA	AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.420A>T	2.37:g.69642381T>A		Somatic	245.0	0.0		WXS	Illumina HiSeq	Phase_I	217.0	53.0	NM_001002755	B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Silent	SNP	ENST00000410022.2	37	CCDS33217.1																																																																																			.		0.368	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327279.3	NM_015700	
NUP153	9972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	17637675	17637675	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr6:17637675T>C	ENST00000262077.2	-	16	2172	c.2173A>G	c.(2173-2175)Act>Gct	p.T725A	NUP153_ENST00000537253.1_Missense_Mutation_p.T756A	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	725					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CAATCCCAAGTGCCTATCACT	0.413																																					p.T725A		.											.	NUP153	637	0			c.A2173G						.						189.0	178.0	182.0					6																	17637675		2203	4300	6503	SO:0001583	missense	9972	exon16			CCCAAGTGCCTAT	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2173A>G	6.37:g.17637675T>C	ENSP00000262077:p.Thr725Ala	Somatic	280.0	0.0		WXS	Illumina HiSeq	Phase_I	338.0	207.0	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.080908	0.55753	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.54675	0.56;0.56	6.11	4.92	0.64577	Zinc finger, RanBP2-type (3);	0.114054	0.39210	N	0.001434	T	0.26955	0.0660	N	0.12961	0.28	0.51482	D	0.999922	B;B;B	0.32188	0.359;0.057;0.287	B;B;B	0.39935	0.234;0.158;0.314	T	0.28933	-1.0028	10	0.59425	D	0.04	-8.2154	12.6328	0.56667	0.1242:0.0:0.0:0.8758	.	756;705;725	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	A	725;705;756	ENSP00000262077:T725A;ENSP00000444029:T756A	ENSP00000262077:T725A	T	-	1	0	NUP153	17745654	1.000000	0.71417	0.999000	0.59377	0.576000	0.36127	3.939000	0.56591	1.091000	0.41335	0.533000	0.62120	ACT	.		0.413	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
OGN	4969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	95155381	95155381	+	Silent	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr9:95155381A>G	ENST00000262551.4	-	4	834	c.414T>C	c.(412-414)gaT>gaC	p.D138D	OGN_ENST00000375561.5_Silent_p.D138D|OGN_ENST00000468743.1_5'UTR|CENPP_ENST00000375587.3_Intron	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	138					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						TGTCTGCAAAATCTTTGGCAG	0.338																																					p.D138D		.											.	OGN	492	0			c.T414C						.						82.0	74.0	77.0					9																	95155381		2203	4300	6503	SO:0001819	synonymous_variant	4969	exon4			TGCAAAATCTTTG	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.414T>C	9.37:g.95155381A>G		Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	71.0	NM_033014	Q6FIB0|Q9UF90|Q9UNK5	Silent	SNP	ENST00000262551.4	37	CCDS6695.1																																																																																			.		0.338	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416	
OR4A47	403253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	48510880	48510880	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr11:48510880T>A	ENST00000446524.1	+	1	612	c.536T>A	c.(535-537)aTg>aAg	p.M179K		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TTCTGTGACATGTATCCCTTA	0.448																																					p.M179K		.											.	OR4A47	92	0			c.T536A						.						168.0	159.0	162.0					11																	48510880		2201	4298	6499	SO:0001583	missense	403253	exon1			GTGACATGTATCC	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.536T>A	11.37:g.48510880T>A	ENSP00000412752:p.Met179Lys	Somatic	268.0	0.0		WXS	Illumina HiSeq	Phase_I	331.0	77.0	NM_001005512		Missense_Mutation	SNP	ENST00000446524.1	37	CCDS31490.1	.	.	.	.	.	.	.	.	.	.	N	10.61	1.399385	0.25291	.	.	ENSG00000237388	ENST00000446524	T	0.37235	1.21	4.84	3.72	0.42706	GPCR, rhodopsin-like superfamily (1);	0.087086	0.49916	D	0.000123	T	0.44456	0.1294	M	0.76574	2.34	0.09310	N	1	P	0.48998	0.918	P	0.49301	0.606	T	0.42344	-0.9457	10	0.87932	D	0	.	7.9607	0.30070	0.0:0.0985:0.0:0.9015	.	179	Q6IF82	O4A47_HUMAN	K	179	ENSP00000412752:M179K	ENSP00000412752:M179K	M	+	2	0	OR4A47	48467456	0.000000	0.05858	0.980000	0.43619	0.018000	0.09664	0.517000	0.22832	1.799000	0.52666	0.418000	0.28097	ATG	.		0.448	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512	
PALM2	114299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	112694224	112694224	+	Intron	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr9:112694224T>A	ENST00000374531.2	+	6	474				PALM2_ENST00000483909.1_Intron|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.S138T|PALM2_ENST00000448454.2_Missense_Mutation_p.S140T|AKAP2_ENST00000555236.1_Missense_Mutation_p.S138T|AKAP2_ENST00000510514.5_Missense_Mutation_p.S138T|PALM2_ENST00000314527.4_Missense_Mutation_p.S138T|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.S138T	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2						regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						AAATTACATTTCCTCCCAGCT	0.552																																					p.S138T		.											PALM2-AKAP2,nipple,malignant_melanoma,-1	PALM2-AKAP2	475	0			c.T412A						.						164.0	159.0	161.0					9																	112694224		2203	4300	6503	SO:0001627	intron_variant	445815	exon6			TACATTTCCTCCC	AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.400+6862T>A	9.37:g.112694224T>A		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	33.0	NM_007203	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	ENST00000374531.2	37	CCDS35099.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.449661	0.43531	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654;ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978	ENST00000448454;ENST00000314527;ENST00000497711;ENST00000374530;ENST00000413420;ENST00000302798;ENST00000555236;ENST00000510514	T;T;T;T;T;T;T;T	0.29142	2.3;2.3;1.58;2.26;2.3;2.26;2.26;2.26	6.17	5.04	0.67666	.	0.369759	0.21007	N	0.081742	T	0.21881	0.0527	N	0.19112	0.55	0.34555	D	0.711741	B;B;B	0.32467	0.372;0.372;0.08	B;B;B	0.32805	0.153;0.153;0.093	T	0.31998	-0.9923	10	0.87932	D	0	-8.0463	11.3853	0.49782	0.0:0.0696:0.0:0.9304	.	138;138;140	Q9Y2D5-6;Q9Y2D5-4;D3YTA4	.;.;.	T	140;138;124;138;138;138;138;138	ENSP00000400206:S140T;ENSP00000323805:S138T;ENSP00000419747:S124T;ENSP00000363654:S138T;ENSP00000397839:S138T;ENSP00000305861:S138T;ENSP00000451476:S138T;ENSP00000421522:S138T	ENSP00000305861:S138T	S	+	1	0	PALM2-AKAP2;PALM2;AKAP2	111734045	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.753000	0.62183	1.165000	0.42670	0.533000	0.62120	TCC	.		0.552	PALM2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053604.1	NM_001037293	
PC	5091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66616778	66616778	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr11:66616778C>A	ENST00000393958.2	-	21	3304	c.3211G>T	c.(3211-3213)Gcc>Tcc	p.A1071S	PC_ENST00000393955.2_Missense_Mutation_p.A1071S|PC_ENST00000529047.1_Missense_Mutation_p.A191S|PC_ENST00000528224.1_5'UTR|PC_ENST00000393960.1_Missense_Mutation_p.A1071S	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	1071					biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CTCTGGCCGGCCCGGTTCAGG	0.637																																					p.A1071S		.											.	PC	228	0			c.G3211T						.						43.0	46.0	45.0					11																	66616778		2200	4295	6495	SO:0001583	missense	5091	exon21			GGCCGGCCCGGTT	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.3211G>T	11.37:g.66616778C>A	ENSP00000377530:p.Ala1071Ser	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	94.0	NM_000920	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780165	0.31502	.	.	ENSG00000173599	ENST00000529047;ENST00000393955;ENST00000393958;ENST00000393960	D;D;D;D	0.95622	-1.6;-3.76;-3.76;-3.76	4.98	3.12	0.35913	.	0.111356	0.64402	D	0.000013	D	0.91047	0.7183	L	0.36672	1.1	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	D	0.86008	0.1499	10	0.52906	T	0.07	-10.3766	9.3447	0.38100	0.0:0.8245:0.0:0.1755	.	1071	P11498	PYC_HUMAN	S	191;1071;1071;1071	ENSP00000435905:A191S;ENSP00000377527:A1071S;ENSP00000377530:A1071S;ENSP00000377532:A1071S	ENSP00000377527:A1071S	A	-	1	0	PC	66373354	0.998000	0.40836	0.682000	0.30024	0.946000	0.59487	3.700000	0.54786	0.691000	0.31592	0.462000	0.41574	GCC	.		0.637	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
PCDHB1	29930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140433269	140433269	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr5:140433269C>A	ENST00000306549.3	+	1	2291	c.2214C>A	c.(2212-2214)aaC>aaA	p.N738K		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	738					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATTTCTCTAACAACCTGGTAC	0.373																																					p.N738K		.											.	PCDHB1	90	0			c.C2214A						.						108.0	106.0	106.0					5																	140433269		2203	4300	6503	SO:0001583	missense	29930	exon1			CTCTAACAACCTG	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.2214C>A	5.37:g.140433269C>A	ENSP00000307234:p.Asn738Lys	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	36.0	NM_013340	Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	C	8.207	0.799440	0.16397	.	.	ENSG00000171815	ENST00000306549	T	0.46451	0.87	5.91	3.91	0.45181	.	0.121727	0.36703	N	0.002448	T	0.31513	0.0799	L	0.36672	1.1	0.26899	N	0.967144	B	0.24258	0.1	B	0.19148	0.024	T	0.30621	-0.9972	10	0.72032	D	0.01	.	9.6089	0.39650	0.0:0.7886:0.0:0.2114	.	738	Q9Y5F3	PCDB1_HUMAN	K	738	ENSP00000307234:N738K	ENSP00000307234:N738K	N	+	3	2	PCDHB1	140413453	0.000000	0.05858	1.000000	0.80357	0.649000	0.38597	-0.506000	0.06359	1.521000	0.48983	0.655000	0.94253	AAC	.		0.373	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PLEC	5339	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144991598	144991598	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr8:144991598A>C	ENST00000322810.4	-	32	12971	c.12802T>G	c.(12802-12804)Tcc>Gcc	p.S4268A	PLEC_ENST00000354958.2_Missense_Mutation_p.S4109A|PLEC_ENST00000354589.3_Missense_Mutation_p.S4131A|PLEC_ENST00000398774.2_Missense_Mutation_p.S4099A|PLEC_ENST00000356346.3_Missense_Mutation_p.S4117A|PLEC_ENST00000527096.1_Missense_Mutation_p.S4154A|PLEC_ENST00000436759.2_Missense_Mutation_p.S4158A|PLEC_ENST00000357649.2_Missense_Mutation_p.S4135A|PLEC_ENST00000345136.3_Missense_Mutation_p.S4131A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	4268	Binding to intermediate filaments. {ECO:0000250}.|Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GACTTGGAGGACGTCTTCCGC	0.612																																					p.S4268A		.											.	PLEC	141	0			c.T12802G						.						60.0	66.0	64.0					8																	144991598		2104	4217	6321	SO:0001583	missense	5339	exon32			TGGAGGACGTCTT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.12802T>G	8.37:g.144991598A>C	ENSP00000323856:p.Ser4268Ala	Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	145.0	21.0	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.894096	0.33442	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.77877	-1.1;-1.1;-1.13;-1.13;-1.11;-1.1;-1.1;-1.1;-1.1	5.08	5.08	0.68730	.	0.000000	0.64402	U	0.000012	D	0.84000	0.5376	L	0.48642	1.525	0.58432	D	0.999995	D;D;D;D;D;D;D;D	0.67145	0.996;0.996;0.996;0.994;0.996;0.996;0.996;0.996	D;D;D;D;D;D;D;D	0.77557	0.99;0.99;0.99;0.978;0.99;0.99;0.99;0.99	D	0.85367	0.1111	10	0.62326	D	0.03	.	14.672	0.68951	1.0:0.0:0.0:0.0	.	4158;4117;4109;4268;4099;4131;4135;4131	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	A	4131;4135;4131;4099;4268;4109;4117;4158;4154	ENSP00000344848:S4131A;ENSP00000350277:S4135A;ENSP00000346602:S4131A;ENSP00000381756:S4099A;ENSP00000323856:S4268A;ENSP00000347044:S4109A;ENSP00000348702:S4117A;ENSP00000388180:S4158A;ENSP00000434583:S4154A	ENSP00000323856:S4268A	S	-	1	0	PLEC	145063586	1.000000	0.71417	0.994000	0.49952	0.777000	0.43975	9.065000	0.93941	2.136000	0.66102	0.408000	0.27601	TCC	.		0.612	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PSG4	5672	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	43699214	43699214	+	Silent	SNP	A	A	G	rs545983733	byFrequency	TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr19:43699214A>G	ENST00000405312.3	-	4	1158	c.921T>C	c.(919-921)ccT>ccC	p.P307P	PSG4_ENST00000244295.9_Intron|PSG4_ENST00000433626.2_Silent_p.P214P	NM_002780.3	NP_002771.2	Q00888	PSG4_HUMAN	pregnancy specific beta-1-glycoprotein 4	307	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	24		Prostate(69;0.00682)				CACATTGATAAGGTCCTGTTT	0.502													A|||	2	0.000399361	0.0	0.0	5008	,	,		22342	0.002		0.0	False		,,,				2504	0.0				p.C307C		.											.	PSG4	91	0			c.T921C						.						206.0	188.0	194.0					19																	43699214		2202	4295	6497	SO:0001819	synonymous_variant	5672	exon4			TTGATAAGGTCCT		CCDS33039.1, CCDS46093.1, CCDS62695.1	19q13.2	2013-01-29			ENSG00000243137	ENSG00000243137		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9521	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1-glycoprotein 4"""	176393				2783133	Standard	NM_002780		Approved		uc002ovy.4	Q00888	OTTHUMG00000151544	ENST00000405312.3:c.921T>C	19.37:g.43699214A>G		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	24.0	NM_002780	E7EX79|Q13047|Q13048|Q15234|Q15240|Q9UQ76	Silent	SNP	ENST00000405312.3	37	CCDS46093.1																																																																																			.		0.502	PSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323073.1	NM_213633	
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	41101120	41101120	+	Silent	SNP	G	G	A	rs376152261		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr20:41101120G>A	ENST00000373187.1	-	8	1235	c.1236C>T	c.(1234-1236)taC>taT	p.Y412Y	PTPRT_ENST00000373198.4_Silent_p.Y412Y|PTPRT_ENST00000373193.3_Silent_p.Y412Y|PTPRT_ENST00000373190.1_Silent_p.Y412Y|PTPRT_ENST00000373184.1_Silent_p.Y412Y|PTPRT_ENST00000373201.1_Silent_p.Y412Y|PTPRT_ENST00000356100.2_Silent_p.Y412Y			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	412	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.		Y -> F (in a colorectal cancer). {ECO:0000269|PubMed:15155950}.		cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.Y412*(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGGTCACCGCGTAGCCGAAGG	0.592																																					p.Y412Y		.											.	PTPRT	664	1	Substitution - Nonsense(1)	lung(1)	c.C1236T						.	G	,	1,4161		0,1,2080	52.0	60.0	57.0		1236,1236	-4.6	0.5	20		57	1,8477		0,1,4238	no	coding-synonymous,coding-synonymous	PTPRT	NM_007050.5,NM_133170.3	,	0,2,6318	AA,AG,GG		0.0118,0.024,0.0158	,	412/1442,412/1461	41101120	2,12638	2081	4239	6320	SO:0001819	synonymous_variant	11122	exon8			CACCGCGTAGCCG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1236C>T	20.37:g.41101120G>A		Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	24.0	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																			.		0.592	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
PUM2	23369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	20490545	20490545	+	Missense_Mutation	SNP	G	G	C	rs530419740		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:20490545G>C	ENST00000361078.2	-	9	1181	c.1159C>G	c.(1159-1161)Cgt>Ggt	p.R387G	PUM2_ENST00000403432.1_Missense_Mutation_p.R387G|PUM2_ENST00000319801.5_Missense_Mutation_p.R387G|PUM2_ENST00000536417.1_Missense_Mutation_p.R331G|PUM2_ENST00000338086.5_Missense_Mutation_p.R387G			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	387	Ala-rich.|Gln-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTCCAGCACGGAGAACCTAC	0.408																																					p.R387G		.											.	PUM2	91	0			c.C1159G						.						52.0	48.0	49.0					2																	20490545		2202	4298	6500	SO:0001583	missense	23369	exon9			CAGCACGGAGAAC	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1159C>G	2.37:g.20490545G>C	ENSP00000354370:p.Arg387Gly	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	36.0	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37		.	.	.	.	.	.	.	.	.	.	G	19.65	3.866975	0.72065	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.27557	1.8;2.04;1.97;1.66;1.8;1.79	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	L	0.58101	1.795	0.58432	D	0.999993	D;P;D	0.89917	0.997;0.798;1.0	D;B;D	0.91635	0.996;0.238;0.999	T	0.25502	-1.0130	10	0.21540	T	0.41	-3.2766	14.1158	0.65151	0.0:0.0:0.8496:0.1504	.	331;387;387	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	G	387;387;387;278;387;331	ENSP00000338173:R387G;ENSP00000354370:R387G;ENSP00000326746:R387G;ENSP00000409905:R278G;ENSP00000385992:R387G;ENSP00000440093:R331G	ENSP00000326746:R387G	R	-	1	0	PUM2	20354026	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.145000	0.64839	2.615000	0.88500	0.591000	0.81541	CGT	.		0.408	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
QPCT	25797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37580079	37580079	+	Splice_Site	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:37580079G>T	ENST00000338415.3	+	2	425		c.e2+1		QPCT_ENST00000537448.1_Intron	NM_012413.3	NP_036545.1	Q16769	QPCT_HUMAN	glutaminyl-peptide cyclotransferase						cellular protein modification process (GO:0006464)|peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	extracellular vesicular exosome (GO:0070062)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|stomach(2)	17		Ovarian(717;0.051)|all_hematologic(82;0.21)				TGCTCGTCAGGTGAGAACATG	0.463																																					.		.											.	QPCT	90	0			c.267+1G>T						.						68.0	63.0	65.0					2																	37580079		2203	4300	6503	SO:0001630	splice_region_variant	25797	exon2			CGTCAGGTGAGAA	X71125	CCDS1790.1	2p22	2008-07-31	2008-07-31		ENSG00000115828	ENSG00000115828	2.3.2.5		9753	protein-coding gene	gene with protein product	"""glutaminyl cyclase"""	607065				7999256	Standard	NM_012413		Approved	QC, GCT	uc002rqg.3	Q16769	OTTHUMG00000100963	ENST00000338415.3:c.267+1G>T	2.37:g.37580079G>T		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	20.0	NM_012413	Q16770|Q3KRG6|Q53TR4	Splice_Site	SNP	ENST00000338415.3	37	CCDS1790.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.941799	0.53079	.	.	ENSG00000115828	ENST00000338415	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8968	0.96969	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	QPCT	37433583	1.000000	0.71417	1.000000	0.80357	0.294000	0.27393	8.881000	0.92415	2.691000	0.91804	0.655000	0.94253	.	.		0.463	QPCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218572.2		Intron
RAB27A	5873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	55527010	55527010	+	Silent	SNP	T	T	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr15:55527010T>A	ENST00000396307.2	-	2	374	c.123A>T	c.(121-123)acA>acT	p.T41T	RAB27A_ENST00000569493.1_Silent_p.T41T|RAB27A_ENST00000336787.1_Silent_p.T41T|RAB27A_ENST00000564609.1_Silent_p.T41T	NM_004580.4	NP_004571.2	P51159	RB27A_HUMAN	RAB27A, member RAS oncogene family	41					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cytotoxic T cell degranulation (GO:0043316)|exocytosis (GO:0006887)|exosomal secretion (GO:1990182)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|multivesicular body organization (GO:0036257)|multivesicular body sorting pathway (GO:0071985)|natural killer cell degranulation (GO:0043320)|positive regulation of exocytosis (GO:0045921)|positive regulation of gene expression (GO:0010628)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle transport (GO:0048489)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|photoreceptor outer segment (GO:0001750)|secretory granule membrane (GO:0030667)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)|skin(1)	9				all cancers(107;0.0273)|GBM - Glioblastoma multiforme(80;0.0993)		CAATGCCCACTGTTGTGATAA	0.353																																					p.T41T		.											.	RAB27A	228	0			c.A123T						.						122.0	122.0	122.0					15																	55527010		2193	4292	6485	SO:0001819	synonymous_variant	5873	exon3			GCCCACTGTTGTG	U38654	CCDS10153.1	15q15-q21.1	2014-09-17			ENSG00000069974	ENSG00000069974		"""RAB, member RAS oncogene"""	9766	protein-coding gene	gene with protein product		603868				7592656	Standard	NM_183235		Approved	RAB27, RAM, GS2, HsT18676	uc002acq.3	P51159	OTTHUMG00000131959	ENST00000396307.2:c.123A>T	15.37:g.55527010T>A		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	16.0	NM_183235	O00195|Q6FI40|Q9UIR9|Q9Y5U3	Silent	SNP	ENST00000396307.2	37	CCDS10153.1																																																																																			.		0.353	RAB27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254918.1	NM_004580, NM_183236	
RAD51AP2	729475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	17696823	17696823	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:17696823C>A	ENST00000399080.2	-	1	2883	c.2860G>T	c.(2860-2862)Gaa>Taa	p.E954*		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	954										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GTCAGAGCTTCTGTTGATAAA	0.313																																					p.E954X		.											.	RAD51AP2	23	0			c.G2860T						.						34.0	34.0	34.0					2																	17696823		1799	4075	5874	SO:0001587	stop_gained	729475	exon1			GAGCTTCTGTTGA	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2860G>T	2.37:g.17696823C>A	ENSP00000382030:p.Glu954*	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	44.0	NM_001099218		Nonsense_Mutation	SNP	ENST00000399080.2	37	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	C	39	7.903963	0.98554	.	.	ENSG00000214842	ENST00000399080	.	.	.	5.17	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-0.7505	12.5509	0.56225	0.0:0.9194:0.0:0.0806	.	.	.	.	X	954	.	ENSP00000382030:E954X	E	-	1	0	RAD51AP2	17560304	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	0.751000	0.26348	2.583000	0.87209	0.655000	0.94253	GAA	.		0.313	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218	
RFC5	5985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	118456923	118456923	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr12:118456923C>G	ENST00000454402.2	+	2	230	c.112C>G	c.(112-114)Cag>Gag	p.Q38E	RFC5_ENST00000392542.2_Missense_Mutation_p.Q17E|RFC5_ENST00000229043.3_5'UTR	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	38					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATTTCTCATCAGGACATTCT	0.358																																					p.Q38E		.											.	RFC5	227	0			c.C112G						.						112.0	103.0	106.0					12																	118456923		2203	4300	6503	SO:0001583	missense	5985	exon2			TCTCATCAGGACA		CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.112C>G	12.37:g.118456923C>G	ENSP00000408295:p.Gln38Glu	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	24.0	NM_007370	A8MZ62|B3KSX8	Missense_Mutation	SNP	ENST00000454402.2	37	CCDS9185.1	.	.	.	.	.	.	.	.	.	.	C	2.404	-0.336975	0.05278	.	.	ENSG00000111445	ENST00000484086;ENST00000420967;ENST00000454402;ENST00000392542;ENST00000535092	T;T;T;T;T	0.37235	2.01;2.01;1.21;2.17;2.01	4.78	4.78	0.61160	.	0.264871	0.37955	N	0.001875	T	0.16896	0.0406	N	0.04636	-0.2	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.10567	-1.0624	10	0.02654	T	1	-4.9009	16.7575	0.85503	0.0:1.0:0.0:0.0	.	17;52;38	A8MZ62;Q59GW7;P40937	.;.;RFC5_HUMAN	E	70;17;38;17;17	ENSP00000445917:Q70E;ENSP00000390340:Q17E;ENSP00000408295:Q38E;ENSP00000376325:Q17E;ENSP00000438252:Q17E	ENSP00000376325:Q17E	Q	+	1	0	RFC5	116941306	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.115000	0.57865	2.480000	0.83734	0.563000	0.77884	CAG	.		0.358	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344196.2	NM_007370	
RPL3	6122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	39709288	39709288	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr22:39709288C>A	ENST00000216146.4	-	9	1248	c.1075G>T	c.(1075-1077)Gct>Tct	p.A359S	SNORD83B_ENST00000386745.1_RNA|SNORD83A_ENST00000386747.1_RNA|RPL3_ENST00000401609.1_Missense_Mutation_p.A307S|RPL3_ENST00000465618.1_5'UTR	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3	359					cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	TTCTCCAGAGCCCGCCGCTTC	0.552																																					p.A359S		.											.	RPL3	154	0			c.G1075T						.						32.0	32.0	32.0					22																	39709288		2203	4300	6503	SO:0001583	missense	6122	exon9			CCAGAGCCCGCCG	AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.1075G>T	22.37:g.39709288C>A	ENSP00000346001:p.Ala359Ser	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	34.0	NM_000967	B2RDV9|Q15548|Q5I0G0	Missense_Mutation	SNP	ENST00000216146.4	37	CCDS13988.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159945	0.78226	.	.	ENSG00000100316	ENST00000401609;ENST00000216146	T;T	0.42900	0.96;0.96	5.22	5.22	0.72569	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.45975	0.1369	M	0.64260	1.97	0.80722	D	1	B;B;B	0.23490	0.006;0.041;0.086	B;B;B	0.24848	0.02;0.043;0.056	T	0.42103	-0.9471	10	0.49607	T	0.09	.	18.7561	0.91833	0.0:1.0:0.0:0.0	.	307;359;310	G5E9G0;P39023;B3KS36	.;RL3_HUMAN;.	S	307;359	ENSP00000386101:A307S;ENSP00000346001:A359S	ENSP00000346001:A359S	A	-	1	0	RPL3	38039234	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	4.858000	0.62947	2.450000	0.82876	0.462000	0.41574	GCT	.		0.552	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321196.1	NM_000967	
SERPINA9	327657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94936087	94936087	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr14:94936087G>T	ENST00000380365.3	-	2	169	c.91C>A	c.(91-93)Ccc>Acc	p.P31T	SERPINA9_ENST00000424550.2_Intron|SERPINA9_ENST00000337425.5_Missense_Mutation_p.P49T|SERPINA9_ENST00000546329.1_Intron|SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000298845.7_Missense_Mutation_p.P49T|SERPINA9_ENST00000448305.2_Intron			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	31					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GAAGGGCGGGGGTATGCACTG	0.552																																					p.P49T		.											.	SERPINA9	226	0			c.C145A						.						80.0	84.0	83.0					14																	94936087		2027	4173	6200	SO:0001583	missense	327657	exon2			GGCGGGGGTATGC	AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.91C>A	14.37:g.94936087G>T	ENSP00000369723:p.Pro31Thr	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	37.0	NM_175739	B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	ENST00000380365.3	37		.	.	.	.	.	.	.	.	.	.	G	6.979	0.550733	0.13374	.	.	ENSG00000170054	ENST00000298845;ENST00000337425;ENST00000380365	D;D;D	0.88046	-2.33;-2.33;-2.33	3.89	-6.68	0.01778	Serpin domain (1);	4.024950	0.00695	U	0.000756	T	0.69187	0.3083	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.56805	-0.7918	10	0.62326	D	0.03	.	0.2398	0.00191	0.3017:0.2235:0.2498:0.225	.	31;49;49	Q86WD7;Q86WD7-7;Q86WD7-2	SPA9_HUMAN;.;.	T	49;49;31	ENSP00000298845:P49T;ENSP00000337133:P49T;ENSP00000369723:P31T	ENSP00000298845:P49T	P	-	1	0	SERPINA9	94005840	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.737000	0.04877	-1.346000	0.02211	-0.823000	0.03104	CCC	.		0.552	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395803.2	NM_175739	
SH2D2A	9047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156785887	156785887	+	Splice_Site	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:156785887C>T	ENST00000368199.3	-	2	188		c.e2-1		SH2D2A_ENST00000368198.3_Intron|NTRK1_ENST00000392302.2_Intron|SH2D2A_ENST00000392306.2_Splice_Site|SH2D2A_ENST00000495306.1_Splice_Site	NM_001161443.1|NM_001161444.1|NM_003975.3	NP_001154915.1|NP_001154916.1|NP_003966.2	Q9NP31	SH22A_HUMAN	SH2 domain containing 2A						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|large_intestine(2)|lung(15)	18	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCGTGACTCCCTGTGAGCACA	0.607																																					.		.											.	SH2D2A	90	0			c.35-1G>A						.						63.0	64.0	64.0					1																	156785887		2203	4300	6503	SO:0001630	splice_region_variant	9047	exon3			GACTCCCTGTGAG	AJ000553	CCDS1159.1, CCDS53380.1, CCDS53381.1	1q21	2013-02-14	2010-04-21		ENSG00000027869	ENSG00000027869		"""SH2 domain containing"""	10821	protein-coding gene	gene with protein product	"""T lymphocyte specific adaptor protein"", ""T cell specific adapter protein TSAd"", ""T cell specific adpater protein TSAd"""	604514	"""SH2 domain protein 2A"""			9468509	Standard	NM_003975		Approved	TSAd, F2771	uc009wsh.2	Q9NP31	OTTHUMG00000041305	ENST00000368199.3:c.35-1G>A	1.37:g.156785887C>T		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	42.0	NM_003975	O43817|Q5UBZ1|Q5VZS4|Q5VZS5|Q9UPA7	Splice_Site	SNP	ENST00000368199.3	37	CCDS1159.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241884	0.39598	.	.	ENSG00000027869	ENST00000368199;ENST00000392306	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7748	0.63046	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SH2D2A	155052511	0.985000	0.35326	0.958000	0.39756	0.382000	0.30200	3.233000	0.51311	2.706000	0.92434	0.655000	0.94253	.	.		0.607	SH2D2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098982.1	NM_003975	Intron
SIPA1L1	26037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	72190403	72190403	+	Silent	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr14:72190403C>T	ENST00000555818.1	+	16	4659	c.4311C>T	c.(4309-4311)ttC>ttT	p.F1437F	SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000381232.3_Silent_p.F1416F|SIPA1L1_ENST00000358550.2_Silent_p.F1416F|SIPA1L1_ENST00000537413.1_Silent_p.F891F	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1437	Ser-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CAGTGGTTTTCACCAGTGCCC	0.532																																					p.F1437F		.											.	SIPA1L1	156	0			c.C4311T						.						130.0	108.0	115.0					14																	72190403		2203	4300	6503	SO:0001819	synonymous_variant	26037	exon16			GGTTTTCACCAGT	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4311C>T	14.37:g.72190403C>T		Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	32.0	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	CCDS9807.1																																																																																			.		0.532	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
SLC22A16	85413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	110752455	110752455	+	Missense_Mutation	SNP	G	G	T	rs145203259	byFrequency	TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr6:110752455G>T	ENST00000368919.3	-	7	1506	c.1440C>A	c.(1438-1440)agC>agA	p.S480R	SLC22A16_ENST00000330550.4_Missense_Mutation_p.S446R|SLC22A16_ENST00000439654.1_Missense_Mutation_p.S480R	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	480					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	CCATGCTGCCGCTTCCCACAG	0.567																																					p.S480R		.											.	SLC22A16	91	0			c.C1440A						.						71.0	64.0	66.0					6																	110752455		2203	4300	6503	SO:0001583	missense	85413	exon7			GCTGCCGCTTCCC		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1440C>A	6.37:g.110752455G>T	ENSP00000357915:p.Ser480Arg	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	14.0	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	37	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	G	15.78	2.935048	0.52866	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654	T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83	5.16	-2.45	0.06481	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.042699	0.85682	D	0.000000	T	0.78272	0.4257	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.982	T	0.79286	-0.1866	10	0.72032	D	0.01	.	10.1319	0.42685	0.4955:0.0:0.5045:0.0	.	480;446	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	R	480;397;446;480	ENSP00000357915:S480R;ENSP00000395642:S397R;ENSP00000328583:S446R;ENSP00000408799:S480R	ENSP00000328583:S446R	S	-	3	2	SLC22A16	110859148	1.000000	0.71417	0.127000	0.21898	0.874000	0.50279	1.046000	0.30354	-0.786000	0.04516	-0.469000	0.05056	AGC	G|0.998;C|0.002		0.567	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
SLC30A10	55532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220088994	220088994	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:220088994C>A	ENST00000366926.3	-	4	1416	c.1255G>T	c.(1255-1257)Gca>Tca	p.A419S	SLC30A10_ENST00000484079.1_5'UTR|SLC30A10_ENST00000536446.1_Missense_Mutation_p.A174S	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	419					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		AGAGGCAGTGCCCCGGGGGGA	0.567																																					p.A419S	Colon(76;360 1614 43677 51136)	.											.	SLC30A10	90	0			c.G1255T						.						91.0	88.0	89.0					1																	220088994		2203	4300	6503	SO:0001583	missense	55532	exon4			GCAGTGCCCCGGG	AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.1255G>T	1.37:g.220088994C>A	ENSP00000355893:p.Ala419Ser	Somatic	224.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	56.0	NM_018713	Q49AL9|Q9NPW0	Missense_Mutation	SNP	ENST00000366926.3	37	CCDS31026.1	.	.	.	.	.	.	.	.	.	.	C	8.728	0.915947	0.17907	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.63913	-0.07;0.52	6.02	0.139	0.14798	.	0.547984	0.19101	N	0.122715	T	0.38453	0.1041	N	0.19112	0.55	0.09310	N	1	B	0.31680	0.335	B	0.22386	0.039	T	0.15954	-1.0419	9	.	.	.	-5.679	10.0805	0.42386	0.0:0.4524:0.4138:0.1337	.	419	Q6XR72	ZNT10_HUMAN	S	419;174	ENSP00000355893:A419S;ENSP00000439489:A174S	.	A	-	1	0	SLC30A10	218155617	0.000000	0.05858	0.003000	0.11579	0.100000	0.18952	0.215000	0.17562	0.113000	0.18004	0.650000	0.86243	GCA	.		0.567	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357709.1	NM_018713	
SPAG16	79582	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	214354720	214354720	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:214354720C>T	ENST00000331683.5	+	10	1071	c.976C>T	c.(976-978)Cca>Tca	p.P326S	SPAG16_ENST00000374309.3_Missense_Mutation_p.P232S	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	326					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GCAACCAAATCCAAACCTGAA	0.353																																					p.P326S		.											.	SPAG16	188	0			c.C976T						.						62.0	71.0	68.0					2																	214354720		2202	4299	6501	SO:0001583	missense	79582	exon10			CCAAATCCAAACC	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.976C>T	2.37:g.214354720C>T	ENSP00000332592:p.Pro326Ser	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	36.0	NM_024532	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	C	2.046	-0.418774	0.04766	.	.	ENSG00000144451	ENST00000331683;ENST00000374309;ENST00000451561	T;T;T	0.60797	0.23;0.16;0.54	5.93	3.16	0.36331	.	0.301950	0.29246	N	0.012709	T	0.41811	0.1175	N	0.17082	0.46	0.09310	N	1	B;P;D;B	0.56746	0.028;0.952;0.977;0.028	B;B;P;B	0.46975	0.015;0.341;0.533;0.015	T	0.32052	-0.9921	10	0.15499	T	0.54	.	10.5382	0.45018	0.0:0.6729:0.2537:0.0734	.	232;177;266;326	B4DYB5;Q8N0X2-2;Q4G1A2;Q8N0X2	.;.;.;SPG16_HUMAN	S	326;232;12	ENSP00000332592:P326S;ENSP00000363428:P232S;ENSP00000416600:P12S	ENSP00000332592:P326S	P	+	1	0	SPAG16	214062965	0.955000	0.32602	0.001000	0.08648	0.005000	0.04900	1.062000	0.30555	0.120000	0.18254	-1.358000	0.01219	CCA	.		0.353	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
SPTBN1	6711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	54858501	54858501	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:54858501A>G	ENST00000356805.4	+	16	3598	c.3317A>G	c.(3316-3318)aAc>aGc	p.N1106S	SPTBN1_ENST00000333896.5_Missense_Mutation_p.N1093S	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1106					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CAGCACGAGAACATCAAGAAC	0.572																																					p.N1106S		.											.	SPTBN1	140	0			c.A3317G						.						161.0	132.0	142.0					2																	54858501		2203	4300	6503	SO:0001583	missense	6711	exon16			ACGAGAACATCAA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3317A>G	2.37:g.54858501A>G	ENSP00000349259:p.Asn1106Ser	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	61.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	37	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.643657	0.29246	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.48522	0.81;0.81	5.56	5.56	0.83823	.	0.205919	0.51477	D	0.000083	T	0.20577	0.0495	N	0.00801	-1.175	0.41923	D	0.990521	B;B	0.02656	0.0;0.0	B;B	0.10450	0.003;0.005	T	0.15178	-1.0446	10	0.21540	T	0.41	.	15.727	0.77770	1.0:0.0:0.0:0.0	.	1093;1106	Q01082-3;Q01082	.;SPTB2_HUMAN	S	1106;1093	ENSP00000349259:N1106S;ENSP00000334156:N1093S	ENSP00000334156:N1093S	N	+	2	0	SPTBN1	54712005	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	2.957000	0.49137	2.118000	0.64928	0.533000	0.62120	AAC	.		0.572	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	220348819	220348819	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr2:220348819C>T	ENST00000312358.7	+	30	6766	c.6634C>T	c.(6634-6636)Caa>Taa	p.Q2212*	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	2212	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCAGCCTGCCCAAGACAAGGC	0.667																																					p.Q2212X		.											.	SPEG	383	0			c.C6634T						.						30.0	41.0	38.0					2																	220348819		2019	4144	6163	SO:0001587	stop_gained	10290	exon30			CCTGCCCAAGACA	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.6634C>T	2.37:g.220348819C>T	ENSP00000311684:p.Gln2212*	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	24.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Nonsense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	46	12.391795	0.99663	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	.	.	.	3.86	3.86	0.44501	.	1.010830	0.07972	N	0.984227	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	12.3783	0.55293	0.0:0.7758:0.2242:0.0	.	.	.	.	X	2212	.	ENSP00000265327:Q2212X	Q	+	1	0	SPEG	220057063	0.001000	0.12720	0.744000	0.31058	0.886000	0.51366	0.644000	0.24766	2.155000	0.67459	0.455000	0.32223	CAA	.		0.667	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
SSH2	85464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	28022497	28022497	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr17:28022497G>C	ENST00000269033.3	-	4	407	c.256C>G	c.(256-258)Cca>Gca	p.P86A	SSH2_ENST00000540801.1_Missense_Mutation_p.P113A|SSH2_ENST00000324677.7_5'UTR|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	86					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTGTCTTCTGGGCGGAGTAAA	0.373																																					p.P86A		.											.	SSH2	92	0			c.C256G						.						178.0	147.0	158.0					17																	28022497		2203	4300	6503	SO:0001583	missense	85464	exon4			CTTCTGGGCGGAG	AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.256C>G	17.37:g.28022497G>C	ENSP00000269033:p.Pro86Ala	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	74.0	NM_033389	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	ENST00000269033.3	37	CCDS11253.1	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050766	0.36181	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848;ENST00000324677	T;T	0.36699	1.24;1.24	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.44871	0.1314	M	0.71581	2.175	0.58432	D	0.999998	P;B;B;P;P	0.41624	0.72;0.041;0.154;0.694;0.757	P;B;B;B;B	0.47251	0.542;0.033;0.048;0.379;0.436	T	0.40194	-0.9576	10	0.05525	T	0.97	-11.9289	18.171	0.89745	0.0:0.0:1.0:0.0	.	113;86;93;86;86	F5H527;Q76I76-3;G5E957;Q76I76-4;Q76I76	.;.;.;.;SSH2_HUMAN	A	86;113;86;93	ENSP00000269033:P86A;ENSP00000444743:P113A	ENSP00000269033:P86A	P	-	1	0	SSH2	25046623	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	6.811000	0.75221	2.576000	0.86940	0.650000	0.86243	CCA	.		0.373	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256116.1	NM_033389	
STK33	65975	hgsc.bcm.edu;broad.mit.edu	37	11	8474374	8474374	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr11:8474374T>C	ENST00000447869.1	-	7	1784	c.866A>G	c.(865-867)tAt>tGt	p.Y289C	STK33_ENST00000473980.1_5'UTR|STK33_ENST00000534493.1_Missense_Mutation_p.Y248C|STK33_ENST00000315204.1_Missense_Mutation_p.Y289C|STK33_ENST00000396672.1_Missense_Mutation_p.Y289C|STK33_ENST00000396673.1_Missense_Mutation_p.Y289C|STK33_ENST00000358872.3_Missense_Mutation_p.Y102C			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	289	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		CTTACCCATATAGATAGGAGT	0.458																																					p.Y289C		.											.	STK33	337	0			c.A866G						.						120.0	127.0	125.0					11																	8474374		2201	4296	6497	SO:0001583	missense	65975	exon9			CCCATATAGATAG	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.866A>G	11.37:g.8474374T>C	ENSP00000416750:p.Tyr289Cys	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	5.0	NM_030906	Q658S6|Q8NEF5	Missense_Mutation	SNP	ENST00000447869.1	37	CCDS7789.1	.	.	.	.	.	.	.	.	.	.	T	18.37	3.608165	0.66558	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000396673;ENST00000444064;ENST00000534493;ENST00000524760	T;T;T;T;T;T;T;T	0.59638	0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.25	5.22	5.22	0.72569	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80560	0.4646	M	0.92412	3.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85130	0.0974	10	0.87932	D	0	.	12.6203	0.56600	0.0:0.0:0.0:1.0	.	248;289	B4DDH2;Q9BYT3	.;STK33_HUMAN	C	289;289;289;102;289;44;248;201	ENSP00000416750:Y289C;ENSP00000320754:Y289C;ENSP00000379905:Y289C;ENSP00000351743:Y102C;ENSP00000379906:Y289C;ENSP00000415688:Y44C;ENSP00000436418:Y248C;ENSP00000436905:Y201C	ENSP00000320754:Y289C	Y	-	2	0	STK33	8430950	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.914000	0.69964	1.978000	0.57642	0.402000	0.26972	TAT	.		0.458	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276819.2	NM_030906	
TCTEX1D1	200132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67242056	67242056	+	Silent	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:67242056C>T	ENST00000282670.2	+	4	434	c.306C>T	c.(304-306)ctC>ctT	p.L102L		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	102										large_intestine(2)|lung(10)|skin(1)	13						AACCAGAGCTCTGTAGACAGA	0.393																																					p.L102L		.											.	TCTEX1D1	90	0			c.C306T						.						108.0	107.0	108.0					1																	67242056		2203	4300	6503	SO:0001819	synonymous_variant	200132	exon4			AGAGCTCTGTAGA	AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.306C>T	1.37:g.67242056C>T		Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	51.0	NM_152665	Q06YR9|Q5VYE1	Silent	SNP	ENST00000282670.2	37	CCDS633.1																																																																																			.		0.393	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025399.2	NM_152665	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	78380651	78380651	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr11:78380651G>A	ENST00000278550.7	-	32	7201	c.6739C>T	c.(6739-6741)Cgg>Tgg	p.R2247W		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2247					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TCACCCAGCCGAGTGATGCGG	0.572																																					p.R2247W		.											.	.	.	0			c.C6739T						.						169.0	173.0	172.0					11																	78380651		2165	4260	6425	SO:0001583	missense	26011	exon32			CCAGCCGAGTGAT	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6739C>T	11.37:g.78380651G>A	ENSP00000278550:p.Arg2247Trp	Somatic	308.0	1.0		WXS	Illumina HiSeq	Phase_I	256.0	86.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.037410	0.54896	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.90844	-2.74;0.7	5.14	2.77	0.32553	.	0.000000	0.85682	D	0.000000	D	0.93776	0.8010	M	0.72118	2.19	0.58432	D	0.999991	D	0.89917	1.0	D	0.79784	0.993	D	0.92223	0.5786	9	.	.	.	.	11.8898	0.52622	0.0:0.0:0.291:0.709	.	2247	Q6N022	TEN4_HUMAN	W	2247;711	ENSP00000278550:R2247W;ENSP00000431711:R711W	.	R	-	1	2	ODZ4	78058299	0.983000	0.35010	0.782000	0.31804	0.995000	0.86356	1.861000	0.39438	0.410000	0.25675	-0.262000	0.10625	CGG	.		0.572	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TERF1	7013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	73921159	73921159	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr8:73921159G>C	ENST00000276603.5	+	1	61	c.38G>C	c.(37-39)cGg>cCg	p.R13P	TERF1_ENST00000276602.6_Missense_Mutation_p.R13P	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	13	Asp/Glu-rich (acidic).				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			CCGAGCCCGCGGGGCTGTGCG	0.607																																					p.R13P		.											.	TERF1	228	0			c.G38C						.						17.0	19.0	18.0					8																	73921159		2202	4300	6502	SO:0001583	missense	7013	exon1			GCCCGCGGGGCTG	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.38G>C	8.37:g.73921159G>C	ENSP00000276603:p.Arg13Pro	Somatic	241.0	0.0		WXS	Illumina HiSeq	Phase_I	318.0	48.0	NM_017489	A7XP29|Q15553|Q8NHT6|Q93029	Missense_Mutation	SNP	ENST00000276603.5	37	CCDS6211.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.784004	0.70222	.	.	ENSG00000147601	ENST00000276603;ENST00000276602;ENST00000518874	.	.	.	4.42	1.51	0.23008	.	0.284208	0.25674	N	0.029047	T	0.47266	0.1436	N	0.19112	0.55	0.24790	N	0.992765	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.48647	-0.9017	9	0.87932	D	0	.	13.6785	0.62469	0.0:0.4465:0.5535:0.0	.	13;13	P54274-2;P54274	.;TERF1_HUMAN	P	13	.	ENSP00000276602:R13P	R	+	2	0	TERF1	74083713	0.997000	0.39634	0.206000	0.23566	0.124000	0.20399	1.543000	0.36147	0.327000	0.23409	0.563000	0.77884	CGG	.		0.607	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
THAP11	57215	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	67877084	67877084	+	Silent	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr16:67877084G>T	ENST00000303596.1	+	1	872	c.627G>T	c.(625-627)tcG>tcT	p.S209S	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	209	Ala-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		CCGCCGCGTCGGAGTTACAGG	0.657																																					p.S209S		.											.	THAP11	90	0			c.G627T						.						42.0	53.0	49.0					16																	67877084		2161	4225	6386	SO:0001819	synonymous_variant	57215	exon1			CGCGTCGGAGTTA	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.627G>T	16.37:g.67877084G>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_020457	A4UCT5|A8K002|O94795	Silent	SNP	ENST00000303596.1	37	CCDS10847.1																																																																																			.		0.657	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457	
TNFRSF18	8784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1139782	1139782	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:1139782G>T	ENST00000379268.2	-	3	514	c.395C>A	c.(394-396)aCa>aAa	p.T132K	TNFRSF18_ENST00000486728.1_Missense_Mutation_p.T60K|TNFRSF18_ENST00000379265.5_Missense_Mutation_p.T132K|TNFRSF18_ENST00000328596.6_Missense_Mutation_p.T132K	NM_004195.2|NM_148902.1	NP_004186.1|NP_683700.1	Q9Y5U5	TNR18_HUMAN	tumor necrosis factor receptor superfamily, member 18	132					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			lung(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GACTCACTCTGTCCAAGGTTT	0.642																																					p.T132K	GBM(157;472 1934 13810 14591 35952)	.											.	TNFRSF18	227	0			c.C395A						.						29.0	32.0	31.0					1																	1139782		2194	4296	6490	SO:0001583	missense	8784	exon3			CACTCTGTCCAAG	AF125304	CCDS9.1, CCDS10.1, CCDS30552.1	1p36.3	2011-08-11			ENSG00000186891	ENSG00000186891		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11914	protein-coding gene	gene with protein product		603905				9177197, 10037686	Standard	NM_004195		Approved	AITR, GITR, CD357	uc001add.3	Q9Y5U5	OTTHUMG00000001414	ENST00000379268.2:c.395C>A	1.37:g.1139782G>T	ENSP00000368570:p.Thr132Lys	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	21.0	NM_148902	B1AME1|O95851|Q5U0I4|Q9NYJ9	Missense_Mutation	SNP	ENST00000379268.2	37	CCDS10.1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967950	0.34754	.	.	ENSG00000186891	ENST00000328596;ENST00000379268;ENST00000379265	T;T;T	0.69435	1.53;-0.4;-0.4	3.55	2.61	0.31194	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.921830	0.09071	N	0.852911	T	0.66665	0.2812	M	0.64997	1.995	0.18873	N	0.999988	P;P;P	0.46512	0.782;0.879;0.879	B;P;P	0.45167	0.242;0.472;0.472	T	0.57248	-0.7844	10	0.87932	D	0	.	8.2734	0.31857	0.0:0.0:0.7637:0.2363	.	132;132;132	Q9Y5U5-2;Q9Y5U5;B1AME3	.;TNR18_HUMAN;.	K	132	ENSP00000328207:T132K;ENSP00000368570:T132K;ENSP00000368567:T132K	ENSP00000328207:T132K	T	-	2	0	TNFRSF18	1129645	0.035000	0.19736	0.105000	0.21289	0.513000	0.34164	1.456000	0.35201	1.051000	0.40369	0.655000	0.94253	ACA	.		0.642	TNFRSF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004083.2	NM_004195	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	C	A	rs193920774		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr17:7577141C>A	ENST00000269305.4	-	8	986	c.797G>T	c.(796-798)gGa>gTa	p.G266V	TP53_ENST00000455263.2_Missense_Mutation_p.G266V|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.G266V|TP53_ENST00000420246.2_Missense_Mutation_p.G266V|TP53_ENST00000359597.4_Missense_Mutation_p.G266V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	266	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G266E(50)|p.G266V(42)|p.0?(8)|p.?(3)|p.G266fs*79(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCTGTTCCGTCCCAGTAGATT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.G266V	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	121	Substitution - Missense(95)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(3)	lung(23)|oesophagus(10)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(9)|breast(9)|upper_aerodigestive_tract(8)|ovary(8)|urinary_tract(7)|pancreas(6)|skin(5)|central_nervous_system(4)|stomach(4)|bone(4)|liver(4)|endometrium(3)|vulva(1)|kidney(1)|thyroid(1)|cervix(1)|eye(1)|genital_tract(1)|biliary_tract(1)	c.G797T						.						50.0	44.0	46.0					17																	7577141		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TTCCGTCCCAGTA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.797G>T	17.37:g.7577141C>A	ENSP00000269305:p.Gly266Val	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	39.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388215	0.82902	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	D	0.96190	0.9137	10	0.87932	D	0	-13.0798	16.1198	0.81342	0.0:1.0:0.0:0.0	.	266;266;266;266	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	266;266;266;266;266;255;134	ENSP00000352610:G266V;ENSP00000269305:G266V;ENSP00000398846:G266V;ENSP00000391127:G266V;ENSP00000391478:G266V;ENSP00000425104:G134V	ENSP00000269305:G266V	G	-	2	0	TP53	7517866	1.000000	0.71417	0.996000	0.52242	0.744000	0.42396	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	GGA	.		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRPS1	7227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	116427073	116427073	+	Silent	SNP	A	A	G			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr8:116427073A>G	ENST00000220888.5	-	6	3183	c.3024T>C	c.(3022-3024)ggT>ggC	p.G1008G	TRPS1_ENST00000519076.1_Silent_p.G762G|TRPS1_ENST00000520276.1_Silent_p.G1012G|TRPS1_ENST00000395715.3_Silent_p.G1021G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1008	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			TAGTCAATGAACCCTGGGCTT	0.453									Langer-Giedion syndrome																												p.G1021G		.											.	TRPS1	229	0			c.T3063C						.						133.0	127.0	128.0					8																	116427073		1891	4127	6018	SO:0001819	synonymous_variant	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	CAATGAACCCTGG	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3024T>C	8.37:g.116427073A>G		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	302.0	45.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37		.	.	.	.	.	.	.	.	.	.	A	3.979	-0.006858	0.07773	.	.	ENSG00000104447	ENST00000518018	.	.	.	5.82	3.23	0.37069	.	.	.	.	.	T	0.59376	0.2189	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54957	-0.8215	4	.	.	.	.	9.6643	0.39974	0.8489:0.0:0.1511:0.0	.	.	.	.	L	133	.	.	F	-	1	0	TRPS1	116496249	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.581000	0.46077	0.898000	0.36418	0.533000	0.62120	TTC	.		0.453	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
VWA1	64856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1372313	1372313	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:1372313C>T	ENST00000476993.1	+	2	158	c.80C>T	c.(79-81)cCa>cTa	p.P27L	VWA1_ENST00000338660.5_Intron|VWA1_ENST00000404702.3_Intron|RP4-758J18.10_ENST00000417917.1_lincRNA	NM_022834.4	NP_073745.2	Q6PCB0	VWA1_HUMAN	von Willebrand factor A domain containing 1	27					behavioral response to pain (GO:0048266)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interstitial matrix (GO:0005614)				NS(1)|breast(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCAGGTCCACCAGCATCAGCC	0.647																																					p.P27L		.											.	VWA1	22	0			c.C80T						.						48.0	54.0	52.0					1																	1372313		2201	4295	6496	SO:0001583	missense	64856	exon2			GTCCACCAGCATC	BC059409	CCDS27.1, CCDS28.1, CCDS28.2	1p36.33	2013-02-11			ENSG00000179403	ENSG00000179403		"""Fibronectin type III domain containing"""	30910	protein-coding gene	gene with protein product		611901				14527666, 12062410	Standard	NM_022834		Approved	FLJ22215, VWA-1, WARP	uc001afs.3	Q6PCB0	OTTHUMG00000002975	ENST00000476993.1:c.80C>T	1.37:g.1372313C>T	ENSP00000417185:p.Pro27Leu	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	35.0	NM_022834	A8K692|B3KUA1|E9PB53|Q7L5D7|Q9H6J5	Missense_Mutation	SNP	ENST00000476993.1	37	CCDS27.1	.	.	.	.	.	.	.	.	.	.	.	12.44	1.939867	0.34189	.	.	ENSG00000179403	ENST00000476993	T	0.61980	0.06	4.23	3.32	0.38043	.	0.658638	0.14155	U	0.337790	T	0.41696	0.1170	N	0.24115	0.695	0.09310	N	0.999998	P	0.35077	0.483	B	0.33392	0.163	T	0.16512	-1.0400	10	0.23891	T	0.37	-3.0384	5.5511	0.17091	0.2101:0.6861:0.0:0.1037	.	27	Q6PCB0	VWA1_HUMAN	L	27	ENSP00000417185:P27L	ENSP00000417185:P27L	P	+	2	0	VWA1	1362176	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.194000	0.09559	1.134000	0.42165	0.645000	0.84053	CCA	.		0.647	VWA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008291.1	NM_022834	
USP48	84196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22084166	22084166	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:22084166C>A	ENST00000308271.9	-	2	893	c.245G>T	c.(244-246)aGg>aTg	p.R82M	USP48_ENST00000421625.2_Missense_Mutation_p.R82M|USP48_ENST00000529637.1_Missense_Mutation_p.R82M|USP48_ENST00000400301.1_Missense_Mutation_p.R82M	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	82					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		CTTTTTTCTCCTCTCACAGTT	0.343																																					p.R82M		.											.	USP48	659	0			c.G245T						.						113.0	104.0	107.0					1																	22084166		2202	4300	6502	SO:0001583	missense	84196	exon2			TTTCTCCTCTCAC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.245G>T	1.37:g.22084166C>A	ENSP00000309262:p.Arg82Met	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	24.0	NM_001032730	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559412	0.86335	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625	T;T;T;T	0.06528	3.31;3.29;3.29;3.48	5.71	5.71	0.89125	.	0.096119	0.64402	D	0.000001	T	0.24084	0.0583	M	0.62723	1.935	0.80722	D	1	D;P;D;D;D;D	0.76494	0.999;0.92;0.999;0.998;0.999;0.998	D;P;D;D;D;P	0.71656	0.974;0.474;0.974;0.951;0.974;0.898	T	0.00039	-1.2241	10	0.66056	D	0.02	.	18.8507	0.92227	0.0:1.0:0.0:0.0	.	82;82;82;82;82;82	B7ZKS7;B7ZKS3;Q86UV5-7;Q86UV5-3;Q86UV5-2;Q86UV5	.;.;.;.;.;UBP48_HUMAN	M	82	ENSP00000383157:R82M;ENSP00000309262:R82M;ENSP00000431949:R82M;ENSP00000406256:R82M	ENSP00000309262:R82M	R	-	2	0	USP48	21956753	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.343000	0.79319	2.689000	0.91719	0.655000	0.94253	AGG	.		0.343	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216062335	216062335	+	Silent	SNP	G	G	A	rs373383107		TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr1:216062335G>A	ENST00000307340.3	-	41	8042	c.7656C>T	c.(7654-7656)acC>acT	p.T2552T	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Silent_p.T2552T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2552	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.T2552K(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GATGCTGCCAGGTGACCAACA	0.408										HNSCC(13;0.011)																											p.T2552T		.											.	USH2A	115	1	Substitution - Missense(1)	lung(1)	c.C7656T						.	G		1,4405	2.1+/-5.4	0,1,2202	93.0	92.0	92.0		7656	1.5	1.0	1		92	0,8600		0,0,4300	no	coding-synonymous	USH2A	NM_206933.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		2552/5203	216062335	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	7399	exon41			CTGCCAGGTGACC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7656C>T	1.37:g.216062335G>A		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	14.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.408	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
ZNF318	24149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	43322734	43322734	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr6:43322734C>A	ENST00000361428.2	-	4	2415	c.2338G>T	c.(2338-2340)Gga>Tga	p.G780*	ZNF318_ENST00000318149.3_Nonsense_Mutation_p.G780*	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	780					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			ATGGCAGGTCCCTGGTAGTTC	0.527																																					p.G780X		.											.	ZNF318	157	0			c.G2338T						.						134.0	130.0	132.0					6																	43322734		2203	4300	6503	SO:0001587	stop_gained	24149	exon4			CAGGTCCCTGGTA	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2338G>T	6.37:g.43322734C>A	ENSP00000354964:p.Gly780*	Somatic	335.0	0.0		WXS	Illumina HiSeq	Phase_I	529.0	113.0	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Nonsense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	C	38	6.770913	0.97825	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	.	.	.	6.07	5.04	0.67666	.	0.269330	0.32655	N	0.005807	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-16.2477	3.9294	0.09278	0.1335:0.4963:0.2508:0.1194	.	.	.	.	X	780	.	ENSP00000323032:G780X	G	-	1	0	ZNF318	43430712	0.987000	0.35691	1.000000	0.80357	0.996000	0.88848	0.814000	0.27239	2.885000	0.99019	0.655000	0.94253	GGA	.		0.527	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
WDR27	253769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	170065609	170065609	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr6:170065609C>A	ENST00000448612.1	-	7	865	c.756G>T	c.(754-756)caG>caT	p.Q252H	WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000423258.1_Missense_Mutation_p.Q125H|WDR27_ENST00000333572.6_Missense_Mutation_p.Q252H|WDR27_ENST00000420344.2_Missense_Mutation_p.S167I	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	222						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		CGGTGACCAGCTGCCTGCTTT	0.478																																					p.Q252H		.											.	WDR27	69	0			c.G756T						.						70.0	74.0	72.0					6																	170065609		1974	4152	6126	SO:0001583	missense	253769	exon7			GACCAGCTGCCTG	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.756G>T	6.37:g.170065609C>A	ENSP00000416289:p.Gln252His	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	30.0	NM_182552	A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	ENST00000448612.1	37	CCDS47520.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.44|12.44	1.938168|1.938168	0.34189|0.34189	.|.	.|.	ENSG00000184465|ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258|ENST00000420344	T;T;D|T	0.95788|0.52057	1.07;1.1;-3.81|0.68	5.18|5.18	3.04|3.04	0.35103|0.35103	.|.	0.249318|.	0.33457|.	N|.	0.004898|.	T|T	0.43612|0.43612	0.1255|0.1255	M|M	0.71581|0.71581	2.175|2.175	0.23816|0.23816	N|N	0.996764|0.996764	D;P;D|.	0.89917|.	1.0;0.927;1.0|.	D;P;D|.	0.91635|.	0.986;0.763;0.999|.	T|T	0.34354|0.34354	-0.9832|-0.9832	10|7	0.38643|0.87932	T|D	0.18|0	-26.8464|-26.8464	11.8546|11.8546	0.52429|0.52429	0.0:0.8239:0.0:0.1761|0.0:0.8239:0.0:0.1761	.|.	252;125;252|.	F2Z2U5;A2RRH5-2;C9JGV0|.	.;.;.|.	H|I	252;252;125|167	ENSP00000416289:Q252H;ENSP00000330265:Q252H;ENSP00000397869:Q125H|ENSP00000406114:S167I	ENSP00000330265:Q252H|ENSP00000406114:S167I	Q|S	-|-	3|2	2|0	WDR27|WDR27	169807534|169807534	1.000000|1.000000	0.71417|0.71417	0.815000|0.815000	0.32552|0.32552	0.006000|0.006000	0.05464|0.05464	2.266000|2.266000	0.43320|0.43320	1.185000|1.185000	0.42971|0.42971	-0.300000|-0.300000	0.09419|0.09419	CAG|AGC	.		0.478	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
ZNF512B	57473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62591366	62591366	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZQ-01A-11D-A25V-10	TCGA-FV-A4ZQ-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d02597f8-3ac7-4165-a65f-0e134e5d215b	813ef938-cbe3-456a-ba15-01bca99c2880	g.chr20:62591366T>C	ENST00000450537.1	-	17	2614	c.2554A>G	c.(2554-2556)Acc>Gcc	p.T852A	ZNF512B_ENST00000217130.3_Missense_Mutation_p.T852A|ZNF512B_ENST00000369888.1_Missense_Mutation_p.T852A			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	852					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCCTCTGGGGTCCGCTCCTTG	0.647																																					p.T852A		.											.	ZNF512B	90	0			c.A2554G						.						63.0	71.0	68.0					20																	62591366		2203	4300	6503	SO:0001583	missense	57473	exon17			CTGGGGTCCGCTC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2554A>G	20.37:g.62591366T>C	ENSP00000393795:p.Thr852Ala	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	10.0	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	37	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	T	7.460	0.644450	0.14451	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.21361	2.01;2.01;2.01	4.38	-1.14	0.09741	.	0.321381	0.28694	N	0.014442	T	0.08891	0.0220	N	0.14661	0.345	0.19775	N	0.999956	B	0.02656	0.0	B	0.01281	0.0	T	0.16394	-1.0404	10	0.36615	T	0.2	-4.0453	3.8994	0.09154	0.2209:0.0:0.3466:0.4325	.	852	Q96KM6	Z512B_HUMAN	A	852	ENSP00000358904:T852A;ENSP00000393795:T852A;ENSP00000217130:T852A	ENSP00000217130:T852A	T	-	1	0	ZNF512B	62061810	1.000000	0.71417	0.005000	0.12908	0.040000	0.13550	0.936000	0.28938	-0.596000	0.05821	-0.755000	0.03482	ACC	.		0.647	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
