#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA1	19	ucsc.edu;bcgsc.ca	37	9	107576476	107576476	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:107576476A>G	ENST00000374736.3	-	27	4218	c.3824T>C	c.(3823-3825)tTc>tCc	p.F1275S		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1275					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CTTGTCCCCGAAGGCCCGCCT	0.468																																					p.F1275S		.											.	ABCA1	1016	0			c.T3824C						.						92.0	79.0	83.0					9																	107576476		2203	4300	6503	SO:0001583	missense	19	exon27			TCCCCGAAGGCCC	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.3824T>C	9.37:g.107576476A>G	ENSP00000363868:p.Phe1275Ser	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.195516	0.58126	.	.	ENSG00000165029	ENST00000374736	D	0.88586	-2.4	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.85405	0.5689	L	0.51422	1.61	0.80722	D	1	B	0.22414	0.069	B	0.20955	0.032	T	0.81208	-0.1037	10	0.18710	T	0.47	.	15.405	0.74871	1.0:0.0:0.0:0.0	.	1275	O95477	ABCA1_HUMAN	S	1275	ENSP00000363868:F1275S	ENSP00000363868:F1275S	F	-	2	0	ABCA1	106616297	1.000000	0.71417	0.989000	0.46669	0.924000	0.55760	8.879000	0.92398	2.060000	0.61445	0.374000	0.22700	TTC	.		0.468	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
ABCB10	23456	ucsc.edu;bcgsc.ca	37	1	229666102	229666102	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:229666102C>T	ENST00000344517.4	-	8	1531	c.1489G>A	c.(1489-1491)Gtg>Atg	p.V497M		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	497	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				GCAAAATGCACGTTCTTAAAC	0.438																																					p.V497M		.											.	ABCB10	153	0			c.G1489A						.						127.0	130.0	129.0					1																	229666102		2203	4300	6503	SO:0001583	missense	23456	exon8			AATGCACGTTCTT	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1489G>A	1.37:g.229666102C>T	ENSP00000355637:p.Val497Met	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	49.0	5.0	NM_012089	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	ENST00000344517.4	37	CCDS1580.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031671	0.75504	.	.	ENSG00000135776	ENST00000344517	D	0.92446	-3.04	5.83	5.83	0.93111	ABC transporter-like (1);	0.052075	0.85682	D	0.000000	D	0.96454	0.8843	M	0.90082	3.085	0.54753	D	0.999983	D	0.89917	1.0	D	0.75484	0.986	D	0.96684	0.9506	10	0.87932	D	0	-30.7015	12.8801	0.58012	0.0:0.8845:0.0:0.1155	.	497	Q9NRK6	ABCBA_HUMAN	M	497	ENSP00000355637:V497M	ENSP00000355637:V497M	V	-	1	0	ABCB10	227732725	0.919000	0.31177	0.400000	0.26346	0.915000	0.54546	1.830000	0.39131	2.745000	0.94114	0.563000	0.77884	GTG	.		0.438	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089	
ABCD1	215	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152991039	152991039	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:152991039C>T	ENST00000218104.3	+	1	717	c.318C>T	c.(316-318)ttC>ttT	p.F106F	ABCD1_ENST00000370129.4_5'Flank|BCAP31_ENST00000458587.2_5'Flank|BCAP31_ENST00000345046.6_5'Flank|BCAP31_ENST00000441714.1_5'Flank	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	106	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCCGCACCTTCCTGTCGGTGT	0.706																																					p.F106F		.											.	ABCD1	130	0			c.C318T						.						15.0	14.0	14.0					X																	152991039		2184	4290	6474	SO:0001819	synonymous_variant	215	exon1			CACCTTCCTGTCG	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.318C>T	X.37:g.152991039C>T		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	8.0	NM_000033	Q6GTZ2	Silent	SNP	ENST00000218104.3	37	CCDS14728.1																																																																																			.		0.706	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
ACOX2	8309	ucsc.edu;bcgsc.ca	37	3	58494706	58494706	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:58494706A>G	ENST00000302819.5	-	14	2188	c.1897T>C	c.(1897-1899)Tgt>Cgt	p.C633R	ACOX2_ENST00000459701.2_Missense_Mutation_p.C619R|ACOX2_ENST00000481527.1_5'UTR	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	633					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		GAATTTAAACACTGATCGGTG	0.418																																					p.C633R		.											.	ACOX2	90	0			c.T1897C						.						130.0	113.0	119.0					3																	58494706		2203	4300	6503	SO:0001583	missense	8309	exon14			TTAAACACTGATC	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.1897T>C	3.37:g.58494706A>G	ENSP00000307697:p.Cys633Arg	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_003500	A6NF16|B2R8U5	Missense_Mutation	SNP	ENST00000302819.5	37	CCDS33775.1	.	.	.	.	.	.	.	.	.	.	A	9.681	1.149306	0.21288	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	T;T	0.42131	0.98;0.98	5.43	-0.399	0.12415	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.504438	0.19854	N	0.104572	T	0.34513	0.0900	M	0.68317	2.08	0.19300	N	0.999972	B	0.18610	0.029	B	0.18263	0.021	T	0.24977	-1.0145	10	0.26408	T	0.33	-12.0134	7.3362	0.26611	0.2711:0.0:0.0758:0.653	.	633	Q99424	ACOX2_HUMAN	R	619;633	ENSP00000418562:C619R;ENSP00000307697:C633R	ENSP00000307697:C633R	C	-	1	0	ACOX2	58469746	0.003000	0.15002	0.901000	0.35422	0.984000	0.73092	0.342000	0.19926	0.013000	0.14918	-0.492000	0.04666	TGT	.		0.418	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
ADAMTS18	170692	ucsc.edu;bcgsc.ca	37	16	77328866	77328866	+	Missense_Mutation	SNP	T	T	C	rs74584252		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:77328866T>C	ENST00000282849.5	-	19	3378	c.2960A>G	c.(2959-2961)aAc>aGc	p.N987S		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	987	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GGCATGGCTGTTGCAGGCTTG	0.522																																					p.N987S		.											.	ADAMTS18	1036	0			c.A2960G						.						106.0	73.0	84.0					16																	77328866		2198	4300	6498	SO:0001583	missense	170692	exon19			TGGCTGTTGCAGG	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2960A>G	16.37:g.77328866T>C	ENSP00000282849:p.Asn987Ser	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_199355	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	ENST00000282849.5	37	CCDS10926.1	.	.	.	.	.	.	.	.	.	.	T	16.46	3.129250	0.56721	.	.	ENSG00000140873	ENST00000282849	T	0.52295	0.67	5.79	4.7	0.59300	.	0.211582	0.47093	N	0.000257	T	0.47303	0.1438	L	0.52905	1.665	0.43267	D	0.995216	B;P	0.35192	0.434;0.489	B;B	0.41691	0.249;0.364	T	0.44590	-0.9318	10	0.51188	T	0.08	.	9.4662	0.38813	0.0:0.1459:0.0:0.8541	.	987;987	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	S	987	ENSP00000282849:N987S	ENSP00000282849:N987S	N	-	2	0	ADAMTS18	75886367	1.000000	0.71417	0.959000	0.39883	0.957000	0.61999	3.737000	0.55060	1.036000	0.39998	0.533000	0.62120	AAC	.		0.522	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
AFG3L2	10939	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	12329717	12329717	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:12329717delG	ENST00000269143.3	-	17	2472	c.2241delC	c.(2239-2241)cccfs	p.P747fs	TUBB6_ENST00000591909.1_3'UTR|TUBB6_ENST00000590967.1_Intron	NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	747					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CAAATGGTCTGGGGCCCAAAA	0.393																																					p.P747fs		.											.	AFG3L2	90	0			c.2241delC						.						91.0	89.0	90.0					18																	12329717		2203	4300	6503	SO:0001589	frameshift_variant	10939	exon17			TGGTCTGGGGCCC	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.2241delC	18.37:g.12329717delG	ENSP00000269143:p.Pro747fs	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	31.0	NM_006796	Q6P1L0	Frame_Shift_Del	DEL	ENST00000269143.3	37	CCDS11859.1																																																																																			.		0.393	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
AFG3L2	10939	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	18	12329714	12329714	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:12329714T>C	ENST00000269143.3	-	17	2475	c.2244A>G	c.(2242-2244)agA>agG	p.R748R	TUBB6_ENST00000591909.1_3'UTR|TUBB6_ENST00000590967.1_Intron	NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	748					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CCGCAAATGGTCTGGGGCCCA	0.398																																					p.R748R		.											.	AFG3L2	90	0			c.A2244G						.						93.0	92.0	92.0					18																	12329714		2203	4300	6503	SO:0001819	synonymous_variant	10939	exon17			AAATGGTCTGGGG	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.2244A>G	18.37:g.12329714T>C		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	36.0	NM_006796	Q6P1L0	Silent	SNP	ENST00000269143.3	37	CCDS11859.1																																																																																			.		0.398	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
AGMO	392636	ucsc.edu;bcgsc.ca	37	7	15433746	15433746	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr7:15433746A>G	ENST00000342526.3	-	6	837	c.668T>C	c.(667-669)gTt>gCt	p.V223A	AGMO_ENST00000498264.1_5'UTR	NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	223					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						ACCATGATGAACCCTATGATG	0.303																																					p.V223A		.											.	AGMO	69	0			c.T668C						.						133.0	136.0	135.0					7																	15433746		2203	4295	6498	SO:0001583	missense	392636	exon6			TGATGAACCCTAT		CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.668T>C	7.37:g.15433746A>G	ENSP00000341662:p.Val223Ala	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001004320	A4D114|A6NCH5	Missense_Mutation	SNP	ENST00000342526.3	37	CCDS34604.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.849654	0.71603	.	.	ENSG00000187546	ENST00000342526	D	0.84730	-1.89	5.19	4.05	0.47172	Fatty acid hydroxylase (1);	0.000000	0.64402	D	0.000001	D	0.92335	0.7568	M	0.88640	2.97	0.47584	D	0.999469	D	0.65815	0.995	D	0.74348	0.983	D	0.92016	0.5622	10	0.59425	D	0.04	-3.0948	10.6477	0.45630	0.925:0.0:0.075:0.0	.	223	Q6ZNB7	ALKMO_HUMAN	A	223	ENSP00000341662:V223A	ENSP00000341662:V223A	V	-	2	0	AGMO	15400271	1.000000	0.71417	0.789000	0.31954	0.985000	0.73830	4.737000	0.62066	0.843000	0.35070	0.477000	0.44152	GTT	.		0.303	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326049.2	NM_001004320	
AGPAT3	56894	ucsc.edu;bcgsc.ca	37	21	45397947	45397947	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr21:45397947T>C	ENST00000398063.2	+	7	1280	c.788T>C	c.(787-789)aTc>aCc	p.I263T	AGPAT3_ENST00000479117.1_3'UTR|AGPAT3_ENST00000398061.1_Missense_Mutation_p.I263T|AGPAT3_ENST00000291572.8_Missense_Mutation_p.I263T|AGPAT3_ENST00000398058.1_Missense_Mutation_p.I263T|AGPAT3_ENST00000546158.1_Missense_Mutation_p.I263T|AGPAT3_ENST00000327505.2_Missense_Mutation_p.I263T	NM_001037553.1	NP_001032642.1	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	263					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			large_intestine(4)|lung(5)|ovary(1)|prostate(1)	11				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		CTGGAAGACATCCCGCTGGAT	0.512																																					p.I263T	Pancreas(60;623 1650 5574 52796)	.											.	AGPAT3	90	0			c.T788C						.						66.0	55.0	59.0					21																	45397947		2203	4300	6503	SO:0001583	missense	56894	exon7			AAGACATCCCGCT	AF156774	CCDS13703.1	21q22.3	2013-02-05			ENSG00000160216	ENSG00000160216	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	326	protein-coding gene	gene with protein product		614794					Standard	XM_005261159		Approved	LPAAT-gamma	uc002zdw.3	Q9NRZ7	OTTHUMG00000086892	ENST00000398063.2:c.788T>C	21.37:g.45397947T>C	ENSP00000381140:p.Ile263Thr	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001037553	D3DSL2|Q3ZCU2|Q6UWP6|Q6ZUC6|Q8N3Q7|Q9NRZ6	Missense_Mutation	SNP	ENST00000398063.2	37	CCDS13703.1	.	.	.	.	.	.	.	.	.	.	T	19.67	3.871056	0.72065	.	.	ENSG00000160216	ENST00000291572;ENST00000398061;ENST00000327505;ENST00000398063;ENST00000438598;ENST00000398058;ENST00000546158	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.70842	0.3270	M	0.90922	3.16	0.80722	D	1	D;P	0.56287	0.975;0.764	P;P	0.58331	0.837;0.461	T	0.79266	-0.1874	10	0.87932	D	0	-41.8457	14.2023	0.65712	0.0:0.0:0.0:1.0	.	283;263	Q9NRZ7-3;Q9NRZ7	.;PLCC_HUMAN	T	263	ENSP00000291572:I263T;ENSP00000381138:I263T;ENSP00000332989:I263T;ENSP00000381140:I263T;ENSP00000381135:I263T;ENSP00000443510:I263T	ENSP00000291572:I263T	I	+	2	0	AGPAT3	44222375	1.000000	0.71417	0.995000	0.50966	0.699000	0.40488	7.457000	0.80775	1.760000	0.52011	0.338000	0.21704	ATC	.		0.512	AGPAT3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195722.1	NM_020132	
AGPAT6	137964	ucsc.edu;bcgsc.ca	37	8	41469488	41469488	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:41469488A>G	ENST00000396987.3	+	6	1605	c.678A>G	c.(676-678)acA>acG	p.T226T	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	226					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			GAGCGCTGACAGCCATCATCA	0.468																																					p.T226T		.											.	AGPAT6	90	0			c.A678G						.						105.0	88.0	93.0					8																	41469488		2203	4300	6503	SO:0001819	synonymous_variant	137964	exon6			GCTGACAGCCATC	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.678A>G	8.37:g.41469488A>G		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_178819	Q86V89	Silent	SNP	ENST00000396987.3	37	CCDS6117.1																																																																																			.		0.468	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
AKAP13	11214	ucsc.edu;bcgsc.ca	37	15	86123458	86123458	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:86123458A>G	ENST00000394518.2	+	7	2254	c.2159A>G	c.(2158-2160)gAc>gGc	p.D720G	AKAP13_ENST00000361243.2_Missense_Mutation_p.D720G|RP11-815J21.2_ENST00000561409.1_RNA	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	720					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GTCACCTCTGACCCTGTAAGG	0.493																																					p.D720G	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13	258	0			c.A2159G						.						67.0	63.0	64.0					15																	86123458		2202	4299	6501	SO:0001583	missense	11214	exon7			CCTCTGACCCTGT	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.2159A>G	15.37:g.86123458A>G	ENSP00000378026:p.Asp720Gly	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	48.0	5.0	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	37	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	A	11.12	1.546593	0.27652	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.26660	1.79;1.72	5.73	-1.18	0.09617	.	.	.	.	.	T	0.09024	0.0223	N	0.11560	0.145	0.09310	N	0.999999	B;B	0.09022	0.001;0.002	B;B	0.10450	0.002;0.005	T	0.35450	-0.9788	9	0.09590	T	0.72	.	1.2065	0.01896	0.4131:0.2842:0.1656:0.1372	.	720;720	Q12802;Q12802-2	AKP13_HUMAN;.	G	720;720;719;719	ENSP00000354718:D720G;ENSP00000378026:D720G	ENSP00000354718:D720G	D	+	2	0	AKAP13	83924462	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.038000	0.12144	-0.474000	0.06862	-0.327000	0.08410	GAC	.		0.493	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
AKNA	80709	ucsc.edu;bcgsc.ca	37	9	117113246	117113246	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:117113246G>A	ENST00000307564.4	-	15	3275	c.3114C>T	c.(3112-3114)ccC>ccT	p.P1038P	AKNA_ENST00000223791.3_Silent_p.P498P|AKNA_ENST00000374079.4_5'Flank|AKNA_ENST00000374088.3_Silent_p.P1038P|AKNA_ENST00000374075.5_Silent_p.P957P	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1038					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TTGTCTTGTTGGGAAGGGGCT	0.597																																					p.P1038P		.											.	AKNA	94	0			c.C3114T						.						40.0	46.0	44.0					9																	117113246		2203	4300	6503	SO:0001819	synonymous_variant	80709	exon15			CTTGTTGGGAAGG	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.3114C>T	9.37:g.117113246G>A		Somatic	67.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Silent	SNP	ENST00000307564.4	37	CCDS6805.1																																																																																			.		0.597	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
AKNAD1	254268	ucsc.edu;bcgsc.ca	37	1	109363223	109363223	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:109363223A>G	ENST00000370001.3	-	14	2461	c.2193T>C	c.(2191-2193)tgT>tgC	p.C731C	AKNAD1_ENST00000477908.1_5'Flank	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	731						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						CTCTCTGAGAACAGATCCGTT	0.338																																					p.C731C		.											.	AKNAD1	93	0			c.T2193C						.						108.0	110.0	109.0					1																	109363223		2203	4300	6503	SO:0001819	synonymous_variant	254268	exon14			CTGAGAACAGATC	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.2193T>C	1.37:g.109363223A>G		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_152763	B9EK62|Q5T1N0|Q8N990|Q8NCN9	Silent	SNP	ENST00000370001.3	37	CCDS791.2																																																																																			.		0.338	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030923.2	NM_152763	
ALAS2	212	ucsc.edu;bcgsc.ca	37	X	55040038	55040038	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:55040038A>G	ENST00000330807.5	-	10	1618	c.1481T>C	c.(1480-1482)cTc>cCc	p.L494P	ALAS2_ENST00000396198.3_Missense_Mutation_p.L481P|ALAS2_ENST00000498636.1_Intron|ALAS2_ENST00000335854.4_Missense_Mutation_p.L457P	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	494					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	ATGCTTGGAGAGCAGGAGATC	0.587																																					p.L494P		.											.	ALAS2	131	0			c.T1481C						.						107.0	76.0	87.0					X																	55040038		2203	4300	6503	SO:0001583	missense	212	exon10			TTGGAGAGCAGGA		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.1481T>C	X.37:g.55040038A>G	ENSP00000332369:p.Leu494Pro	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	65.0	5.0	NM_000032	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.217307	0.79352	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.92299	-3.01;-3.01;-3.01	5.25	5.25	0.73442	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.062954	0.64402	D	0.000005	D	0.97636	0.9225	H	0.98370	4.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.98732	1.0713	10	0.87932	D	0	-25.1933	13.3975	0.60863	1.0:0.0:0.0:0.0	.	457;481;494	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	P	494;481;457	ENSP00000332369:L494P;ENSP00000379501:L481P;ENSP00000337131:L457P	ENSP00000332369:L494P	L	-	2	0	ALAS2	55056763	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	1.875000	0.54330	0.441000	0.28932	CTC	.		0.587	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032	
ANKRD24	170961	ucsc.edu;bcgsc.ca	37	19	4224483	4224483	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:4224483T>C	ENST00000600132.1	+	22	3698	c.3422T>C	c.(3421-3423)cTc>cCc	p.L1141P	ANKRD24_ENST00000318934.4_Missense_Mutation_p.L1141P|ANKRD24_ENST00000262970.5_Missense_Mutation_p.L1231P	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1141										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		ATGCAGAGACTCCAGGCTCAG	0.617																																					p.L1141P		.											.	ANKRD24	68	0			c.T3422C						.						44.0	51.0	49.0					19																	4224483		2108	4235	6343	SO:0001583	missense	170961	exon22			AGAGACTCCAGGC	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3422T>C	19.37:g.4224483T>C	ENSP00000471252:p.Leu1141Pro	Somatic	21.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_133475	O75268|O95781	Missense_Mutation	SNP	ENST00000600132.1	37	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.597646	0.46318	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.35789	1.31;1.29	5.39	5.39	0.77823	.	.	.	.	.	T	0.50240	0.1604	L	0.44542	1.39	0.21782	N	0.999542	D	0.65815	0.995	D	0.69142	0.962	T	0.40831	-0.9542	9	0.52906	T	0.07	.	11.7733	0.51970	0.0:0.0:0.0:1.0	.	1141	Q8TF21	ANR24_HUMAN	P	1141;1231	ENSP00000321731:L1141P;ENSP00000262970:L1231P	ENSP00000262970:L1231P	L	+	2	0	ANKRD24	4175483	0.524000	0.26282	0.020000	0.16555	0.975000	0.68041	3.344000	0.52174	2.054000	0.61138	0.397000	0.26171	CTC	.		0.617	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
ANKRD45	339416	ucsc.edu;bcgsc.ca	37	1	173596300	173596300	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:173596300T>C	ENST00000333279.2	-	4	557		c.e4-2			NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45											NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						GCCTTGCATCTGAAAGAATGG	0.433																																					.		.											.	ANKRD45	90	0			c.497-2A>G						.						90.0	92.0	92.0					1																	173596300		2203	4300	6503	SO:0001630	splice_region_variant	339416	exon5			TGCATCTGAAAGA		CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.497-2A>G	1.37:g.173596300T>C		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_198493	A1A4G2|Q6ZST1	Splice_Site	SNP	ENST00000333279.2	37	CCDS1309.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.506262	0.64410	.	.	ENSG00000183831	ENST00000333279	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7422	0.51799	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD45	171862923	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	3.634000	0.54302	2.048000	0.60808	0.455000	0.32223	.	.		0.433	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097580.2	NM_198493	Intron
APEH	327	ucsc.edu;bcgsc.ca	37	3	49713561	49713561	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:49713561A>G	ENST00000296456.5	+	6	915	c.515A>G	c.(514-516)aAg>aGg	p.K172R	APEH_ENST00000438011.1_Missense_Mutation_p.K172R	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	172					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AAGCGCCCCAAGGCCGAGTCC	0.582																																					p.K172R		.											.	APEH	91	0			c.A515G						.						59.0	62.0	61.0					3																	49713561		2203	4300	6503	SO:0001583	missense	327	exon6			GCCCCAAGGCCGA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.515A>G	3.37:g.49713561A>G	ENSP00000296456:p.Lys172Arg	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_001640	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.102317	0.76983	.	.	ENSG00000164062	ENST00000296456;ENST00000449966;ENST00000442186;ENST00000438011;ENST00000457042	T;T;T	0.51325	0.71;1.0;0.71	4.9	4.9	0.64082	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (1);	0.097855	0.64402	D	0.000002	T	0.62660	0.2446	M	0.81341	2.54	0.36384	D	0.862076	D;D	0.58970	0.984;0.984	P;P	0.57548	0.823;0.823	T	0.70464	-0.4864	10	0.32370	T	0.25	-0.6758	11.798	0.52110	0.8537:0.1463:0.0:0.0	.	172;172	C9JIF9;P13798	.;ACPH_HUMAN	R	172;71;97;172;169	ENSP00000296456:K172R;ENSP00000402365:K97R;ENSP00000415862:K172R	ENSP00000296456:K172R	K	+	2	0	APEH	49688565	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.196000	0.72094	1.839000	0.53478	0.402000	0.26972	AAG	.		0.582	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
ARNTL	406	ucsc.edu;bcgsc.ca	37	11	13408275	13408275	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:13408275A>G	ENST00000403290.1	+	20	2208	c.1853A>G	c.(1852-1854)gAc>gGc	p.D618G	ARNTL_ENST00000401424.1_Missense_Mutation_p.D575G|ARNTL_ENST00000361003.4_Missense_Mutation_p.D500G|ARNTL_ENST00000403482.3_Missense_Mutation_p.D616G|ARNTL_ENST00000403510.3_Missense_Mutation_p.D574G|ARNTL_ENST00000389707.4_Missense_Mutation_p.D617G|ARNTL_ENST00000396441.3_Missense_Mutation_p.D617G|ARNTL_ENST00000389708.3_3'UTR			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	618					circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		GGCCCTGTTGACTTTAGTGAC	0.478																																					p.D617G		.											.	ARNTL	90	0			c.A1850G						.						175.0	145.0	155.0					11																	13408275		2200	4294	6494	SO:0001583	missense	406	exon19			CTGTTGACTTTAG	D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.1853A>G	11.37:g.13408275A>G	ENSP00000384517:p.Asp618Gly	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	62.0	6.0	NM_001030272	A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Missense_Mutation	SNP	ENST00000403290.1	37		.	.	.	.	.	.	.	.	.	.	A	21.1	4.099003	0.76870	.	.	ENSG00000133794	ENST00000396441;ENST00000389707;ENST00000401424;ENST00000403290;ENST00000361003;ENST00000403510;ENST00000339640;ENST00000403482	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.68577	0.3016	M	0.75615	2.305	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.997;0.998;1.0	D;D;D;D;D	0.81914	0.993;0.99;0.989;0.995;0.976	T	0.72734	-0.4204	10	0.87932	D	0	.	15.2707	0.73699	1.0:0.0:0.0:0.0	.	616;575;618;617;574	O00327-7;O00327-1;O00327;O00327-8;A2I2N6	.;.;BMAL1_HUMAN;.;.	G	617;617;575;618;500;574;574;616	ENSP00000379718:D617G;ENSP00000374357:D617G;ENSP00000385915:D575G;ENSP00000384517:D618G;ENSP00000354278:D500G;ENSP00000385581:D574G;ENSP00000385897:D616G	ENSP00000340289:D574G	D	+	2	0	ARNTL	13364851	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.761000	0.91691	2.281000	0.76405	0.533000	0.62120	GAC	.		0.478	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000319173.1	NM_001178	
ARAP1	116985	ucsc.edu;bcgsc.ca	37	11	72404496	72404496	+	Silent	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:72404496G>T	ENST00000393609.3	-	29	4030	c.3828C>A	c.(3826-3828)acC>acA	p.T1276T	ARAP1_ENST00000426523.1_Silent_p.T1031T|ARAP1_ENST00000455638.2_Silent_p.T1276T|ARAP1_ENST00000429686.1_Silent_p.T970T|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000334211.8_Silent_p.T1031T|ARAP1_ENST00000393605.3_Silent_p.T1036T|ARAP1_ENST00000359373.5_Silent_p.T1276T|ARAP1-AS1_ENST00000542022.1_RNA	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1276	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TGCCATGCTTGGTGTCACCGA	0.647																																					p.T1276T	Ovarian(102;1198 1520 13195 17913 37529)	.											.	ARAP1	91	0			c.C3828A						.						92.0	86.0	88.0					11																	72404496		2200	4293	6493	SO:0001819	synonymous_variant	116985	exon29			ATGCTTGGTGTCA	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3828C>A	11.37:g.72404496G>T		Somatic	46.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	ENST00000393609.3	37	CCDS41687.1																																																																																			.		0.647	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
ASXL1	171023	broad.mit.edu;bcgsc.ca	37	20	31019176	31019176	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:31019176C>T	ENST00000375687.4	+	9	1195	c.771C>T	c.(769-771)tcC>tcT	p.S257S	ASXL1_ENST00000306058.5_Silent_p.S252S	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	257	Interaction with KDM1A. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CACCTGGGTCCATTCTTGTCA	0.453			"""F, N, Mis"""		"""MDS, CMML"""																																p.S257S		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	2057	0			c.C771T						.						142.0	135.0	138.0					20																	31019176		2203	4300	6503	SO:0001819	synonymous_variant	171023	exon8			TGGGTCCATTCTT	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.771C>T	20.37:g.31019176C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	6.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	ENST00000375687.4	37	CCDS13201.1																																																																																			.		0.453	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	52439874	52439874	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:52439874G>A	ENST00000460680.1	-	10	1309	c.838C>T	c.(838-840)Cag>Tag	p.Q280*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.Q262*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	191					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q280*(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TCAGGCAGCTGTGACTCTTGA	0.567			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.Q280X	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	1032	1	Substitution - Nonsense(1)	breast(1)	c.C838T						.						70.0	69.0	70.0					3																	52439874		2203	4300	6503	SO:0001587	stop_gained	8314	exon10			GCAGCTGTGACTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.838C>T	3.37:g.52439874G>A	ENSP00000417132:p.Gln280*	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	19.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	32	5.123994	0.94429	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	5.35	5.35	0.76521	.	0.252992	0.42172	D	0.000752	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-5.5978	19.4309	0.94765	0.0:0.0:1.0:0.0	.	.	.	.	X	280;262	.	ENSP00000296288:Q262X	Q	-	1	0	BAP1	52414914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.676000	0.74498	2.663000	0.90544	0.561000	0.74099	CAG	.		0.567	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
ACSM6	142827	ucsc.edu;bcgsc.ca	37	10	96967135	96967135	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:96967135A>G	ENST00000394005.3	+	3	583	c.574A>G	c.(574-576)Agc>Ggc	p.S192G	C10orf129_ENST00000341686.3_Missense_Mutation_p.S192G|C10orf129_ENST00000430183.1_Missense_Mutation_p.S37G			Q6P461	ACSM6_HUMAN		192					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GTCAGATAAGAGCTATGATGG	0.448																																					p.S192G		.											.	C10orf129	90	0			c.A574G						.						88.0	80.0	83.0					10																	96967135		2203	4300	6503	SO:0001583	missense	142827	exon4			GATAAGAGCTATG																												ENST00000394005.3:c.574A>G	10.37:g.96967135A>G	ENSP00000377573:p.Ser192Gly	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_207321	A4FU95|A4IF38|Q5VZX2|Q6ZTX1	Missense_Mutation	SNP	ENST00000394005.3	37	CCDS7440.2	.	.	.	.	.	.	.	.	.	.	A	12.45	1.940819	0.34283	.	.	ENSG00000173124	ENST00000539707;ENST00000341686;ENST00000430183;ENST00000394005	T;T;T	0.41400	1.0;1.0;1.0	1.2	1.2	0.21068	AMP-dependent synthetase/ligase (1);	.	.	.	.	T	0.30947	0.0781	L	0.41492	1.28	0.09310	N	1	B	0.10296	0.003	B	0.18561	0.022	T	0.22312	-1.0220	9	0.36615	T	0.2	.	6.6699	0.23062	1.0:0.0:0.0:0.0	.	192	Q6P461	ACSM6_HUMAN	G	218;192;37;192	ENSP00000340296:S192G;ENSP00000400368:S37G;ENSP00000377573:S192G	ENSP00000340296:S192G	S	+	1	0	C10orf129	96957125	0.000000	0.05858	0.048000	0.18961	0.889000	0.51656	0.434000	0.21494	0.867000	0.35654	0.472000	0.43445	AGC	.		0.448	C10orf129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049506.2		
C11orf30	56946	ucsc.edu;bcgsc.ca	37	11	76224573	76224573	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:76224573C>A	ENST00000529032.1	+	9	1507	c.1507C>A	c.(1507-1509)Cct>Act	p.P503T	C11orf30_ENST00000533248.1_Missense_Mutation_p.P517T|C11orf30_ENST00000525038.1_Missense_Mutation_p.P518T|C11orf30_ENST00000525919.1_Missense_Mutation_p.P504T|C11orf30_ENST00000524767.1_Missense_Mutation_p.P518T|C11orf30_ENST00000524490.1_Missense_Mutation_p.P419T|C11orf30_ENST00000343878.3_Missense_Mutation_p.P503T|C11orf30_ENST00000334736.3_Missense_Mutation_p.P503T			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	503	Thr-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						GGTAACCACTCCTACTGGTAA	0.408																																					p.P503T		.											.	C11orf30	232	0			c.C1507A						.						120.0	104.0	109.0					11																	76224573		2200	4292	6492	SO:0001583	missense	56946	exon10			ACCACTCCTACTG	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1507C>A	11.37:g.76224573C>A	ENSP00000432327:p.Pro503Thr	Somatic	74.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_020193	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Missense_Mutation	SNP	ENST00000529032.1	37	CCDS8244.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.246355	0.59103	.	.	ENSG00000158636	ENST00000524490;ENST00000334736;ENST00000343878;ENST00000533972;ENST00000524767;ENST00000533248;ENST00000525919;ENST00000525038;ENST00000529032;ENST00000531998	.	.	.	5.34	5.34	0.76211	.	0.049376	0.85682	D	0.000000	T	0.62221	0.2410	L	0.29908	0.895	0.58432	D	0.999998	P;P;P;D;D;P;D	0.59767	0.941;0.941;0.941;0.986;0.976;0.941;0.976	P;P;P;P;P;P;P	0.56088	0.527;0.527;0.527;0.791;0.622;0.527;0.622	T	0.63963	-0.6518	9	0.51188	T	0.08	-7.036	19.057	0.93069	0.0:1.0:0.0:0.0	.	517;518;518;503;504;419;503	B7ZKT8;B7ZKU2;B7ZKU0;Q7Z589-2;Q17RM7;E9PMC9;Q7Z589	.;.;.;.;.;.;EMSY_HUMAN	T	419;503;503;72;518;517;504;518;503;45	.	ENSP00000334130:P503T	P	+	1	0	C11orf30	75902221	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.892000	0.63193	2.508000	0.84585	0.655000	0.94253	CCT	.		0.408	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193	
C17orf77	146723	ucsc.edu;bcgsc.ca	37	17	72588235	72588235	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:72588235A>G	ENST00000392620.1	+	3	412	c.50A>G	c.(49-51)aAc>aGc	p.N17S	CD300LD_ENST00000375352.1_Intron|C17orf77_ENST00000328023.2_Missense_Mutation_p.N17S	NM_152460.2	NP_689673.2	Q96MU5	CQ077_HUMAN	chromosome 17 open reading frame 77	17						extracellular region (GO:0005576)				breast(2)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11						CTTCCTGAGAACAGAGCGTCT	0.488																																					p.N17S		.											.	C17orf77	90	0			c.A50G						.						97.0	97.0	97.0					17																	72588235		2203	4300	6503	SO:0001583	missense	146723	exon3			CTGAGAACAGAGC		CCDS32721.1	17q25.1	2006-01-16			ENSG00000182352	ENSG00000182352			26480	protein-coding gene	gene with protein product							Standard	NM_152460		Approved	FLJ31882	uc002jla.1	Q96MU5	OTTHUMG00000067611	ENST00000392620.1:c.50A>G	17.37:g.72588235A>G	ENSP00000376396:p.Asn17Ser	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_152460		Missense_Mutation	SNP	ENST00000392620.1	37	CCDS32721.1	.	.	.	.	.	.	.	.	.	.	A	4.490	0.090842	0.08632	.	.	ENSG00000182352	ENST00000524389;ENST00000392620;ENST00000328023	T;T	0.52295	0.67;0.67	3.16	-1.71	0.08133	.	.	.	.	.	T	0.21267	0.0512	N	0.08118	0	0.09310	N	1	B	0.28128	0.201	B	0.20767	0.031	T	0.13764	-1.0497	9	0.87932	D	0	.	3.1043	0.06336	0.4064:0.0:0.387:0.2066	.	17	Q96MU5	CQ077_HUMAN	S	17	ENSP00000376396:N17S;ENSP00000329353:N17S	ENSP00000329353:N17S	N	+	2	0	C17orf77	70099830	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.139000	0.10358	-0.408000	0.07565	-1.256000	0.01477	AAC	.		0.488	C17orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145090.2	NM_152460	
CIART	148523	ucsc.edu;bcgsc.ca	37	1	150256042	150256042	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:150256042A>G	ENST00000290363.5	+	1	814	c.365A>G	c.(364-366)aAg>aGg	p.K122R	C1orf51_ENST00000469255.1_3'UTR|C1orf51_ENST00000369094.1_Splice_Site_p.K34R|C1orf51_ENST00000369095.1_Splice_Site_p.K122R	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		122					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTTGCCCAGAAGGTAAGAGAA	0.507																																					p.K122R		.											.	C1orf51	90	0			c.A365G						.						71.0	66.0	68.0					1																	150256042		2203	4300	6503	SO:0001630	splice_region_variant	148523	exon1			CCCAGAAGGTAAG																												ENST00000290363.5:c.366+1A>G	1.37:g.150256042A>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_144697	B2RD43|D3DV01|Q8N795|Q96MG6	Missense_Mutation	SNP	ENST00000290363.5	37	CCDS949.1	.	.	.	.	.	.	.	.	.	.	A	18.55	3.647698	0.67358	.	.	ENSG00000159208	ENST00000447007;ENST00000369095;ENST00000369094;ENST00000417398;ENST00000290363	.	.	.	4.76	3.6	0.41247	.	0.053749	0.64402	D	0.000001	T	0.60547	0.2277	M	0.68952	2.095	0.36197	D	0.850479	D	0.89917	1.0	D	0.85130	0.997	T	0.65586	-0.6132	9	0.66056	D	0.02	-15.3113	7.4255	0.27096	0.8072:0.0:0.0:0.1928	.	122	Q8N365	CA051_HUMAN	R	34;122;34;34;122	.	ENSP00000290363:K122R	K	+	2	0	C1orf51	148522666	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.561000	0.67339	0.808000	0.34231	0.533000	0.62120	AAG	.		0.507	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035058.1		Missense_Mutation
C1QBP	708	ucsc.edu;bcgsc.ca	37	17	5336345	5336345	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:5336345T>A	ENST00000225698.4	-	6	920	c.839A>T	c.(838-840)aAg>aTg	p.K280M	CTC-524C5.2_ENST00000575890.1_RNA|C1QBP_ENST00000574444.1_Missense_Mutation_p.K176M	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein	280					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	CTACTGGCTCTTGACAAAACT	0.478																																					p.K280M		.											.	C1QBP	91	0			c.A839T						.						76.0	75.0	75.0					17																	5336345		2203	4300	6503	SO:0001583	missense	708	exon6			TGGCTCTTGACAA	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021		ENST00000225698.4:c.839A>T	17.37:g.5336345T>A	ENSP00000225698:p.Lys280Met	Somatic	60.0	0.0		WXS	Illumina HiSeq	.	44.0	5.0	NM_001212	Q2HXR8|Q9NNY8	Missense_Mutation	SNP	ENST00000225698.4	37	CCDS11071.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.237112	0.79800	.	.	ENSG00000108561	ENST00000225698	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.76047	0.3933	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.77710	-0.2486	9	0.62326	D	0.03	-18.8033	15.3829	0.74673	0.0:0.0:0.0:1.0	.	280	Q07021	C1QBP_HUMAN	M	280	.	ENSP00000225698:K280M	K	-	2	0	C1QBP	5277069	1.000000	0.71417	1.000000	0.80357	0.524000	0.34500	6.187000	0.72039	2.227000	0.72691	0.533000	0.62120	AAG	.		0.478	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439388.1	NM_001212	
CACNA2D2	9254	ucsc.edu;bcgsc.ca	37	3	50421651	50421651	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:50421651T>C	ENST00000479441.1	-	6	627	c.628A>G	c.(628-630)Atc>Gtc	p.I210V	CACNA2D2_ENST00000424201.2_Missense_Mutation_p.I210V|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.I210V|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.I210V|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.I141V|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.I210V|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.I210V|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.I210V			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	210					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TCCGTAGGGATCTGTACAGCC	0.562																																					p.I210V		.											.	CACNA2D2	278	0			c.A628G						.						319.0	291.0	300.0					3																	50421651		2203	4300	6503	SO:0001583	missense	9254	exon6			TAGGGATCTGTAC	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.628A>G	3.37:g.50421651T>C	ENSP00000418081:p.Ile210Val	Somatic	95.0	0.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	37	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.748962	0.89753	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.04917	3.54;3.53;3.53;3.55;3.54;3.53;3.53;3.53	5.53	5.53	0.82687	VWA N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	N	0.25647	0.755	0.54753	D	0.999982	P;D	0.62365	0.938;0.991	P;D	0.64877	0.874;0.93	T	0.37220	-0.9715	10	0.13108	T	0.6	-25.8801	15.6598	0.77178	0.0:0.0:0.0:1.0	.	210;210	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	V	210;210;210;141;210;210;210;210	ENSP00000407393:I210V;ENSP00000404631:I210V;ENSP00000266039:I210V;ENSP00000354228:I141V;ENSP00000390526:I210V;ENSP00000378519:I210V;ENSP00000390329:I210V;ENSP00000418081:I210V	ENSP00000266039:I210V	I	-	1	0	CACNA2D2	50396655	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.415000	0.80131	2.100000	0.63781	0.460000	0.39030	ATC	.		0.562	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
CASP1	834	ucsc.edu;bcgsc.ca	37	11	104897623	104897623	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:104897623A>G	ENST00000533400.1	-	8	1097	c.1062T>C	c.(1060-1062)atT>atC	p.I354I	CASP1_ENST00000594519.1_Silent_p.I213I|CASP1_ENST00000527979.1_Silent_p.I317I|CASP1_ENST00000415981.2_Silent_p.I38I|CASP1_ENST00000534497.1_Silent_p.I213I|CASP1_ENST00000526568.1_Silent_p.I261I|CASP1_ENST00000525825.1_Silent_p.I333I|CASP1_ENST00000393136.4_Silent_p.I333I|CASP1_ENST00000598974.1_Silent_p.I354I|CASP1_ENST00000593315.1_Silent_p.I333I|CASP1_ENST00000528974.1_3'UTR|CASP1_ENST00000446369.1_Silent_p.I213I|CASP1_ENST00000353247.5_Silent_p.I38I|CASP1_ENST00000531166.1_Silent_p.I38I|CASP1_ENST00000436863.3_Silent_p.I354I	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	354					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	GCATATGTTCAATGAGTCTTC	0.408																																					p.I354I	NSCLC(41;1246 1743 4934)	.											.	CASP1	661	0			c.T1062C						.						117.0	108.0	111.0					11																	104897623		2202	4299	6501	SO:0001819	synonymous_variant	834	exon8			ATGTTCAATGAGT	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.1062T>C	11.37:g.104897623A>G		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_001257118	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Silent	SNP	ENST00000533400.1	37	CCDS8330.1																																																																																			.		0.408	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292	
CADM1	23705	ucsc.edu;bcgsc.ca	37	11	115099884	115099884	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:115099884G>T	ENST00000452722.3	-	5	690	c.670C>A	c.(670-672)Cac>Aac	p.H224N	CADM1_ENST00000536727.1_Missense_Mutation_p.H224N|CADM1_ENST00000331581.6_Missense_Mutation_p.H224N|CADM1_ENST00000537058.1_Missense_Mutation_p.H224N|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000542447.2_Missense_Mutation_p.H224N	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		ACCGCAGGGTGCTCCACCTGG	0.537																																					p.H224N		.											.	CADM1	92	0			c.C670A						.						100.0	75.0	83.0					11																	115099884		2201	4296	6497	SO:0001583	missense	23705	exon5			CAGGGTGCTCCAC	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.670C>A	11.37:g.115099884G>T	ENSP00000395359:p.His224Asn	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_014333		Missense_Mutation	SNP	ENST00000452722.3	37	CCDS8373.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.856740|4.856740	0.91433|0.91433	.|.	.|.	ENSG00000182985|ENSG00000182985	ENST00000545380|ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000542450;ENST00000543540	.|D;D;D;D;D;T;T	.|0.84370	.|-1.84;-1.84;-1.84;-1.84;-1.84;3.35;3.35	6.17|6.17	6.17|6.17	0.99709|0.99709	.|CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89298|0.89298	0.6675|0.6675	L|L	0.48986|0.48986	1.54|1.54	0.80722|0.80722	D|D	1|1	.|D;D;D;P;D	.|0.76494	.|0.997;0.999;0.997;0.944;0.991	.|D;D;D;D;D	.|0.80764	.|0.99;0.994;0.994;0.923;0.982	T|T	0.81953|0.81953	-0.0697|-0.0697	5|10	.|0.02654	.|T	.|1	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|224;224;225;224;224	.|Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1	.|.;.;.;CADM1_HUMAN;.	E|N	222|224;224;224;224;183;224;77;77	.|ENSP00000439176:H224N;ENSP00000395359:H224N;ENSP00000439817:H224N;ENSP00000440322:H224N;ENSP00000329797:H224N;ENSP00000442001:H77N;ENSP00000439847:H77N	.|ENSP00000329797:H224N	A|H	-|-	2|1	0|0	CADM1|CADM1	114605094|114605094	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.434000|9.434000	0.97515|0.97515	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCA|CAC	.		0.537	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CCDC109B	55013	ucsc.edu;bcgsc.ca	37	4	110581513	110581513	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:110581513T>C	ENST00000394650.4	+	3	471	c.338T>C	c.(337-339)tTc>tCc	p.F113S		NM_017918.4	NP_060388.2	Q9NWR8	MCUB_HUMAN	coiled-coil domain containing 109B	113					mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of membrane (GO:0031224)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium channel inhibitor activity (GO:0019855)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(1)	9				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)		GCAGCCATCTTCACAGCAGGT	0.368																																					p.F113S		.											.	CCDC109B	90	0			c.T338C						.						70.0	62.0	65.0					4																	110581513		2203	4300	6503	SO:0001583	missense	55013	exon3			CCATCTTCACAGC	BC002633	CCDS3683.2	4q25	2011-05-24			ENSG00000005059	ENSG00000005059			26076	protein-coding gene	gene with protein product						12477932	Standard	NM_017918		Approved	FLJ20647	uc011cfs.2	Q9NWR8	OTTHUMG00000161103	ENST00000394650.4:c.338T>C	4.37:g.110581513T>C	ENSP00000378145:p.Phe113Ser	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_017918	A8K4Y3|Q6IAC1	Missense_Mutation	SNP	ENST00000394650.4	37	CCDS3683.2	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904189	0.33628	.	.	ENSG00000005059	ENST00000394650;ENST00000452915	T;T	0.39787	1.56;1.06	5.43	5.43	0.79202	Coiled-coil domain containing protein 109, C-terminal (1);	0.770075	0.12599	N	0.454940	T	0.42017	0.1184	L	0.61036	1.89	0.09310	N	1	B;P	0.41848	0.1;0.763	B;B	0.39738	0.11;0.308	T	0.39440	-0.9614	10	0.42905	T	0.14	-0.3331	9.9224	0.41472	0.0:0.076:0.0:0.924	.	113;92	Q9NWR8;C9JTJ6	C109B_HUMAN;.	S	113;92	ENSP00000378145:F113S;ENSP00000414591:F92S	ENSP00000378145:F113S	F	+	2	0	CCDC109B	110800962	0.708000	0.27876	0.066000	0.19879	0.075000	0.17131	1.855000	0.39378	2.060000	0.61445	0.528000	0.53228	TTC	.		0.368	CCDC109B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254865.1	NM_017918	
CCDC120	90060	ucsc.edu;bcgsc.ca	37	X	48919845	48919845	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:48919845T>C	ENST00000376396.3	+	3	257	c.38T>C	c.(37-39)tTc>tCc	p.F13S	CCDC120_ENST00000536628.2_Intron|CCDC120_ENST00000496529.2_Missense_Mutation_p.F13S|CCDC120_ENST00000597275.1_Missense_Mutation_p.F13S|CCDC120_ENST00000422185.2_Missense_Mutation_p.F13S|CCDC120_ENST00000603986.1_Missense_Mutation_p.F48S	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	13										breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						TCTCCTACCTTCAATGCCCCA	0.587																																					p.F48S		.											.	CCDC120	131	0			c.T143C						.						140.0	90.0	107.0					X																	48919845		2203	4300	6503	SO:0001583	missense	90060	exon3			CTACCTTCAATGC	BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.38T>C	X.37:g.48919845T>C	ENSP00000365577:p.Phe13Ser	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001163321	B4DFC1|B4DTU2|F5GZU4	Missense_Mutation	SNP	ENST00000376396.3	37	CCDS14316.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.003607	0.54254	.	.	ENSG00000147144	ENST00000376396;ENST00000422185	.	.	.	5.51	2.9	0.33743	.	0.331478	0.26369	N	0.024761	T	0.23727	0.0574	N	0.08118	0	0.80722	D	1	B;B	0.33413	0.411;0.411	B;B	0.37015	0.239;0.239	T	0.03259	-1.1055	9	0.21540	T	0.41	-6.0172	4.3536	0.11167	0.4272:0.0:0.1369:0.4359	.	48;13	B4DFC1;Q96HB5	.;CC120_HUMAN	S	13	.	ENSP00000365577:F13S	F	+	2	0	CCDC120	48806789	1.000000	0.71417	0.977000	0.42913	0.928000	0.56348	1.368000	0.34216	0.697000	0.31718	0.356000	0.21956	TTC	.		0.587	CCDC120-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056528.1	NM_033626	
CCDC136	64753	ucsc.edu;bcgsc.ca	37	7	128454946	128454946	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr7:128454946T>C	ENST00000297788.4	+	15	3385	c.3018T>C	c.(3016-3018)acT>acC	p.T1006T	CCDC136_ENST00000471729.1_3'UTR|CCDC136_ENST00000378685.4_Intron|CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000487361.1_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	1006						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						GCTCGGATACTTCTGAGAGCG	0.468																																					p.T1006T		.											.	CCDC136	24	0			c.T3018C						.						48.0	48.0	48.0					7																	128454946		1913	4135	6048	SO:0001819	synonymous_variant	64753	exon15			GGATACTTCTGAG		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.3018T>C	7.37:g.128454946T>C		Somatic	32.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Silent	SNP	ENST00000297788.4	37	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	T	4.303	0.055537	0.08291	.	.	ENSG00000128596	ENST00000494552	.	.	.	5.23	-4.56	0.03431	.	.	.	.	.	T	0.18425	0.0442	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28713	-1.0035	4	.	.	.	1.5538	2.9287	0.05793	0.1134:0.3774:0.2957:0.2135	.	.	.	.	P	883	.	.	L	+	2	0	CCDC136	128242182	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.745000	0.04834	-0.595000	0.05828	0.528000	0.53228	CTT	.		0.468	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CD96	10225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111319663	111319663	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:111319663C>G	ENST00000283285.5	+	8	1168	c.1037C>G	c.(1036-1038)gCc>gGc	p.A346G	CD96_ENST00000352690.4_Missense_Mutation_p.A330G|CD96_ENST00000438817.2_Missense_Mutation_p.A330G	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	346	Ig-like C2-type.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						AATAAACCAGCCCAATCAGAC	0.383									Opitz Trigonocephaly syndrome																												p.A346G		.											.	CD96	93	0			c.C1037G						.						115.0	115.0	115.0					3																	111319663		2203	4300	6503	SO:0001583	missense	10225	exon8	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	AACCAGCCCAATC	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1037C>G	3.37:g.111319663C>G	ENSP00000283285:p.Ala346Gly	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	35.0	NM_198196	Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	37	CCDS2959.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365945	0.24684	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.65916	-0.15;-0.13;-0.18	5.04	2.12	0.27331	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.999489	0.08098	N	0.998280	T	0.45196	0.1330	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.17852	0.024;0.019;0.01;0.01	B;B;B;B	0.19391	0.025;0.015;0.015;0.015	T	0.31861	-0.9928	10	0.26408	T	0.33	-1.9133	5.5991	0.17343	0.0:0.6406:0.1674:0.192	.	330;330;346;330	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	G	330;346;330	ENSP00000342040:A330G;ENSP00000283285:A346G;ENSP00000389801:A330G	ENSP00000283285:A346G	A	+	2	0	CD96	112802353	0.003000	0.15002	0.924000	0.36721	0.820000	0.46376	0.110000	0.15437	0.591000	0.29711	0.650000	0.86243	GCC	.		0.383	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2		
CDC40	51362	ucsc.edu;bcgsc.ca	37	6	110551184	110551184	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:110551184A>G	ENST00000368932.1	+	16	1691	c.1590A>G	c.(1588-1590)ggA>ggG	p.G530G	CDC40_ENST00000307731.1_Silent_p.G530G|CDC40_ENST00000445340.2_Intron|CDC40_ENST00000368930.1_Intron			O60508	PRP17_HUMAN	cell division cycle 40	530					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ATGGAAATGGAAAATTAAACA	0.348																																					p.G530G		.											.	CDC40	90	0			c.A1590G						.						80.0	76.0	77.0					6																	110551184		2203	4300	6503	SO:0001819	synonymous_variant	51362	exon15			AAATGGAAAATTA	AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.1590A>G	6.37:g.110551184A>G		Somatic	77.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_015891	B2RBC5|O75471|Q5SRN0|Q9UPG1	Silent	SNP	ENST00000368932.1	37	CCDS5081.1																																																																																			.		0.348	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041791.1	NM_015891	
CDH2	1000	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	25591881	25591881	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:25591881T>C	ENST00000269141.3	-	4	898	c.475A>G	c.(475-477)Aga>Gga	p.R159G	CDH2_ENST00000399380.3_Missense_Mutation_p.R128G	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	159					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ACCCAGTCTCTCTTCTGCCTT	0.433																																					p.R159G		.											.	CDH2	525	0			c.A475G						.						184.0	166.0	172.0					18																	25591881		2203	4300	6503	SO:0001583	missense	1000	exon4			AGTCTCTCTTCTG	S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.475A>G	18.37:g.25591881T>C	ENSP00000269141:p.Arg159Gly	Somatic	81.0	1.0		WXS	Illumina HiSeq	Phase_I	88.0	33.0	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.611434	0.87258	.	.	ENSG00000170558	ENST00000269141;ENST00000399380;ENST00000418492;ENST00000430882	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.93	5.93	0.95920	Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.64182	0.2575	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.73100	-0.4089	10	0.87932	D	0	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	128;159	A8MWK3;P19022	.;CADH2_HUMAN	G	159;128;108;74	ENSP00000269141:R159G;ENSP00000382312:R128G;ENSP00000411360:R108G;ENSP00000412120:R74G	ENSP00000269141:R159G	R	-	1	2	CDH2	23845879	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.737000	0.62066	2.281000	0.76405	0.533000	0.62120	AGA	.		0.433	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
CDK12	51755	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37619236	37619236	+	Silent	SNP	C	C	G	rs56403491	byFrequency	TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:37619236C>G	ENST00000447079.4	+	1	945	c.912C>G	c.(910-912)ccC>ccG	p.P304P	CDK12_ENST00000430627.2_Silent_p.P304P	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	304					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CTGTCAGTCCCTATAGCAGGA	0.607			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)			C|||	2	0.000399361	0.0008	0.0014	5008	,	,		16533	0.0		0.0	False		,,,				2504	0.0				p.P304P		.		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	CDK12	1055	0			c.C912G						.	C	,	4,4402	8.1+/-20.4	0,4,2199	55.0	56.0	56.0		912,912	-1.9	1.0	17	dbSNP_129	56	37,8563	25.1+/-72.6	0,37,4263	no	coding-synonymous,coding-synonymous	CDK12	NM_015083.1,NM_016507.2	,	0,41,6462	GG,GC,CC		0.4302,0.0908,0.3152	,	304/1482,304/1491	37619236	41,12965	2203	4300	6503	SO:0001819	synonymous_variant	51755	exon1			CAGTCCCTATAGC	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.912C>G	17.37:g.37619236C>G		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	19.0	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Silent	SNP	ENST00000447079.4	37	CCDS11337.1																																																																																			C|0.998;G|0.002		0.607	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
CDK17	5128	ucsc.edu;bcgsc.ca	37	12	96707197	96707197	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:96707197C>T	ENST00000261211.3	-	4	922	c.319G>A	c.(319-321)Ggt>Agt	p.G107S	CDK17_ENST00000542666.1_Missense_Mutation_p.G54S|CDK17_ENST00000543119.2_Missense_Mutation_p.G107S	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	107					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						TCACTCTCACCATCTGATCCC	0.333																																					p.G107S		.											.	CDK17	550	0			c.G319A						.						85.0	79.0	81.0					12																	96707197		2203	4300	6503	SO:0001583	missense	5128	exon4			TCTCACCATCTGA		CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.319G>A	12.37:g.96707197C>T	ENSP00000261211:p.Gly107Ser	Somatic	24.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_001170464	A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	ENST00000261211.3	37	CCDS9061.1	.	.	.	.	.	.	.	.	.	.	C	35	5.482461	0.96307	.	.	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666;ENST00000551816;ENST00000552496;ENST00000548734	T;T;T;T;T;T	0.71341	-0.55;-0.56;-0.5;0.56;0.49;0.21	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.84270	0.5435	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84928	0.0858	10	0.62326	D	0.03	-13.2447	19.5071	0.95124	0.0:1.0:0.0:0.0	.	107;107	A8K1U6;Q00537	.;CDK17_HUMAN	S	107;107;54;107;107;127	ENSP00000261211:G107S;ENSP00000444459:G107S;ENSP00000442926:G54S;ENSP00000450058:G107S;ENSP00000447282:G107S;ENSP00000447441:G127S	ENSP00000261211:G107S	G	-	1	0	CDK17	95231328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.486000	0.81215	2.617000	0.88574	0.557000	0.71058	GGT	.		0.333	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408751.1	NM_002595	
CHD6	84181	ucsc.edu;bcgsc.ca	37	20	40052166	40052166	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:40052166C>T	ENST00000373233.3	-	30	4698	c.4521G>A	c.(4519-4521)cgG>cgA	p.R1507R		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1507					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GACAGACATTCCGGCACATGG	0.423																																					p.R1507R		.											.	CHD6	238	0			c.G4521A						.						245.0	270.0	262.0					20																	40052166		2203	4300	6503	SO:0001819	synonymous_variant	84181	exon30			GACATTCCGGCAC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4521G>A	20.37:g.40052166C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	37	CCDS13317.1																																																																																			.		0.423	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
CNOT1	23019	ucsc.edu;bcgsc.ca	37	16	58612823	58612823	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:58612823T>C	ENST00000317147.5	-	13	1696	c.1364A>G	c.(1363-1365)gAa>gGa	p.E455G	CNOT1_ENST00000569240.1_Missense_Mutation_p.E455G|CNOT1_ENST00000441024.2_Missense_Mutation_p.E455G	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	455					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CAGCAGAGATTCAATCAAATC	0.403																																					p.E455G		.											.	CNOT1	95	0			c.A1364G						.						80.0	81.0	80.0					16																	58612823		2198	4300	6498	SO:0001583	missense	23019	exon13			AGAGATTCAATCA	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1364A>G	16.37:g.58612823T>C	ENSP00000320949:p.Glu455Gly	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.900990	0.92035	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.54479	0.59;0.57	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75932	0.3917	M	0.87758	2.905	0.80722	D	1	D;D;D	0.76494	0.989;0.999;0.999	D;D;D	0.72982	0.979;0.941;0.964	T	0.80002	-0.1565	9	.	.	.	0.3608	15.8755	0.79159	0.0:0.0:0.0:1.0	.	455;455;455	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	G	455	ENSP00000320949:E455G;ENSP00000413113:E455G	.	E	-	2	0	CNOT1	57170324	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.027000	0.88791	2.154000	0.67381	0.454000	0.30748	GAA	.		0.403	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CPNE9	151835	ucsc.edu;bcgsc.ca	37	3	9756640	9756640	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:9756640G>A	ENST00000383832.3	+	11	882		c.e11+1		CPNE9_ENST00000383831.3_Splice_Site	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					GGGATGGAAGGTAGAACTGCC	0.463																																					.		.											.	CPNE9	70	0			c.692+1G>A						.						170.0	164.0	166.0					3																	9756640		1977	4150	6127	SO:0001630	splice_region_variant	151835	exon10			TGGAAGGTAGAAC		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.692+1G>A	3.37:g.9756640G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_153635	A1L430|A6NDX6|A8MSP8	Splice_Site	SNP	ENST00000383832.3	37	CCDS2574.2	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282008	0.40394	.	.	ENSG00000144550	ENST00000383832;ENST00000383831	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.714	0.85393	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPNE9	9731640	1.000000	0.71417	1.000000	0.80357	0.239000	0.25481	9.767000	0.98960	2.049000	0.60858	0.313000	0.20887	.	.		0.463	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250205.4	NM_001033755	Intron
COL8A1	1295	ucsc.edu;bcgsc.ca	37	3	99514406	99514406	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:99514406G>T	ENST00000261037.3	+	5	2041	c.1661G>T	c.(1660-1662)gGc>gTc	p.G554V	COL8A1_ENST00000273342.4_Missense_Mutation_p.G554V	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	554	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						GGTCCTCAAGGCCAGCCTGGC	0.677																																					p.G554V		.											.	COL8A1	90	0			c.G1661T						.						21.0	23.0	22.0					3																	99514406		2203	4299	6502	SO:0001583	missense	1295	exon5			CTCAAGGCCAGCC	AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.1661G>T	3.37:g.99514406G>T	ENSP00000261037:p.Gly554Val	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_001850	D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	ENST00000261037.3	37	CCDS2934.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964532	0.53507	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.99637	-6.29;-6.29	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	H	0.99238	4.48	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96660	0.9488	10	0.87932	D	0	.	17.2855	0.87140	0.0:0.0:1.0:0.0	.	555;554	E7EPK9;P27658	.;CO8A1_HUMAN	V	554	ENSP00000261037:G554V;ENSP00000273342:G554V	ENSP00000261037:G554V	G	+	2	0	COL8A1	100997096	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.406000	0.97321	2.688000	0.91661	0.563000	0.77884	GGC	.		0.677	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309001.1	NM_001850	
CPXM2	119587	ucsc.edu;bcgsc.ca	37	10	125601903	125601903	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:125601903G>A	ENST00000241305.3	-	4	769	c.615C>T	c.(613-615)ttC>ttT	p.F205F	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	205	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		TGACACCAGTGAATCTGGTCA	0.517																																					p.F205F		.											.	CPXM2	92	0			c.C615T						.						103.0	101.0	101.0					10																	125601903		2203	4300	6503	SO:0001819	synonymous_variant	119587	exon4			ACCAGTGAATCTG	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.615C>T	10.37:g.125601903G>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_198148	B4E3Q2	Silent	SNP	ENST00000241305.3	37	CCDS7637.1																																																																																			.		0.517	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
CRB1	23418	ucsc.edu;bcgsc.ca	37	1	197390976	197390976	+	Missense_Mutation	SNP	A	A	G	rs145956521		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:197390976A>G	ENST00000367400.3	+	6	2153	c.2018A>G	c.(2017-2019)aAg>aGg	p.K673R	CRB1_ENST00000367399.2_Missense_Mutation_p.K561R|CRB1_ENST00000544212.1_Missense_Mutation_p.K154R|CRB1_ENST00000538660.1_Missense_Mutation_p.K673R|CRB1_ENST00000367397.1_Missense_Mutation_p.K54R|CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.K604R	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	673	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGTGTGAGAAAGGATTGGTGT	0.483													A|||	1	0.000199681	0.0008	0.0	5008	,	,		20508	0.0		0.0	False		,,,				2504	0.0				p.K673R		.											.	CRB1	161	0			c.A2018G						.	A	ARG/LYS,ARG/LYS	1,4405	2.1+/-5.4	0,1,2202	112.0	108.0	109.0		1682,2018	3.5	0.4	1	dbSNP_134	109	0,8600		0,0,4300	no	missense,missense	CRB1	NM_001193640.1,NM_201253.2	26,26	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging,probably-damaging	561/1295,673/1407	197390976	1,13005	2203	4300	6503	SO:0001583	missense	23418	exon6			TGAGAAAGGATTG		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2018A>G	1.37:g.197390976A>G	ENSP00000356370:p.Lys673Arg	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_001257966	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	A	5.434	0.265290	0.10294	2.27E-4	0.0	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	5.8	3.47	0.39725	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.69593	0.3128	N	0.03967	-0.31	0.25119	N	0.990651	B;P;D;B;D	0.76494	0.324;0.472;0.999;0.016;0.998	B;B;D;B;D	0.80764	0.109;0.151;0.994;0.024;0.989	T	0.59204	-0.7498	9	0.16420	T	0.52	.	8.4843	0.33063	0.7192:0.0:0.2808:0.0	.	673;604;561;322;673	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	R	604;673;673;561;154;54;322	ENSP00000438786:K604R;ENSP00000438091:K673R;ENSP00000356370:K673R;ENSP00000356369:K561R;ENSP00000444556:K154R;ENSP00000356367:K54R	ENSP00000356367:K54R	K	+	2	0	CRB1	195657599	1.000000	0.71417	0.449000	0.26957	0.006000	0.05464	1.579000	0.36536	0.451000	0.26802	-0.297000	0.09499	AAG	A|1.000;G|0.000		0.483	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
CST6	1474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65780325	65780325	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:65780325C>A	ENST00000312134.2	+	2	473	c.269C>A	c.(268-270)aCg>aAg	p.T90K		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	90					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TACTTCCTGACGATGGAGATG	0.602																																					p.T90K		.											.	CST6	523	0			c.C269A						.						80.0	66.0	71.0					11																	65780325		2201	4296	6497	SO:0001583	missense	1474	exon2			TCCTGACGATGGA	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.269C>A	11.37:g.65780325C>A	ENSP00000311313:p.Thr90Lys	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	25.0	NM_001323	Q540N7	Missense_Mutation	SNP	ENST00000312134.2	37	CCDS8126.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529899	0.45073	.	.	ENSG00000175315	ENST00000312134	T	0.24538	1.85	5.66	2.77	0.32553	Proteinase inhibitor I25, cystatin, conserved site (1);Proteinase inhibitor I25, cystatin (2);	0.124523	0.52532	D	0.000071	T	0.23572	0.0570	L	0.58669	1.825	0.24883	N	0.992218	P	0.41420	0.749	B	0.42188	0.379	T	0.09015	-1.0694	10	0.30854	T	0.27	-17.3569	5.4001	0.16291	0.1613:0.6795:0.0:0.1592	.	90	Q15828	CYTM_HUMAN	K	90	ENSP00000311313:T90K	ENSP00000311313:T90K	T	+	2	0	CST6	65536901	0.591000	0.26824	0.190000	0.23270	0.220000	0.24768	0.865000	0.27940	0.327000	0.23409	0.563000	0.77884	ACG	.		0.602	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
CUL7	9820	ucsc.edu;bcgsc.ca	37	6	43016296	43016296	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:43016296G>T	ENST00000265348.3	-	8	1922	c.1837C>A	c.(1837-1839)Cca>Aca	p.P613T	CUL7_ENST00000535468.1_Missense_Mutation_p.P697T|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	613					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CTCTGAGATGGGGGTTCTTTT	0.498																																					p.P697T		.											.	CUL7	229	0			c.C2089A						.						33.0	35.0	35.0					6																	43016296		2199	4295	6494	SO:0001583	missense	9820	exon8			GAGATGGGGGTTC	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.1837C>A	6.37:g.43016296G>T	ENSP00000265348:p.Pro613Thr	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001168370	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350161	0.41599	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.78707	-1.19;-1.2	5.13	4.23	0.50019	.	5.701370	0.00649	U	0.000559	T	0.58235	0.2108	L	0.39898	1.24	0.21950	N	0.999452	B;B	0.23249	0.082;0.004	B;B	0.21917	0.037;0.005	T	0.50642	-0.8804	10	0.59425	D	0.04	-15.9248	10.2458	0.43341	0.0:0.0:0.7754:0.2246	.	697;613	F5H0L1;Q14999	.;CUL7_HUMAN	T	613;697	ENSP00000265348:P613T;ENSP00000438788:P697T	ENSP00000265348:P613T	P	-	1	0	CUL7	43124274	0.018000	0.18449	0.363000	0.25875	0.363000	0.29612	0.913000	0.28611	1.322000	0.45245	0.655000	0.94253	CCA	.		0.498	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
CUL9	23113	ucsc.edu;bcgsc.ca	37	6	43174080	43174080	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:43174080G>T	ENST00000252050.4	+	26	5128	c.5044G>T	c.(5044-5046)Gct>Tct	p.A1682S	CUL9_ENST00000354495.3_Missense_Mutation_p.A1572S|CUL9_ENST00000372647.2_Missense_Mutation_p.A1682S	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1682	Glu-rich.				microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GGAAGAGGAAGCTGAGAAAGA	0.522																																					p.A1682S		.											.	CUL9	529	0			c.G5044T						.						96.0	97.0	96.0					6																	43174080		2203	4300	6503	SO:0001583	missense	23113	exon26			GAGGAAGCTGAGA	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5044G>T	6.37:g.43174080G>T	ENSP00000252050:p.Ala1682Ser	Somatic	24.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	1.990	-0.432088	0.04669	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.79845	-1.31;-1.31;-1.31	5.35	-4.42	0.03579	Cullin, N-terminal (1);Cullin homology (2);	1.082070	0.07275	N	0.869765	T	0.27731	0.0682	N	0.08118	0	0.09310	N	0.999998	B;B;B	0.28933	0.228;0.042;0.042	B;B;B	0.28385	0.083;0.089;0.089	T	0.16247	-1.0409	10	0.10111	T	0.7	-0.0256	1.4549	0.02383	0.4538:0.1796:0.1712:0.1954	.	1572;1682;1682	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	S	1682;1572;1682	ENSP00000252050:A1682S;ENSP00000346490:A1572S;ENSP00000361730:A1682S	ENSP00000252050:A1682S	A	+	1	0	CUL9	43282058	0.992000	0.36948	0.083000	0.20561	0.664000	0.39144	1.284000	0.33249	-0.625000	0.05604	-0.136000	0.14681	GCT	.		0.522	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
ZMYND15	84225	ucsc.edu;bcgsc.ca	37	17	4642567	4642567	+	5'Flank	SNP	A	A	G	rs143565057		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:4642567A>G	ENST00000433935.1	+	0	0				ZMYND15_ENST00000573751.2_5'Flank|CXCL16_ENST00000293778.6_Missense_Mutation_p.L42P|CXCL16_ENST00000574412.1_Missense_Mutation_p.L42P|CXCL16_ENST00000576153.1_5'Flank|ZMYND15_ENST00000269289.6_5'Flank|ZMYND15_ENST00000592813.1_5'Flank	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15						negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						TGGCTGAGTCAGGTACACCAG	0.697																																					p.L42P		.											.	CXCL16	226	0			c.T125C						.	A	PRO/LEU,PRO/LEU	0,4388		0,0,2194	18.0	23.0	21.0		125,125	0.0	0.0	17	dbSNP_134	21	1,8591		0,1,4295	no	missense,missense	CXCL16	NM_001100812.1,NM_022059.2	98,98	0,1,6489	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging	42/274,42/274	4642567	1,12979	2194	4296	6490	SO:0001631	upstream_gene_variant	58191	exon1			TGAGTCAGGTACA	AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760		17.37:g.4642567A>G	Exception_encountered	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	43.0	5.0	NM_022059	B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	37	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	A	13.12	2.142807	0.37825	0.0	1.16E-4	ENSG00000161921	ENST00000293778	T	0.53857	0.6	3.59	0.0306	0.14168	.	0.796481	0.10269	N	0.694993	T	0.56093	0.1962	L	0.48642	1.525	0.20638	N	0.999878	D	0.76494	0.999	D	0.67382	0.951	T	0.43196	-0.9406	10	0.33141	T	0.24	-1.6118	2.93	0.05796	0.5017:0.0:0.1116:0.3868	.	23	Q9H2A7	CXL16_HUMAN	P	42	ENSP00000293778:L42P	ENSP00000293778:L42P	L	-	2	0	CXCL16	4589316	0.046000	0.20272	0.000000	0.03702	0.001000	0.01503	1.182000	0.32029	-0.043000	0.13513	-0.531000	0.04308	CTG	A|1.000;G|0.000		0.697	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265	
CYBA	1535	ucsc.edu;bcgsc.ca	37	16	88713203	88713203	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:88713203A>G	ENST00000261623.3	-	4	385	c.247T>C	c.(247-249)Ttt>Ctt	p.F83L	CYBA_ENST00000569359.1_Missense_Mutation_p.F83L|CYBA_ENST00000561972.1_5'Flank|CYBA_ENST00000567174.1_Missense_Mutation_p.F83L	NM_000101.3	NP_000092.2	P13498	CY24A_HUMAN	cytochrome b-245, alpha polypeptide	83					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to amino acid stimulus (GO:0071230)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|cytochrome complex assembly (GO:0017004)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|negative regulation of glomerular filtration by angiotensin (GO:0003106)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of cell growth (GO:0030307)|positive regulation of endothelial cell proliferation (GO:0001938)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|response to nutrient levels (GO:0031667)|smooth muscle hypertrophy (GO:0014895)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|secretory granule (GO:0030141)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activity (GO:0016175)			endometrium(1)|liver(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0478)	Dextromethorphan(DB00514)	TTCCTGGTAAAGGGCCCGAAC	0.657																																					p.F83L		.											.	CYBA	90	0			c.T247C						.						87.0	96.0	93.0					16																	88713203		2198	4300	6498	SO:0001583	missense	1535	exon4			TGGTAAAGGGCCC		CCDS32504.1	16q24	2014-09-17				ENSG00000051523		"""Cytochrome b genes"""	2577	protein-coding gene	gene with protein product	"""flavocytochrome b-558 alpha polypeptide"""	608508				2243141	Standard	NM_000101		Approved	p22-PHOX	uc002flb.4	P13498		ENST00000261623.3:c.247T>C	16.37:g.88713203A>G	ENSP00000261623:p.Phe83Leu	Somatic	21.0	0.0		WXS	Illumina HiSeq	.	16.0	4.0	NM_000101	Q14090|Q9BR72	Missense_Mutation	SNP	ENST00000261623.3	37	CCDS32504.1	.	.	.	.	.	.	.	.	.	.	A	4.423	0.078176	0.08485	.	.	ENSG00000051523	ENST00000261623	T	0.81163	-1.46	4.46	2.47	0.30058	.	0.370350	0.27668	N	0.018344	T	0.35189	0.0923	N	0.00066	-2.3	0.21802	N	0.999535	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.51364	-0.8715	10	0.02654	T	1	-30.7152	8.9105	0.35550	0.1807:0.0:0.8193:0.0	.	19;83	B4DT46;P13498	.;CY24A_HUMAN	L	83	ENSP00000261623:F83L	ENSP00000261623:F83L	F	-	1	0	CYBA	87240704	0.983000	0.35010	0.808000	0.32385	0.817000	0.46193	1.467000	0.35321	0.335000	0.23614	-0.357000	0.07601	TTT	.		0.657	CYBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422765.1	NM_000101	
CYP4Z1	199974	ucsc.edu;bcgsc.ca	37	1	47533245	47533245	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:47533245A>G	ENST00000334194.3	+	1	86	c.83A>G	c.(82-84)cAg>cGg	p.Q28R		NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	28						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						CTGCTGTTTCAGGTAATCAGG	0.547																																					p.Q28R		.											.	CYP4Z1	91	0			c.A83G						.						83.0	76.0	78.0					1																	47533245		2203	4300	6503	SO:0001583	missense	199974	exon1			TGTTTCAGGTAAT	AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.83A>G	1.37:g.47533245A>G	ENSP00000334246:p.Gln28Arg	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	52.0	4.0	NM_178134	Q5VVE4	Missense_Mutation	SNP	ENST00000334194.3	37	CCDS545.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.089004	0.36855	.	.	ENSG00000186160	ENST00000334194	T	0.69435	-0.4	3.1	3.1	0.35709	.	0.159187	0.28493	U	0.015145	T	0.59348	0.2187	N	0.08118	0	0.19300	N	0.99998	D	0.63880	0.993	D	0.72982	0.979	T	0.48514	-0.9029	10	0.28530	T	0.3	.	7.6568	0.28379	1.0:0.0:0.0:0.0	.	28	Q86W10	CP4Z1_HUMAN	R	28	ENSP00000334246:Q28R	ENSP00000334246:Q28R	Q	+	2	0	CYP4Z1	47305832	0.982000	0.34865	0.678000	0.29963	0.256000	0.26092	4.263000	0.58853	1.274000	0.44362	0.378000	0.23410	CAG	.		0.547	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022020.1	NM_178134	
DCK	1633	ucsc.edu;bcgsc.ca	37	4	71888086	71888086	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:71888086A>G	ENST00000286648.5	+	3	607	c.210A>G	c.(208-210)gaA>gaG	p.E70E	DCK_ENST00000504952.1_Silent_p.E70E|MOB1B_ENST00000511449.1_3'UTR|DCK_ENST00000504730.1_Silent_p.E70E	NM_000788.2	NP_000779.1	P27707	DCK_HUMAN	deoxycytidine kinase	70					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxycytidine kinase activity (GO:0004137)|drug binding (GO:0008144)|nucleoside kinase activity (GO:0019206)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)	9			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Cytarabine(DB00987)|Decitabine(DB01262)|Emtricitabine(DB00879)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Lamivudine(DB00709)|Nelarabine(DB01280)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	CAAAATAGGAACTTACAATGT	0.308																																					p.E70E		.											.	DCK	116	0			c.A210G						.						77.0	76.0	76.0					4																	71888086		2203	4300	6503	SO:0001819	synonymous_variant	1633	exon3			ATAGGAACTTACA	M60527	CCDS3548.1	4q13.3-q21.1	2008-02-05			ENSG00000156136	ENSG00000156136	2.7.1.74		2704	protein-coding gene	gene with protein product		125450				8406512	Standard	NM_000788		Approved		uc003hfx.3	P27707	OTTHUMG00000129908	ENST00000286648.5:c.210A>G	4.37:g.71888086A>G		Somatic	63.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_000788	B2R8V6|Q5TZY7|Q6FI11	Silent	SNP	ENST00000286648.5	37	CCDS3548.1																																																																																			.		0.308	DCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252159.2		
DCX	1641	ucsc.edu;bcgsc.ca	37	X	110644538	110644538	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:110644538A>G	ENST00000338081.3	-	3	799	c.628T>C	c.(628-630)Tca>Cca	p.S210P	DCX_ENST00000496551.1_5'UTR|DCX_ENST00000371993.2_Missense_Mutation_p.S129P|DCX_ENST00000356220.3_Missense_Mutation_p.S129P|DCX_ENST00000488120.1_Missense_Mutation_p.S129P|DCX_ENST00000356915.2_Missense_Mutation_p.S129P	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	210	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						AAGTTGTCTGAGGAACAGACA	0.383																																					p.S210P		.											.	DCX	554	0			c.T628C						.						85.0	82.0	83.0					X																	110644538		2203	4300	6503	SO:0001583	missense	1641	exon3			TGTCTGAGGAACA	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.628T>C	X.37:g.110644538A>G	ENSP00000337697:p.Ser210Pro	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_000555	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	ENST00000338081.3	37	CCDS14556.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.123177	0.77436	.	.	ENSG00000077279	ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120	D;D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17;-3.17	4.74	4.74	0.60224	Doublecortin domain (5);	0.309163	0.31495	N	0.007547	D	0.97145	0.9067	M	0.91090	3.175	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.993	D	0.97735	1.0205	10	0.59425	D	0.04	.	13.9428	0.64066	1.0:0.0:0.0:0.0	.	198;210	B4DM53;O43602	.;DCX_HUMAN	P	129;129;210;129;129	ENSP00000349385:S129P;ENSP00000361061:S129P;ENSP00000337697:S210P;ENSP00000348553:S129P;ENSP00000419861:S129P	ENSP00000337697:S210P	S	-	1	0	DCX	110531194	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.315000	0.96313	1.826000	0.53198	0.486000	0.48141	TCA	.		0.383	DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357058.1	NM_178153	
DNHD1	144132	ucsc.edu;bcgsc.ca	37	11	6579218	6579218	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:6579218A>G	ENST00000527990.2	+	23	8693	c.8693A>G	c.(8692-8694)cAc>cGc	p.H2898R	DNHD1_ENST00000254579.6_Missense_Mutation_p.H2898R			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	2898					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ACTGGGCGCCACACTGCCATC	0.617																																					p.H2898R		.											.	DNHD1	24	0			c.A8693G						.						48.0	37.0	40.0					11																	6579218		692	1591	2283	SO:0001583	missense	144132	exon25			GGCGCCACACTGC	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.8693A>G	11.37:g.6579218A>G	ENSP00000436180:p.His2898Arg	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	53.0	4.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	A	0.072	-1.200583	0.01581	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000534210	T;T	0.23950	1.88;1.88	5.6	-2.84	0.05751	.	.	.	.	.	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.39187	-0.9626	9	0.02654	T	1	.	12.5037	0.55970	0.6021:0.0:0.3979:0.0	.	2898;645	Q96M86;E9PHZ7	DNHD1_HUMAN;.	R	2898;2898;645	ENSP00000254579:H2898R;ENSP00000436180:H2898R	ENSP00000254579:H2898R	H	+	2	0	DNHD1	6535794	0.000000	0.05858	0.213000	0.23690	0.942000	0.58702	-0.265000	0.08644	-0.983000	0.03511	0.528000	0.53228	CAC	.		0.617	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
DOCK3	1795	ucsc.edu;bcgsc.ca	37	3	51395251	51395251	+	Silent	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:51395251C>A	ENST00000266037.9	+	45	4769	c.4746C>A	c.(4744-4746)ctC>ctA	p.L1582L		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1582	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCACCCAGCTCAAGGAGCTTA	0.502																																					p.L1582L		.											.	DOCK3	22	0			c.C4746A						.						101.0	96.0	98.0					3																	51395251		1967	4164	6131	SO:0001819	synonymous_variant	1795	exon45			CCAGCTCAAGGAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4746C>A	3.37:g.51395251C>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_004947	O15017	Silent	SNP	ENST00000266037.9	37	CCDS46835.1																																																																																			.		0.502	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
EIF3M	10480	ucsc.edu;bcgsc.ca	37	11	32610277	32610277	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:32610277T>C	ENST00000531120.1	+	3	376	c.313T>C	c.(313-315)Ttg>Ctg	p.L105L	EIF3M_ENST00000524896.1_Intron	NM_006360.4	NP_006351.2			eukaryotic translation initiation factor 3, subunit M											breast(3)|endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16	Breast(20;0.109)					GAGACTGCAGTTGTAAGTTAA	0.413																																					p.L105L		.											.	EIF3M	155	0			c.T313C						.						137.0	131.0	133.0					11																	32610277		2202	4299	6501	SO:0001630	splice_region_variant	10480	exon3			CTGCAGTTGTAAG	AK131064	CCDS7880.1	11p13	2012-12-13	2007-07-27	2007-07-27	ENSG00000149100	ENSG00000149100			24460	protein-coding gene	gene with protein product	"""transport and golgi organization 7 homolog (Drosophila)"""	609641	"""PCI domain containing 1 (herpesvirus entry mediator)"""	PCID1		15919898, 15919899	Standard	NM_006360		Approved	hfl-B5, FLJ29030, GA17, eIF3m, TANGO7	uc001mtu.4	Q7L2H7	OTTHUMG00000166258	ENST00000531120.1:c.314+1T>C	11.37:g.32610277T>C		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_006360		Silent	SNP	ENST00000531120.1	37	CCDS7880.1																																																																																			.		0.413	EIF3M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388762.2	NM_006360	Silent
EPHA7	2045	ucsc.edu;bcgsc.ca	37	6	93973601	93973601	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:93973601C>T	ENST00000369303.4	-	9	1959	c.1775G>A	c.(1774-1776)gGc>gAc	p.G592D		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	592					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CTCTTCATCGCCTTCTTGGTC	0.323																																					p.G592D		.											.	EPHA7	1453	0			c.G1775A						.						121.0	120.0	120.0					6																	93973601		2203	4300	6503	SO:0001583	missense	2045	exon9			TCATCGCCTTCTT	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1775G>A	6.37:g.93973601C>T	ENSP00000358309:p.Gly592Asp	Somatic	21.0	0.0		WXS	Illumina HiSeq	.	14.0	4.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.947691	0.53186	.	.	ENSG00000135333	ENST00000369303	T	0.09723	2.95	5.55	5.55	0.83447	.	0.062472	0.64402	D	0.000006	T	0.18257	0.0438	L	0.53249	1.67	0.80722	D	1	D;P;P	0.76494	0.999;0.818;0.722	D;B;B	0.66847	0.947;0.394;0.221	T	0.02588	-1.1137	10	0.19590	T	0.45	.	19.4933	0.95060	0.0:1.0:0.0:0.0	.	592;587;592	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	D	592	ENSP00000358309:G592D	ENSP00000358309:G592D	G	-	2	0	EPHA7	94030322	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.863000	0.69568	2.602000	0.87976	0.650000	0.86243	GGC	.		0.323	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
EPHB2	2048	ucsc.edu;bcgsc.ca	37	1	23232519	23232519	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:23232519A>T	ENST00000400191.3	+	10	1823	c.1805A>T	c.(1804-1806)tAc>tTc	p.Y602F	EPHB2_ENST00000374627.1_Missense_Mutation_p.Y597F|EPHB2_ENST00000374632.3_Missense_Mutation_p.Y603F|EPHB2_ENST00000374630.3_Missense_Mutation_p.Y602F	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	602					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CCTTTCACCTACGAGGACCCC	0.512																																					p.Y603F		.											.	EPHB2	1381	0			c.A1808T						.						97.0	88.0	91.0					1																	23232519		2203	4300	6503	SO:0001583	missense	2048	exon10			TCACCTACGAGGA	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1805A>T	1.37:g.23232519A>T	ENSP00000383053:p.Tyr602Phe	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37		.	.	.	.	.	.	.	.	.	.	A	26.0	4.699093	0.88830	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	5.01	5.01	0.66863	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.66317	0.2777	M	0.90082	3.085	0.80722	D	1	B;D;D;D	0.89917	0.062;0.999;0.999;1.0	B;D;D;D	0.91635	0.029;0.998;0.998;0.999	T	0.74080	-0.3780	10	0.72032	D	0.01	.	14.0348	0.64638	1.0:0.0:0.0:0.0	.	544;602;620;603	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	F	544;602;602;603;597	ENSP00000363761:Y602F;ENSP00000383053:Y602F;ENSP00000363763:Y603F;ENSP00000363758:Y597F	ENSP00000363755:Y544F	Y	+	2	0	EPHB2	23105106	1.000000	0.71417	0.941000	0.38009	0.837000	0.47467	9.087000	0.94110	2.239000	0.73571	0.524000	0.50904	TAC	.		0.512	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
EPHB2	2048	ucsc.edu;bcgsc.ca	37	1	23234452	23234452	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:23234452G>A	ENST00000400191.3	+	12	2161	c.2143G>A	c.(2143-2145)Gat>Aat	p.D715N	EPHB2_ENST00000374627.1_Missense_Mutation_p.D710N|EPHB2_ENST00000374632.3_Missense_Mutation_p.D716N|EPHB2_ENST00000374630.3_Missense_Mutation_p.D715N	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	715	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AAAGCAAAACGATGGGCAGTT	0.537																																					p.D716N		.											.	EPHB2	1381	0			c.G2146A						.						136.0	134.0	134.0					1																	23234452		2203	4300	6503	SO:0001583	missense	2048	exon12			CAAAACGATGGGC	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2143G>A	1.37:g.23234452G>A	ENSP00000383053:p.Asp715Asn	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37		.	.	.	.	.	.	.	.	.	.	G	34	5.350499	0.95830	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.32	5.32	0.75619	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61850	0.2380	N	0.17631	0.505	0.80722	D	1	P;D;D;D	0.61697	0.938;0.99;0.982;0.977	B;P;P;P	0.61477	0.359;0.889;0.844;0.825	T	0.66571	-0.5890	10	0.87932	D	0	.	17.7989	0.88580	0.0:0.0:1.0:0.0	.	657;715;733;716	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	N	657;715;715;716;710	ENSP00000363761:D715N;ENSP00000383053:D715N;ENSP00000363763:D716N;ENSP00000363758:D710N	ENSP00000363755:D657N	D	+	1	0	EPHB2	23107039	1.000000	0.71417	0.709000	0.30452	0.903000	0.53119	9.614000	0.98353	2.778000	0.95560	0.650000	0.86243	GAT	.		0.537	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
EPS8L3	79574	ucsc.edu;bcgsc.ca	37	1	110301155	110301155	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:110301155G>T	ENST00000361965.4	-	7	698	c.592C>A	c.(592-594)Cta>Ata	p.L198I	EPS8L3_ENST00000494151.1_5'UTR|RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000361852.4_Missense_Mutation_p.L198I|EPS8L3_ENST00000369805.3_Missense_Mutation_p.L199I	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	198	Pro-rich.					cytoplasm (GO:0005737)		p.L199I(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		CTGTGCTCTAGGGTCCTCTGG	0.572																																					p.L199I		.											.	EPS8L3	93	1	Substitution - Missense(1)	breast(1)	c.C595A						.						73.0	68.0	69.0					1																	110301155		2203	4300	6503	SO:0001583	missense	79574	exon7			GCTCTAGGGTCCT	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.592C>A	1.37:g.110301155G>T	ENSP00000355255:p.Leu198Ile	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_139053	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.986470	0.35036	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.60424	2.56;0.19;0.19	5.13	3.2	0.36748	.	3.135340	0.00866	N	0.001970	T	0.18299	0.0439	N	0.08118	0	0.09310	N	1	B;B;B;B	0.23990	0.028;0.095;0.072;0.004	B;B;B;B	0.20955	0.014;0.032;0.019;0.003	T	0.10894	-1.0610	10	0.35671	T	0.21	-2.426	7.7854	0.29089	0.0895:0.1622:0.7484:0.0	.	198;198;198;199	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	I	198;199;198	ENSP00000354551:L198I;ENSP00000358820:L199I;ENSP00000355255:L198I	ENSP00000354551:L198I	L	-	1	2	EPS8L3	110102678	0.069000	0.21087	0.108000	0.21378	0.720000	0.41350	0.415000	0.21181	0.634000	0.30469	0.561000	0.74099	CTA	.		0.572	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526	
EVC2	132884	ucsc.edu;bcgsc.ca	37	4	5620323	5620323	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:5620323T>C	ENST00000344408.5	-	15	2641	c.2588A>G	c.(2587-2589)gAc>gGc	p.D863G	EVC2_ENST00000310917.2_Missense_Mutation_p.D783G|EVC2_ENST00000344938.1_Missense_Mutation_p.D863G	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	863					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CAAGCTCCTGTCCATCTGAGC	0.592																																					p.D863G		.											.	EVC2	155	0			c.A2588G						.						41.0	38.0	39.0					4																	5620323		2203	4300	6503	SO:0001583	missense	132884	exon15			CTCCTGTCCATCT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2588A>G	4.37:g.5620323T>C	ENSP00000342144:p.Asp863Gly	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	T	22.3	4.265966	0.80358	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	D;D;D	0.82803	-1.64;-1.64;-1.65	5.3	5.3	0.74995	.	0.049324	0.85682	D	0.000000	D	0.86552	0.5960	L	0.36672	1.1	0.47276	D	0.999377	D	0.89917	1.0	D	0.83275	0.996	D	0.87814	0.2633	10	0.72032	D	0.01	-38.4177	13.1878	0.59691	0.0:0.0:0.0:1.0	.	863	Q86UK5	LBN_HUMAN	G	863;783;863	ENSP00000339954:D863G;ENSP00000311683:D783G;ENSP00000342144:D863G	ENSP00000311683:D783G	D	-	2	0	EVC2	5671224	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.471000	0.60182	2.013000	0.59113	0.533000	0.62120	GAC	.		0.592	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
EXOG	9941	ucsc.edu;bcgsc.ca	37	3	38565778	38565778	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:38565778G>T	ENST00000287675.5	+	6	1128	c.1032G>T	c.(1030-1032)atG>atT	p.M344I	EXOG_ENST00000422077.2_Missense_Mutation_p.M294I|EXOG_ENST00000358249.2_Intron	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	344					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.M344I(1)		central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						ATTACTTTATGAGTCGCTATG	0.408																																					p.M344I		.											.	EXOG	90	1	Substitution - Missense(1)	skin(1)	c.G1032T						.						59.0	61.0	60.0					3																	38565778		2203	4300	6503	SO:0001583	missense	9941	exon6			CTTTATGAGTCGC	AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.1032G>T	3.37:g.38565778G>T	ENSP00000287675:p.Met344Ile	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_005107	A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Missense_Mutation	SNP	ENST00000287675.5	37	CCDS2680.1	.	.	.	.	.	.	.	.	.	.	G	9.932	1.215170	0.22373	.	.	ENSG00000157036	ENST00000287675;ENST00000422077	T;T	0.39997	1.05;1.05	5.54	3.38	0.38709	.	0.808990	0.11589	N	0.548980	T	0.27559	0.0677	L	0.34521	1.04	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.09377	0.004;0.002	T	0.06552	-1.0820	10	0.12103	T	0.63	-5.7117	6.9262	0.24416	0.0805:0.1452:0.6602:0.1141	.	294;344	Q9Y2C4-4;Q9Y2C4	.;EXOG_HUMAN	I	344;294	ENSP00000287675:M344I;ENSP00000404305:M294I	ENSP00000287675:M344I	M	+	3	0	EXOG	38540782	0.021000	0.18746	0.787000	0.31911	0.997000	0.91878	0.003000	0.13083	1.581000	0.49865	0.655000	0.94253	ATG	.		0.408	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254063.2	NM_005107	
FAM160B1	57700	ucsc.edu;bcgsc.ca	37	10	116593104	116593104	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:116593104G>A	ENST00000369248.4	+	3	572	c.237G>A	c.(235-237)atG>atA	p.M79I	FAM160B1_ENST00000369250.3_Missense_Mutation_p.M79I|FAM160B1_ENST00000369246.1_Missense_Mutation_p.M79I	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	79										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						GGCCATGTATGGAATATTTGC	0.408																																					p.M79I		.											.	FAM160B1	91	0			c.G237A						.						147.0	142.0	144.0					10																	116593104		2203	4300	6503	SO:0001583	missense	57700	exon3			ATGTATGGAATAT	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.237G>A	10.37:g.116593104G>A	ENSP00000358251:p.Met79Ile	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	37	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276670	0.80580	.	.	ENSG00000151553	ENST00000369248;ENST00000369250;ENST00000369246	T;T;T	0.61040	0.14;0.14;1.4	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.71031	0.3292	M	0.65498	2.005	0.80722	D	1	P;P	0.49862	0.929;0.875	P;P	0.53593	0.729;0.73	T	0.71513	-0.4570	10	0.62326	D	0.03	-34.5249	20.3593	0.98849	0.0:0.0:1.0:0.0	.	79;79	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	I	79	ENSP00000358251:M79I;ENSP00000358253:M79I;ENSP00000358249:M79I	ENSP00000358249:M79I	M	+	3	0	FAM160B1	116583094	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.714000	0.98744	2.822000	0.97130	0.557000	0.71058	ATG	.		0.408	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
FAM47A	158724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	34149594	34149594	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:34149594C>A	ENST00000346193.3	-	1	853	c.802G>T	c.(802-804)Gat>Tat	p.D268Y		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	268										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CTCTCAGAATCCAGTTTCAGC	0.587																																					p.D268Y		.											.	FAM47A	134	0			c.G802T						.						31.0	32.0	32.0					X																	34149594		2198	4299	6497	SO:0001583	missense	158724	exon1			CAGAATCCAGTTT	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.802G>T	X.37:g.34149594C>A	ENSP00000345029:p.Asp268Tyr	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	56.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	12.20	1.865190	0.32977	.	.	ENSG00000185448	ENST00000346193	T	0.22336	1.96	0.13	0.13	0.14746	.	.	.	.	.	T	0.27349	0.0671	L	0.39898	1.24	0.09310	N	0.999997	D	0.58268	0.982	P	0.58660	0.843	T	0.12656	-1.0539	8	0.59425	D	0.04	.	.	.	.	.	268	Q5JRC9	FA47A_HUMAN	Y	268	ENSP00000345029:D268Y	ENSP00000345029:D268Y	D	-	1	0	FAM47A	34059515	0.766000	0.28496	0.419000	0.26584	0.420000	0.31355	0.421000	0.21280	0.171000	0.19730	0.173000	0.16961	GAT	.		0.587	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
FAM3A	60343	ucsc.edu;bcgsc.ca	37	X	153735768	153735768	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:153735768A>G	ENST00000447601.2	-	7	905	c.439T>C	c.(439-441)Ttc>Ctc	p.F147L	FAM3A_ENST00000359889.5_Missense_Mutation_p.F147L|FAM3A_ENST00000492763.1_5'Flank|FAM3A_ENST00000369643.1_Missense_Mutation_p.F147L|FAM3A_ENST00000393572.1_Missense_Mutation_p.F109L|FAM3A_ENST00000434658.2_Missense_Mutation_p.F130L|FAM3A_ENST00000369641.3_Missense_Mutation_p.F154L	NM_021806.2	NP_068578.2	P98173	FAM3A_HUMAN	family with sequence similarity 3, member A	147						extracellular region (GO:0005576)				kidney(2)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GATGCCACGAACACCAGGGTG	0.607																																					p.F147L		.											.	FAM3A	130	0			c.T439C						.						65.0	46.0	52.0					X																	153735768		2203	4299	6502	SO:0001583	missense	60343	exon8			CCACGAACACCAG	X74610	CCDS35453.1, CCDS55542.1, CCDS55543.1, CCDS76060.1	Xq28	2008-07-29			ENSG00000071889	ENSG00000071889			13749	protein-coding gene	gene with protein product		300492				8733135, 8281148	Standard	NM_021806		Approved	DXS560S, 2-19, XAP-7	uc004fls.2	P98173	OTTHUMG00000013418	ENST00000447601.2:c.439T>C	X.37:g.153735768A>G	ENSP00000416146:p.Phe147Leu	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_001171132	A6QRH6|B2RBI7|B4DFI8|D3DWX4|Q5HY76|Q96H51	Missense_Mutation	SNP	ENST00000447601.2	37	CCDS35453.1	.	.	.	.	.	.	.	.	.	.	A	6.025	0.373070	0.11409	.	.	ENSG00000071889	ENST00000434658;ENST00000359889;ENST00000369643;ENST00000447601;ENST00000369641;ENST00000393572;ENST00000426266	T;T;T;T;T;T;T	0.21734	2.08;2.08;2.08;2.08;1.99;2.08;2.3	5.26	4.06	0.47325	.	0.102460	0.64402	D	0.000002	T	0.11537	0.0281	L	0.31476	0.935	0.46901	D	0.999242	B;B;B;B	0.15473	0.004;0.001;0.013;0.001	B;B;B;B	0.19391	0.009;0.002;0.025;0.008	T	0.14952	-1.0454	10	0.02654	T	1	-26.236	6.186	0.20498	0.6726:0.1653:0.0:0.1621	.	130;154;161;147	B4DFI8;Q5HY75;D3DWX8;P98173	.;.;.;FAM3A_HUMAN	L	130;147;147;147;154;109;154	ENSP00000396243:F130L;ENSP00000352955:F147L;ENSP00000358657:F147L;ENSP00000416146:F147L;ENSP00000358655:F154L;ENSP00000377202:F109L;ENSP00000396845:F154L	ENSP00000352955:F147L	F	-	1	0	FAM3A	153388962	1.000000	0.71417	0.743000	0.31040	0.971000	0.66376	3.599000	0.54045	0.625000	0.30304	0.430000	0.28490	TTC	.		0.607	FAM3A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037362.2		
FAM63A	55793	ucsc.edu;bcgsc.ca	37	1	150975098	150975098	+	5'UTR	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:150975098A>G	ENST00000361936.5	-	0	950				FAM63A_ENST00000493834.2_Intron|FAM63A_ENST00000361738.6_Missense_Mutation_p.L47S|FAM63A_ENST00000312210.5_Intron|FAM63A_ENST00000470877.1_Intron	NM_018379.4	NP_060849	Q8N5J2	FA63A_HUMAN	family with sequence similarity 63, member A							extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(3)|large_intestine(4)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTCCATGGTCAAAAGGGACTT	0.537																																					p.L47S		.											.	FAM63A	91	0			c.T140C						.						55.0	53.0	54.0					1																	150975098		2203	4300	6503	SO:0001623	5_prime_UTR_variant	55793	exon3			ATGGTCAAAAGGG	BC032321	CCDS976.1, CCDS30854.1, CCDS53361.1, CCDS55635.1	1q21.2	2008-02-05			ENSG00000143409	ENSG00000143409			25648	protein-coding gene	gene with protein product						10718198	Standard	NM_001040217		Approved	FLJ11280	uc010pcn.2	Q8N5J2	OTTHUMG00000035061	ENST00000361936.5:c.-5T>C	1.37:g.150975098A>G		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_001163258	B3KWP4|B3KWV8|B4DXF2|B4E1S4|D3DV09|J3KP53|Q5SZF0|Q9NUL9|Q9P2F7	Missense_Mutation	SNP	ENST00000361936.5	37	CCDS976.1	.	.	.	.	.	.	.	.	.	.	A	15.01	2.707624	0.48412	.	.	ENSG00000143409	ENST00000361738	T	0.52526	0.66	4.86	-2.97	0.05530	.	7.100730	0.00786	N	0.001311	T	0.10294	0.0252	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.07654	-1.0761	9	0.15499	T	0.54	1.3919	7.8906	0.29675	0.2241:0.0:0.6265:0.1494	.	47	Q8N5J2-3	.	S	47	ENSP00000354669:L47S	ENSP00000354669:L47S	L	-	2	0	FAM63A	149241722	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.271000	0.08572	-0.426000	0.07360	-0.250000	0.11733	TTG	.		0.537	FAM63A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411753.1	NM_018379	
FARP1	10160	ucsc.edu;bcgsc.ca	37	13	98896771	98896771	+	Intron	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:98896771A>G	ENST00000319562.6	+	2	436				FARP1_ENST00000376586.2_Intron|FARP1_ENST00000595437.1_Intron|FARP1_ENST00000376581.5_Silent_p.K66K	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)						dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CCTTCCTCAAAGCCACCGGCT	0.468																																					p.K66K		.											.	FARP1	290	0			c.A198G						.						70.0	63.0	65.0					13																	98896771		2203	4300	6503	SO:0001627	intron_variant	10160	exon3			CCTCAAAGCCACC	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.171+31104A>G	13.37:g.98896771A>G		Somatic	32.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001001715	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	37	CCDS9487.1																																																																																			.		0.468	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
FARP1	10160	ucsc.edu;bcgsc.ca	37	13	99091413	99091413	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:99091413T>C	ENST00000319562.6	+	21	2661	c.2396T>C	c.(2395-2397)tTt>tCt	p.F799S	FARP1_ENST00000376586.2_Missense_Mutation_p.F830S|FARP1_ENST00000595437.1_Missense_Mutation_p.F830S	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	799	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TCCAATCAGTTTAAAGTCCAC	0.617																																					p.F799S		.											.	FARP1	290	0			c.T2396C						.						133.0	131.0	132.0					13																	99091413		2203	4300	6503	SO:0001583	missense	10160	exon21			ATCAGTTTAAAGT	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2396T>C	13.37:g.99091413T>C	ENSP00000322926:p.Phe799Ser	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_005766	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.518553	0.85495	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.63255	-0.03;-0.03	5.57	5.57	0.84162	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.79149	0.4397	M	0.75884	2.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.81897	-0.0722	10	0.87932	D	0	.	15.73	0.77794	0.0:0.0:0.0:1.0	.	799;830	Q9Y4F1;C9JME2	FARP1_HUMAN;.	S	830;799	ENSP00000365771:F830S;ENSP00000322926:F799S	ENSP00000322926:F799S	F	+	2	0	FARP1	97889414	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	8.036000	0.88901	2.116000	0.64780	0.533000	0.62120	TTT	.		0.617	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
FBXL14	144699	ucsc.edu;bcgsc.ca	37	12	1702850	1702850	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:1702850T>C	ENST00000339235.3	-	1	481	c.383A>G	c.(382-384)aAg>aGg	p.K128R	FBXL14_ENST00000543278.1_5'Flank|WNT5B_ENST00000537031.1_Intron	NM_152441.2	NP_689654.1	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14	128					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	8	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			AGTGATCTGCTTGCAGAGGCT	0.622																																					p.K128R		.											.	FBXL14	227	0			c.A383G						.						58.0	58.0	58.0					12																	1702850		2203	4300	6503	SO:0001583	missense	144699	exon1			ATCTGCTTGCAGA	BC028132	CCDS8509.1	12p13.33	2011-06-09			ENSG00000171823	ENSG00000171823		"""F-boxes / Leucine-rich repeats"""	28624	protein-coding gene	gene with protein product		609081				12477932	Standard	NM_152441		Approved	MGC40195, Fbl14	uc001qjh.3	Q8N1E6	OTTHUMG00000090369	ENST00000339235.3:c.383A>G	12.37:g.1702850T>C	ENSP00000344855:p.Lys128Arg	Somatic	67.0	0.0		WXS	Illumina HiSeq	.	53.0	5.0	NM_152441		Missense_Mutation	SNP	ENST00000339235.3	37	CCDS8509.1	.	.	.	.	.	.	.	.	.	.	T	19.53	3.844467	0.71488	.	.	ENSG00000171823	ENST00000339235	T	0.02421	4.3	4.34	4.34	0.51931	.	0.119115	0.56097	D	0.000028	T	0.09555	0.0235	L	0.52206	1.635	0.58432	D	0.999996	D	0.63880	0.993	D	0.68192	0.956	T	0.32161	-0.9917	10	0.28530	T	0.3	.	13.3448	0.60566	0.0:0.0:0.0:1.0	.	128	Q8N1E6	FXL14_HUMAN	R	128	ENSP00000344855:K128R	ENSP00000344855:K128R	K	-	2	0	FBXL14	1573111	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.691000	0.84191	1.804000	0.52760	0.455000	0.32223	AAG	.		0.622	FBXL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206741.1	NM_152441	
FGF3	2248	ucsc.edu;bcgsc.ca	37	11	69631167	69631167	+	Missense_Mutation	SNP	T	T	C	rs146864055		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:69631167T>C	ENST00000334134.2	-	2	335	c.245A>G	c.(244-246)gAg>gGg	p.E82G		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	82					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			AATGCCCACCTCCACTGCCGT	0.622																																					p.E82G		.											.	FGF3	847	0			c.A245G						.						132.0	114.0	120.0					11																	69631167		2200	4294	6494	SO:0001583	missense	2248	exon2			CCCACCTCCACTG		CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.245A>G	11.37:g.69631167T>C	ENSP00000334122:p.Glu82Gly	Somatic	66.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_005247	Q0VG69	Missense_Mutation	SNP	ENST00000334134.2	37	CCDS8195.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.357064	0.82243	.	.	ENSG00000186895	ENST00000334134	T	0.64438	-0.1	4.83	4.83	0.62350	.	0.167402	0.50627	D	0.000104	T	0.59998	0.2235	N	0.13327	0.33	0.50171	D	0.999857	D	0.58268	0.982	P	0.60236	0.871	T	0.59947	-0.7358	9	.	.	.	.	14.4164	0.67153	0.0:0.0:0.0:1.0	.	82	P11487	FGF3_HUMAN	G	82	ENSP00000334122:E82G	.	E	-	2	0	FGF3	69340104	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.561000	0.82288	1.810000	0.52873	0.454000	0.30748	GAG	.		0.622	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396835.1	NM_005247	
FGR	2268	ucsc.edu;bcgsc.ca	37	1	27942344	27942344	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:27942344C>T	ENST00000374005.3	-	8	982	c.694G>A	c.(694-696)Ggg>Agg	p.G232R	FGR_ENST00000374004.1_Missense_Mutation_p.G232R|FGR_ENST00000545953.1_Missense_Mutation_p.G166R|FGR_ENST00000399173.1_Missense_Mutation_p.G232R	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	232	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TTGCACAGCCCGTCATTCACC	0.627																																					p.G232R		.											.	FGR	547	0			c.G694A						.						17.0	19.0	18.0					1																	27942344		2202	4298	6500	SO:0001583	missense	2268	exon8			ACAGCCCGTCATT	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.694G>A	1.37:g.27942344C>T	ENSP00000363117:p.Gly232Arg	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	37	CCDS305.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881345	0.91740	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	D;T;D;D;D;D	0.93547	-3.24;1.55;-3.24;-3.24;-3.24;-3.24	4.38	4.38	0.52667	SH2 motif (3);	0.000000	0.56097	D	0.000028	D	0.97592	0.9211	H	0.95043	3.615	0.53688	D	0.999979	D	0.89917	1.0	D	0.71870	0.975	D	0.98834	1.0752	10	0.87932	D	0	.	16.3984	0.83631	0.0:1.0:0.0:0.0	.	232	P09769	FGR_HUMAN	R	232;166;232;232;232;232	ENSP00000363117:G232R;ENSP00000445302:G166R;ENSP00000382126:G232R;ENSP00000363116:G232R;ENSP00000363115:G232R;ENSP00000407670:G232R	ENSP00000363115:G232R	G	-	1	0	FGR	27814931	1.000000	0.71417	0.887000	0.34795	0.840000	0.47671	7.811000	0.86092	2.392000	0.81423	0.561000	0.74099	GGG	.		0.627	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
FIBCD1	84929	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	133787241	133787241	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:133787241A>G	ENST00000372338.4	-	5	1126	c.884T>C	c.(883-885)tTc>tCc	p.F295S	FIBCD1_ENST00000448616.1_Missense_Mutation_p.F295S|FIBCD1_ENST00000372337.2_Missense_Mutation_p.F137S|FIBCD1_ENST00000253018.4_Missense_Mutation_p.F137S	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	295	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		GCCCCGGAAGAAGTTCACGGA	0.677																																					p.F295S		.											.	FIBCD1	90	0			c.T884C						.						46.0	38.0	41.0					9																	133787241		2199	4299	6498	SO:0001583	missense	84929	exon6			CGGAAGAAGTTCA	AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.884T>C	9.37:g.133787241A>G	ENSP00000361413:p.Phe295Ser	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	11.0	NM_001145106	A3KFK0|Q6UXK6|Q96SJ7	Missense_Mutation	SNP	ENST00000372338.4	37	CCDS6937.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.072459|5.072459	0.93950|0.93950	.|.	.|.	ENSG00000130720|ENSG00000130720	ENST00000448616;ENST00000372338;ENST00000372337;ENST00000253018|ENST00000444139	D;D;D;D|.	0.92595|.	-3.07;-3.07;-3.07;-2.02|.	5.06|5.06	5.06|5.06	0.68205|0.68205	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88819|0.88819	0.6540|0.6540	H|H	0.99026|0.99026	4.405|4.405	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.92863|0.92863	0.6307|0.6307	10|5	0.87932|.	D|.	0|.	.|.	13.63|13.63	0.62189|0.62189	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	295|.	Q8N539|.	FBCD1_HUMAN|.	S|P	295;295;137;137|249	ENSP00000414501:F295S;ENSP00000361413:F295S;ENSP00000361412:F137S;ENSP00000253018:F137S|.	ENSP00000253018:F137S|.	F|S	-|-	2|1	0|0	FIBCD1|FIBCD1	132777062|132777062	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	9.115000|9.115000	0.94336|0.94336	1.890000|1.890000	0.54733|0.54733	0.397000|0.397000	0.26171|0.26171	TTC|TCT	.		0.677	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054687.2	NM_032843	
FLT1	2321	ucsc.edu;bcgsc.ca	37	13	28896449	28896449	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:28896449A>G	ENST00000282397.4	-	22	3252	c.3001T>C	c.(3001-3003)Tct>Cct	p.S1001P	FLT1_ENST00000540678.1_Missense_Mutation_p.S219P|FLT1_ENST00000543394.1_Missense_Mutation_p.S24P	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	1001	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAACTGTAAGAAATCAGATCT	0.448																																					p.S1001P		.											.	FLT1	1406	0			c.T3001C						.						114.0	104.0	107.0					13																	28896449		2203	4300	6503	SO:0001583	missense	2321	exon22			TGTAAGAAATCAG	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3001T>C	13.37:g.28896449A>G	ENSP00000282397:p.Ser1001Pro	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	A	17.51	3.406720	0.62399	.	.	ENSG00000102755	ENST00000282397;ENST00000543394;ENST00000540678	D;D;D	0.83673	-1.75;-1.75;-1.75	5.91	4.73	0.59995	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.122149	0.56097	D	0.000023	D	0.86518	0.5952	L	0.41710	1.295	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86279	0.1666	10	0.54805	T	0.06	.	12.055	0.53529	0.9327:0.0:0.0673:0.0	.	1001	P17948	VGFR1_HUMAN	P	1001;24;219	ENSP00000282397:S1001P;ENSP00000437841:S24P;ENSP00000443311:S219P	ENSP00000282397:S1001P	S	-	1	0	FLT1	27794449	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.949000	0.70257	1.060000	0.40578	-0.451000	0.05528	TCT	.		0.448	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
FOXK1	221937	ucsc.edu;bcgsc.ca	37	7	4798690	4798690	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr7:4798690C>T	ENST00000328914.4	+	6	1253	c.1253C>T	c.(1252-1254)cCa>cTa	p.P418L	FOXK1_ENST00000446823.1_Missense_Mutation_p.P255L	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		AGGAGCGCTCCAGCTTCGCCC	0.692																																					p.P418L		.											.	FOXK1	516	0			c.C1253T						.						47.0	54.0	52.0					7																	4798690		2203	4299	6502	SO:0001583	missense	221937	exon6			GCGCTCCAGCTTC	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1253C>T	7.37:g.4798690C>T	ENSP00000328720:p.Pro418Leu	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	c	22.4	4.285794	0.80803	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.97066	-3.92;-4.23	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.98118	0.9379	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.98306	1.0521	10	0.52906	T	0.07	.	19.2294	0.93831	0.0:1.0:0.0:0.0	.	418;255	P85037;P85037-2	FOXK1_HUMAN;.	L	255;182;418;301	ENSP00000394442:P255L;ENSP00000328720:P418L	ENSP00000328720:P418L	P	+	2	0	FOXK1	4765216	1.000000	0.71417	0.294000	0.24946	0.349000	0.29174	7.811000	0.86092	2.793000	0.96121	0.558000	0.71614	CCA	.		0.692	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
GABBR1	2550	ucsc.edu;bcgsc.ca	37	6	29576390	29576390	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:29576390A>G	ENST00000377034.4	-	16	2315	c.1980T>C	c.(1978-1980)ccT>ccC	p.P660P	GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377016.4_Silent_p.P598P|GABBR1_ENST00000377012.4_Silent_p.P543P|GABBR1_ENST00000355973.3_Silent_p.P543P	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	660					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	GGCAGACGAAAGGAAACTGGT	0.547																																					p.P660P		.											.	GABBR1	521	0			c.T1980C						.						98.0	83.0	89.0					6																	29576390		1511	2708	4219	SO:0001819	synonymous_variant	2550	exon16			GACGAAAGGAAAC	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1980T>C	6.37:g.29576390A>G		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	A	8.868	0.948489	0.18356	.	.	ENSG00000204681	ENST00000485026	.	.	.	4.49	-4.48	0.03515	.	.	.	.	.	T	0.18718	0.0449	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37776	-0.9691	4	.	.	.	-8.8067	0.5476	0.00657	0.3868:0.2275:0.1558:0.2299	.	.	.	.	L	41	.	.	F	-	1	0	GABBR1	29684369	0.347000	0.24853	0.778000	0.31720	0.877000	0.50540	-0.374000	0.07484	-1.450000	0.01936	-0.479000	0.04858	TTT	.		0.547	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
GBP4	115361	ucsc.edu;bcgsc.ca	37	1	89664501	89664501	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:89664501A>G	ENST00000355754.6	-	1	114	c.17T>C	c.(16-18)cTt>cCt	p.L6P		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	6	GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TGCAGCGTGAAGAGTTCTCTC	0.468																																					p.L6P		.											.	GBP4	90	0			c.T17C						.						162.0	146.0	151.0					1																	89664501		2203	4300	6503	SO:0001583	missense	115361	exon1			GCGTGAAGAGTTC	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.17T>C	1.37:g.89664501A>G	ENSP00000359490:p.Leu6Pro	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_052941	B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	CCDS721.1	.	.	.	.	.	.	.	.	.	.	A	8.615	0.890153	0.17613	.	.	ENSG00000162654	ENST00000355754	T	0.59502	0.26	2.02	-4.04	0.04010	.	.	.	.	.	T	0.09686	0.0238	N	0.08118	0	0.09310	N	0.999999	B	0.33266	0.404	B	0.17433	0.018	T	0.08289	-1.0729	9	0.45353	T	0.12	.	3.8797	0.09072	0.1953:0.2448:0.0:0.5599	.	6	Q96PP9	GBP4_HUMAN	P	6	ENSP00000359490:L6P	ENSP00000359490:L6P	L	-	2	0	GBP4	89437089	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.878000	0.04192	-1.256000	0.02478	-1.086000	0.02197	CTT	.		0.468	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941	
GPRASP1	9737	ucsc.edu;bcgsc.ca	37	X	101911002	101911002	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:101911002G>T	ENST00000361600.5	+	5	2962	c.2161G>T	c.(2161-2163)Ggg>Tgg	p.G721W	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000415986.1_Missense_Mutation_p.G721W|GPRASP1_ENST00000444152.1_Missense_Mutation_p.G721W|GPRASP1_ENST00000537097.1_Missense_Mutation_p.G721W	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	721	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGCCATTATAGGGTCCTGGTT	0.473																																					p.G721W		.											.	GPRASP1	131	0			c.G2161T						.						101.0	100.0	100.0					X																	101911002		2203	4300	6503	SO:0001583	missense	9737	exon3			ATTATAGGGTCCT	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.2161G>T	X.37:g.101911002G>T	ENSP00000355146:p.Gly721Trp	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	35.0	5.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.159246	0.38119	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	2.79	2.79	0.32731	.	.	.	.	.	T	0.38188	0.1031	L	0.48642	1.525	0.09310	N	0.999999	D	0.89917	1.0	D	0.77004	0.989	T	0.09840	-1.0656	9	0.87932	D	0	-8.0738	5.1041	0.14775	0.1666:0.0:0.8334:0.0	.	721	Q5JY77	GASP1_HUMAN	W	721	ENSP00000393691:G721W;ENSP00000409420:G721W;ENSP00000355146:G721W;ENSP00000445683:G721W	ENSP00000355146:G721W	G	+	1	0	GPRASP1	101797658	0.951000	0.32395	0.246000	0.24233	0.704000	0.40688	3.442000	0.52900	1.693000	0.51124	0.425000	0.28330	GGG	.		0.473	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
GRAMD1B	57476	ucsc.edu;bcgsc.ca	37	11	123448232	123448232	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:123448232G>T	ENST00000529750.1	+	2	508	c.181G>T	c.(181-183)Gtg>Ttg	p.V61L	GRAMD1B_ENST00000456860.2_Missense_Mutation_p.V61L|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.V61L	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	61						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GGAGCAGGGCGTGCAGCGCAG	0.672											OREG0021454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V61L		.											.	GRAMD1B	69	0			c.G181T						.																																			SO:0001583	missense	57476	exon2			CAGGGCGTGCAGC	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.181G>T	11.37:g.123448232G>T	ENSP00000436500:p.Val61Leu	Somatic	62.0	0.0	1526	WXS	Illumina HiSeq	.	42.0	4.0	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	G	32	5.112196	0.94339	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.32515	1.91;1.9;1.9;1.88;1.45	4.92	4.92	0.64577	.	0.126603	0.52532	D	0.000065	T	0.38639	0.1048	N	0.24115	0.695	0.58432	D	0.999997	D;P;B;P	0.63046	0.992;0.943;0.114;0.899	P;P;B;P	0.61592	0.891;0.821;0.039;0.502	T	0.11743	-1.0575	10	0.25751	T	0.34	.	18.1148	0.89549	0.0:0.0:1.0:0.0	.	21;61;61;61	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	L	61;61;61;61;21;57	ENSP00000402457:V61L;ENSP00000325628:V61L;ENSP00000436500:V61L;ENSP00000432987:V21L;ENSP00000434214:V57L	ENSP00000325628:V61L	V	+	1	0	GRAMD1B	122953442	1.000000	0.71417	0.988000	0.46212	0.979000	0.70002	7.549000	0.82163	2.275000	0.75901	0.462000	0.41574	GTG	.		0.672	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
GTF3C4	9329	ucsc.edu;bcgsc.ca	37	9	135553517	135553517	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:135553517C>A	ENST00000372146.4	+	2	1075	c.511C>A	c.(511-513)Ccc>Acc	p.P171T	GTF3C4_ENST00000483873.2_Intron	NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	171					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		CAGCTGGTCTCCCATGGGTTG	0.542																																					p.P171T	Pancreas(142;417 1875 11086 31973 47667)	.											.	GTF3C4	91	0			c.C511A						.						117.0	115.0	116.0					9																	135553517		2203	4300	6503	SO:0001583	missense	9329	exon2			TGGTCTCCCATGG	AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.511C>A	9.37:g.135553517C>A	ENSP00000361219:p.Pro171Thr	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_012204	Q5VZJ7	Missense_Mutation	SNP	ENST00000372146.4	37	CCDS6953.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.910929	0.72983	.	.	ENSG00000125484	ENST00000372146	T	0.67171	-0.25	5.72	5.72	0.89469	Transcription factor IIIC, 90kDa subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.74253	0.3692	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76966	-0.2763	10	0.87932	D	0	-27.9704	18.4551	0.90717	0.0:1.0:0.0:0.0	.	171	Q9UKN8	TF3C4_HUMAN	T	171	ENSP00000361219:P171T	ENSP00000361219:P171T	P	+	1	0	GTF3C4	134543338	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.298000	0.78815	2.709000	0.92574	0.561000	0.74099	CCC	.		0.542	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054792.1		
HAPLN2	60484	ucsc.edu;bcgsc.ca	37	1	156593366	156593366	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:156593366A>G	ENST00000255039.1	+	3	491	c.84A>G	c.(82-84)ccA>ccG	p.P28P		NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	28					cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAGGAGACCCAGGTAAGACCC	0.622																																					p.P28P		.											.	HAPLN2	90	0			c.A84G						.						52.0	45.0	47.0					1																	156593366		2203	4300	6503	SO:0001630	splice_region_variant	60484	exon3			AGACCCAGGTAAG	AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.85+1A>G	1.37:g.156593366A>G		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_021817	Q5T3J0	Silent	SNP	ENST00000255039.1	37	CCDS1148.1																																																																																			.		0.622	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081039.1	NM_021817	Silent
HIP1R	9026	ucsc.edu;bcgsc.ca	37	12	123339461	123339461	+	Missense_Mutation	SNP	C	C	T	rs191719039		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:123339461C>T	ENST00000253083.4	+	9	853	c.728C>T	c.(727-729)gCg>gTg	p.A243V		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	243					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GGTCTCCCTGCGGACACCCTG	0.612																																					p.A243V		.											.	HIP1R	91	0			c.C728T						.						95.0	91.0	93.0					12																	123339461		2203	4300	6503	SO:0001583	missense	9026	exon9			TCCCTGCGGACAC	AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.728C>T	12.37:g.123339461C>T	ENSP00000253083:p.Ala243Val	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	51.0	4.0	NM_003959	A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	ENST00000253083.4	37	CCDS31922.1	12	0.005494505494505495	3	0.006097560975609756	2	0.0055248618784530384	6	0.01048951048951049	1	0.0013192612137203166	C	19.21	3.783762	0.70222	.	.	ENSG00000130787	ENST00000253083	T	0.31769	1.48	4.44	4.44	0.53790	ANTH (1);	0.057170	0.64402	D	0.000001	T	0.26666	0.0652	L	0.31294	0.92	0.54753	D	0.999988	D;P;P	0.60160	0.987;0.941;0.872	P;P;B	0.53593	0.73;0.473;0.293	T	0.02901	-1.1096	10	0.24483	T	0.36	-17.2876	16.6633	0.85246	0.0:1.0:0.0:0.0	.	243;243;231	O75146;Q6NXG8;B3KQW8	HIP1R_HUMAN;.;.	V	243	ENSP00000253083:A243V	ENSP00000253083:A243V	A	+	2	0	HIP1R	121905414	1.000000	0.71417	0.062000	0.19696	0.688000	0.40055	5.818000	0.69236	2.028000	0.59812	0.462000	0.41574	GCG	C|0.994;T|0.006		0.612	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400935.1	NM_003959	
HIVEP1	3096	ucsc.edu;bcgsc.ca	37	6	12124295	12124295	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:12124295G>A	ENST00000379388.2	+	4	4599	c.4267G>A	c.(4267-4269)Gaa>Aaa	p.E1423K	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1423					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GCCTCTCTTAGAAAGAAGGAG	0.488																																					p.E1423K		.											.	HIVEP1	139	0			c.G4267A						.						95.0	95.0	95.0					6																	12124295		1956	4142	6098	SO:0001583	missense	3096	exon4			CTCTTAGAAAGAA	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.4267G>A	6.37:g.12124295G>A	ENSP00000368698:p.Glu1423Lys	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	36	5.836827	0.97009	.	.	ENSG00000095951	ENST00000379388	T	0.18657	2.2	5.79	5.79	0.91817	.	0.000000	0.37437	N	0.002095	T	0.48714	0.1515	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.52328	-0.8590	9	.	.	.	-30.2801	20.04	0.97581	0.0:0.0:1.0:0.0	.	1423	P15822	ZEP1_HUMAN	K	1423	ENSP00000368698:E1423K	.	E	+	1	0	HIVEP1	12232281	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	9.476000	0.97823	2.733000	0.93635	0.655000	0.94253	GAA	.		0.488	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
HNRNPL	3191	ucsc.edu;bcgsc.ca	37	19	39329657	39329657	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:39329657T>C	ENST00000221419.5	-	9	1600		c.e9-2		AC104534.3_ENST00000594769.1_Splice_Site|HNRNPL_ENST00000600873.1_Splice_Site	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GAATTTCACCTTGGGGAGAGT	0.572																																					.		.											.	HNRNPL	22	0			c.1234-2A>G						.						63.0	65.0	64.0					19																	39329657		2203	4300	6503	SO:0001630	splice_region_variant	3191	exon10			TTCACCTTGGGGA	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1234-2A>G	19.37:g.39329657T>C		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_001533	A6ND69|A6NIT8|Q9H3P3	Splice_Site	SNP	ENST00000221419.5	37	CCDS33015.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.024731	0.75390	.	.	ENSG00000104824	ENST00000221419;ENST00000388749;ENST00000388750	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2803	0.73778	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HNRNPL	44021497	1.000000	0.71417	0.944000	0.38274	0.720000	0.41350	7.776000	0.85560	2.255000	0.74692	0.533000	0.62120	.	.		0.572	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		Intron
HTR4	3360	ucsc.edu;bcgsc.ca	37	5	147889387	147889387	+	Silent	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr5:147889387G>T	ENST00000377888.3	-	6	846	c.708C>A	c.(706-708)tcC>tcA	p.S236S	HTR4_ENST00000360693.3_Silent_p.S236S|HTR4_ENST00000520514.1_Silent_p.S236S|HTR4_ENST00000314512.6_Silent_p.S236S|HTR4_ENST00000517929.1_Silent_p.S236S|HTR4_ENST00000521530.1_Silent_p.S236S|HTR4_ENST00000521735.1_Silent_p.S236S|HTR4_ENST00000354217.2_Silent_p.S236S|HTR4_ENST00000362016.2_Silent_p.S250S	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	236					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	GCCTGCTCTCGGAGGAGGCTC	0.552																																					p.S236S	GBM(120;370 1604 14007 17804 41573)	.											.	HTR4	91	0			c.C708A						.						96.0	79.0	85.0					5																	147889387		2203	4300	6503	SO:0001819	synonymous_variant	3360	exon5			GCTCTCGGAGGAG	Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.708C>A	5.37:g.147889387G>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001040169	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Silent	SNP	ENST00000377888.3	37	CCDS4291.1																																																																																			.		0.552	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252187.2	NM_000870	
IDH2	3418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90631837	90631837	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:90631837C>G	ENST00000330062.3	-	4	629	c.516G>C	c.(514-516)agG>agC	p.R172S	IDH2_ENST00000559482.1_Intron|IDH2_ENST00000539790.1_Missense_Mutation_p.R42S|IDH2_ENST00000540499.2_Missense_Mutation_p.R120S	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	172					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R172S(17)|p.R172N(1)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CATGGGCGTGCCTGCCAATGG	0.637			M		GBM																																p.R172S		.		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	IDH2,brain,glioma,-1	IDH2	15118	18	Substitution - Missense(18)	bone(11)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|biliary_tract(1)|large_intestine(1)	c.G516C						.						85.0	80.0	82.0					15																	90631837		2200	4298	6498	SO:0001583	missense	3418	exon4			GGCGTGCCTGCCA		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.516G>C	15.37:g.90631837C>G	ENSP00000331897:p.Arg172Ser	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	40.0	NM_002168	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	37	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005845	0.35415	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.86865	-2.18;-2.18;-2.18	5.93	-3.19	0.05171	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94112	0.8112	H	0.98487	4.245	0.53005	D	0.999962	D	0.89917	1.0	D	0.91635	0.999	D	0.89382	0.3682	10	0.87932	D	0	.	5.0108	0.14312	0.237:0.2848:0.0:0.4782	.	172	P48735	IDHP_HUMAN	S	172;42;120	ENSP00000331897:R172S;ENSP00000438457:R42S;ENSP00000446147:R120S	ENSP00000331897:R172S	R	-	3	2	IDH2	88432841	0.145000	0.22656	0.004000	0.12327	0.001000	0.01503	-0.449000	0.06812	-0.649000	0.05430	-1.288000	0.01363	AGG	.		0.637	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
IGSF9B	22997	ucsc.edu;bcgsc.ca	37	11	133801031	133801031	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:133801031T>C	ENST00000321016.8	-	11	1599		c.e11-2		IGSF9B_ENST00000533871.2_Splice_Site			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B						homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTTCCCTACCTTGGTGAACAA	0.637																																					.		.											.	IGSF9B	68	0			c.1369-2A>G						.						61.0	69.0	67.0					11																	133801031		2127	4241	6368	SO:0001630	splice_region_variant	22997	exon12			CCTACCTTGGTGA	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.1369-2A>G	11.37:g.133801031T>C		Somatic	69.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_014987	G5EA26	Splice_Site	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	T	19.52	3.842907	0.71488	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9761	0.58538	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	IGSF9B	133306241	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.734000	0.84928	1.651000	0.50673	0.448000	0.29417	.	.		0.637	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	Intron
IKBKAP	8518	ucsc.edu;bcgsc.ca	37	9	111665218	111665218	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:111665218T>C	ENST00000374647.5	-	16	2062	c.1755A>G	c.(1753-1755)tcA>tcG	p.S585S	IKBKAP_ENST00000537196.1_Silent_p.S236S	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	585					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CCAGAGAAGGTGACTCTGCAA	0.418																																					p.S585S		.											.	IKBKAP	318	0			c.A1755G						.						84.0	84.0	84.0					9																	111665218		2203	4300	6503	SO:0001819	synonymous_variant	8518	exon16			AGAAGGTGACTCT	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1755A>G	9.37:g.111665218T>C		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_003640	Q5JSV2|Q9H327|Q9UG87	Silent	SNP	ENST00000374647.5	37	CCDS6773.1																																																																																			.		0.418	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1		
IKBKE	9641	ucsc.edu;bcgsc.ca	37	1	206647814	206647814	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:206647814G>T	ENST00000367120.3	+	4	601	c.228G>T	c.(226-228)acG>acT	p.T76T	IKBKE_ENST00000537984.1_5'UTR|IKBKE_ENST00000463979.1_3'UTR	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	76	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					TGGAGGAGACGGTAGGTCCGG	0.557																																					p.T76T		.											.	IKBKE	1061	0			c.G228T						.						66.0	47.0	54.0					1																	206647814		2203	4300	6503	SO:0001630	splice_region_variant	9641	exon4			GGAGACGGTAGGT	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.228+1G>T	1.37:g.206647814G>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001193322	D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	ENST00000367120.3	37	CCDS30996.1																																																																																			.		0.557	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1		Silent
QRICH1	54870	ucsc.edu;bcgsc.ca	37	3	49064263	49064263	+	IGR	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:49064263C>A	ENST00000395443.2	-	0	3549				RP13-131K19.6_ENST00000607245.1_RNA|IMPDH2_ENST00000326739.4_Missense_Mutation_p.D226Y	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)		p.D226H(1)		breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TTCTTCAGGTCTGTCCGGGCA	0.502																																					p.D226Y		.											IMPDH2,NS,carcinoma,0	IMPDH2	227	1	Substitution - Missense(1)	lung(1)	c.G676T						.						141.0	137.0	138.0					3																	49064263		2203	4300	6503	SO:0001628	intergenic_variant	3615	exon7			TCAGGTCTGTCCG		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		3.37:g.49064263C>A		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	55.0	5.0	NM_000884	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	37	CCDS2787.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.5|26.5	4.740653|4.740653	0.89573|0.89573	.|.	.|.	ENSG00000178035|ENSG00000178035	ENST00000537036;ENST00000326739;ENST00000442157|ENST00000429182	D;D|.	0.97731|.	-4.51;-4.51|.	5.97|5.97	5.97|5.97	0.96955|0.96955	Aldolase-type TIM barrel (1);Cystathionine beta-synthase, core (3);IMP dehydrogenase/GMP reductase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91868|0.91868	0.7426|0.7426	H|H	0.99169|0.99169	4.455|4.455	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	D|D	0.94523|0.94523	0.7729|0.7729	10|5	0.87932|.	D|.	0|.	-29.9163|-29.9163	20.428|20.428	0.99075|0.99075	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	226|.	P12268|.	IMDH2_HUMAN|.	Y|I	226;226;201|157	ENSP00000321584:D226Y;ENSP00000403502:D201Y|.	ENSP00000321584:D226Y|.	D|R	-|-	1|2	0|0	IMPDH2|IMPDH2	49039267|49039267	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	7.710000|7.710000	0.84655|0.84655	2.837000|2.837000	0.97791|0.97791	0.655000|0.655000	0.94253|0.94253	GAC|AGA	.		0.502	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
INTU	27152	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	128590302	128590302	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:128590302G>A	ENST00000335251.6	+	5	1187	c.1084G>A	c.(1084-1086)Gtt>Att	p.V362I	INTU_ENST00000296461.5_Missense_Mutation_p.V362I	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	362					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						TGGGACACAAGTTACTAGGTA	0.318																																					p.V362I		.											.	INTU	91	0			c.G1084A						.						76.0	78.0	77.0					4																	128590302		2203	4300	6503	SO:0001583	missense	27152	exon5			ACACAAGTTACTA	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1084G>A	4.37:g.128590302G>A	ENSP00000334003:p.Val362Ile	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	8.0	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413374	0.25465	.	.	ENSG00000164066	ENST00000335251;ENST00000296461	T	0.39592	1.07	5.83	5.83	0.93111	.	0.059572	0.64402	D	0.000005	T	0.17789	0.0427	N	0.03608	-0.345	0.33536	D	0.594245	B	0.12630	0.006	B	0.11329	0.006	T	0.29427	-1.0012	10	0.09843	T	0.71	-17.3329	9.035	0.36282	0.1563:0.0:0.8437:0.0	.	362	Q9ULD6	PDZD6_HUMAN	I	362	ENSP00000296461:V362I	ENSP00000296461:V362I	V	+	1	0	INTU	128809752	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.346000	0.59367	2.761000	0.94854	0.650000	0.86243	GTT	.		0.318	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
ITGA7	3679	ucsc.edu;bcgsc.ca	37	12	56086982	56086982	+	Silent	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:56086982G>T	ENST00000555728.1	-	21	2815	c.2787C>A	c.(2785-2787)ggC>ggA	p.G929G	ITGA7_ENST00000347027.6_Silent_p.G879G|ITGA7_ENST00000394230.2_Silent_p.G889G|ITGA7_ENST00000257879.6_Silent_p.G885G|ITGA7_ENST00000452168.2_Silent_p.G792G|ITGA7_ENST00000553804.1_Silent_p.G889G|ITGA7_ENST00000257880.7_Silent_p.G929G|ITGA7_ENST00000394229.2_Silent_p.G885G			Q13683	ITA7_HUMAN	integrin, alpha 7	929					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.G885G(2)|p.G889G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GCCCCTGCCCGCCCTCCAGCT	0.602																																					p.G889G		.											ITGA7,NS,carcinoma,0	ITGA7	229	3	Substitution - coding silent(3)	lung(2)|ovary(1)	c.C2667A						.						57.0	59.0	58.0					12																	56086982		2203	4300	6503	SO:0001819	synonymous_variant	3679	exon20			CTGCCCGCCCTCC		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.2787C>A	12.37:g.56086982G>T		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Silent	SNP	ENST00000555728.1	37																																																																																				.		0.602	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
IVNS1ABP	10625	ucsc.edu;bcgsc.ca	37	1	185274729	185274729	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:185274729T>C	ENST00000367498.3	-	8	1326	c.704A>G	c.(703-705)aAc>aGc	p.N235S	IVNS1ABP_ENST00000392007.3_Missense_Mutation_p.N17S|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	235	Sufficient for AHR interaction and signaling.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						ATCTAGTAGGTTCCCATCAAG	0.478																																					p.N235S		.											.	IVNS1ABP	94	0			c.A704G						.						187.0	154.0	166.0					1																	185274729		2203	4300	6503	SO:0001583	missense	10625	exon8			AGTAGGTTCCCAT	AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.704A>G	1.37:g.185274729T>C	ENSP00000356468:p.Asn235Ser	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_006469	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	ENST00000367498.3	37	CCDS1368.1	.	.	.	.	.	.	.	.	.	.	T	9.481	1.098242	0.20552	.	.	ENSG00000116679	ENST00000367498;ENST00000392007	T;T	0.75589	-0.95;-0.49	5.57	5.57	0.84162	.	0.096867	0.64402	D	0.000001	T	0.47395	0.1443	N	0.02539	-0.55	0.41884	D	0.990339	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.47812	-0.9088	10	0.20519	T	0.43	.	10.1333	0.42691	0.0:0.0744:0.0:0.9256	.	17;235	A8MVR0;Q9Y6Y0	.;NS1BP_HUMAN	S	235;17	ENSP00000356468:N235S;ENSP00000375864:N17S	ENSP00000356468:N235S	N	-	2	0	IVNS1ABP	183541352	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.062000	0.57492	2.113000	0.64589	0.455000	0.32223	AAC	.		0.478	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469	
KAT6A	7994	ucsc.edu;bcgsc.ca	37	8	41812874	41812874	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:41812874T>C	ENST00000396930.3	-	10	2081	c.1538A>G	c.(1537-1539)gAg>gGg	p.E513G	KAT6A_ENST00000265713.2_Missense_Mutation_p.E513G|KAT6A_ENST00000406337.1_Missense_Mutation_p.E513G|KAT6A_ENST00000485568.1_Missense_Mutation_p.E513G	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	513	Catalytic.|Interaction with PML.|Interaction with RUNX1-1.|MYST-type HAT.|Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CTTCCCAAACTCAATGACAGA	0.438																																					p.E513G		.											.	.	.	0			c.A1538G						.						105.0	94.0	98.0					8																	41812874		2203	4300	6503	SO:0001583	missense	7994	exon10			CCAAACTCAATGA	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.1538A>G	8.37:g.41812874T>C	ENSP00000380136:p.Glu513Gly	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_001099412	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019233	0.54576	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721;ENST00000485568	T;T;T;D	0.85484	0.03;0.03;0.03;-1.99	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	D	0.93184	0.7829	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.992;0.997	D	0.94226	0.7472	10	0.72032	D	0.01	-24.858	15.7083	0.77602	0.0:0.0:0.0:1.0	.	513;513	A5PLL3;Q92794	.;KAT6A_HUMAN	G	513;513;513;93;513	ENSP00000265713:E513G;ENSP00000385888:E513G;ENSP00000380136:E513G;ENSP00000430606:E513G	ENSP00000265713:E513G	E	-	2	0	KAT6A	41932031	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	6.139000	0.71728	2.107000	0.64212	0.374000	0.22700	GAG	.		0.438	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
SPIDR	23514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48614552	48614552	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:48614552C>G	ENST00000297423.4	+	14	2336	c.1952C>G	c.(1951-1953)gCc>gGc	p.A651G	SPIDR_ENST00000541342.1_Missense_Mutation_p.A581G|SPIDR_ENST00000517693.1_Missense_Mutation_p.A126G|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000518074.1_Missense_Mutation_p.A591G	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	651					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AGTTTCTATGCCACGGTGATT	0.438																																					p.A651G		.											.	KIAA0146	68	0			c.C1952G						.						115.0	107.0	110.0					8																	48614552		1900	4127	6027	SO:0001583	missense	23514	exon14			TCTATGCCACGGT	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1952C>G	8.37:g.48614552C>G	ENSP00000297423:p.Ala651Gly	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	59.0	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	37	CCDS43737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.59|16.59	3.164646|3.164646	0.57476|0.57476	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342;ENST00000519141;ENST00000517693;ENST00000519362;ENST00000522321;ENST00000518692;ENST00000521056|ENST00000519401	.|.	.|.	.|.	5.61|5.61	4.74|4.74	0.60224|0.60224	.|.	0.116963|.	0.56097|.	D|.	0.000027|.	T|T	0.60340|0.60340	0.2261|0.2261	L|L	0.51422|0.51422	1.61|1.61	0.34809|0.34809	D|D	0.737514|0.737514	B;B;P;D;P;B;D|.	0.89917|.	0.38;0.38;0.884;1.0;0.884;0.38;1.0|.	B;B;P;D;P;B;D|.	0.77004|.	0.178;0.178;0.636;0.989;0.826;0.178;0.989|.	T|T	0.68603|0.68603	-0.5365|-0.5365	9|5	0.40728|.	T|.	0.16|.	.|.	12.2897|12.2897	0.54810|0.54810	0.0:0.9208:0.0:0.0792|0.0:0.9208:0.0:0.0792	.|.	141;156;591;581;651;126;651|.	B4DZY2;B4DWT8;B4E0Y6;B4DFV2;B4DEV5;B3KP42;Q14159|.	.;.;.;.;.;.;K0146_HUMAN|.	G|A	651;591;581;156;126;126;12;12;12|333	.|.	ENSP00000297423:A651G|.	A|P	+|+	2|1	0|0	KIAA0146|KIAA0146	48777105|48777105	0.981000|0.981000	0.34729|0.34729	0.984000|0.984000	0.44739|0.44739	0.433000|0.433000	0.31745|0.31745	2.015000|2.015000	0.40961|0.40961	1.388000|1.388000	0.46506|0.46506	0.650000|0.650000	0.86243|0.86243	GCC|CCA	.		0.438	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123238013	123238013	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:123238013C>T	ENST00000264501.4	+	62	11039	c.10666C>T	c.(10666-10668)Ctg>Ttg	p.L3556L	KIAA1109_ENST00000388738.3_Silent_p.L3556L|KIAA1109_ENST00000455637.1_Silent_p.L3556L			Q2LD37	K1109_HUMAN	KIAA1109	3556					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AATAGATGATCTGAAGTATGT	0.328																																					p.L3556L		.											.	KIAA1109	80	0			c.C10666T						.						88.0	88.0	88.0					4																	123238013		1822	4084	5906	SO:0001819	synonymous_variant	84162	exon60			GATGATCTGAAGT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10666C>T	4.37:g.123238013C>T		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	16.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	37	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	C	7.460	0.644447	0.14451	.	.	ENSG00000138688	ENST00000419325	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	T	0.71256	0.3318	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69457	-0.5140	4	.	.	.	.	14.8521	0.70306	0.0:0.9294:0.0:0.0706	.	.	.	.	F	1513	.	.	S	+	2	0	KIAA1109	123457463	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	4.655000	0.61476	2.637000	0.89404	0.655000	0.94253	TCT	.		0.328	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
KIAA1210	57481	ucsc.edu;bcgsc.ca	37	X	118230610	118230610	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:118230610C>A	ENST00000402510.2	-	8	1112	c.1113G>T	c.(1111-1113)ttG>ttT	p.L371F		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	371										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CAAATGCAGTCAAGGACTGTG	0.527																																					p.L371F		.											.	KIAA1210	67	0			c.G1113T						.						80.0	82.0	81.0					X																	118230610		2059	4182	6241	SO:0001583	missense	57481	exon8			TGCAGTCAAGGAC	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1113G>T	X.37:g.118230610C>A	ENSP00000384670:p.Leu371Phe	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	60.0	5.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803729	0.31869	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.11821	2.74	4.15	-1.84	0.07809	.	.	.	.	.	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	B	0.31227	0.314	B	0.31337	0.128	T	0.37103	-0.9720	9	0.10111	T	0.7	.	0.9186	0.01310	0.1575:0.3365:0.1523:0.3537	.	371	Q9ULL0	K1210_HUMAN	F	371;207	ENSP00000384670:L371F	ENSP00000396164:L207F	L	-	3	2	RP13-347D8.5;RP13-347D8.6	118114638	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.559000	0.05971	-0.725000	0.04901	-1.049000	0.02347	TTG	.		0.527	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
KIAA1644	85352	ucsc.edu;bcgsc.ca	37	22	44692666	44692666	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr22:44692666A>T	ENST00000381176.4	-	3	299	c.167T>A	c.(166-168)tTc>tAc	p.F56Y		NM_001099294.1	NP_001092764.1	Q3SXP7	K1644_HUMAN	KIAA1644	56						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)				ACAGAGGATGAAGGTCTTGTT	0.557																																					p.F56Y		.											.	KIAA1644	23	0			c.T167A						.						173.0	191.0	185.0					22																	44692666		2138	4244	6382	SO:0001583	missense	85352	exon3			AGGATGAAGGTCT	AB051431	CCDS43025.1	22q13	2009-02-06	2009-02-06		ENSG00000138944	ENSG00000138944			29335	protein-coding gene	gene with protein product						11258795	Standard	NM_001099294		Approved		uc003bet.2	Q3SXP7	OTTHUMG00000030991	ENST00000381176.4:c.167T>A	22.37:g.44692666A>T	ENSP00000370568:p.Phe56Tyr	Somatic	73.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_001099294	A6NHP0|A9Z1Z0|Q3SXP8|Q5JZ71|Q9BYB5	Missense_Mutation	SNP	ENST00000381176.4	37	CCDS43025.1	.	.	.	.	.	.	.	.	.	.	A	7.783	0.709868	0.15239	.	.	ENSG00000138944	ENST00000381176	.	.	.	5.27	4.19	0.49359	.	0.188299	0.48286	D	0.000188	T	0.17534	0.0421	N	0.02539	-0.55	0.30930	N	0.72702	B	0.02656	0.0	B	0.06405	0.002	T	0.26292	-1.0107	8	0.02654	T	1	-18.4088	9.1698	0.37074	0.6537:0.0:0.0:0.3463	.	56	Q3SXP7	K1644_HUMAN	Y	56	.	ENSP00000370568:F56Y	F	-	2	0	KIAA1644	43023999	1.000000	0.71417	0.912000	0.35992	0.955000	0.61496	3.986000	0.56937	1.977000	0.57605	0.459000	0.35465	TTC	.		0.557	KIAA1644-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075879.2	NM_001099294	
KIF14	9928	ucsc.edu;bcgsc.ca	37	1	200544760	200544760	+	Silent	SNP	G	G	T	rs548095378		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:200544760G>T	ENST00000367350.4	-	22	3963	c.3525C>A	c.(3523-3525)ccC>ccA	p.P1175P		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1175	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						CTGTAATGTCGGGTTCCCATT	0.378																																					p.P1175P		.											.	KIF14	140	0			c.C3525A						.						107.0	101.0	103.0					1																	200544760		2203	4300	6503	SO:0001819	synonymous_variant	9928	exon22			AATGTCGGGTTCC	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.3525C>A	1.37:g.200544760G>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Silent	SNP	ENST00000367350.4	37	CCDS30963.1																																																																																			.		0.378	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
KIF15	56992	ucsc.edu;bcgsc.ca	37	3	44884683	44884683	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:44884683C>A	ENST00000326047.4	+	30	3801	c.3652C>A	c.(3652-3654)Ctg>Atg	p.L1218M	KIF15_ENST00000425755.1_Missense_Mutation_p.L853M	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	1218					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		AAACTGGCTCCTGCAAGGTCA	0.413																																					p.L1218M		.											.	KIF15	91	0			c.C3652A						.						81.0	87.0	85.0					3																	44884683		2203	4300	6503	SO:0001583	missense	56992	exon30			TGGCTCCTGCAAG	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.3652C>A	3.37:g.44884683C>A	ENSP00000324020:p.Leu1218Met	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	37	CCDS33744.1	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733122	0.69189	.	.	ENSG00000163808	ENST00000326047;ENST00000425755	T;T	0.70986	-0.53;1.61	5.36	4.47	0.54385	.	0.000000	0.38897	N	0.001529	T	0.81356	0.4805	M	0.70595	2.14	0.40942	D	0.984476	D	0.89917	1.0	D	0.71184	0.972	T	0.83177	-0.0091	10	0.66056	D	0.02	.	12.6199	0.56597	0.0:0.872:0.0:0.128	.	1218	Q9NS87	KIF15_HUMAN	M	1218;853	ENSP00000324020:L1218M;ENSP00000389982:L853M	ENSP00000324020:L1218M	L	+	1	2	KIF15	44859687	0.981000	0.34729	1.000000	0.80357	0.967000	0.64934	2.438000	0.44837	2.658000	0.90341	0.591000	0.81541	CTG	.		0.413	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
KIF16B	55614	ucsc.edu;bcgsc.ca	37	20	16360076	16360076	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:16360076T>C	ENST00000354981.2	-	19	2728	c.2571A>G	c.(2569-2571)gaA>gaG	p.E857E	KIF16B_ENST00000408042.1_Silent_p.E857E|KIF16B_ENST00000378003.2_Silent_p.E83E|KIF16B_ENST00000355755.3_Silent_p.E857E	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	857	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GGATCTCCTGTTCTTCTTGGA	0.413																																					p.E857E		.											.	KIF16B	291	0			c.A2571G						.						146.0	143.0	144.0					20																	16360076		2203	4300	6503	SO:0001819	synonymous_variant	55614	exon19			CTCCTGTTCTTCT	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2571A>G	20.37:g.16360076T>C		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	49.0	5.0	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																			.		0.413	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
KRT85	3891	ucsc.edu;bcgsc.ca	37	12	52758150	52758150	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:52758150C>A	ENST00000257901.3	-	3	705	c.630G>T	c.(628-630)aaG>aaT	p.K210N	KRT85_ENST00000544265.1_Splice_Site	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	210	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTCTTCATACCTGGGTGTGG	0.542																																					p.K210N		.											.	KRT85	91	0			c.G630T						.						75.0	74.0	74.0					12																	52758150		2203	4300	6503	SO:0001630	splice_region_variant	3891	exon3			TTCATACCTGGGT	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.630-1G>T	12.37:g.52758150C>A		Somatic	32.0	0.0		WXS	Illumina HiSeq	.	42.0	6.0	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.77|13.77	2.335556|2.335556	0.41398|0.41398	.|.	.|.	ENSG00000135443|ENSG00000135443	ENST00000544265|ENST00000257901	.|D	.|0.89050	.|-2.46	4.62|4.62	1.74|1.74	0.24563|0.24563	.|Filament (1);	.|0.204155	.|0.34362	.|N	.|0.004031	.|D	.|0.92153	.|0.7512	H|H	0.94886|0.94886	3.595|3.595	0.80722|0.80722	D|D	1|1	.|B	.|0.33135	.|0.399	.|B	.|0.41646	.|0.362	.|D	.|0.90909	.|0.4774	.|10	.|0.87932	.|D	.|0	.|.	8.7281|8.7281	0.34483|0.34483	0.0:0.5551:0.0:0.4449|0.0:0.5551:0.0:0.4449	.|.	.|210	.|P78386	.|KRT85_HUMAN	.|N	-1|210	.|ENSP00000257901:K210N	.|ENSP00000257901:K210N	.|K	-|-	.|3	.|2	KRT85|KRT85	51044417|51044417	0.994000|0.994000	0.37717|0.37717	0.997000|0.997000	0.53966|0.53966	0.887000|0.887000	0.51463|0.51463	0.451000|0.451000	0.21779|0.21779	0.573000|0.573000	0.29400|0.29400	0.561000|0.561000	0.74099|0.74099	.|AAG	.		0.542	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	Missense_Mutation
KNTC1	9735	broad.mit.edu;bcgsc.ca	37	12	123060387	123060387	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:123060387A>G	ENST00000333479.7	+	29	2704	c.2527A>G	c.(2527-2529)Aaa>Gaa	p.K843E	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	843					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AATGGAGATGAAAAAACTTTT	0.318																																					p.K843E		.											.	KNTC1	543	0			c.A2527G						.						76.0	71.0	72.0					12																	123060387		1808	4079	5887	SO:0001583	missense	9735	exon29			GAGATGAAAAAAC		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.2527A>G	12.37:g.123060387A>G	ENSP00000328236:p.Lys843Glu	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	7.0	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.599432	0.87055	.	.	ENSG00000184445	ENST00000333479	T	0.17854	2.25	5.89	5.89	0.94794	.	0.050180	0.85682	D	0.000000	T	0.25644	0.0624	L	0.54323	1.7	0.80722	D	1	D	0.53885	0.963	P	0.50082	0.63	T	0.01172	-1.1429	10	0.72032	D	0.01	-28.6866	11.3621	0.49648	0.93:0.0:0.07:0.0	.	843	P50748	KNTC1_HUMAN	E	843	ENSP00000328236:K843E	ENSP00000328236:K843E	K	+	1	0	KNTC1	121626340	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.115000	0.71566	2.246000	0.74042	0.533000	0.62120	AAA	.		0.318	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
LAMB4	22798	ucsc.edu;bcgsc.ca	37	7	107696361	107696361	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr7:107696361T>C	ENST00000388781.3	-	25	3554	c.3471A>G	c.(3469-3471)agA>agG	p.R1157R	LAMB4_ENST00000388780.3_Silent_p.R1157R|LAMB4_ENST00000205386.4_Silent_p.R1157R	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1157	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						AGCGATCACATCTCTGGCCGC	0.547																																					p.R1157R		.											.	LAMB4	140	0			c.A3471G						.						63.0	62.0	63.0					7																	107696361		2203	4300	6503	SO:0001819	synonymous_variant	22798	exon25			ATCACATCTCTGG	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.3471A>G	7.37:g.107696361T>C		Somatic	65.0	0.0		WXS	Illumina HiSeq	.	53.0	6.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Silent	SNP	ENST00000388781.3	37	CCDS34732.1																																																																																			.		0.547	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
LAMC3	10319	ucsc.edu;bcgsc.ca	37	9	133963173	133963173	+	Silent	SNP	C	C	A	rs200452667	byFrequency	TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:133963173C>A	ENST00000361069.4	+	27	4579	c.4446C>A	c.(4444-4446)atC>atA	p.I1482I	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1482	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AGAAGGACATCGAGACCTTGT	0.597																																					p.I1482I		.											.	LAMC3	93	0			c.C4446A						.						88.0	83.0	85.0					9																	133963173		2203	4300	6503	SO:0001819	synonymous_variant	10319	exon27			GGACATCGAGACC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.4446C>A	9.37:g.133963173C>A		Somatic	27.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_006059	B1APX9|B1APY0|Q59H72	Silent	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	C	0.214	-1.034247	0.02029	.	.	ENSG00000050555	ENST00000355452	.	.	.	5.13	2.28	0.28536	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999976	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.5829	0.17260	0.0:0.6591:0.1615:0.1795	.	.	.	.	X	164	.	.	S	+	2	0	LAMC3	132952994	0.065000	0.20965	0.012000	0.15200	0.000000	0.00434	0.137000	0.15995	0.197000	0.20387	-0.362000	0.07510	TCG	C|0.999;T|0.001		0.597	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
LDB3	11155	ucsc.edu;bcgsc.ca	37	10	88478562	88478562	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:88478562A>G	ENST00000361373.4	+	11	1957	c.1936A>G	c.(1936-1938)Agc>Ggc	p.S646G	LDB3_ENST00000352360.5_Missense_Mutation_p.S389G|LDB3_ENST00000458213.2_Missense_Mutation_p.S536G|LDB3_ENST00000263066.6_Missense_Mutation_p.S536G|LDB3_ENST00000429277.2_Missense_Mutation_p.S651G	NM_007078.2	NP_009009.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						TTTTGGGAACAGCCTCTTCCA	0.582																																					p.S651G		.											.	LDB3	92	0			c.A1951G						.						76.0	68.0	71.0					10																	88478562		2203	4300	6503	SO:0001583	missense	11155	exon12			GGGAACAGCCTCT	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000361373.4:c.1936A>G	10.37:g.88478562A>G	ENSP00000355296:p.Ser646Gly	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_001171610		Missense_Mutation	SNP	ENST00000361373.4	37	CCDS7377.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.961467	0.92791	.	.	ENSG00000122367	ENST00000539402;ENST00000429277;ENST00000458213;ENST00000352360;ENST00000263066;ENST00000361373	D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16	5.95	5.95	0.96441	Zinc finger, LIM-type (4);	0.000000	0.38436	N	0.001695	D	0.87799	0.6268	N	0.13043	0.29	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.988;0.998;0.978;0.998	D;D;D;D;D	0.79108	0.992;0.983;0.987;0.928;0.987	D	0.88450	0.3048	10	0.39692	T	0.17	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	651;567;389;646;536	B4E3K3;B4DGP4;O75112-3;O75112;O75112-2	.;.;.;LDB3_HUMAN;.	G	567;651;536;389;536;646	ENSP00000401437:S651G;ENSP00000409148:S536G;ENSP00000263067:S389G;ENSP00000263066:S536G;ENSP00000355296:S646G	ENSP00000263066:S536G	S	+	1	0	LDB3	88468542	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.339000	0.96797	2.279000	0.76181	0.533000	0.62120	AGC	.		0.582	LDB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000049160.2		
LGR6	59352	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202287962	202287962	+	Missense_Mutation	SNP	G	G	A	rs374809410		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:202287962G>A	ENST00000367278.3	+	18	2620	c.2531G>A	c.(2530-2532)cGc>cAc	p.R844H	LGR6_ENST00000255432.7_Missense_Mutation_p.R792H|LGR6_ENST00000439764.2_Missense_Mutation_p.R705H	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	844					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						CTTCGGCCCCGCGCAGGGGAC	0.652																																					p.R844H		.											.	LGR6	160	0			c.G2531A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	59.0	67.0	64.0		2531,2114,2375	1.2	0.0	1		64	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	LGR6	NM_001017403.1,NM_001017404.1,NM_021636.2	29,29,29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,benign,benign	844/968,705/829,792/916	202287962	2,13004	2203	4300	6503	SO:0001583	missense	59352	exon18			GGCCCCGCGCAGG	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.2531G>A	1.37:g.202287962G>A	ENSP00000356247:p.Arg844His	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	13.0	NM_001017403	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	37	CCDS30971.1	.	.	.	.	.	.	.	.	.	.	G	2.995	-0.207318	0.06180	2.27E-4	1.16E-4	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	T;T;T	0.39592	1.07;1.07;1.07	4.46	1.19	0.21007	.	1.197620	0.05562	N	0.569510	T	0.27866	0.0686	L	0.38175	1.15	0.09310	N	1	P;B;P	0.44090	0.826;0.02;0.733	B;B;B	0.34722	0.188;0.009;0.068	T	0.21827	-1.0234	10	0.31617	T	0.26	.	4.8154	0.13363	0.3462:0.1599:0.4938:0.0	.	705;792;844	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	H	844;792;705	ENSP00000356247:R844H;ENSP00000255432:R792H;ENSP00000387869:R705H	ENSP00000255432:R792H	R	+	2	0	LGR6	200554585	0.000000	0.05858	0.011000	0.14972	0.095000	0.18619	0.029000	0.13666	0.576000	0.29452	-0.350000	0.07774	CGC	.		0.652	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
LIPA	3988	ucsc.edu;bcgsc.ca	37	10	90988121	90988121	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:90988121C>A	ENST00000336233.5	-	4	586	c.264G>T	c.(262-264)ttG>ttT	p.L88F	LIPA_ENST00000456827.1_Missense_Mutation_p.L88F|LIPA_ENST00000371837.1_Missense_Mutation_p.L32F			P38571	LICH_HUMAN	lipase A, lysosomal acid, cholesterol esterase	88					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cytokine production (GO:0001816)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|lung development (GO:0030324)|tissue remodeling (GO:0048771)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	lipase activity (GO:0016298)|sterol esterase activity (GO:0004771)			endometrium(1)|large_intestine(2)|lung(3)	6		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)		AATCTGCCAGCAAGCCATGTT	0.463																																					p.L88F		.											.	LIPA	90	0			c.G264T						.						91.0	89.0	90.0					10																	90988121		2203	4300	6503	SO:0001583	missense	3988	exon4			TGCCAGCAAGCCA	M74775	CCDS7401.1, CCDS73160.1	10q23.2-q23.3	2012-07-13	2008-08-01		ENSG00000107798	ENSG00000107798	3.1.1.13		6617	protein-coding gene	gene with protein product	"""Wolman disease"""	613497				8432549	Standard	NM_000235		Approved	LAL, CESD	uc009xtq.3	P38571	OTTHUMG00000018716	ENST00000336233.5:c.264G>T	10.37:g.90988121C>A	ENSP00000337354:p.Leu88Phe	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_000235	B2RBH5|D3DR29|Q16529|Q53H21|Q5T074|Q5T771|Q96EJ0	Missense_Mutation	SNP	ENST00000336233.5	37	CCDS7401.1	.	.	.	.	.	.	.	.	.	.	C	9.658	1.143450	0.21205	.	.	ENSG00000107798	ENST00000336233;ENST00000371837;ENST00000371829;ENST00000541980;ENST00000354621;ENST00000456827;ENST00000425287;ENST00000542307;ENST00000428800;ENST00000282673	D;D;D;D;D	0.95377	-3.69;-3.69;-3.69;-3.69;-3.69	4.31	-4.73	0.03259	Partial AB-hydrolase lipase domain (1);	0.137837	0.42682	N	0.000662	D	0.92476	0.7611	M	0.69523	2.12	0.49915	D	0.999837	B;B;B	0.26002	0.139;0.054;0.08	B;B;B	0.36244	0.067;0.04;0.22	T	0.78743	-0.2085	10	0.44086	T	0.13	-0.7084	4.5693	0.12202	0.4081:0.2315:0.2934:0.067	.	83;32;88	E7EUT7;P38571-2;P38571	.;.;LICH_HUMAN	F	88;32;88;88;46;88;83;88;88;88	ENSP00000337354:L88F;ENSP00000360903:L32F;ENSP00000413019:L88F;ENSP00000388415:L88F;ENSP00000282673:L88F	ENSP00000282673:L88F	L	-	3	2	LIPA	90978101	0.001000	0.12720	0.628000	0.29241	0.639000	0.38242	-1.677000	0.01944	-0.941000	0.03700	-0.136000	0.14681	TTG	.		0.463	LIPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049308.1	NM_000235	
LPHN2	23266	ucsc.edu;bcgsc.ca	37	1	82417786	82417786	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:82417786A>G	ENST00000370728.1	+	11	2387	c.1742A>G	c.(1741-1743)aAa>aGa	p.K581R	LPHN2_ENST00000370727.1_Missense_Mutation_p.K581R|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000394879.1_Missense_Mutation_p.K581R|LPHN2_ENST00000271029.4_Missense_Mutation_p.K581R|LPHN2_ENST00000370721.1_Missense_Mutation_p.K519R|LPHN2_ENST00000370715.1_Missense_Mutation_p.K581R|LPHN2_ENST00000335786.5_Missense_Mutation_p.K581R|LPHN2_ENST00000370717.2_Missense_Mutation_p.K581R|LPHN2_ENST00000370730.1_Missense_Mutation_p.K581R|LPHN2_ENST00000370725.1_Missense_Mutation_p.K581R|LPHN2_ENST00000359929.3_Missense_Mutation_p.K581R|LPHN2_ENST00000370723.1_Missense_Mutation_p.K581R|LPHN2_ENST00000319517.6_Missense_Mutation_p.K581R|LPHN2_ENST00000370713.1_Missense_Mutation_p.K581R			O95490	LPHN2_HUMAN	latrophilin 2	581					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CAGGAACTGAAACCTAGTGAA	0.433																																					p.K581R		.											.	LPHN2	525	0			c.A1742G						.						123.0	110.0	115.0					1																	82417786		2203	4300	6503	SO:0001583	missense	23266	exon8			AACTGAAACCTAG	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1742A>G	1.37:g.82417786A>G	ENSP00000359763:p.Lys581Arg	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	63.0	5.0	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.822|0.822	-0.748451|-0.748451	0.03065|0.03065	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786|ENST00000449420	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.09445|.	2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98;2.98|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.174356|.	0.47852|.	D|.	0.000210|.	T|T	0.10078|0.10078	0.0247|0.0247	N|N	0.01464|0.01464	-0.85|-0.85	0.36247|0.36247	D|D	0.853664|0.853664	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.001;0.001|.	T|T	0.19549|0.19549	-1.0302|-1.0302	10|5	0.02654|.	T|.	1|.	.|.	11.338|11.338	0.49516|0.49516	0.9251:0.0:0.0749:0.0|0.9251:0.0:0.0749:0.0	.|.	581;581;581|.	O95490-3;O95490-4;O95490-2|.	.;.;.|.	R|D	519;581;581;581;581;581;581;581;581;581;581;581;581;581|449	ENSP00000359756:K519R;ENSP00000359763:K581R;ENSP00000359765:K581R;ENSP00000359762:K581R;ENSP00000359760:K581R;ENSP00000359758:K581R;ENSP00000353006:K581R;ENSP00000359750:K581R;ENSP00000359748:K581R;ENSP00000322270:K581R;ENSP00000359752:K581R;ENSP00000378344:K581R;ENSP00000271029:K581R;ENSP00000337306:K581R|.	ENSP00000271029:K581R|.	K|N	+|+	2|1	0|0	LPHN2|LPHN2	82190374|82190374	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.917000|0.917000	0.54804|0.54804	3.335000|3.335000	0.52105|0.52105	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	AAA|AAC	.		0.433	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	
LPIN2	9663	ucsc.edu;bcgsc.ca	37	18	2920361	2920361	+	Missense_Mutation	SNP	C	C	A	rs201160155	byFrequency	TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:2920361C>A	ENST00000261596.4	-	20	2859	c.2621G>T	c.(2620-2622)tGc>tTc	p.C874F	RP11-737O24.5_ENST00000608032.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	874					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GAACTCCGGGCAGGGAAAAGC	0.577													C|||	9	0.00179712	0.0	0.0	5008	,	,		22239	0.0		0.0	False		,,,				2504	0.0092				p.C874F		.											.	LPIN2	227	0			c.G2621T						.	C	PHE/CYS	0,4406		0,0,2203	56.0	50.0	52.0		2621	4.7	1.0	18		52	2,8598	1.2+/-3.3	0,2,4298	no	missense	LPIN2	NM_014646.2	205	0,2,6501	AA,AC,CC		0.0233,0.0,0.0154	benign	874/897	2920361	2,13004	2203	4300	6503	SO:0001583	missense	9663	exon20			TCCGGGCAGGGAA	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.2621G>T	18.37:g.2920361C>A	ENSP00000261596:p.Cys874Phe	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_014646	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476587	0.26511	0.0	2.33E-4	ENSG00000101577	ENST00000261596	T	0.80738	-1.41	5.62	4.74	0.60224	.	0.270733	0.48767	D	0.000167	T	0.75376	0.3841	L	0.48362	1.52	0.54753	D	0.999983	B	0.14805	0.011	B	0.16289	0.015	T	0.72398	-0.4306	10	0.54805	T	0.06	.	14.3048	0.66377	0.0:0.9287:0.0:0.0713	.	874	Q92539	LPIN2_HUMAN	F	874	ENSP00000261596:C874F	ENSP00000261596:C874F	C	-	2	0	LPIN2	2910361	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.590000	0.36654	2.804000	0.96469	0.655000	0.94253	TGC	C|0.999;A|0.001		0.577	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
LRBA	987	ucsc.edu;bcgsc.ca	37	4	151408925	151408925	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:151408925A>G	ENST00000357115.3	-	43	6786	c.6543T>C	c.(6541-6543)ccT>ccC	p.P2181P	LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000510413.1_Silent_p.P2170P|LRBA_ENST00000535741.1_Silent_p.P2170P|LRBA_ENST00000507224.1_Silent_p.P2170P	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2181						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CGCCAACACGAGGTAGATAGT	0.343																																					p.P2181P		.											.	LRBA	157	0			c.T6543C						.						126.0	116.0	120.0					4																	151408925		2203	4299	6502	SO:0001819	synonymous_variant	987	exon43			AACACGAGGTAGA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6543T>C	4.37:g.151408925A>G		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	51.0	4.0	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.414831	0.25465	.	.	ENSG00000198589	ENST00000509835	.	.	.	5.53	1.54	0.23209	.	.	.	.	.	T	0.45816	0.1361	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22695	-1.0209	4	.	.	.	.	3.7373	0.08515	0.582:0.0:0.1464:0.2716	.	.	.	.	P	823	.	.	L	-	2	0	LRBA	151628375	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	1.301000	0.33447	0.036000	0.15547	0.477000	0.44152	CTC	.		0.343	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
LRAT	9227	ucsc.edu;bcgsc.ca	37	4	155665881	155665881	+	Missense_Mutation	SNP	G	G	A	rs139819099	byFrequency	TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:155665881G>A	ENST00000336356.3	+	2	656	c.403G>A	c.(403-405)Gca>Aca	p.A135T	LRAT_ENST00000507827.1_Missense_Mutation_p.A135T	NM_004744.3	NP_004735.2	O95237	LRAT_HUMAN	lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)	135					phototransduction, visible light (GO:0007603)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)	phosphatidylcholine-retinol O-acyltransferase activity (GO:0047173)|retinoic acid binding (GO:0001972)|retinol binding (GO:0019841)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)	16	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	CCAGAAAAAGGCACTGCTCAA	0.572																																					p.A135T		.											.	LRAT	90	0			c.G403A						.						58.0	62.0	60.0					4																	155665881		2203	4300	6503	SO:0001583	missense	9227	exon2			AAAAAGGCACTGC	AF071510	CCDS3789.1	4q32.1	2014-01-28			ENSG00000121207	ENSG00000121207	2.3.1.135		6685	protein-coding gene	gene with protein product		604863				9920938	Standard	XM_006714412		Approved	LCA14	uc003ion.1	O95237	OTTHUMG00000161418	ENST00000336356.3:c.403G>A	4.37:g.155665881G>A	ENSP00000337224:p.Ala135Thr	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_004744	A8K983|Q8N716	Missense_Mutation	SNP	ENST00000336356.3	37	CCDS3789.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.866436	0.72065	.	.	ENSG00000121207	ENST00000507827;ENST00000336356	T;T	0.22743	1.94;1.94	5.5	4.63	0.57726	NC (1);	0.335255	0.35013	N	0.003518	T	0.27027	0.0662	M	0.65498	2.005	0.35191	D	0.773344	P	0.45044	0.849	B	0.44315	0.446	T	0.40459	-0.9562	10	0.40728	T	0.16	-17.2061	10.9278	0.47201	0.0:0.1363:0.713:0.1507	.	135	O95237	LRAT_HUMAN	T	135	ENSP00000426761:A135T;ENSP00000337224:A135T	ENSP00000337224:A135T	A	+	1	0	LRAT	155885331	0.886000	0.30341	1.000000	0.80357	0.923000	0.55619	1.222000	0.32515	1.272000	0.44329	0.549000	0.68633	GCA	G|0.999;T|0.001		0.572	LRAT-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365246.1	NM_004744	
LRRC32	2615	ucsc.edu;bcgsc.ca	37	11	76371606	76371606	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:76371606A>G	ENST00000407242.2	-	3	1273	c.1031T>C	c.(1030-1032)cTg>cCg	p.L344P	LRRC32_ENST00000404995.1_Missense_Mutation_p.L344P|LRRC32_ENST00000260061.5_Missense_Mutation_p.L344P|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000464145.1_Intron	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	344					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GCTGAGGTTCAGGAAGCACAG	0.567																																					p.L344P		.											.	LRRC32	90	0			c.T1031C						.						31.0	32.0	32.0					11																	76371606		2200	4292	6492	SO:0001583	missense	2615	exon3			AGGTTCAGGAAGC	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1031T>C	11.37:g.76371606A>G	ENSP00000384126:p.Leu344Pro	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_005512	Q86V06	Missense_Mutation	SNP	ENST00000407242.2	37	CCDS8245.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.118305	0.56505	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.21932	1.98;1.98;1.98	4.26	4.26	0.50523	.	0.000000	0.64402	D	0.000001	T	0.54775	0.1879	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67425	-0.5674	10	0.87932	D	0	.	13.5366	0.61650	1.0:0.0:0.0:0.0	.	344	Q14392	LRC32_HUMAN	P	344	ENSP00000260061:L344P;ENSP00000384126:L344P;ENSP00000385766:L344P	ENSP00000260061:L344P	L	-	2	0	LRRC32	76049254	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.859000	0.92264	1.798000	0.52647	0.397000	0.26171	CTG	.		0.567	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
LRRC38	126755	ucsc.edu;bcgsc.ca	37	1	13839496	13839496	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:13839496A>G	ENST00000376085.3	-	1	1047	c.593T>C	c.(592-594)tTc>tCc	p.F198S	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	198	LRRCT.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GATCCAGGAGAAGAGGTGGGC	0.706																																					p.F198S		.											.	.	.	0			c.T593C						.																																			SO:0001583	missense	126755	exon1			CAGGAGAAGAGGT	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.593T>C	1.37:g.13839496A>G	ENSP00000365253:p.Phe198Ser	Somatic	95.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001010847	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	37	CCDS53269.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759041	0.69763	.	.	ENSG00000162494	ENST00000376085	T	0.02498	4.27	4.96	3.83	0.44106	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.01835	0.0058	N	0.13272	0.32	0.58432	D	0.999997	B	0.28998	0.23	B	0.31495	0.131	T	0.43669	-0.9377	10	0.05525	T	0.97	.	9.523	0.39147	0.9153:0.0:0.0847:0.0	.	198	Q5VT99	LRC38_HUMAN	S	198	ENSP00000365253:F198S	ENSP00000365253:F198S	F	-	2	0	LRRC38	13712083	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	2.980000	0.49321	0.735000	0.32537	-0.407000	0.06327	TTC	.		0.706	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
LRRC73	221424	ucsc.edu;bcgsc.ca	37	6	43476630	43476630	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:43476630C>A	ENST00000372441.1	-	2	1201	c.301G>T	c.(301-303)Ggg>Tgg	p.G101W		NM_001012974.1	NP_001012992.1	Q5JTD7	LRC73_HUMAN	leucine rich repeat containing 73	101																	AAGGCCAGCCCCGCATCTGTC	0.617																																					p.G101W		.											.	.	.	0			c.G301T						.						27.0	26.0	27.0					6																	43476630		2202	4299	6501	SO:0001583	missense	221424	exon2			CCAGCCCCGCATC		CCDS34456.1	6p21.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000204052	ENSG00000204052			21375	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 154"""	C6orf154			Standard	NM_001012974		Approved	dJ337H4.2	uc003ovk.2	Q5JTD7	OTTHUMG00000014737	ENST00000372441.1:c.301G>T	6.37:g.43476630C>A	ENSP00000361518:p.Gly101Trp	Somatic	79.0	0.0		WXS	Illumina HiSeq	.	52.0	4.0	NM_001012974		Missense_Mutation	SNP	ENST00000372441.1	37	CCDS34456.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651607	0.67472	.	.	ENSG00000204052	ENST00000372441	T	0.62232	0.04	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.81307	0.4795	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86152	0.1588	10	0.87932	D	0	-12.0007	16.0434	0.80701	0.0:1.0:0.0:0.0	.	101	Q5JTD7	CF154_HUMAN	W	101	ENSP00000361518:G101W	ENSP00000361518:G101W	G	-	1	0	C6orf154	43584608	1.000000	0.71417	0.702000	0.30337	0.562000	0.35680	7.065000	0.76727	2.362000	0.80069	0.563000	0.77884	GGG	.		0.617	LRRC73-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040635.1	NM_001012974	
LRRC8A	56262	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131678510	131678510	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:131678510C>T	ENST00000259324.5	+	4	2816	c.2293C>T	c.(2293-2295)Cgg>Tgg	p.R765W	LRRC8A_ENST00000492784.1_3'UTR|LRRC8A_ENST00000372600.4_Missense_Mutation_p.R765W|LRRC8A_ENST00000372599.3_Missense_Mutation_p.R765W	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	765					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						GCGGGGCAACCGGCTGGAGTG	0.667																																					p.R765W		.											.	LRRC8A	90	0			c.C2293T						.						44.0	43.0	43.0					9																	131678510		2203	4300	6503	SO:0001583	missense	56262	exon4			GGCAACCGGCTGG	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.2293C>T	9.37:g.131678510C>T	ENSP00000259324:p.Arg765Trp	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	7.0	NM_001127244	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	ENST00000259324.5	37	CCDS35155.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349296	0.41599	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.60040	0.22;0.22;0.22	5.03	3.14	0.36123	.	0.000000	0.85682	D	0.000000	T	0.72898	0.3518	M	0.81239	2.535	0.58432	D	0.999995	D	0.71674	0.998	D	0.64237	0.923	T	0.72969	-0.4130	10	0.40728	T	0.16	.	13.1081	0.59259	0.2925:0.7075:0.0:0.0	.	765	Q8IWT6	LRC8A_HUMAN	W	765	ENSP00000361682:R765W;ENSP00000361680:R765W;ENSP00000259324:R765W	ENSP00000259324:R765W	R	+	1	2	LRRC8A	130718331	1.000000	0.71417	1.000000	0.80357	0.359000	0.29487	3.686000	0.54685	0.505000	0.28104	-0.656000	0.03901	CGG	.		0.667	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054516.2	NM_019594	
MAATS1	89876	ucsc.edu;bcgsc.ca	37	3	119434475	119434475	+	Silent	SNP	G	G	A	rs560430820		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:119434475G>A	ENST00000273390.5	+	6	644	c.567G>A	c.(565-567)gtG>gtA	p.V189V	MAATS1_ENST00000463700.1_Silent_p.V189V	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	189						mitochondrion (GO:0005739)											AGTCTACTGTGGGCACTCAGA	0.428													G|||	1	0.000199681	0.0	0.0	5008	,	,		20673	0.0		0.0	False		,,,				2504	0.001				p.V189V		.											.	.	.	0			c.G567A						.						190.0	185.0	187.0					3																	119434475		2203	4300	6503	SO:0001819	synonymous_variant	89876	exon6			TACTGTGGGCACT	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.567G>A	3.37:g.119434475G>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_033364	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Silent	SNP	ENST00000273390.5	37	CCDS2994.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008301	0.54361	.	.	ENSG00000183833	ENST00000383667	.	.	.	5.32	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.03	8.2751	0.31868	0.1349:0.1559:0.7092:0.0	.	.	.	.	X	167	.	ENSP00000373163:W167X	W	+	2	0	C3orf15	120917165	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.381000	0.34362	2.488000	0.83962	0.585000	0.79938	TGG	.		0.428	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364	
MAGEF1	64110	ucsc.edu;bcgsc.ca	37	3	184429305	184429305	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:184429305A>G	ENST00000317897.3	-	1	531	c.305T>C	c.(304-306)aTg>aCg	p.M102T		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	102	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			GTATTTCACCATCTCCGAGCG	0.542																																					p.M102T		.											.	MAGEF1	91	0			c.T305C						.						135.0	141.0	139.0					3																	184429305		2203	4300	6503	SO:0001583	missense	64110	exon1			TTCACCATCTCCG	AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.305T>C	3.37:g.184429305A>G	ENSP00000315064:p.Met102Thr	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_022149	Q9H215	Missense_Mutation	SNP	ENST00000317897.3	37	CCDS3269.1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.551422	0.45487	.	.	ENSG00000177383	ENST00000317897	T	0.05382	3.45	4.22	1.12	0.20585	.	0.281459	0.36519	N	0.002556	T	0.09423	0.0232	M	0.61703	1.905	0.23449	N	0.997659	P	0.37548	0.599	P	0.45276	0.475	T	0.15321	-1.0441	10	0.87932	D	0	.	3.416	0.07376	0.6082:0.2131:0.1787:0.0	.	102	Q9HAY2	MAGF1_HUMAN	T	102	ENSP00000315064:M102T	ENSP00000315064:M102T	M	-	2	0	MAGEF1	185911999	0.020000	0.18652	0.514000	0.27761	0.929000	0.56500	0.010000	0.13242	0.106000	0.17784	0.533000	0.62120	ATG	.		0.542	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1	NM_022149	
MAPK13	5603	ucsc.edu;bcgsc.ca	37	6	36100412	36100412	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:36100412G>A	ENST00000211287.4	+	3	526	c.264G>A	c.(262-264)ctG>ctA	p.L88L	MAPK13_ENST00000373766.5_Silent_p.L88L|MAPK13_ENST00000373761.6_Silent_p.L88L|MAPK13_ENST00000373759.1_Silent_p.L10L|MAPK13_ENST00000490334.1_3'UTR	NM_002754.4	NP_002745.1	O15264	MK13_HUMAN	mitogen-activated protein kinase 13	88	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 production (GO:0032755)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|prostate(2)|skin(1)	12						TTGGGCTCCTGGATGTCTTCA	0.607																																					p.L88L		.											.	MAPK13	1521	0			c.G264A						.						162.0	139.0	147.0					6																	36100412		2203	4300	6503	SO:0001819	synonymous_variant	5603	exon3			GCTCCTGGATGTC	Y10488	CCDS4818.1	6p21	2011-06-09			ENSG00000156711	ENSG00000156711	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6875	protein-coding gene	gene with protein product		602899		PRKM13		9295308, 9218798	Standard	NM_002754		Approved	SAPK4, p38delta	uc003ols.4	O15264	OTTHUMG00000014587	ENST00000211287.4:c.264G>A	6.37:g.36100412G>A		Somatic	58.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_002754	O14739|O15124|Q5U4A5|Q6FI46|Q9UNU0	Silent	SNP	ENST00000211287.4	37	CCDS4818.1																																																																																			.		0.607	MAPK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040328.1		
MATN2	4147	ucsc.edu;bcgsc.ca	37	8	98973649	98973649	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:98973649T>C	ENST00000520016.1	+	4	973	c.849T>C	c.(847-849)tgT>tgC	p.C283C	MATN2_ENST00000524308.1_Silent_p.C283C|MATN2_ENST00000521689.1_Silent_p.C283C|MATN2_ENST00000254898.5_Silent_p.C283C|MATN2_ENST00000522025.2_5'UTR			O00339	MATN2_HUMAN	matrilin 2	283	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			AGGATCTGTGTGCCATGGAGG	0.572																																					p.C283C		.											.	MATN2	24	0			c.T849C						.						173.0	170.0	171.0					8																	98973649		2128	4244	6372	SO:0001819	synonymous_variant	4147	exon5			TCTGTGTGCCATG	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.849T>C	8.37:g.98973649T>C		Somatic	34.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Silent	SNP	ENST00000520016.1	37	CCDS55264.1	.	.	.	.	.	.	.	.	.	.	T	10.07	1.250819	0.22880	.	.	ENSG00000132561	ENST00000521041	D	0.99966	-10.09	4.67	2.27	0.28462	.	0.000000	0.64402	D	0.000008	D	0.99949	0.9978	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.94456	0.7672	7	0.87932	D	0	-12.8762	6.2188	0.20669	0.0:0.2026:0.0:0.7974	.	.	.	.	R	38	ENSP00000430396:C38R	ENSP00000430396:C38R	C	+	1	0	MATN2	99042825	1.000000	0.71417	0.994000	0.49952	0.965000	0.64279	0.364000	0.20325	0.387000	0.25024	0.533000	0.62120	TGC	.		0.572	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
MCM3AP	8888	ucsc.edu;bcgsc.ca	37	21	47686021	47686021	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr21:47686021T>C	ENST00000397708.1	-	12	3103	c.2849A>G	c.(2848-2850)aAg>aGg	p.K950R	MCM3AP_ENST00000291688.1_Missense_Mutation_p.K950R			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	950	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AAACACCGACTTCCTGGTCTT	0.572																																					p.K950R		.											.	MCM3AP	291	0			c.A2849G						.						156.0	168.0	164.0					21																	47686021		2203	4300	6503	SO:0001583	missense	8888	exon11			ACCGACTTCCTGG	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2849A>G	21.37:g.47686021T>C	ENSP00000380820:p.Lys950Arg	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.047857	0.36085	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.03524	3.9;3.9	5.67	4.53	0.55603	.	0.085942	0.85682	D	0.000000	T	0.04363	0.0120	L	0.43152	1.355	0.47341	D	0.999398	B	0.20887	0.049	B	0.22880	0.042	T	0.44143	-0.9347	10	0.25751	T	0.34	-36.5182	11.0685	0.47989	0.0:0.0723:0.0:0.9277	.	950	O60318	MCM3A_HUMAN	R	950	ENSP00000380820:K950R;ENSP00000291688:K950R	ENSP00000291688:K950R	K	-	2	0	MCM3AP	46510449	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	2.834000	0.48167	2.165000	0.68154	0.533000	0.62120	AAG	.		0.572	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
MDN1	23195	ucsc.edu;bcgsc.ca	37	6	90353833	90353833	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:90353833A>G	ENST00000369393.3	-	102	16797	c.16682T>C	c.(16681-16683)tTc>tCc	p.F5561S	MDN1_ENST00000428876.1_Missense_Mutation_p.F5561S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5561	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGGGAATGGGAACTCTTCCAT	0.438																																					p.F5561S		.											.	MDN1	100	0			c.T16682C						.						189.0	169.0	176.0					6																	90353833		2203	4300	6503	SO:0001583	missense	23195	exon102			AATGGGAACTCTT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.16682T>C	6.37:g.90353833A>G	ENSP00000358400:p.Phe5561Ser	Somatic	104.0	0.0		WXS	Illumina HiSeq	.	54.0	5.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.223563	0.58668	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.21191	2.02;2.02	5.83	5.83	0.93111	von Willebrand factor, type A (2);	0.000000	0.85682	D	0.000000	T	0.51329	0.1668	M	0.93898	3.47	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.66126	-0.6001	10	0.87932	D	0	.	16.1988	0.82053	1.0:0.0:0.0:0.0	.	5561	Q9NU22	MDN1_HUMAN	S	5561	ENSP00000358400:F5561S;ENSP00000413970:F5561S	ENSP00000358400:F5561S	F	-	2	0	MDN1	90410554	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.678000	0.91211	2.230000	0.72887	0.454000	0.30748	TTC	.		0.438	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
MED27	9442	ucsc.edu;bcgsc.ca	37	9	134955144	134955144	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:134955144T>C	ENST00000292035.5	-	1	151	c.88A>G	c.(88-90)Agg>Ggg	p.R30G	RP11-32B11.2_ENST00000444872.2_RNA|MED27_ENST00000474263.1_Missense_Mutation_p.R30G|MED27_ENST00000357028.2_Missense_Mutation_p.R30G	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	30					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		TCGAACACCCTGCTCACGCTG	0.587																																					p.R30G	Colon(41;784 923 6932 42329 52483)	.											.	MED27	69	0			c.A88G						.						57.0	56.0	56.0					9																	134955144		2203	4300	6503	SO:0001583	missense	9442	exon1			ACACCCTGCTCAC	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.88A>G	9.37:g.134955144T>C	ENSP00000292035:p.Arg30Gly	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_001253881	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	ENST00000292035.5	37	CCDS6945.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.215041	0.79352	.	.	ENSG00000160563	ENST00000292035;ENST00000372184	.	.	.	5.59	3.28	0.37604	.	0.000000	0.85682	D	0.000000	T	0.67581	0.2908	L	0.51422	1.61	0.58432	D	0.999996	D;D;D	0.57899	0.978;0.981;0.967	P;D;P	0.66351	0.647;0.943;0.879	T	0.69577	-0.5108	9	0.66056	D	0.02	-0.6942	12.6677	0.56851	0.0:0.0:0.4349:0.5651	.	30;30;30	B4DPP5;Q6P2C8-2;Q6P2C8	.;.;MED27_HUMAN	G	30	.	ENSP00000292035:R30G	R	-	1	2	MED27	133944965	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.887000	0.39698	0.926000	0.37118	0.528000	0.53228	AGG	.		0.587	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
MEGF8	1954	ucsc.edu;bcgsc.ca	37	19	42839306	42839306	+	Silent	SNP	T	T	C	rs373385185		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:42839306T>C	ENST00000251268.6	+	4	678	c.678T>C	c.(676-678)tcT>tcC	p.S226S	MEGF8_ENST00000334370.4_Silent_p.S226S	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	226					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CTGCCTTCTCTGCCCGTATTG	0.652																																					p.S226S		.											.	MEGF8	23	0			c.T678C						.	T		2,4064		0,2,2031	31.0	37.0	35.0		678	-5.8	1.0	19		35	0,8328		0,0,4164	no	coding-synonymous	MEGF8	NM_001410.2		0,2,6195	CC,CT,TT		0.0,0.0492,0.0161		226/2779	42839306	2,12392	2033	4164	6197	SO:0001819	synonymous_variant	1954	exon4			CTTCTCTGCCCGT	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.678T>C	19.37:g.42839306T>C		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_001271938	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																				.		0.652	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
METTL21B	25895	ucsc.edu;bcgsc.ca	37	12	58163694	58163694	+	5'Flank	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:58163694T>C	ENST00000300209.8	+	0	0				METTL21B_ENST00000333012.5_5'Flank|METTL1_ENST00000324871.7_Missense_Mutation_p.E107G|CYP27B1_ENST00000228606.4_5'Flank|METTL21B_ENST00000548256.1_5'Flank|METTL1_ENST00000548681.1_5'Flank|METTL1_ENST00000257848.7_Intron|METTL21B_ENST00000551420.1_5'Flank	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						CACCCGGATCTCCAGACCCAG	0.512																																					p.E107G		.											.	METTL1	492	0			c.A320G						.						45.0	41.0	42.0					12																	58163694		2203	4300	6503	SO:0001631	upstream_gene_variant	4234	exon3			CGGATCTCCAGAC	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58163694T>C	Exception_encountered	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_005371	Q9H749|Q9Y3W2	Missense_Mutation	SNP	ENST00000300209.8	37	CCDS8957.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.759005	0.89843	.	.	ENSG00000037897	ENST00000324871	T	0.55413	0.52	4.88	4.88	0.63580	.	0.166954	0.50627	N	0.000102	T	0.81522	0.4840	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87820	0.2637	10	0.87932	D	0	-18.6845	13.4567	0.61204	0.0:0.0:0.0:1.0	.	107	Q9UBP6	TRMB_HUMAN	G	107	ENSP00000314441:E107G	ENSP00000314441:E107G	E	-	2	0	METTL1	56449961	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.020000	0.76419	1.837000	0.53436	0.533000	0.62120	GAG	.		0.512	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
MIR200A	406983	broad.mit.edu;mdanderson.org	37	1	1103284	1103284	+	lincRNA	SNP	C	C	G	rs202051309	byFrequency	TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:1103284C>G	ENST00000606993.1	+	0	0				MIR429_ENST00000362106.1_RNA|MIR200A_ENST00000384875.1_RNA|MIR200B_ENST00000384997.1_RNA																							GCTGGATTTCCCAGCTTGACT	0.637																																					.		.											.	.	.	0			.						.						39.0	39.0	39.0					1																	1103284		1562	3580	5142			406983	.			GATTTCCCAGCTT																													1.37:g.1103284C>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	16.0	.		RNA	SNP	ENST00000606993.1	37																																																																																				C|0.996;T|0.004		0.637	RP11-465B22.8-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000470776.1		
MLF2	8079	ucsc.edu;bcgsc.ca	37	12	6861205	6861205	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:6861205A>G	ENST00000203630.5	-	3	710	c.66T>C	c.(64-66)atT>atC	p.I22I	MLF2_ENST00000564181.1_5'Flank|MLF2_ENST00000539187.1_Silent_p.I22I|MLF2_ENST00000435120.1_Silent_p.I22I|MLF2_ENST00000542154.1_Silent_p.I22I			Q15773	MLF2_HUMAN	myeloid leukemia factor 2	22					defense response (GO:0006952)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(2)|large_intestine(3)|lung(4)	9						GCTGACGGTGAATAGCAAAGG	0.532											OREG0021633	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I22I		.											.	MLF2	153	0			c.T66C						.						88.0	79.0	82.0					12																	6861205		2203	4300	6503	SO:0001819	synonymous_variant	8079	exon3			ACGGTGAATAGCA	U57342	CCDS8559.1	12p13.31	2014-09-11			ENSG00000089693	ENSG00000089693			7126	protein-coding gene	gene with protein product		601401				8661158	Standard	NM_005439		Approved	NTN4	uc010sfi.2	Q15773	OTTHUMG00000168717	ENST00000203630.5:c.66T>C	12.37:g.6861205A>G		Somatic	35.0	0.0	637	WXS	Illumina HiSeq	.	43.0	4.0	NM_005439		Silent	SNP	ENST00000203630.5	37	CCDS8559.1																																																																																			.		0.532	MLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400733.2		
KMT2A	4297	ucsc.edu;bcgsc.ca	37	11	118343416	118343416	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:118343416C>T	ENST00000389506.5	+	3	1542	c.1542C>T	c.(1540-1542)ccC>ccT	p.P514P	KMT2A_ENST00000534358.1_Silent_p.P514P|KMT2A_ENST00000354520.4_Silent_p.P514P			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	514					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CTCCACTGCCCATTTCCCAGT	0.478																																					p.P514P		.											.	MLL	1255	0			c.C1542T						.						96.0	102.0	100.0					11																	118343416		2200	4296	6496	SO:0001819	synonymous_variant	4297	exon3			ACTGCCCATTTCC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.1542C>T	11.37:g.118343416C>T		Somatic	34.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	ENST00000389506.5	37	CCDS31686.1																																																																																			.		0.478	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
MMP15	4324	ucsc.edu;bcgsc.ca	37	16	58075733	58075733	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:58075733G>T	ENST00000219271.3	+	6	1908	c.1123G>T	c.(1123-1125)Gac>Tac	p.D375Y		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	375					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	CGGGGACTTTGACACAGTGGC	0.682																																					p.D375Y		.											.	MMP15	713	0			c.G1123T						.						53.0	55.0	54.0					16																	58075733		2198	4300	6498	SO:0001583	missense	4324	exon6			GACTTTGACACAG	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.1123G>T	16.37:g.58075733G>T	ENSP00000219271:p.Asp375Tyr	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_002428	A0A2U6|Q14111	Missense_Mutation	SNP	ENST00000219271.3	37	CCDS10792.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913813	0.92178	.	.	ENSG00000102996	ENST00000219271	T	0.08984	3.03	5.03	5.03	0.67393	Hemopexin/matrixin (2);	0.104805	0.64402	D	0.000006	T	0.45836	0.1362	H	0.97587	4.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67039	-0.5771	10	0.87932	D	0	.	17.3717	0.87380	0.0:0.0:1.0:0.0	.	375	P51511	MMP15_HUMAN	Y	375	ENSP00000219271:D375Y	ENSP00000219271:D375Y	D	+	1	0	MMP15	56633234	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.793000	0.99091	2.347000	0.79759	0.491000	0.48974	GAC	.		0.682	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428	
MMS19	64210	ucsc.edu;bcgsc.ca	37	10	99238131	99238131	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:99238131A>G	ENST00000438925.2	-	4	613	c.278T>C	c.(277-279)cTg>cCg	p.L93P	MMS19_ENST00000327238.10_Missense_Mutation_p.L93P|MMS19_ENST00000327277.7_5'UTR|MMS19_ENST00000370782.2_Missense_Mutation_p.L93P|MMS19_ENST00000355839.6_Missense_Mutation_p.L93P|MMS19_ENST00000483626.1_5'UTR	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	93					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		CTCATAGAACAGTATCAGGTG	0.448								Direct reversal of damage																													p.L93P		.											.	.	.	0			c.T278C						.						109.0	80.0	90.0					10																	99238131		2203	4300	6503	SO:0001583	missense	64210	exon4			TAGAACAGTATCA	AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.278T>C	10.37:g.99238131A>G	ENSP00000412698:p.Leu93Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	26.0	5.0	NM_022362	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Missense_Mutation	SNP	ENST00000438925.2	37	CCDS7464.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.623039	0.46840	.	.	ENSG00000155229	ENST00000438925;ENST00000370782;ENST00000327238;ENST00000422291;ENST00000355839;ENST00000437002;ENST00000422685	T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;1.75;2.29	5.99	5.99	0.97316	Armadillo-like helical (1);Armadillo-type fold (1);	0.365044	0.28736	N	0.014306	T	0.62417	0.2426	L	0.46157	1.445	0.80722	D	1	D;D	0.57571	0.98;0.98	B;P	0.47470	0.445;0.548	T	0.60530	-0.7245	10	0.30854	T	0.27	.	16.4645	0.84074	1.0:0.0:0.0:0.0	.	114;93	B4DQX2;Q96T76	.;MMS19_HUMAN	P	93;93;93;76;93;93;132	ENSP00000412698:L93P;ENSP00000359818:L93P;ENSP00000320059:L93P;ENSP00000348097:L93P;ENSP00000409425:L93P;ENSP00000391765:L132P	ENSP00000320059:L93P	L	-	2	0	MMS19	99228121	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	7.036000	0.76524	2.292000	0.77174	0.533000	0.62120	CTG	.		0.448	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049706.2		
MRAS	22808	ucsc.edu;bcgsc.ca	37	3	138117409	138117409	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:138117409A>G	ENST00000289104.4	+	4	1093	c.446A>G	c.(445-447)aAt>aGt	p.N149S	MRAS_ENST00000423968.2_Splice_Site_p.N149S|MRAS_ENST00000464896.1_Splice_Site_p.N73S|MRAS_ENST00000474559.1_Splice_Site_p.N149S	NM_001085049.2|NM_001252090.1|NM_001252091.1|NM_012219.4	NP_001078518.1|NP_001239019.1|NP_001239020.1|NP_036351.3	O14807	RASM_HUMAN	muscle RAS oncogene homolog	149					actin cytoskeleton organization (GO:0030036)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|Ras protein signal transduction (GO:0007265)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	14						ACCAAACACAATGTAGGTGTG	0.498																																					p.N149S		.											.	MRAS	848	0			c.A446G						.						110.0	101.0	104.0					3																	138117409		2203	4300	6503	SO:0001630	splice_region_variant	22808	exon4			AACACAATGTAGG	AF022080	CCDS3100.1, CCDS58855.1	3q22.3	2014-05-09			ENSG00000158186	ENSG00000158186			7227	protein-coding gene	gene with protein product		608435				9400994, 10446149	Standard	NM_012219		Approved	M-RAs, R-RAS3, RRAS3	uc003esi.4	O14807	OTTHUMG00000159888	ENST00000289104.4:c.447+1A>G	3.37:g.138117409A>G		Somatic	46.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_012219	B4DIK0|Q86WX8	Missense_Mutation	SNP	ENST00000289104.4	37	CCDS3100.1	.	.	.	.	.	.	.	.	.	.	A	11.50	1.657371	0.29425	.	.	ENSG00000158186	ENST00000289104;ENST00000423968;ENST00000494949;ENST00000464896;ENST00000474559	T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35	4.71	3.56	0.40772	Small GTP-binding protein domain (1);	0.174386	0.64402	N	0.000008	T	0.71056	0.3295	L	0.42487	1.325	0.50632	D	0.999881	B	0.02656	0.0	B	0.01281	0.0	T	0.63651	-0.6589	10	0.41790	T	0.15	.	8.1314	0.31029	0.9023:0.0:0.0977:0.0	.	149	O14807	RASM_HUMAN	S	149;149;73;73;149	ENSP00000289104:N149S;ENSP00000389682:N149S;ENSP00000417685:N73S;ENSP00000419582:N73S;ENSP00000418356:N149S	ENSP00000289104:N149S	N	+	2	0	MRAS	139600099	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	4.825000	0.62708	0.664000	0.31047	0.459000	0.35465	AAT	.		0.498	MRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357990.1		Missense_Mutation
MRC2	9902	ucsc.edu;bcgsc.ca	37	17	60759723	60759723	+	Silent	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:60759723C>A	ENST00000303375.5	+	20	3333	c.2931C>A	c.(2929-2931)atC>atA	p.I977I	MRC2_ENST00000446119.2_5'UTR|RNU6-446P_ENST00000362827.1_RNA	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	977					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CTGACTGGATCCAGTTCCTCA	0.607																																					p.I977I		.											.	MRC2	117	0			c.C2931A						.						20.0	18.0	19.0					17																	60759723		2203	4299	6502	SO:0001819	synonymous_variant	9902	exon20			CTGGATCCAGTTC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2931C>A	17.37:g.60759723C>A		Somatic	82.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Silent	SNP	ENST00000303375.5	37	CCDS11634.1																																																																																			.		0.607	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
MTHFD1L	25902	ucsc.edu;bcgsc.ca	37	6	151258025	151258025	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:151258025T>C	ENST00000367321.3	+	12	1616	c.1342T>C	c.(1342-1344)Tcc>Ccc	p.S448P	RNU6-302P_ENST00000365249.1_RNA	NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	448	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		GAATGTCAACTCCTTTGCCTG	0.547																																					p.S449P		.											.	MTHFD1L	292	0			c.T1345C						.						135.0	118.0	124.0					6																	151258025		2203	4300	6503	SO:0001583	missense	25902	exon12			GTCAACTCCTTTG	BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1342T>C	6.37:g.151258025T>C	ENSP00000356290:p.Ser448Pro	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	20.0	5.0	NM_001242767	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	37	CCDS5228.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082047	0.76528	.	.	ENSG00000120254	ENST00000367321;ENST00000441122	T;T	0.23950	1.88;1.88	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	M	0.79926	2.475	0.80722	D	1	D;P;D	0.89917	1.0;0.907;1.0	D;P;D	0.91635	0.989;0.864;0.999	T	0.52801	-0.8527	10	0.66056	D	0.02	.	16.4781	0.84144	0.0:0.0:0.0:1.0	.	449;203;448	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	P	448;119	ENSP00000356290:S448P;ENSP00000407070:S119P	ENSP00000356290:S448P	S	+	1	0	MTHFD1L	151299718	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	1.122000	0.31295	2.288000	0.76882	0.528000	0.53228	TCC	.		0.547	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440	
MUC2	4583	ucsc.edu;bcgsc.ca	37	11	1087497	1087497	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:1087497A>G	ENST00000441003.2	+	24	3275	c.3248A>G	c.(3247-3249)gAc>gGc	p.D1083G	MUC2_ENST00000359061.5_Missense_Mutation_p.D1083G	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1083					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGCTCCTGTGACACGGGTGGG	0.652																																					p.D1083G		.											.	MUC2	90	0			c.A3248G						.						81.0	92.0	88.0					11																	1087497		2164	4259	6423	SO:0001583	missense	4583	exon24			CCTGTGACACGGG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3248A>G	11.37:g.1087497A>G	ENSP00000415183:p.Asp1083Gly	Somatic	57.0	1.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	a	15.73	2.920243	0.52653	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.75704	-0.96;-0.96	3.62	3.62	0.41486	.	0.426812	0.19062	U	0.123734	D	0.85097	0.5619	M	0.78801	2.425	0.40360	D	0.979236	D	0.89917	1.0	D	0.91635	0.999	D	0.87228	0.2258	10	0.87932	D	0	.	12.7191	0.57131	1.0:0.0:0.0:0.0	.	1083	E7EUV1	.	G	1083	ENSP00000415183:D1083G;ENSP00000351956:D1083G	ENSP00000351956:D1083G	D	+	2	0	MUC2	1077497	1.000000	0.71417	0.952000	0.39060	0.738000	0.42128	7.119000	0.77145	1.649000	0.50652	0.393000	0.25936	GAC	.		0.652	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MYBL2	4605	ucsc.edu;bcgsc.ca	37	20	42331148	42331148	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:42331148G>A	ENST00000217026.4	+	8	1097	c.970G>A	c.(970-972)Gac>Aac	p.D324N	MYBL2_ENST00000396863.4_Missense_Mutation_p.D300N	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	324					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TGCTTGGTGTGACCTGAGTAA	0.473																																					p.D324N		.											.	MYBL2	415	0			c.G970A						.						160.0	163.0	162.0					20																	42331148		2203	4300	6503	SO:0001583	missense	4605	exon8			TGGTGTGACCTGA		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.970G>A	20.37:g.42331148G>A	ENSP00000217026:p.Asp324Asn	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	48.0	5.0	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	37	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.346801	0.41599	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.22134	1.97;2.0	5.12	5.12	0.69794	.	0.193682	0.53938	D	0.000045	T	0.24509	0.0594	N	0.14661	0.345	0.42933	D	0.994329	D;P	0.58620	0.983;0.787	P;B	0.56434	0.798;0.241	T	0.04976	-1.0914	10	0.27082	T	0.32	-33.3974	17.7189	0.88344	0.0:0.0:1.0:0.0	.	300;324	F8W6N6;P10244	.;MYBB_HUMAN	N	300;324	ENSP00000380072:D300N;ENSP00000217026:D324N	ENSP00000217026:D324N	D	+	1	0	MYBL2	41764562	1.000000	0.71417	0.994000	0.49952	0.451000	0.32288	6.014000	0.70784	2.557000	0.86248	0.561000	0.74099	GAC	.		0.473	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
MYO1C	4641	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	1387559	1387559	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:1387559A>C	ENST00000575158.1	-	2	185	c.9T>G	c.(7-9)agT>agG	p.S3R	MYO1C_ENST00000359786.5_Missense_Mutation_p.S38R|MYO1C_ENST00000545534.2_Missense_Mutation_p.S14R|MYO1C_ENST00000438665.2_Missense_Mutation_p.S19R|MYO1C_ENST00000361007.2_Missense_Mutation_p.S3R			Q12965	MYO1E_HUMAN	myosin IC	0					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGGTGAGCGCACTCTCCATGG	0.657																																					p.S38R		.											.	MYO1C	90	0			c.T114G						.						46.0	44.0	45.0					17																	1387559		2203	4300	6503	SO:0001583	missense	4641	exon2			GAGCGCACTCTCC	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.9T>G	17.37:g.1387559A>C	ENSP00000459174:p.Ser3Arg	Somatic	20.0	1.0		WXS	Illumina HiSeq	Phase_I	9.0	5.0	NM_001080779	Q14778	Missense_Mutation	SNP	ENST00000575158.1	37	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	A	10.68	1.419420	0.25552	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	4.54	-6.24	0.02046	.	0.284053	0.37857	N	0.001912	D	0.85075	0.5614	L	0.28458	0.855	0.40059	D	0.975875	P;B;P	0.52577	0.923;0.085;0.954	P;B;P	0.59643	0.729;0.032;0.861	D	0.83499	0.0074	10	0.31617	T	0.26	.	17.2692	0.87096	0.2673:0.0:0.7327:0.0	.	14;38;19	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	R	38;19;19;3;14;3	ENSP00000352834:S38R;ENSP00000412197:S19R;ENSP00000354283:S3R;ENSP00000437685:S14R	ENSP00000352834:S38R	S	-	3	2	MYO1C	1334309	0.000000	0.05858	0.868000	0.34077	0.459000	0.32528	-1.522000	0.02237	-1.276000	0.02414	-0.411000	0.06167	AGT	.		0.657	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27421740	27421740	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:27421740G>A	ENST00000527372.1	-	30	4818	c.4638C>T	c.(4636-4638)gaC>gaT	p.D1546D	MYO18A_ENST00000531253.1_Silent_p.D1546D|MYO18A_ENST00000533112.1_Silent_p.D1546D|MYO18A_ENST00000354329.4_Silent_p.D1546D	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1546					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TGGCCTCCAGGTCCCGGAGCT	0.562																																					p.D1546D	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A	22	0			c.C4638T						.						158.0	153.0	155.0					17																	27421740		2032	4190	6222	SO:0001819	synonymous_variant	399687	exon30			CTCCAGGTCCCGG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4638C>T	17.37:g.27421740G>A		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	33.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	37	CCDS45642.1																																																																																			.		0.562	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
NAGA	4668	ucsc.edu;bcgsc.ca	37	22	42463846	42463846	+	Missense_Mutation	SNP	C	C	T	rs202010344		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr22:42463846C>T	ENST00000396398.3	-	3	779	c.247G>A	c.(247-249)Ggt>Agt	p.G83S	NAGA_ENST00000403363.1_Missense_Mutation_p.G83S|NAGA_ENST00000402937.1_Missense_Mutation_p.G83S	NM_000262.2	NP_000253.1	P17050	NAGAB_HUMAN	N-acetylgalactosaminidase, alpha-	83					carbohydrate catabolic process (GO:0016052)|glycolipid catabolic process (GO:0019377)|glycoside catabolic process (GO:0016139)|glycosylceramide catabolic process (GO:0046477)|oligosaccharide metabolic process (GO:0009311)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|alpha-N-acetylgalactosaminidase activity (GO:0008456)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						TCGCGACCACCGATCCAGCAG	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		18408	0.0		0.001	False		,,,				2504	0.0				p.G83S		.											.	NAGA	90	0			c.G247A						.						178.0	162.0	167.0					22																	42463846		2203	4300	6503	SO:0001583	missense	4668	exon3			GACCACCGATCCA		CCDS14030.1	22q13.2	2010-07-09			ENSG00000198951	ENSG00000198951	3.2.1.49		7631	protein-coding gene	gene with protein product		104170					Standard	NM_000262		Approved	D22S674	uc003bbw.4	P17050	OTTHUMG00000151276	ENST00000396398.3:c.247G>A	22.37:g.42463846C>T	ENSP00000379680:p.Gly83Ser	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_000262		Missense_Mutation	SNP	ENST00000396398.3	37	CCDS14030.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.72	2.022365	0.35701	.	.	ENSG00000198951	ENST00000396398;ENST00000403363;ENST00000402937	D;D;D	0.82526	-1.62;-1.62;-1.62	4.66	4.66	0.58398	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.324882	0.33364	N	0.004992	T	0.62539	0.2436	N	0.04387	-0.21	0.39211	D	0.963314	B	0.06786	0.001	B	0.01281	0.0	T	0.60156	-0.7318	10	0.13853	T	0.58	-17.769	11.255	0.49048	0.0:0.9164:0.0:0.0836	.	83	P17050	NAGAB_HUMAN	S	83	ENSP00000379680:G83S;ENSP00000385283:G83S;ENSP00000384603:G83S	ENSP00000379680:G83S	G	-	1	0	NAGA	40793792	0.180000	0.23148	1.000000	0.80357	0.943000	0.58893	1.867000	0.39499	2.441000	0.82636	0.561000	0.74099	GGT	C|0.999;T|0.000		0.597	NAGA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322056.1		
NALCN	259232	ucsc.edu;bcgsc.ca	37	13	101881828	101881828	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:101881828G>A	ENST00000251127.6	-	13	1623	c.1542C>T	c.(1540-1542)gcC>gcT	p.A514A	NALCN_ENST00000376196.3_Silent_p.A514A|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	514					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCAAGAGGCTGGCAGTAAATA	0.388																																					p.A514A		.											.	NALCN	167	0			c.C1542T						.						106.0	111.0	109.0					13																	101881828		2203	4300	6503	SO:0001819	synonymous_variant	259232	exon13			GAGGCTGGCAGTA	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1542C>T	13.37:g.101881828G>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	ENST00000251127.6	37	CCDS9498.1																																																																																			.		0.388	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
NCLN	56926	ucsc.edu;bcgsc.ca	37	19	3204024	3204024	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:3204024A>G	ENST00000246117.4	+	8	1342	c.911A>G	c.(910-912)aAt>aGt	p.N304S	NCLN_ENST00000590671.1_Missense_Mutation_p.N230S	NM_020170.3	NP_064555.2	Q969V3	NCLN_HUMAN	nicalin	304					regulation of signal transduction (GO:0009966)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				kidney(1)|lung(3)|skin(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCAGGACAATGTGGCCTTC	0.701																																					p.N304S		.											.	NCLN	90	0			c.A911G						.						20.0	22.0	21.0					19																	3204024		2190	4291	6481	SO:0001583	missense	56926	exon8			AGGACAATGTGGC	BC025926	CCDS32869.1	19p13.3	2010-08-13	2010-08-13			ENSG00000125912			26923	protein-coding gene	gene with protein product	"""nicastrin-like protein"""	609156	"""nicalin homolog (zebrafish)"""			11230166	Standard	NM_020170		Approved	NICALIN, NET59	uc002lxi.3	Q969V3		ENST00000246117.4:c.911A>G	19.37:g.3204024A>G	ENSP00000246117:p.Asn304Ser	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_020170	D6W613|O75252|Q6FI60|Q6ZMB7|Q8TAT7|Q96H48|Q96IS7|Q9BQH9|Q9BTX4|Q9NPP2	Missense_Mutation	SNP	ENST00000246117.4	37	CCDS32869.1	.	.	.	.	.	.	.	.	.	.	A	7.765	0.706224	0.15239	.	.	ENSG00000125912	ENST00000246117	T	0.73152	-0.72	4.13	3.11	0.35812	Peptidase M28 (1);	0.045661	0.85682	D	0.000000	T	0.59998	0.2235	L	0.45352	1.415	0.58432	D	0.999991	B	0.24426	0.103	B	0.27076	0.076	T	0.51560	-0.8690	10	0.34782	T	0.22	.	8.3299	0.32180	0.9016:0.0:0.0984:0.0	.	304	Q969V3	NCLN_HUMAN	S	304	ENSP00000246117:N304S	ENSP00000246117:N304S	N	+	2	0	NCLN	3155024	1.000000	0.71417	0.872000	0.34217	0.052000	0.14988	8.800000	0.91900	0.461000	0.27071	0.459000	0.35465	AAT	.		0.701	NCLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452545.1	NM_020170	
NFKB1	4790	ucsc.edu;bcgsc.ca	37	4	103533727	103533727	+	Silent	SNP	T	T	C	rs147169338		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:103533727T>C	ENST00000505458.1	+	22	2830	c.2553T>C	c.(2551-2553)agT>agC	p.S851S	NFKB1_ENST00000226574.4_Silent_p.S852S|NFKB1_ENST00000394820.4_Silent_p.S851S|NFKB1_ENST00000600343.1_Silent_p.S671S			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	851	Death.|Interaction with CFLAR.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	TCCGGCTGAGTCCTGCTCCTT	0.413																																					p.S852S		.											.	NFKB1	912	0			c.T2556C						.						82.0	82.0	82.0					4																	103533727		2203	4300	6503	SO:0001819	synonymous_variant	4790	exon22			GCTGAGTCCTGCT	M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.2553T>C	4.37:g.103533727T>C		Somatic	25.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_003998	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Silent	SNP	ENST00000505458.1	37	CCDS54783.1																																																																																			T|1.000;G|0.000		0.413	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363411.1		
NISCH	11188	ucsc.edu;bcgsc.ca	37	3	52525524	52525524	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:52525524C>T	ENST00000479054.1	+	21	3971	c.3899C>T	c.(3898-3900)aCc>aTc	p.T1300I	NISCH_ENST00000345716.4_Missense_Mutation_p.T1300I			Q9Y2I1	NISCH_HUMAN	nischarin	1300					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GGGAACAAGACCACAGGTACC	0.612																																					p.T1300I		.											.	NISCH	93	0			c.C3899T						.						55.0	50.0	52.0					3																	52525524		2203	4300	6503	SO:0001583	missense	11188	exon20			ACAAGACCACAGG	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.3899C>T	3.37:g.52525524C>T	ENSP00000418232:p.Thr1300Ile	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_007184	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069000	0.55539	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000433196;ENST00000414197	T;T	0.08546	3.08;3.08	5.8	-2.0	0.07433	.	0.544560	0.20494	N	0.091227	T	0.03178	0.0093	N	0.08118	0	0.22354	N	0.999179	B	0.11235	0.004	B	0.04013	0.001	T	0.32824	-0.9892	10	0.62326	D	0.03	-12.9712	3.2229	0.06721	0.414:0.187:0.316:0.0831	.	1300	Q9Y2I1	NISCH_HUMAN	I	1300;1300;224;644	ENSP00000418232:T1300I;ENSP00000339958:T1300I	ENSP00000339958:T1300I	T	+	2	0	NISCH	52500564	0.984000	0.35163	0.851000	0.33527	0.995000	0.86356	0.904000	0.28491	-0.211000	0.10124	0.561000	0.74099	ACC	.		0.612	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
NOTCH2	4853	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	120529697	120529697	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:120529697C>T	ENST00000256646.2	-	5	979	c.760G>A	c.(760-762)Ggg>Agg	p.G254R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	254	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGGTGCTCCCTTCAAAACCT	0.448			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.G254R		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	1441	0			c.G760A						.						101.0	99.0	100.0					1																	120529697		2203	4300	6503	SO:0001583	missense	4853	exon5	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	TGCTCCCTTCAAA	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.760G>A	1.37:g.120529697C>T	ENSP00000256646:p.Gly254Arg	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	6.0	NM_001200001	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	34	5.374771	0.95923	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	D	0.99121	-5.45	6.06	6.06	0.98353	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.38326	U	0.001726	D	0.99715	0.9890	H	0.98818	4.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.999	D	0.97533	1.0081	10	0.72032	D	0.01	.	19.609	0.95594	0.0:1.0:0.0:0.0	.	215;254;254	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	R	254;215	ENSP00000256646:G254R	ENSP00000256646:G254R	G	-	1	0	NOTCH2	120331220	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.003000	0.70701	2.882000	0.98803	0.655000	0.94253	GGG	.		0.448	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NPR1	4881	ucsc.edu;bcgsc.ca	37	1	153660119	153660119	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:153660119G>T	ENST00000368680.3	+	14	2574	c.2102G>T	c.(2101-2103)tGg>tTg	p.W701L		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	701	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GAAAAGCTGTGGACGGCCCCT	0.592																																					p.W701L	Pancreas(141;1349 1870 15144 15830 40702)	.											.	NPR1	393	0			c.G2102T						.						114.0	107.0	109.0					1																	153660119		2203	4300	6503	SO:0001583	missense	4881	exon14			AGCTGTGGACGGC	BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2102G>T	1.37:g.153660119G>T	ENSP00000357669:p.Trp701Leu	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_000906	B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	ENST00000368680.3	37	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358538	0.82243	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	T	0.66460	-0.21	4.09	4.09	0.47781	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.85725	0.5763	H	0.97390	3.995	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.954;0.994	D	0.90289	0.4321	10	0.87932	D	0	.	14.1901	0.65633	0.0:0.0:1.0:0.0	.	180;701	B7Z4Y7;P16066	.;ANPRA_HUMAN	L	701;180	ENSP00000357669:W701L	ENSP00000357669:W701L	W	+	2	0	NPR1	151926743	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.485000	0.97942	2.287000	0.76781	0.455000	0.32223	TGG	.		0.592	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906	
NRAP	4892	ucsc.edu;bcgsc.ca	37	10	115417257	115417257	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:115417257G>T	ENST00000359988.3	-	4	576	c.332C>A	c.(331-333)gCa>gAa	p.A111E	NRAP_ENST00000369358.4_Missense_Mutation_p.A111E|NRAP_ENST00000369360.3_Missense_Mutation_p.A111E|NRAP_ENST00000360478.3_Missense_Mutation_p.A111E	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CCTGTTAGGTGCACCTTCCTT	0.403																																					p.A111E		.											.	NRAP	522	0			c.C332A						.						156.0	123.0	134.0					10																	115417257		2203	4300	6503	SO:0001583	missense	4892	exon4			TTAGGTGCACCTT		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.332C>A	10.37:g.115417257G>T	ENSP00000353078:p.Ala111Glu	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001261463		Missense_Mutation	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059917	0.36373	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.21031	2.21;2.22;2.11;2.03	5.46	1.52	0.23074	.	0.298679	0.35466	N	0.003198	T	0.21881	0.0527	L	0.46157	1.445	0.09310	N	1	B;P;P	0.37176	0.399;0.534;0.586	B;B;B	0.43478	0.241;0.421;0.305	T	0.09015	-1.0694	10	0.54805	T	0.06	.	8.7927	0.34861	0.3834:0.0:0.6166:0.0	.	111;111;111	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	E	111	ENSP00000358365:A111E;ENSP00000358367:A111E;ENSP00000353078:A111E;ENSP00000353666:A111E	ENSP00000353078:A111E	A	-	2	0	NRAP	115407247	0.009000	0.17119	0.001000	0.08648	0.341000	0.28922	1.251000	0.32862	0.284000	0.22305	0.555000	0.69702	GCA	.		0.403	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
NSMCE1	197370	ucsc.edu;bcgsc.ca	37	16	27238075	27238075	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:27238075T>C	ENST00000361439.4	-	6	665	c.566A>G	c.(565-567)aAg>aGg	p.K189R	NSMCE1_ENST00000565384.1_5'UTR	NM_145080.3	NP_659547.2	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog (S. cerevisiae)	189					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|intracellular signal transduction (GO:0035556)|positive regulation of response to DNA damage stimulus (GO:2001022)|protein ubiquitination (GO:0016567)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)	7						ATTGCAGATCTTCACCGCGTC	0.627																																					p.K189R		.											.	NSMCE1	90	0			c.A566G						.						109.0	118.0	115.0					16																	27238075		2060	4185	6245	SO:0001583	missense	197370	exon6			CAGATCTTCACCG	AF161451	CCDS10628.2	16p12.1	2010-03-23	2006-07-05		ENSG00000169189	ENSG00000169189			29897	protein-coding gene	gene with protein product						11927594	Standard	XM_005255163		Approved	NSE1	uc002doi.1	Q8WV22	OTTHUMG00000131674	ENST00000361439.4:c.566A>G	16.37:g.27238075T>C	ENSP00000355077:p.Lys189Arg	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	43.0	5.0	NM_145080	D3DWF6|Q9P045|Q9P049	Missense_Mutation	SNP	ENST00000361439.4	37	CCDS10628.2	.	.	.	.	.	.	.	.	.	.	T	12.06	1.825342	0.32237	.	.	ENSG00000169189	ENST00000361439	D	0.83591	-1.74	5.09	5.09	0.68999	Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.000000	0.85682	D	0.000000	T	0.78000	0.4215	L	0.48218	1.51	0.54753	D	0.999983	B	0.11235	0.004	B	0.08055	0.003	T	0.73360	-0.4007	10	0.34782	T	0.22	.	14.0119	0.64503	0.0:0.0:0.0:1.0	.	189	Q8WV22	NSE1_HUMAN	R	189	ENSP00000355077:K189R	ENSP00000355077:K189R	K	-	2	0	NSMCE1	27145576	0.997000	0.39634	1.000000	0.80357	0.531000	0.34715	1.790000	0.38734	2.046000	0.60703	0.459000	0.35465	AAG	.		0.627	NSMCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254577.3	NM_145080	
NUDT5	11164	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	12221083	12221083	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:12221083A>G	ENST00000491614.1	-	4	575	c.180T>C	c.(178-180)gaT>gaC	p.D60D	NUDT5_ENST00000378940.3_Splice_Site_p.D60D|NUDT5_ENST00000378927.3_Splice_Site_p.D60D|NUDT5_ENST00000378952.3_5'UTR|NUDT5_ENST00000378937.3_Splice_Site_p.D73D|NUDT5_ENST00000537776.1_Splice_Site_p.D60D			Q9UKK9	NUDT5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 5	60	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				D-ribose catabolic process (GO:0019303)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|ribonucleoside diphosphate catabolic process (GO:0009191)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)|magnesium ion binding (GO:0000287)|nucleoside-diphosphatase activity (GO:0017110)|snoRNA binding (GO:0030515)			breast(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)	8		Renal(717;0.228)				CACTCCTACCATCCGCAGTCT	0.403																																					p.D60D		.											.	NUDT5	92	0			c.T180C						.						201.0	167.0	179.0					10																	12221083		2203	4300	6503	SO:0001630	splice_region_variant	11164	exon4			CCTACCATCCGCA	AF155832	CCDS7089.1	10p14	2008-05-14			ENSG00000165609	ENSG00000165609		"""Nudix motif containing"""	8052	protein-coding gene	gene with protein product		609230				10373642	Standard	NM_014142		Approved	hYSAH1, YSA1H	uc001ilj.3	Q9UKK9	OTTHUMG00000017682	ENST00000491614.1:c.181+1T>C	10.37:g.12221083A>G		Somatic	90.0	1.0		WXS	Illumina HiSeq	Phase_I	80.0	35.0	NM_014142	A8K516|Q6IAG0|Q9UH49	Silent	SNP	ENST00000491614.1	37	CCDS7089.1																																																																																			.		0.403	NUDT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046811.1		Silent
OAS1	4938	ucsc.edu;bcgsc.ca	37	12	113354512	113354512	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:113354512A>G	ENST00000202917.5	+	4	1116	c.853A>G	c.(853-855)Aag>Gag	p.K285E	OAS1_ENST00000452357.2_Missense_Mutation_p.K285E|OAS1_ENST00000445409.2_Missense_Mutation_p.K285E|RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000551241.1_Missense_Mutation_p.K285E	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	285					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						CATTATTGAAAAGTACCTGAG	0.453																																					p.K285E		.											.	OAS1	70	0			c.A853G						.						89.0	87.0	88.0					12																	113354512		2203	4300	6503	SO:0001583	missense	4938	exon4			ATTGAAAAGTACC	X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.853A>G	12.37:g.113354512A>G	ENSP00000202917:p.Lys285Glu	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_001032409	A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Missense_Mutation	SNP	ENST00000202917.5	37	CCDS41838.1	.	.	.	.	.	.	.	.	.	.	A	3.898	-0.022668	0.07634	.	.	ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000551241;ENST00000377508;ENST00000550689;ENST00000553152	T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03	4.82	-9.64	0.00541	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	3.485270	0.00589	N	0.000342	T	0.16811	0.0404	N	0.11756	0.17	0.09310	N	0.999999	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.0	B;B;B;B;B	0.09377	0.004;0.002;0.004;0.003;0.002	T	0.18398	-1.0338	10	0.08599	T	0.76	1.6098	3.3236	0.07059	0.4089:0.1053:0.3458:0.1401	.	285;285;285;285;285	E7EMI9;F8VXY3;P00973;P00973-3;P00973-2	.;.;OAS1_HUMAN;.;.	E	285;285;285;285;285;281;31	ENSP00000202917:K285E;ENSP00000388001:K285E;ENSP00000415721:K285E;ENSP00000448790:K285E;ENSP00000448348:K281E;ENSP00000449053:K31E	ENSP00000202917:K285E	K	+	1	0	OAS1	111838895	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-8.567000	0.00019	-2.282000	0.00673	-0.313000	0.08912	AAG	.		0.453	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405896.2		
OGFRL1	79627	ucsc.edu;bcgsc.ca	37	6	72011093	72011093	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:72011093C>A	ENST00000370435.4	+	7	831	c.697C>A	c.(697-699)Cag>Aag	p.Q233K	RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	233						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						TTCCAGGTCCCAGCACAACTA	0.353																																					p.Q233K		.											.	OGFRL1	68	0			c.C697A						.						227.0	262.0	250.0					6																	72011093		2203	4298	6501	SO:0001583	missense	79627	exon7			AGGTCCCAGCACA		CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.697C>A	6.37:g.72011093C>A	ENSP00000359464:p.Gln233Lys	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	36.0	5.0	NM_024576	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	ENST00000370435.4	37	CCDS34482.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398015	0.83120	.	.	ENSG00000119900	ENST00000370435	T	0.44881	0.91	5.94	5.94	0.96194	Opioid growth factor receptor (OGFr) conserved domain (1);	0.052410	0.85682	D	0.000000	T	0.41143	0.1146	L	0.44542	1.39	0.51233	D	0.999918	D	0.58970	0.984	P	0.57204	0.815	T	0.03619	-1.1019	10	0.13853	T	0.58	-23.7701	20.3556	0.98839	0.0:1.0:0.0:0.0	.	233	Q5TC84	OGRL1_HUMAN	K	233	ENSP00000359464:Q233K	ENSP00000359464:Q233K	Q	+	1	0	OGFRL1	72067814	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.787000	0.85759	2.817000	0.96982	0.563000	0.77884	CAG	.		0.353	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
OR6K6	128371	ucsc.edu;bcgsc.ca	37	1	158724983	158724983	+	Silent	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:158724983C>A	ENST00000368144.2	+	1	474	c.378C>A	c.(376-378)ctC>ctA	p.L126L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					CTGGCTGCCTCCTGCAGATGT	0.502																																					p.L126L		.											.	OR6K6	69	0			c.C378A						.						80.0	79.0	80.0					1																	158724983		2203	4300	6503	SO:0001819	synonymous_variant	128371	exon1			CTGCCTCCTGCAG	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.378C>A	1.37:g.158724983C>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001005184	B9EIM8|Q5VUU9|Q6IFR4	Silent	SNP	ENST00000368144.2	37	CCDS30904.1																																																																																			.		0.502	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
OST4	100128731	ucsc.edu;bcgsc.ca	37	2	27294250	27294250	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:27294250G>A	ENST00000456793.1	-	2	254	c.81C>T	c.(79-81)taC>taT	p.Y27Y	OST4_ENST00000447619.1_Silent_p.Y27Y|OST4_ENST00000429985.1_Silent_p.Y27Y	NM_001134693.1	NP_001128165.1	P0C6T2	OST4_HUMAN	oligosaccharyltransferase 4 homolog (S. cerevisiae)	27						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											TGACGGCCACGTAGTGATAGA	0.602																																					p.Y27Y		.											.	.	.	0			c.C81T						.						112.0	109.0	110.0					2																	27294250		692	1591	2283	SO:0001819	synonymous_variant	100128731	exon2			GGCCACGTAGTGA	BC105283	CCDS58703.1	2p23.3	2012-04-19			ENSG00000228474	ENSG00000228474			32483	protein-coding gene	gene with protein product						16317064	Standard	NM_001134693		Approved		uc002rig.3	P0C6T2	OTTHUMG00000151990	ENST00000456793.1:c.81C>T	2.37:g.27294250G>A		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	41.0	6.0	NM_001134693		Silent	SNP	ENST00000456793.1	37	CCDS58703.1																																																																																			.		0.602	OST4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324704.2	NM_001134693	
PAICS	10606	ucsc.edu;bcgsc.ca	37	4	57302496	57302496	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:57302496T>C	ENST00000512576.1	+	1	177		c.e1+2		PAICS_ENST00000264221.2_Splice_Site|PPAT_ENST00000264220.2_5'Flank|PAICS_ENST00000399688.3_Splice_Site|PAICS_ENST00000514888.1_Splice_Site	NM_001079524.1	NP_001072992.1	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase						'de novo' IMP biosynthetic process (GO:0006189)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|phosphoribosylaminoimidazole carboxylase activity (GO:0004638)|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity (GO:0004639)			endometrium(1)|kidney(2)|large_intestine(1)|urinary_tract(1)	5	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	CAGCTGAGGGTGAGTAACAGG	0.652																																					.	GBM(53;429 1144 8755 40726)	.											.	PAICS	68	0			c.16+2T>C						.						21.0	25.0	24.0					4																	57302496		1890	4090	5980	SO:0001630	splice_region_variant	10606	exon2			TGAGGGTGAGTAA	X53793	CCDS47060.1, CCDS47061.1	4q12	2012-07-13			ENSG00000128050	ENSG00000128050	4.1.1.21, 6.3.2.6		8587	protein-coding gene	gene with protein product		172439		PAIS		2253271, 8106516	Standard	NM_006452		Approved	ADE2H1, AIRC	uc003hbt.1	P22234	OTTHUMG00000160957	ENST00000512576.1:c.16+2T>C	4.37:g.57302496T>C		Somatic	58.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_006452	E9PDH9|Q68CQ5	Splice_Site	SNP	ENST00000512576.1	37	CCDS47061.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.383111	0.61845	.	.	ENSG00000128050	ENST00000264221;ENST00000505164;ENST00000399688;ENST00000512576	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6738	0.45774	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAICS	56997253	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	3.156000	0.50708	2.023000	0.59567	0.402000	0.26972	.	.		0.652	PAICS-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363136.2	NM_006452	Intron
PAPPA	5069	ucsc.edu;bcgsc.ca	37	9	119116037	119116037	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:119116037T>C	ENST00000328252.3	+	17	4681	c.4312T>C	c.(4312-4314)Tgt>Cgt	p.C1438R	PAPPA_ENST00000534838.1_Missense_Mutation_p.C476R	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1438	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CAACAGTGAGTGTAGGATCAA	0.498																																					p.C1438R		.											.	PAPPA	77	0			c.T4312C						.						200.0	167.0	178.0					9																	119116037		2203	4300	6503	SO:0001583	missense	5069	exon17			AGTGAGTGTAGGA		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4312T>C	9.37:g.119116037T>C	ENSP00000330658:p.Cys1438Arg	Somatic	86.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.456372	0.84317	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.65732	-0.17;-0.17	5.91	5.91	0.95273	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.80391	0.4614	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.83090	-0.0133	10	0.87932	D	0	-13.3139	15.5264	0.75910	0.0:0.0:0.0:1.0	.	476;1438	F5GZ19;Q13219	.;PAPP1_HUMAN	R	1438;476	ENSP00000330658:C1438R;ENSP00000441461:C476R	ENSP00000330658:C1438R	C	+	1	0	PAPPA	118155858	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.750000	0.85110	2.261000	0.74972	0.533000	0.62120	TGT	.		0.498	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PAQR3	152559	ucsc.edu;bcgsc.ca	37	4	79856387	79856387	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:79856387C>A	ENST00000512733.1	-	2	449	c.236G>T	c.(235-237)gGt>gTt	p.G79V	PAQR3_ENST00000380645.4_Missense_Mutation_p.G79V|PAQR3_ENST00000295462.3_Intron	NM_001040202.1	NP_001035292.1	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III	79					negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein phosphorylation (GO:0001933)|protein localization to Golgi apparatus (GO:0034067)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	8						GAGAAAGAAACCCAGCAAATG	0.368																																					p.G79V		.											.	PAQR3	46	0			c.G236T						.						85.0	85.0	85.0					4																	79856387		2203	4300	6503	SO:0001583	missense	152559	exon2			AAGAAACCCAGCA	AK055774	CCDS34020.1	4q21	2008-02-05				ENSG00000163291			30130	protein-coding gene	gene with protein product		614577				16044242	Standard	XM_006714104		Approved		uc003hlp.1	Q6TCH7		ENST00000512733.1:c.236G>T	4.37:g.79856387C>A	ENSP00000421981:p.Gly79Val	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_001040202	A8K5B7|B3KP59|Q6PIQ1|Q86X05|Q8NCP9	Missense_Mutation	SNP	ENST00000512733.1	37	CCDS34020.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751398	0.89753	.	.	ENSG00000163291	ENST00000512733;ENST00000380645	T;T	0.39229	1.09;1.09	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.73233	0.3561	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79999	-0.1566	10	0.87932	D	0	-4.8993	18.7283	0.91724	0.0:1.0:0.0:0.0	.	79	Q6TCH7	PAQR3_HUMAN	V	79	ENSP00000421981:G79V;ENSP00000370019:G79V	ENSP00000344203:G79V	G	-	2	0	PAQR3	80075411	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.651000	0.83577	2.532000	0.85374	0.563000	0.77884	GGT	.		0.368	PAQR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363442.1	NM_177453	
PAX8	7849	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113993092	113993092	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:113993092G>A	ENST00000429538.3	-	9	1160	c.966C>T	c.(964-966)tcC>tcT	p.S322S	AC016683.6_ENST00000431844.2_RNA|PAX8_ENST00000348715.5_Intron|PAX8_ENST00000397647.3_Intron|AC016683.6_ENST00000456685.1_RNA|AC016683.6_ENST00000437551.1_RNA|PAX8_ENST00000263335.7_Intron|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000263334.5_Intron	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	322	Ser-rich.			S -> C (in Ref. 1; X69699). {ECO:0000305}.	anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						TAGATAAAGAGGAAGGGGTGG	0.587			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.S322S	Ovarian(188;7 2067 9084 29802 29892)	.		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	684	0			c.C966T						.						51.0	61.0	58.0					2																	113993092		1928	4125	6053	SO:0001819	synonymous_variant	7849	exon9			TAAAGAGGAAGGG	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.966C>T	2.37:g.113993092G>A		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	12.0	NM_003466	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Silent	SNP	ENST00000429538.3	37	CCDS46398.1																																																																																			.		0.587	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
PAX3	5077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	223066132	223066132	+	3'UTR	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:223066132C>T	ENST00000350526.4	-	0	2087				PAX3_ENST00000336840.6_Splice_Site_p.S401S|PAX3_ENST00000392069.2_Splice_Site_p.A484T|PAX3_ENST00000464706.1_5'Flank|PAX3_ENST00000409551.3_Missense_Mutation_p.A483T|PAX3_ENST00000392070.2_Missense_Mutation_p.A484T|PAX3_ENST00000344493.4_Silent_p.S401S	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A484T(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCACTTACGCGATATCTGGC	0.443			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.A484T		.		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	PAX3	1821	1	Substitution - Missense(1)	endometrium(1)	c.G1450A						.						88.0	89.0	88.0					2																	223066132		2203	4300	6503	SO:0001624	3_prime_UTR_variant	5077	exon9			CTTACGCGATATC		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.*511G>A	2.37:g.223066132C>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	22.0	NM_181459	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	37	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027007	0.54683	.	.	ENSG00000135903	ENST00000392069;ENST00000392070;ENST00000409551	D;D;D	0.94537	-3.4;-3.44;-3.45	5.77	5.77	0.91146	.	1.499710	0.04241	N	0.336907	D	0.90573	0.7045	N	0.14661	0.345	0.80722	D	1	B;P	0.39920	0.005;0.695	B;B	0.29077	0.002;0.098	T	0.78831	-0.2049	10	0.66056	D	0.02	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	483;484	Q494Z4;G5E9C1	.;.	T	484;484;483	ENSP00000375921:A484T;ENSP00000375922:A484T;ENSP00000386750:A483T	ENSP00000375921:A484T	A	-	1	0	PAX3	222774376	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.015000	0.57152	2.885000	0.99019	0.655000	0.94253	GCT;GCG;GCG	.		0.443	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
PC	5091	ucsc.edu;bcgsc.ca	37	11	66619923	66619923	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:66619923C>T	ENST00000393958.2	-	14	1905	c.1812G>A	c.(1810-1812)atG>atA	p.M604I	PC_ENST00000529047.1_5'Flank|PC_ENST00000393955.2_Missense_Mutation_p.M604I|PC_ENST00000528224.1_5'Flank|PC_ENST00000393960.1_Missense_Mutation_p.M604I	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	604	Carboxyltransferase.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	CCCAGTTCTCCATGCTGAAGA	0.622																																					p.M604I		.											.	PC	228	0			c.G1812A						.						59.0	58.0	58.0					11																	66619923		2200	4295	6495	SO:0001583	missense	5091	exon14			GTTCTCCATGCTG	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1812G>A	11.37:g.66619923C>T	ENSP00000377530:p.Met604Ile	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_000920	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.558273	0.45590	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960	D;D;D	0.96104	-3.91;-3.91;-3.91	5.4	0.101	0.14517	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.316618	0.35495	N	0.003170	D	0.88629	0.6488	N	0.20766	0.605	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.78285	-0.2263	10	0.49607	T	0.09	-6.8528	8.5854	0.33655	0.0:0.4916:0.0:0.5084	.	604	P11498	PYC_HUMAN	I	604	ENSP00000377527:M604I;ENSP00000377530:M604I;ENSP00000377532:M604I	ENSP00000377527:M604I	M	-	3	0	PC	66376499	0.800000	0.28916	0.998000	0.56505	0.995000	0.86356	0.098000	0.15189	-0.030000	0.13804	0.563000	0.77884	ATG	.		0.622	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
PCDHB15	56121	ucsc.edu;bcgsc.ca	37	5	140627378	140627378	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr5:140627378C>T	ENST00000231173.3	+	1	2232	c.2232C>T	c.(2230-2232)acC>acT	p.T744T		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	744					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACCGGGACCCTTTCCCAGA	0.587																																					p.T744T		.											.	PCDHB15	156	0			c.C2232T						.						108.0	122.0	118.0					5																	140627378		2203	4298	6501	SO:0001819	synonymous_variant	56121	exon1			CGGGACCCTTTCC	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.2232C>T	5.37:g.140627378C>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	.	49.0	5.0	NM_018935	Q8IUX5	Silent	SNP	ENST00000231173.3	37	CCDS4257.1																																																																																			.		0.587	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
PCID2	55795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	113835485	113835485	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:113835485T>C	ENST00000337344.4	-	10	821	c.745A>G	c.(745-747)Agg>Ggg	p.R249G	PCID2_ENST00000375479.2_Missense_Mutation_p.R249G|PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000375457.2_Missense_Mutation_p.R247G|PCID2_ENST00000375459.1_Missense_Mutation_p.R247G|PCID2_ENST00000375477.1_Missense_Mutation_p.R249G|PCID2_ENST00000246505.5_Missense_Mutation_p.R303G	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	249					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			AGAATCATCCTTTTGTTCTTC	0.433																																					p.R303G		.											.	PCID2	90	0			c.A907G						.						146.0	126.0	133.0					13																	113835485		2203	4300	6503	SO:0001583	missense	55795	exon10			TCATCCTTTTGTT	AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.745A>G	13.37:g.113835485T>C	ENSP00000337405:p.Arg249Gly	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	11.0	NM_001258212	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	ENST00000337344.4	37	CCDS9532.2	.	.	.	.	.	.	.	.	.	.	T	17.51	3.406644	0.62399	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000375462;ENST00000246506;ENST00000351317	.	.	.	5.25	2.7	0.31948	PCI/PINT associated module (1);	0.000000	0.85682	D	0.000000	T	0.79275	0.4418	M	0.87038	2.855	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.71184	0.972;0.951	T	0.79799	-0.1651	9	0.52906	T	0.07	-30.4952	12.5786	0.56378	0.0:0.0:0.4358:0.5641	.	303;249	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	G	249;249;249;303;247;247;226;249;226	.	ENSP00000246505:R303G	R	-	1	2	PCID2	112883486	0.990000	0.36364	0.994000	0.49952	0.878000	0.50629	1.076000	0.30729	0.269000	0.21961	0.460000	0.39030	AGG	.		0.433	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045897.1	NM_018386	
PHC2	1912	ucsc.edu;bcgsc.ca	37	1	33832734	33832734	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:33832734T>C	ENST00000257118.5	-	6	1012	c.959A>G	c.(958-960)cAc>cGc	p.H320R	PHC2_ENST00000419414.2_Missense_Mutation_p.H320R|PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000431992.1_Missense_Mutation_p.H291R	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	320					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AATGAGGGGGTGGGCAGCCAC	0.572																																					p.H320R		.											.	PHC2	227	0			c.A959G						.						72.0	74.0	73.0					1																	33832734		2202	4299	6501	SO:0001583	missense	1912	exon6			AGGGGGTGGGCAG	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.959A>G	1.37:g.33832734T>C	ENSP00000257118:p.His320Arg	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	ENST00000257118.5	37	CCDS378.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.346655	0.61073	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000419414	T;T;T	0.35236	1.78;1.32;1.7	5.88	5.88	0.94601	.	0.174159	0.51477	D	0.000082	T	0.49541	0.1563	M	0.62723	1.935	0.80722	D	1	B;B;D	0.59357	0.158;0.158;0.985	B;B;P	0.55508	0.046;0.046;0.777	T	0.47636	-0.9102	10	0.44086	T	0.13	-10.4415	12.6927	0.56985	0.0:0.0:0.0:1.0	.	320;291;320	A8KA40;B7ZLY0;Q8IXK0	.;.;PHC2_HUMAN	R	291;320;320	ENSP00000389436:H291R;ENSP00000257118:H320R;ENSP00000391440:H320R	ENSP00000257118:H320R	H	-	2	0	PHC2	33605321	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.650000	0.61440	2.246000	0.74042	0.533000	0.62120	CAC	.		0.572	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
PGBD5	79605	ucsc.edu;bcgsc.ca	37	1	230461062	230461062	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:230461062T>A	ENST00000525115.1	-	6	1189	c.1166A>T	c.(1165-1167)tAc>tTc	p.Y389F	PGBD5_ENST00000530424.1_5'UTR|PGBD5_ENST00000391860.1_Missense_Mutation_p.Y343F|PGBD5_ENST00000321327.2_Missense_Mutation_p.Y488F			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	389						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		TTACTTGCTGTATTTGTCATC	0.527																																					p.Y458F		.											.	PGBD5	93	0			c.A1373T						.						233.0	196.0	209.0					1																	230461062		2203	4300	6503	SO:0001583	missense	79605	exon6			TTGCTGTATTTGT	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.1166A>T	1.37:g.230461062T>A	ENSP00000431404:p.Tyr389Phe	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37		.	.	.	.	.	.	.	.	.	.	T	21.1	4.102702	0.76983	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.16897	2.31;2.31;2.31	5.17	5.17	0.71159	.	0.127929	0.53938	D	0.000046	T	0.26810	0.0656	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.04635	-1.0937	10	0.13470	T	0.59	-36.2941	15.3584	0.74448	0.0:0.0:0.0:1.0	.	389;79	Q8N414;B4DM72	PGBD5_HUMAN;.	F	343;488;389	ENSP00000375733:Y343F;ENSP00000322530:Y488F;ENSP00000431404:Y389F	ENSP00000322530:Y488F	Y	-	2	0	PGBD5	228527685	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.965000	0.87945	2.099000	0.63709	0.454000	0.30748	TAC	.		0.527	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
PHLDB2	90102	ucsc.edu;bcgsc.ca	37	3	111671497	111671497	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:111671497A>G	ENST00000431670.2	+	11	3121	c.2710A>G	c.(2710-2712)Acc>Gcc	p.T904A	PHLDB2_ENST00000495180.1_Intron|PHLDB2_ENST00000412622.1_Missense_Mutation_p.T861A|PHLDB2_ENST00000393925.3_Missense_Mutation_p.T904A|PHLDB2_ENST00000481953.1_Missense_Mutation_p.T861A|PHLDB2_ENST00000393923.3_Missense_Mutation_p.T888A	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	904						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TCGAAAGAAAACCACATCTTC	0.453																																					p.T904A		.											.	PHLDB2	96	0			c.A2710G						.						134.0	130.0	131.0					3																	111671497		2203	4300	6503	SO:0001583	missense	90102	exon11			AAGAAAACCACAT		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2710A>G	3.37:g.111671497A>G	ENSP00000405405:p.Thr904Ala	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001134439	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.666088	0.47677	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.61	3.1	0.35709	.	0.307754	0.35903	N	0.002915	T	0.38612	0.1047	L	0.59436	1.845	0.37679	D	0.923426	B;B;B	0.24721	0.017;0.11;0.11	B;B;B	0.31547	0.027;0.132;0.132	T	0.16837	-1.0389	10	0.10377	T	0.69	.	6.0876	0.19976	0.751:0.1639:0.0852:0.0	.	904;861;888	Q86SQ0;Q86SQ0-2;Q86SQ0-3	PHLB2_HUMAN;.;.	A	888;904;861;861;904;861	ENSP00000377500:T888A;ENSP00000405405:T904A;ENSP00000405292:T861A;ENSP00000418296:T861A;ENSP00000377502:T904A;ENSP00000418319:T861A	ENSP00000377500:T888A	T	+	1	0	PHLDB2	113154187	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.419000	0.52728	0.964000	0.38108	0.528000	0.53228	ACC	.		0.453	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
PIK3CD	5293	ucsc.edu;bcgsc.ca	37	1	9776674	9776674	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:9776674C>A	ENST00000377346.4	+	6	972	c.777C>A	c.(775-777)ttC>ttA	p.F259L	PIK3CD_ENST00000361110.2_Missense_Mutation_p.F259L|PIK3CD_ENST00000536656.1_Missense_Mutation_p.F259L|PIK3CD_ENST00000543390.1_5'Flank	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	259	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	TCTGCCAGTTCCAGGTGAGGC	0.652																																					p.F259L		.											.	PIK3CD	1311	0			c.C777A						.						24.0	21.0	22.0					1																	9776674		2155	4214	6369	SO:0001583	missense	5293	exon6			CCAGTTCCAGGTG		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.777C>A	1.37:g.9776674C>A	ENSP00000366563:p.Phe259Leu	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.894071	0.91889	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.60548	0.18;0.18;0.18	5.5	4.58	0.56647	Phosphoinositide 3-kinase, ras-binding (2);	0.000000	0.85682	D	0.000000	T	0.73001	0.3531	M	0.78456	2.415	0.80722	D	1	D;D;D	0.76494	0.999;0.993;0.986	D;D;P	0.71414	0.973;0.95;0.877	T	0.75462	-0.3309	10	0.72032	D	0.01	-41.0529	9.7501	0.40470	0.0:0.8405:0.0:0.1595	.	259;259;259	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	L	259	ENSP00000446444:F259L;ENSP00000366563:F259L;ENSP00000354410:F259L	ENSP00000353766:F259L	F	+	3	2	PIK3CD	9699261	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.818000	0.39012	1.299000	0.44798	0.591000	0.81541	TTC	.		0.652	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
PIKFYVE	200576	ucsc.edu;bcgsc.ca	37	2	209198115	209198115	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:209198115G>A	ENST00000264380.4	+	24	4198	c.4040G>A	c.(4039-4041)gGg>gAg	p.G1347E		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1347					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGGTTTTATGGGCACCAGTAT	0.433																																					p.G1347E		.											.	PIKFYVE	583	0			c.G4040A						.						148.0	134.0	139.0					2																	209198115		2203	4300	6503	SO:0001583	missense	200576	exon24			TTTATGGGCACCA	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.4040G>A	2.37:g.209198115G>A	ENSP00000264380:p.Gly1347Glu	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	65.0	6.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883655	0.91740	.	.	ENSG00000115020	ENST00000264380;ENST00000392200;ENST00000452564	T;T	0.32023	1.47;1.67	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.57799	0.2078	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.59963	-0.7355	10	0.51188	T	0.08	-13.5398	18.5277	0.90978	0.0:0.0:1.0:0.0	.	1347;1291	Q9Y2I7;E9PDH4	FYV1_HUMAN;.	E	1347;923;1291	ENSP00000264380:G1347E;ENSP00000405736:G1291E	ENSP00000264380:G1347E	G	+	2	0	PIKFYVE	208906360	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.635000	0.83286	2.387000	0.81309	0.555000	0.69702	GGG	.		0.433	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PIKFYVE	200576	ucsc.edu;bcgsc.ca	37	2	209203240	209203240	+	Silent	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:209203240G>T	ENST00000264380.4	+	29	4778	c.4620G>T	c.(4618-4620)gcG>gcT	p.A1540A		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1540					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGATAAGTGCGATGGATGCAT	0.343																																					p.A1540A		.											.	PIKFYVE	583	0			c.G4620T						.						80.0	80.0	80.0					2																	209203240		2203	4300	6503	SO:0001819	synonymous_variant	200576	exon29			AAGTGCGATGGAT	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.4620G>T	2.37:g.209203240G>T		Somatic	70.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	37	CCDS2382.1																																																																																			.		0.343	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PITPNM1	9600	ucsc.edu;bcgsc.ca	37	11	67264809	67264809	+	Missense_Mutation	SNP	G	G	A	rs576997667	byFrequency	TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:67264809G>A	ENST00000534749.1	-	13	2227	c.2039C>T	c.(2038-2040)cCc>cTc	p.P680L	PITPNM1_ENST00000356404.3_Missense_Mutation_p.P680L|PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000436757.2_Missense_Mutation_p.P680L			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	680					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						AGTGCTGCTGGGGCCGTCAGG	0.682													G|||	2	0.000399361	0.0	0.0	5008	,	,		14243	0.0		0.0	False		,,,				2504	0.002				p.P680L	GBM(28;144 709 4607 5525)	.											.	PITPNM1	227	0			c.C2039T						.						27.0	29.0	29.0					11																	67264809		2196	4294	6490	SO:0001583	missense	9600	exon14			CTGCTGGGGCCGT	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2039C>T	11.37:g.67264809G>A	ENSP00000437286:p.Pro680Leu	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001130848	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472879	0.26423	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.44083	0.94;0.93;0.94	4.68	3.76	0.43208	.	0.925415	0.08994	N	0.863984	T	0.26122	0.0637	N	0.08118	0	0.44976	D	0.997999	B;B	0.18166	0.026;0.007	B;B	0.23419	0.046;0.015	T	0.03423	-1.1038	10	0.30854	T	0.27	-11.9903	10.5653	0.45169	0.0931:0.0:0.9069:0.0	.	680;680	O00562-2;O00562	.;PITM1_HUMAN	L	680	ENSP00000437286:P680L;ENSP00000398787:P680L;ENSP00000348772:P680L	ENSP00000348772:P680L	P	-	2	0	PITPNM1	67021385	1.000000	0.71417	0.229000	0.23960	0.225000	0.24961	3.835000	0.55805	1.101000	0.41535	0.561000	0.74099	CCC	.		0.682	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
PLA2R1	22925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160804063	160804063	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:160804063T>C	ENST00000283243.7	-	26	3923	c.3717A>G	c.(3715-3717)agA>agG	p.R1239R	PLA2R1_ENST00000460710.1_5'Flank|PLA2R1_ENST00000392771.1_Silent_p.R1239R	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1239					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GTTCAGATTGTCTTGTTTCTG	0.328																																					p.R1239R		.											.	PLA2R1	93	0			c.A3717G						.						96.0	105.0	102.0					2																	160804063		2201	4299	6500	SO:0001819	synonymous_variant	22925	exon26			AGATTGTCTTGTT	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3717A>G	2.37:g.160804063T>C		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	21.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	CCDS33309.1																																																																																			.		0.328	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
PLBD2	196463	broad.mit.edu;ucsc.edu;mdanderson.org	37	12	113824744	113824744	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:113824744C>T	ENST00000280800.3	+	10	1320	c.1289C>T	c.(1288-1290)tCc>tTc	p.S430F	PLBD2_ENST00000545182.2_Missense_Mutation_p.S398F	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	430					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CCCGGCAGGTCCTTCGAGACT	0.622																																					p.S430F		.											.	PLBD2	68	0			c.C1289T						.						51.0	44.0	46.0					12																	113824744		2203	4300	6503	SO:0001583	missense	196463	exon10			GCAGGTCCTTCGA	BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.1289C>T	12.37:g.113824744C>T	ENSP00000280800:p.Ser430Phe	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	15.0	NM_173542	F5H5E2	Missense_Mutation	SNP	ENST00000280800.3	37	CCDS9168.1	.	.	.	.	.	.	.	.	.	.	C	9.838	1.190293	0.21954	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.10860	2.83;2.83	5.33	0.429	0.16506	.	0.252483	0.41194	D	0.000924	T	0.04318	0.0119	N	0.02181	-0.65	0.23975	N	0.996292	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.36939	-0.9727	10	0.30854	T	0.27	-22.8453	15.2073	0.73190	0.6683:0.3317:0.0:0.0	.	398;430	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	F	398;430	ENSP00000443463:S398F;ENSP00000280800:S430F	ENSP00000280800:S430F	S	+	2	0	PLBD2	112309127	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	2.265000	0.43311	0.149000	0.19098	0.561000	0.74099	TCC	.		0.622	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404835.1	NM_173542	
PLCL2	23228	ucsc.edu;bcgsc.ca	37	3	17053597	17053597	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:17053597T>A	ENST00000418129.2	+	2	2846	c.2381T>A	c.(2380-2382)tTc>tAc	p.F794Y	PLCL2_ENST00000432376.1_Missense_Mutation_p.F794Y|PLCL2_ENST00000396755.2_Missense_Mutation_p.F794Y	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	920	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						GATGAGGTATTCAAGAATGCC	0.438																																					p.F794Y		.											.	PLCL2	229	0			c.T2381A						.						71.0	76.0	74.0					3																	17053597		2203	4300	6503	SO:0001583	missense	23228	exon2			AGGTATTCAAGAA	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.2381T>A	3.37:g.17053597T>A	ENSP00000409637:p.Phe794Tyr	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_015184	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	ENST00000418129.2	37	CCDS33713.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.521331|4.521331	0.85600|0.85600	.|.	.|.	ENSG00000154822|ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376|ENST00000419842	T;T;T|.	0.24723|.	1.84;1.9;1.84|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.043583|.	0.85682|.	D|.	0.000000|.	T|T	0.71771|0.71771	0.3379|0.3379	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.71159|0.71159	-0.4674|-0.4674	9|4	0.54805|.	T|.	0.06|.	.|.	15.6596|15.6596	0.77174|0.77174	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	920|.	Q9UPR0|.	PLCL2_HUMAN|.	Y|T	794;921;794;794|538	ENSP00000409637:F794Y;ENSP00000379979:F794Y;ENSP00000412836:F794Y|.	ENSP00000285094:F921Y|.	F|S	+|+	2|1	0|0	PLCL2|PLCL2	17028601|17028601	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	8.040000|8.040000	0.89188|0.89188	2.110000|2.110000	0.64415|0.64415	0.402000|0.402000	0.26972|0.26972	TTC|TCA	.		0.438	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
PLEKHG4	25894	ucsc.edu;bcgsc.ca	37	16	67320715	67320715	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:67320715C>A	ENST00000360461.5	+	16	5353	c.2818C>A	c.(2818-2820)Cac>Aac	p.H940N	PLEKHG4_ENST00000427155.2_Missense_Mutation_p.H940N|PLEKHG4_ENST00000450733.1_Missense_Mutation_p.H859N|PLEKHG4_ENST00000379344.3_Missense_Mutation_p.H940N	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	940	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CACTGGGCGCCACAAGTCCGT	0.607																																					p.H940N		.											.	PLEKHG4	92	0			c.C2818A						.						63.0	66.0	65.0					16																	67320715		2198	4300	6498	SO:0001583	missense	25894	exon17			GGGCGCCACAAGT	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.2818C>A	16.37:g.67320715C>A	ENSP00000353646:p.His940Asn	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001129728	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	37	CCDS32466.1	.	.	.	.	.	.	.	.	.	.	C	14.86	2.661102	0.47572	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	4.62	3.6	0.41247	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.235883	0.21961	N	0.066585	T	0.10252	0.0251	L	0.28274	0.84	0.24864	N	0.992323	P;P	0.38504	0.634;0.501	B;B	0.41813	0.367;0.054	T	0.13522	-1.0506	10	0.87932	D	0	.	11.5091	0.50484	0.2993:0.7007:0.0:0.0	.	859;940	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	N	940;940;940;859	ENSP00000353646:H940N;ENSP00000401118:H940N;ENSP00000368649:H940N;ENSP00000398030:H859N	ENSP00000353646:H940N	H	+	1	0	PLEKHG4	65878216	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	2.502000	0.45398	2.291000	0.77112	0.313000	0.20887	CAC	.		0.607	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
PLOD1	5351	ucsc.edu;bcgsc.ca	37	1	12020740	12020740	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:12020740C>T	ENST00000196061.4	+	10	1040	c.1013C>T	c.(1012-1014)gCa>gTa	p.A338V	PLOD1_ENST00000376369.3_Missense_Mutation_p.A385V	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	338					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	GAGTTCCTGGCACAGCATGGC	0.637																																					p.A338V		.											.	PLOD1	155	0			c.C1013T						.						91.0	79.0	83.0					1																	12020740		2203	4300	6503	SO:0001583	missense	5351	exon10			TCCTGGCACAGCA	BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1013C>T	1.37:g.12020740C>T	ENSP00000196061:p.Ala338Val	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_000302	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	ENST00000196061.4	37	CCDS142.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396082	0.42512	.	.	ENSG00000083444	ENST00000376369;ENST00000196061	D;D	0.85556	-2.0;-2.0	5.42	2.02	0.26589	.	0.697001	0.14901	N	0.291787	T	0.68632	0.3022	N	0.08118	0	0.23487	N	0.997571	B;B	0.12630	0.004;0.006	B;B	0.14023	0.007;0.01	T	0.59311	-0.7478	10	0.49607	T	0.09	.	7.5537	0.27812	0.3715:0.5427:0.0:0.0857	.	385;338	B4DR87;Q02809	.;PLOD1_HUMAN	V	385;338	ENSP00000365548:A385V;ENSP00000196061:A338V	ENSP00000196061:A338V	A	+	2	0	PLOD1	11943327	0.059000	0.20769	0.960000	0.40013	0.872000	0.50106	0.486000	0.22340	0.611000	0.30052	0.650000	0.86243	GCA	.		0.637	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006865.1	NM_000302	
PQLC1	80148	ucsc.edu;bcgsc.ca	37	18	77710729	77710729	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:77710729G>A	ENST00000397778.2	-	2	380	c.198C>T	c.(196-198)ctC>ctT	p.L66L	PQLC1_ENST00000409073.1_5'UTR|PQLC1_ENST00000590381.1_Silent_p.L66L|PQLC1_ENST00000357575.4_Silent_p.L66L	NM_025078.4	NP_079354.2	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	66	PQ-loop 1.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	9		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		CTTACCAGAAGAGTATCCGCA	0.602																																					p.L66L		.											.	PQLC1	154	0			c.C198T						.						59.0	55.0	56.0					18																	77710729		2203	4299	6502	SO:0001819	synonymous_variant	80148	exon2			CCAGAAGAGTATC	AK123870	CCDS12020.1, CCDS54192.1, CCDS54193.1	18q23	2004-01-14			ENSG00000122490	ENSG00000122490			26188	protein-coding gene	gene with protein product						12477932	Standard	NM_025078		Approved	FLJ22378	uc002lnl.2	Q8N2U9	OTTHUMG00000132921	ENST00000397778.2:c.198C>T	18.37:g.77710729G>A		Somatic	73.0	0.0		WXS	Illumina HiSeq	.	51.0	5.0	NM_025078	B7Z7D9|G5E989|Q9H6D0	Silent	SNP	ENST00000397778.2	37	CCDS12020.1																																																																																			.		0.602	PQLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256434.1	NM_025078	
PRKD2	25865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47207834	47207834	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:47207834C>T	ENST00000291281.4	-	4	809	c.584G>A	c.(583-585)cGc>cAc	p.R195H	PRKD2_ENST00000600194.1_Missense_Mutation_p.R38H|PRKD2_ENST00000601806.1_Missense_Mutation_p.R38H|PRKD2_ENST00000595515.1_Missense_Mutation_p.R195H|PRKD2_ENST00000433867.1_Missense_Mutation_p.R195H			Q9BZL6	KPCD2_HUMAN	protein kinase D2	195					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GGATGACAGGCGCCGTTTGCG	0.652											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R195H		.											.	PRKD2	759	0			c.G584A						.						38.0	43.0	41.0					19																	47207834		2203	4300	6503	SO:0001583	missense	25865	exon4			GACAGGCGCCGTT	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.584G>A	19.37:g.47207834C>T	ENSP00000291281:p.Arg195His	Somatic	31.0	0.0	945	WXS	Illumina HiSeq	Phase_I	47.0	13.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	32	5.164073	0.94727	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.69040	-0.37;-0.37	5.4	5.4	0.78164	.	0.163832	0.37761	N	0.001948	T	0.77505	0.4140	M	0.61703	1.905	0.54753	D	0.999985	D;D	0.65815	0.995;0.995	P;P	0.58520	0.775;0.84	T	0.78795	-0.2064	10	0.56958	D	0.05	-37.0929	17.9478	0.89044	0.0:1.0:0.0:0.0	.	195;195	E7ER94;Q9BZL6	.;KPCD2_HUMAN	H	195	ENSP00000291281:R195H;ENSP00000393978:R195H	ENSP00000291281:R195H	R	-	2	0	PRKD2	51899674	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	3.778000	0.55371	2.535000	0.85469	0.313000	0.20887	CGC	.		0.652	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
PSKH2	85481	broad.mit.edu;bcgsc.ca	37	8	87076798	87076798	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:87076798T>C	ENST00000276616.2	-	2	322	c.248A>G	c.(247-249)aAg>aGg	p.K83R	PSKH2_ENST00000517981.1_5'UTR	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	83	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			CTTGGTGGTCTTCTGCTCTAC	0.488																																					p.K83R		.											.	PSKH2	385	0			c.A248G						.						96.0	80.0	86.0					8																	87076798		2203	4300	6503	SO:0001583	missense	85481	exon2			GTGGTCTTCTGCT	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.248A>G	8.37:g.87076798T>C	ENSP00000276616:p.Lys83Arg	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	7.0	NM_033126	A0AV22	Missense_Mutation	SNP	ENST00000276616.2	37	CCDS6240.1	.	.	.	.	.	.	.	.	.	.	T	6.776	0.512034	0.12944	.	.	ENSG00000147613	ENST00000276616	T	0.65732	-0.17	5.13	3.75	0.43078	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.39145	0.1067	N	0.13043	0.29	0.27791	N	0.942828	B	0.10296	0.003	B	0.15484	0.013	T	0.22626	-1.0211	9	0.13108	T	0.6	.	6.3553	0.21398	0.0:0.1982:0.0:0.8018	.	83	Q96QS6	KPSH2_HUMAN	R	83	ENSP00000276616:K83R	ENSP00000276616:K83R	K	-	2	0	PSKH2	87145914	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.150000	0.31639	1.908000	0.55244	0.482000	0.46254	AAG	.		0.488	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	NM_033126	
PYGM	5837	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	64522270	64522270	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:64522270A>T	ENST00000164139.3	-	8	1292	c.894T>A	c.(892-894)taT>taA	p.Y298*	PYGM_ENST00000377432.3_Nonsense_Mutation_p.Y210*|PYGM_ENST00000462303.1_5'Flank	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	298					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCACCACGAAATACTCCTGCT	0.612																																					p.Y298X		.											.	PYGM	92	0			c.T894A						.						83.0	66.0	71.0					11																	64522270		2201	4297	6498	SO:0001587	stop_gained	5837	exon8			CACGAAATACTCC		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.894T>A	11.37:g.64522270A>T	ENSP00000164139:p.Tyr298*	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	8.0	NM_005609	A0AVK1|A6NDY6	Nonsense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	A	41	8.610609	0.98884	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	.	.	.	4.89	3.01	0.34805	.	0.000000	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.2113	9.3743	0.38272	0.1485:0.0:0.8515:0.0	.	.	.	.	X	210;298;279	.	ENSP00000164139:Y298X	Y	-	3	2	PYGM	64278846	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	3.090000	0.50191	0.657000	0.30906	-0.441000	0.05720	TAT	.		0.612	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
QRSL1	55278	ucsc.edu;bcgsc.ca	37	6	107113739	107113739	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:107113739T>C	ENST00000369046.4	+	11	1553	c.1449T>C	c.(1447-1449)tgT>tgC	p.C483C		NM_018292.4	NP_060762.3			glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1											endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		GTGCGTTTTGTGACCAGCAGC	0.438																																					p.C483C	NSCLC(192;2127 2142 11668 26277 49545)	.											.	QRSL1	90	0			c.T1449C						.						76.0	70.0	72.0					6																	107113739		2203	4300	6503	SO:0001819	synonymous_variant	55278	exon11			GTTTTGTGACCAG	AK001851	CCDS5057.1	6q21	2014-08-04			ENSG00000130348	ENSG00000130348			21020	protein-coding gene	gene with protein product	"""glutamyl-tRNA(Gln) amidotransferase, subunit A"""					11230166, 19805282	Standard	NM_018292		Approved	GatA, FLJ10989, FLJ12189, DKFZP564C1278, FLJ13447	uc003prm.3	Q9H0R6	OTTHUMG00000015301	ENST00000369046.4:c.1449T>C	6.37:g.107113739T>C		Somatic	67.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_018292		Silent	SNP	ENST00000369046.4	37	CCDS5057.1																																																																																			.		0.438	QRSL1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041667.1	NM_018292	
RAD51B	5890	ucsc.edu;bcgsc.ca	37	14	68331784	68331784	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr14:68331784T>C	ENST00000487270.1	+	5	428	c.380T>C	c.(379-381)tTa>tCa	p.L127S	RAD51B_ENST00000471583.1_Missense_Mutation_p.L127S|RAD51B_ENST00000487861.1_Missense_Mutation_p.L127S|RAD51B_ENST00000390683.3_Missense_Mutation_p.L127S|RAD51B_ENST00000488612.1_Missense_Mutation_p.L127S	NM_133509.3	NP_598193.2	O15315	RA51B_HUMAN	RAD51 paralog B	127					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|reciprocal meiotic recombination (GO:0007131)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)		HMGA2/RAD51B(11)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11						TTGGCTACATTACCCACCAAC	0.318								Direct reversal of damage																													p.L127S		.											.	RAD51B	660	0			c.T380C						.						85.0	77.0	80.0					14																	68331784		2203	4300	6503	SO:0001583	missense	5890	exon5			CTACATTACCCAC	U84138	CCDS9789.1, CCDS9790.1	14q23-q24.2	2013-07-02	2013-07-02	2011-07-01	ENSG00000182185	ENSG00000182185			9822	protein-coding gene	gene with protein product		602948	"""RAD51 (S. cerevisiae)-like 1"", ""RAD51-like 1 (S. cerevisiae)"", ""RAD51 homolog B (S. cerevisiae)"""	RAD51L1		6261043, 9207106	Standard	NM_002877		Approved	REC2, hREC2, R51H2	uc001xkf.2	O15315	OTTHUMG00000157530	ENST00000487270.1:c.380T>C	14.37:g.68331784T>C	ENSP00000419471:p.Leu127Ser	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_133509	O60914|O75210|Q3Y4F8|Q6FHX8|Q86SY3|Q86SY4|Q86TR0|Q86U92|Q86U93|Q86U94|Q8N6H4|Q9UPL5	Missense_Mutation	SNP	ENST00000487270.1	37	CCDS9789.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243318	0.79912	.	.	ENSG00000182185	ENST00000487861;ENST00000471583;ENST00000487270;ENST00000488612;ENST00000485181;ENST00000390683;ENST00000402498;ENST00000342389	T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34	5.21	5.21	0.72293	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.000000	0.56097	D	0.000031	T	0.74053	0.3666	M	0.85197	2.74	0.50313	D	0.999862	P;D;P;D;P;P	0.71674	0.938;0.998;0.928;0.996;0.928;0.746	P;D;P;D;P;P	0.70227	0.791;0.968;0.671;0.939;0.671;0.661	T	0.79191	-0.1905	10	0.87932	D	0	-25.4599	13.9413	0.64057	0.0:0.0:0.0:1.0	.	127;127;127;127;127;127	C9JYJ0;C9JSP9;O15315-4;O15315;O15315-1;O15315-2	.;.;.;RA51B_HUMAN;.;.	S	127	ENSP00000419881:L127S;ENSP00000418859:L127S;ENSP00000419471:L127S;ENSP00000420061:L127S;ENSP00000417948:L127S;ENSP00000375101:L127S	ENSP00000343531:L127S	L	+	2	0	RAD51B	67401537	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.342000	0.72982	2.101000	0.63845	0.383000	0.25322	TTA	.		0.318	RAD51B-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000349063.1		
RETNLB	84666	ucsc.edu;bcgsc.ca	37	3	108476030	108476030	+	Start_Codon_SNP	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:108476030C>A	ENST00000295755.6	-	1	201	c.3G>T	c.(1-3)atG>atT	p.M1I	RETNLB_ENST00000482939.1_5'Flank	NM_032579.2	NP_115968.1	Q9BQ08	RETNB_HUMAN	resistin like beta	1					cell proliferation (GO:0008283)	extracellular region (GO:0005576)				endometrium(1)|kidney(3)|lung(10)|prostate(1)|skin(1)	16						AGGACGGCCCCATCCTGTACA	0.527																																					p.M1I		.											.	RETNLB	91	0			c.G3T						.						58.0	53.0	55.0					3																	108476030		2203	4300	6503	SO:0001582	initiator_codon_variant	84666	exon1			CGGCCCCATCCTG	AF290873	CCDS2953.1	3q13.1	2008-02-05			ENSG00000163515	ENSG00000163515			20388	protein-coding gene	gene with protein product		605645				10921885, 12574343	Standard	NM_032579		Approved	HXCP2, FIZZ2, RELMb	uc003dxh.2	Q9BQ08	OTTHUMG00000159393	ENST00000295755.6:c.3G>T	3.37:g.108476030C>A	ENSP00000295755:p.Met1Ile	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_032579	Q14D27	Missense_Mutation	SNP	ENST00000295755.6	37	CCDS2953.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.596326	0.28445	.	.	ENSG00000163515	ENST00000295755	T	0.45668	0.89	4.6	2.76	0.32466	.	0.000000	0.53938	D	0.000054	T	0.27900	0.0687	.	.	.	0.39295	D	0.964805	P	0.37330	0.59	B	0.30251	0.113	T	0.12708	-1.0537	9	0.87932	D	0	-10.2175	5.4675	0.16652	0.1965:0.7003:0.0:0.1031	.	1	Q9BQ08	RETNB_HUMAN	I	1	ENSP00000295755:M1I	ENSP00000295755:M1I	M	-	3	0	RETNLB	109958720	0.996000	0.38824	0.134000	0.22075	0.363000	0.29612	0.638000	0.24674	0.524000	0.28502	0.655000	0.94253	ATG	.		0.527	RETNLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355093.1		Missense_Mutation
RIMS1	22999	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	72892264	72892264	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:72892264T>G	ENST00000521978.1	+	6	1090	c.1090T>G	c.(1090-1092)Tac>Gac	p.Y364D	RIMS1_ENST00000348717.5_Missense_Mutation_p.Y364D|RIMS1_ENST00000522291.1_Missense_Mutation_p.Y364D|RIMS1_ENST00000520567.1_Missense_Mutation_p.Y364D|RIMS1_ENST00000491071.2_Missense_Mutation_p.Y364D|RIMS1_ENST00000518273.1_Missense_Mutation_p.Y364D|RIMS1_ENST00000264839.7_Missense_Mutation_p.Y364D|RIMS1_ENST00000517960.1_Missense_Mutation_p.Y364D	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	364					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCTAGCTCGGTACCCGGTGAA	0.652																																					p.Y364D		.											.	RIMS1	144	0			c.T1090G						.						16.0	21.0	19.0					6																	72892264		1959	4049	6008	SO:0001583	missense	22999	exon6			GCTCGGTACCCGG	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.1090T>G	6.37:g.72892264T>G	ENSP00000428417:p.Tyr364Asp	Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	45.0	20.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	T	13.99	2.400676	0.42613	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	4.43	3.22	0.36961	.	0.000000	0.51477	U	0.000099	T	0.26195	0.0639	M	0.73217	2.22	0.41685	D	0.989317	P	0.45902	0.868	B	0.39299	0.296	T	0.10543	-1.0625	10	0.72032	D	0.01	-0.3878	10.0519	0.42221	0.151:0.0:0.0:0.849	.	364	Q86UR5	RIMS1_HUMAN	D	364	ENSP00000430101:Y364D;ENSP00000275037:Y364D;ENSP00000264839:Y364D;ENSP00000429959:Y364D;ENSP00000430408:Y364D;ENSP00000430502:Y364D;ENSP00000430932:Y364D;ENSP00000428417:Y364D	ENSP00000264839:Y364D	Y	+	1	0	RIMS1	72948985	1.000000	0.71417	0.009000	0.14445	0.882000	0.50991	4.466000	0.60148	0.529000	0.28599	0.379000	0.24179	TAC	.		0.652	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
REV3L	5980	ucsc.edu;bcgsc.ca	37	6	111696640	111696640	+	Missense_Mutation	SNP	G	G	T	rs183900471		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:111696640G>T	ENST00000358835.3	-	14	3372	c.2918C>A	c.(2917-2919)cCt>cAt	p.P973H	REV3L_ENST00000435970.1_Missense_Mutation_p.P895H|REV3L_ENST00000368802.3_Missense_Mutation_p.P973H|REV3L_ENST00000368805.1_Missense_Mutation_p.P973H			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	973					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TATGATGACAGGGGGCAGCTT	0.313								DNA polymerases (catalytic subunits)																													p.P973H		.											.	REV3L	294	0			c.C2918A						.						19.0	20.0	20.0					6																	111696640		2199	4290	6489	SO:0001583	missense	5980	exon13			ATGACAGGGGGCA	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.2918C>A	6.37:g.111696640G>T	ENSP00000351697:p.Pro973His	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	41.0	5.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487355	0.63962	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.26810	1.8;1.8;1.8;1.71	6.02	6.02	0.97574	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	M	0.73962	2.25	0.53688	D	0.999972	D	0.89917	1.0	D	0.87578	0.998	T	0.47381	-0.9122	10	0.87932	D	0	-26.3922	20.5407	0.99260	0.0:0.0:1.0:0.0	.	973	O60673	DPOLZ_HUMAN	H	973;973;973;895	ENSP00000357792:P973H;ENSP00000357795:P973H;ENSP00000351697:P973H;ENSP00000402003:P895H	ENSP00000351697:P973H	P	-	2	0	REV3L	111803333	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.295000	0.96095	2.865000	0.98341	0.655000	0.94253	CCT	G|0.999;A|0.000		0.313	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
RINL	126432	ucsc.edu;bcgsc.ca	37	19	39360320	39360320	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:39360320A>G	ENST00000591812.1	-	10	1453	c.1367T>C	c.(1366-1368)cTg>cCg	p.L456P	RINL_ENST00000340740.3_Missense_Mutation_p.L342P|RINL_ENST00000598904.1_Missense_Mutation_p.L342P|RINL_ENST00000602238.1_5'Flank|CTC-360G5.6_ENST00000593830.1_RNA			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	456	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						CAGCGCCGGCAGGAAGGCGTC	0.592											OREG0025454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L456P		.											.	RINL	91	0			c.T1367C						.						54.0	62.0	59.0					19																	39360320		2203	4300	6503	SO:0001583	missense	126432	exon10			GCCGGCAGGAAGG	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1367T>C	19.37:g.39360320A>G	ENSP00000467107:p.Leu456Pro	Somatic	43.0	0.0	885	WXS	Illumina HiSeq	.	45.0	6.0	NM_001195833	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.316836	0.81469	.	.	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.59224	0.28	5.06	5.06	0.68205	Vacuolar sorting protein 9 (2);	0.170428	0.39146	N	0.001451	T	0.75361	0.3839	M	0.81341	2.54	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78934	-0.2008	10	0.87932	D	0	-4.9528	11.4709	0.50268	1.0:0.0:0.0:0.0	.	456;342	B4DPG5;Q6ZS11	.;RINL_HUMAN	P	342	ENSP00000340369:L342P	ENSP00000340369:L342P	L	-	2	0	RINL	44052160	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	5.206000	0.65192	2.021000	0.59480	0.379000	0.24179	CTG	.		0.592	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
RNASE10	338879	ucsc.edu;bcgsc.ca	37	14	20979191	20979191	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr14:20979191T>C	ENST00000328444.5	+	1	580	c.561T>C	c.(559-561)acT>acC	p.T187T	RNASE10_ENST00000430083.1_Silent_p.T215T	NM_001012975.1	NP_001012993.1	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	187					epithelial cell morphogenesis (GO:0003382)|heterotypic cell-cell adhesion (GO:0034113)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of sperm motility (GO:1902093)|regulation of fertilization (GO:0080154)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	12	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		ACCAGGTCACTCCTAACTGCA	0.438																																					p.T187T		.											.	RNASE10	90	0			c.T561C						.						67.0	65.0	65.0					14																	20979191		2203	4300	6503	SO:0001819	synonymous_variant	338879	exon1			GGTCACTCCTAAC		CCDS32035.1	14q11.1	2004-11-16				ENSG00000182545		"""Ribonucleases, RNase A"""	19275	protein-coding gene	gene with protein product						12920233	Standard	XM_005267584		Approved	RNASE9	uc010tlj.2	Q5GAN6		ENST00000328444.5:c.561T>C	14.37:g.20979191T>C		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	35.0	5.0	NM_001012975	A2RUQ3|B4DKY4	Silent	SNP	ENST00000328444.5	37	CCDS32035.1																																																																																			.		0.438	RNASE10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411088.1	XM_292225	
RTEL1	51750	ucsc.edu;bcgsc.ca	37	20	62324537	62324537	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:62324537G>A	ENST00000360203.5	+	30	3218	c.2893G>A	c.(2893-2895)Gag>Aag	p.E965K	RTEL1_ENST00000318100.4_Missense_Mutation_p.E965K|RTEL1_ENST00000508582.2_Missense_Mutation_p.E989K|RTEL1_ENST00000370018.3_Missense_Mutation_p.E965K|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.E965K|RTEL1_ENST00000370003.1_Missense_Mutation_p.E210K					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GCAGCAGTTTGAGGAGGTCTG	0.597																																					p.E989K		.											.	RTEL1	44	0			c.G2965A						.						111.0	118.0	116.0					20																	62324537		2201	4294	6495	SO:0001583	missense	51750	exon30			CAGTTTGAGGAGG	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2893G>A	20.37:g.62324537G>A	ENSP00000353332:p.Glu965Lys	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_032957		Missense_Mutation	SNP	ENST00000360203.5	37		.	.	.	.	.	.	.	.	.	.	G	11.44	1.639729	0.29157	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000370003	T;T;T;T;T	0.09350	2.99;2.99;2.99;2.99;2.99	4.82	4.82	0.62117	.	0.109676	0.64402	D	0.000010	T	0.13543	0.0328	M	0.64997	1.995	0.38021	D	0.934862	B;P;B;B	0.38223	0.009;0.623;0.002;0.009	B;B;B;B	0.32289	0.013;0.143;0.008;0.03	T	0.09552	-1.0669	10	0.46703	T	0.11	-31.9999	16.6576	0.85232	0.0:0.0:1.0:0.0	.	989;210;965;965	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	K	965;965;989;965;210	ENSP00000359035:E965K;ENSP00000322287:E965K;ENSP00000424307:E989K;ENSP00000353332:E965K;ENSP00000359020:E210K	ENSP00000353332:E965K	E	+	1	0	AL353715.1	61794981	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	4.596000	0.61055	2.220000	0.72140	0.289000	0.19496	GAG	.		0.597	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
RYR3	6263	ucsc.edu;bcgsc.ca	37	15	34030707	34030707	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:34030707G>T	ENST00000389232.4	+	50	7642	c.7572G>T	c.(7570-7572)tgG>tgT	p.W2524C	RYR3_ENST00000415757.3_Missense_Mutation_p.W2524C	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2524	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTTCAGGATGGGGGAGCTACG	0.512											OREG0023032	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W2524C		.											.	RYR3	520	0			c.G7572T						.						91.0	96.0	95.0					15																	34030707		1952	4135	6087	SO:0001583	missense	6263	exon50			AGGATGGGGGAGC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7572G>T	15.37:g.34030707G>T	ENSP00000373884:p.Trp2524Cys	Somatic	35.0	0.0	844	WXS	Illumina HiSeq	.	59.0	5.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586962	0.66105	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.93366	-3.21;-3.21	5.65	5.65	0.86999	.	0.409051	0.24377	N	0.039043	D	0.95414	0.8511	M	0.66939	2.045	0.80722	D	1	D;D	0.60575	0.988;0.97	P;P	0.55161	0.77;0.566	D	0.95179	0.8297	10	0.66056	D	0.02	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	2524;2524	Q15413-2;Q15413	.;RYR3_HUMAN	C	2524	ENSP00000373884:W2524C;ENSP00000399610:W2524C	ENSP00000354735:W2524C	W	+	3	0	RYR3	31817999	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	6.470000	0.73558	2.941000	0.99782	0.655000	0.94253	TGG	.		0.512	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SEC14L3	266629	ucsc.edu;bcgsc.ca	37	22	30860870	30860870	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr22:30860870C>T	ENST00000215812.4	-	8	691	c.601G>A	c.(601-603)Ggc>Agc	p.G201S	SEC14L3_ENST00000403066.1_Missense_Mutation_p.G142S|SEC14L3_ENST00000539629.1_Missense_Mutation_p.G142S|SEC14L3_ENST00000402286.1_Missense_Mutation_p.G124S|SEC14L3_ENST00000401751.1_Missense_Mutation_p.G142S|SEC14L3_ENST00000415957.2_Missense_Mutation_p.G142S|SEC14L3_ENST00000540910.1_Missense_Mutation_p.G124S	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	201	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	AGGTTGTAGCCCACAGGGAAC	0.438																																					p.G201S	Esophageal Squamous(108;290 1516 3584 23771 37333)	.											.	SEC14L3	95	0			c.G601A						.						151.0	134.0	140.0					22																	30860870		2203	4300	6503	SO:0001583	missense	266629	exon8			TGTAGCCCACAGG	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.601G>A	22.37:g.30860870C>T	ENSP00000215812:p.Gly201Ser	Somatic	88.0	0.0		WXS	Illumina HiSeq	.	56.0	5.0	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	37	CCDS13877.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.58|12.58	1.979263|1.979263	0.34942|0.34942	.|.	.|.	ENSG00000100012|ENSG00000100012	ENST00000403066;ENST00000415957;ENST00000215812;ENST00000402286;ENST00000401751;ENST00000539629;ENST00000540910|ENST00000435069	T;T;T;T;T;T;T|.	0.74421|.	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84|.	5.4|5.4	4.37|4.37	0.52481|0.52481	Cellular retinaldehyde-binding/triple function, C-terminal (5);|.	0.105171|.	0.64402|.	D|.	0.000005|.	T|.	0.57888|.	0.2084|.	L|L	0.38838|0.38838	1.175|1.175	0.80722|0.80722	D|D	1|1	B;B|.	0.21821|.	0.061;0.006|.	B;B|.	0.22152|.	0.038;0.038|.	T|.	0.54397|.	-0.8300|.	10|.	0.62326|.	D|.	0.03|.	-23.4724|-23.4724	15.7666|15.7666	0.78131|0.78131	0.0:0.863:0.137:0.0|0.0:0.863:0.137:0.0	.|.	124;201|.	E9PE57;Q9UDX4|.	.;S14L3_HUMAN|.	S|X	142;142;201;124;142;142;124|166	ENSP00000385941:G142S;ENSP00000401864:G142S;ENSP00000215812:G201S;ENSP00000385004:G124S;ENSP00000383896:G142S;ENSP00000444691:G142S;ENSP00000439752:G124S|.	ENSP00000215812:G201S|.	G|W	-|-	1|3	0|0	SEC14L3|SEC14L3	29190870|29190870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.072000|0.072000	0.16883|0.16883	7.396000|7.396000	0.79891|0.79891	1.262000|1.262000	0.44165|0.44165	-0.176000|-0.176000	0.13171|0.13171	GGC|TGG	.		0.438	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
SEMG1	6406	broad.mit.edu;bcgsc.ca	37	20	43837123	43837123	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:43837123A>G	ENST00000372781.3	+	2	1242	c.1185A>G	c.(1183-1185)caA>caG	p.Q395Q	SEMG1_ENST00000244069.6_Silent_p.Q335Q	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	395	Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				ATCCTAAGCAAGAGCCATGGC	0.428																																					p.Q395Q		.											.	SEMG1	92	0			c.A1185G						.						73.0	66.0	69.0					20																	43837123		2203	4300	6503	SO:0001819	synonymous_variant	6406	exon2			TAAGCAAGAGCCA		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.1185A>G	20.37:g.43837123A>G		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_003007	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Silent	SNP	ENST00000372781.3	37	CCDS13345.1																																																																																			.		0.428	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079416.3	NM_003007	
SETD1A	9739	ucsc.edu;bcgsc.ca	37	16	30976519	30976519	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:30976519A>G	ENST00000262519.8	+	7	2142	c.1456A>G	c.(1456-1458)Agc>Ggc	p.S486G		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	486	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CGCCCAGCACAGCAGCCTGGA	0.617																																					p.S486G		.											.	SETD1A	93	0			c.A1456G						.						46.0	47.0	46.0					16																	30976519		2197	4300	6497	SO:0001583	missense	9739	exon7			CAGCACAGCAGCC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1456A>G	16.37:g.30976519A>G	ENSP00000262519:p.Ser486Gly	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	ENST00000262519.8	37	CCDS32435.1	.	.	.	.	.	.	.	.	.	.	A	15.55	2.867800	0.51588	.	.	ENSG00000099381	ENST00000262519	D	0.95171	-3.63	5.55	5.55	0.83447	.	0.154508	0.53938	D	0.000042	D	0.94358	0.8186	N	0.22421	0.69	0.47407	D	0.999419	D	0.69078	0.997	D	0.75020	0.985	D	0.93973	0.7251	10	0.35671	T	0.21	.	14.6663	0.68910	1.0:0.0:0.0:0.0	.	486	O15047	SET1A_HUMAN	G	486	ENSP00000262519:S486G	ENSP00000262519:S486G	S	+	1	0	SETD1A	30884020	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.978000	0.70501	2.102000	0.63906	0.459000	0.35465	AGC	.		0.617	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
SHC1	6464	ucsc.edu;bcgsc.ca	37	1	154938479	154938479	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:154938479C>T	ENST00000368445.5	-	10	1541	c.1327G>A	c.(1327-1329)Gct>Act	p.A443T	SHC1_ENST00000368453.4_Missense_Mutation_p.A334T|SHC1_ENST00000606391.1_Missense_Mutation_p.A244T|SHC1_ENST00000368449.4_Missense_Mutation_p.A214T|SHC1_ENST00000448116.2_Missense_Mutation_p.A444T|PYGO2_ENST00000483463.1_5'Flank|SHC1_ENST00000490667.1_5'Flank|SHC1_ENST00000368450.1_Missense_Mutation_p.A333T	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	443	CH1.|Pro-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGGGGCCCAGCACCACCCACT	0.567																																					p.A444T	NSCLC(4;32 234 1864 2492 3259 13747 17376)	.											.	SHC1	847	0			c.G1330A						.						81.0	86.0	84.0					1																	154938479		2203	4300	6503	SO:0001583	missense	6464	exon10			GCCCAGCACCACC	U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.1327G>A	1.37:g.154938479C>T	ENSP00000357430:p.Ala443Thr	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_001130040	B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	37	CCDS30881.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.199|9.199	1.027977|1.027977	0.19512|0.19512	.|.	.|.	ENSG00000160691|ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368449;ENST00000368453;ENST00000368450;ENST00000368443;ENST00000368441;ENST00000414115|ENST00000444664	T;T;T;T;T;T|.	0.49139|.	0.79;0.79;0.79;0.79;0.79;0.79|.	4.52|4.52	3.61|3.61	0.41365|0.41365	.|.	0.452279|.	0.21731|.	N|.	0.069968|.	T|T	0.10551|0.10551	0.0258|0.0258	N|N	0.22421|0.22421	0.69|0.69	0.21627|0.21627	N|N	0.999611|0.999611	B;B;B|.	0.34181|.	0.029;0.032;0.44|.	B;B;B|.	0.26969|.	0.008;0.025;0.075|.	T|T	0.22068|0.22068	-1.0227|-1.0227	10|5	0.21014|.	T|.	0.42|.	.|.	6.9017|6.9017	0.24286|0.24286	0.1726:0.7356:0.0:0.0918|0.1726:0.7356:0.0:0.0918	.|.	222;444;443|.	Q59HB0;P29353-6;P29353|.	.;.;SHC1_HUMAN|.	T|Y	443;444;244;334;333;380;115;197|106	ENSP00000357430:A443T;ENSP00000401303:A444T;ENSP00000357434:A244T;ENSP00000357438:A334T;ENSP00000357435:A333T;ENSP00000404908:A197T|.	ENSP00000357426:A115T|.	A|C	-|-	1|2	0|0	SHC1|SHC1	153205103|153205103	0.355000|0.355000	0.24921|0.24921	0.743000|0.743000	0.31040|0.31040	0.718000|0.718000	0.41266|0.41266	-0.422000|-0.422000	0.07043|0.07043	1.134000|1.134000	0.42165|0.42165	0.557000|0.557000	0.71058|0.71058	GCT|TGC	.		0.567	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001	
SLC25A37	51312	ucsc.edu;bcgsc.ca	37	8	23425873	23425873	+	Missense_Mutation	SNP	G	G	A	rs147621958		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:23425873G>A	ENST00000519973.1	+	3	676	c.478G>A	c.(478-480)Gta>Ata	p.V160I		NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	160					iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CCACGATGCGGTAATGAATCC	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		18471	0.0		0.001	False		,,,				2504	0.0				p.V160I		.											.	SLC25A37	90	0			c.G478A						.						211.0	199.0	203.0					8																	23425873		1937	4152	6089	SO:0001583	missense	51312	exon3			GATGCGGTAATGA	AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.478G>A	8.37:g.23425873G>A	ENSP00000429200:p.Val160Ile	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_016612	A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Missense_Mutation	SNP	ENST00000519973.1	37	CCDS47828.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.93	1.785002	0.31593	.	.	ENSG00000147454	ENST00000519973;ENST00000523930	T;T	0.80304	-1.36;-1.2	5.7	5.7	0.88788	Mitochondrial carrier domain (2);	0.065529	0.64402	D	0.000005	T	0.71400	0.3335	L	0.28556	0.865	0.58432	D	0.999995	B	0.23937	0.094	B	0.18871	0.023	T	0.65861	-0.6065	10	0.15066	T	0.55	-1.3253	18.4109	0.90550	0.0:0.0:1.0:0.0	.	160	Q9NYZ2	MFRN1_HUMAN	I	160;141	ENSP00000429200:V160I;ENSP00000428066:V141I	ENSP00000429200:V160I	V	+	1	0	SLC25A37	23481818	1.000000	0.71417	0.982000	0.44146	0.991000	0.79684	5.108000	0.64609	2.688000	0.91661	0.655000	0.94253	GTA	G|0.999;A|0.000		0.522	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612	
SLC30A8	169026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	118170071	118170071	+	Missense_Mutation	SNP	C	C	T	rs141202988		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:118170071C>T	ENST00000456015.2	+	4	560	c.560C>T	c.(559-561)gCg>gTg	p.A187V	SLC30A8_ENST00000519688.1_Missense_Mutation_p.A138V|SLC30A8_ENST00000521243.1_Missense_Mutation_p.A138V|SLC30A8_ENST00000427715.2_Missense_Mutation_p.A138V	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	187					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.A187V(1)		breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TGCGCAGTGGCGGCCAACATT	0.517																																					p.A187V	Ovarian(162;1202 1922 6011 16223 52092)	.											SLC30A8,NS,carcinoma,0	SLC30A8	229	1	Substitution - Missense(1)	ovary(1)	c.C560T						.	C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	179.0	149.0	159.0		413,413,413,413,560	2.1	1.0	8	dbSNP_134	159	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense,missense,missense,missense	SLC30A8	NM_001172811.1,NM_001172813.1,NM_001172814.1,NM_001172815.1,NM_173851.2	64,64,64,64,64	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign,benign,benign	138/321,138/321,138/321,138/321,187/370	118170071	3,13003	2203	4300	6503	SO:0001583	missense	169026	exon4			CAGTGGCGGCCAA		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.560C>T	8.37:g.118170071C>T	ENSP00000415011:p.Ala187Val	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	65.0	NM_173851	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	37	CCDS6322.1	.	.	.	.	.	.	.	.	.	.	C	0.744	-0.775314	0.02951	0.0	3.49E-4	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.76	2.11	0.27256	.	0.832250	0.11028	N	0.607612	T	0.34135	0.0887	N	0.21240	0.645	0.25532	N	0.987267	B	0.06786	0.001	B	0.09377	0.004	T	0.29212	-1.0019	10	0.05620	T	0.96	0.941	4.8273	0.13423	0.0:0.2227:0.135:0.6423	.	187	Q8IWU4	ZNT8_HUMAN	V	138;138;138;187	ENSP00000428545:A138V;ENSP00000407505:A138V;ENSP00000431069:A138V;ENSP00000415011:A187V	ENSP00000407505:A138V	A	+	2	0	SLC30A8	118239252	0.389000	0.25205	0.993000	0.49108	0.213000	0.24496	1.004000	0.29822	0.101000	0.17610	0.650000	0.86243	GCG	C|1.000;T|0.000		0.517	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851	
SLC44A3	126969	ucsc.edu;bcgsc.ca	37	1	95293104	95293104	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:95293104G>A	ENST00000271227.6	+	4	422	c.320G>A	c.(319-321)gGt>gAt	p.G107D	SLC44A3_ENST00000467909.1_Missense_Mutation_p.G59D|SLC44A3_ENST00000529450.1_Splice_Site|SLC44A3_ENST00000532427.1_Splice_Site|SLC44A3_ENST00000527077.1_Splice_Site|SLC44A3_ENST00000530397.1_Splice_Site|SLC44A3_ENST00000446120.2_Missense_Mutation_p.G71D	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	107					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	GAAGTCAAAGGTACGCAGCTC	0.468																																					p.G107D		.											.	SLC44A3	91	0			c.G320A						.						160.0	149.0	152.0					1																	95293104		2203	4300	6503	SO:0001583	missense	126969	exon4			TCAAAGGTACGCA	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.320G>A	1.37:g.95293104G>A	ENSP00000271227:p.Gly107Asp	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	37	CCDS44176.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.576|0.576	-0.838932|-0.838932	0.02692|0.02692	.|.	.|.	ENSG00000143036|ENSG00000143036	ENST00000527077;ENST00000529450;ENST00000532427|ENST00000446120;ENST00000271227;ENST00000467909;ENST00000422520	.|T;T;T;T	.|0.79749	.|-1.3;-1.3;2.74;-1.3	5.67|5.67	0.831|0.831	0.18860|0.18860	.|.	.|0.639573	.|0.15823	.|N	.|0.242894	.|T	.|0.16854	.|0.0405	N|N	0.00162|0.00162	-1.95|-1.95	0.25407|0.25407	N|N	0.988399|0.988399	.|B;P;B	.|0.39326	.|0.0;0.668;0.0	.|B;B;B	.|0.32724	.|0.002;0.151;0.0	.|T	.|0.51872	.|-0.8650	.|10	.|0.17369	.|T	.|0.5	.|-4.2957	8.9676|8.9676	0.35885|0.35885	0.699:0.0:0.301:0.0|0.699:0.0:0.301:0.0	.|.	.|71;107;107	.|Q8N4M1-3;E9PJH2;Q8N4M1	.|.;.;CTL3_HUMAN	.|D	-1|71;107;59;59	.|ENSP00000389143:G71D;ENSP00000271227:G107D;ENSP00000432789:G59D;ENSP00000410832:G59D	.|ENSP00000271227:G107D	.|G	+|+	.|2	.|0	SLC44A3|SLC44A3	95065692|95065692	0.096000|0.096000	0.21769|0.21769	0.002000|0.002000	0.10522|0.10522	0.006000|0.006000	0.05464|0.05464	0.684000|0.684000	0.25364|0.25364	-0.043000|-0.043000	0.13513|0.13513	-0.302000|-0.302000	0.09304|0.09304	.|GGT	.		0.468	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
SLC4A8	9498	ucsc.edu;bcgsc.ca	37	12	51868218	51868218	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:51868218A>G	ENST00000453097.2	+	15	2214	c.1997A>G	c.(1996-1998)aAc>aGc	p.N666S	SLC4A8_ENST00000535225.2_Missense_Mutation_p.N613S|SLC4A8_ENST00000394856.1_Missense_Mutation_p.N613S|SLC4A8_ENST00000358657.3_Missense_Mutation_p.N693S|SLC4A8_ENST00000514353.3_Missense_Mutation_p.N613S	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		CACTGGGCTAACCTGACTGTC	0.532																																					p.N666S		.											.	SLC4A8	95	0			c.A1997G						.						151.0	105.0	121.0					12																	51868218		2203	4300	6503	SO:0001583	missense	9498	exon15			GGGCTAACCTGAC	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1997A>G	12.37:g.51868218A>G	ENSP00000405812:p.Asn666Ser	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	A	12.66	2.004752	0.35320	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17	4.96	4.96	0.65561	Bicarbonate transporter, C-terminal (1);	0.080477	0.85682	D	0.000000	T	0.68540	0.3012	L	0.31420	0.93	0.38391	D	0.945395	B;B;P;B;B;B	0.35700	0.051;0.003;0.516;0.01;0.008;0.14	B;B;B;B;B;B	0.42030	0.033;0.008;0.373;0.038;0.022;0.23	T	0.65537	-0.6144	10	0.07482	T	0.82	.	14.0579	0.64781	1.0:0.0:0.0:0.0	.	613;693;613;666;666;666	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	S	613;693;666;613;666;613;613	ENSP00000441520:N613S;ENSP00000351483:N693S;ENSP00000405812:N666S;ENSP00000378325:N613S;ENSP00000442561:N613S	ENSP00000315789:N666S	N	+	2	0	SLC4A8	50154485	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.134000	0.57990	2.225000	0.72522	0.533000	0.62120	AAC	.		0.532	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
SLC6A4	6532	ucsc.edu;bcgsc.ca	37	17	28543143	28543143	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:28543143A>G	ENST00000401766.2	-	6	1441	c.929T>C	c.(928-930)cTc>cCc	p.L310P	SLC6A4_ENST00000261707.3_Missense_Mutation_p.L310P			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	310					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	CAAGTAGAAGAGAACACCCCT	0.507																																					p.L310P		.											.	SLC6A4	94	0			c.T929C						.						84.0	84.0	84.0					17																	28543143		2203	4300	6503	SO:0001583	missense	6532	exon7			TAGAAGAGAACAC	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.929T>C	17.37:g.28543143A>G	ENSP00000385822:p.Leu310Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_001045	Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	37	CCDS11256.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905292	0.72868	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T	0.74737	-0.87;-0.87	6.17	6.17	0.99709	.	0.163605	0.56097	D	0.000035	D	0.85531	0.5718	M	0.88241	2.94	0.80722	D	1	P	0.40266	0.71	P	0.52514	0.701	D	0.84637	0.0693	10	0.31617	T	0.26	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	310	P31645	SC6A4_HUMAN	P	352;310;310	ENSP00000385822:L310P;ENSP00000261707:L310P	ENSP00000261707:L310P	L	-	2	0	SLC6A4	25567269	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.287000	0.95975	2.371000	0.80710	0.533000	0.62120	CTC	.		0.507	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045	
SLIT2	9353	ucsc.edu;bcgsc.ca	37	4	20611768	20611768	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:20611768T>C	ENST00000504154.1	+	34	4077	c.3825T>C	c.(3823-3825)ttT>ttC	p.F1275F	SLIT2_ENST00000503837.1_Silent_p.F1271F|SLIT2_ENST00000273739.5_Silent_p.F1288F|SLIT2_ENST00000503823.1_Silent_p.F1267F	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1275	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CTCTGAATTTTGACTCTCCAC	0.438																																					p.F1275F		.											.	SLIT2	521	0			c.T3825C						.						129.0	118.0	122.0					4																	20611768		2203	4300	6503	SO:0001819	synonymous_variant	9353	exon34			GAATTTTGACTCT	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3825T>C	4.37:g.20611768T>C		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	T	10.54	1.379052	0.24944	.	.	ENSG00000145147	ENST00000512993	.	.	.	6.07	0.325	0.15903	.	.	.	.	.	T	0.58722	0.2142	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53718	-0.8399	4	.	.	.	.	10.973	0.47450	0.0:0.4571:0.0:0.5429	.	.	.	.	S	59	.	.	L	+	2	0	SLIT2	20220866	0.992000	0.36948	0.999000	0.59377	0.995000	0.86356	0.270000	0.18607	0.064000	0.16427	0.533000	0.62120	TTG	.		0.438	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SLITRK3	22865	ucsc.edu;bcgsc.ca	37	3	164906098	164906098	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:164906098G>T	ENST00000475390.1	-	2	2964	c.2521C>A	c.(2521-2523)Cca>Aca	p.P841T	SLITRK3_ENST00000241274.3_Missense_Mutation_p.P841T			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	841					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CCAACTGCTGGGTGGTGAGGG	0.567										HNSCC(40;0.11)																											p.P841T		.											.	SLITRK3	100	0			c.C2521A						.						96.0	94.0	95.0					3																	164906098		2203	4300	6503	SO:0001583	missense	22865	exon2			CTGCTGGGTGGTG	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2521C>A	3.37:g.164906098G>T	ENSP00000420091:p.Pro841Thr	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_014926	Q1RMY6	Missense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	8.075	0.771106	0.16051	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.52754	0.65;0.65	5.86	-1.1	0.09872	.	0.214452	0.23722	N	0.045204	T	0.22513	0.0543	N	0.14661	0.345	0.25945	N	0.982827	B	0.15719	0.014	B	0.17098	0.017	T	0.07849	-1.0751	10	0.56958	D	0.05	-0.2775	1.527	0.02527	0.3601:0.1313:0.3738:0.1348	.	841	O94933	SLIK3_HUMAN	T	841	ENSP00000420091:P841T;ENSP00000241274:P841T	ENSP00000241274:P841T	P	-	1	0	SLITRK3	166388792	0.995000	0.38212	0.271000	0.24616	0.814000	0.46013	0.923000	0.28757	-0.274000	0.09232	0.655000	0.94253	CCA	.		0.567	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
SLITRK3	22865	ucsc.edu;bcgsc.ca	37	3	164908427	164908427	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:164908427T>C	ENST00000475390.1	-	2	635	c.192A>G	c.(190-192)aaA>aaG	p.K64K	SLITRK3_ENST00000241274.3_Silent_p.K64K			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	64					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TTGTAAATCCTTTACTGTCAC	0.363										HNSCC(40;0.11)																											p.K64K		.											.	SLITRK3	100	0			c.A192G						.						93.0	97.0	95.0					3																	164908427		2203	4300	6503	SO:0001819	synonymous_variant	22865	exon2			AAATCCTTTACTG	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.192A>G	3.37:g.164908427T>C		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	52.0	6.0	NM_014926	Q1RMY6	Silent	SNP	ENST00000475390.1	37	CCDS3197.1																																																																																			.		0.363	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
SMAD9	4093	ucsc.edu;bcgsc.ca	37	13	37453767	37453767	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:37453767T>C	ENST00000399275.2	-	1	199	c.60A>G	c.(58-60)agA>agG	p.R20R	SMAD9_ENST00000483941.1_5'UTR|SMAD9_ENST00000379826.4_Silent_p.R20R|SMAD9_ENST00000350148.5_Silent_p.R20R			O15198	SMAD9_HUMAN	SMAD family member 9	20	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		AGCCTAGCAGTCTCTTCACTG	0.572																																					p.R20R		.											.	SMAD9	414	0			c.A60G						.						62.0	66.0	65.0					13																	37453767		2203	4300	6503	SO:0001819	synonymous_variant	4093	exon2			TAGCAGTCTCTTC		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.60A>G	13.37:g.37453767T>C		Somatic	92.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_005905	A2A2Y6|O14989|Q5TBA1	Silent	SNP	ENST00000399275.2	37	CCDS45032.1																																																																																			.		0.572	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905	
SMG6	23293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2203159	2203159	+	Silent	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:2203159C>A	ENST00000263073.6	-	2	938	c.888G>T	c.(886-888)gtG>gtT	p.V296V	SMG6_ENST00000544865.1_Silent_p.V265V	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	296	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AGGACACAGACACTTGCTTCT	0.522																																					p.V296V	Melanoma(59;28 1088 11621 25887 46638 50814)	.											.	SMG6	228	0			c.G888T						.						94.0	84.0	88.0					17																	2203159		2203	4300	6503	SO:0001819	synonymous_variant	23293	exon2			CACAGACACTTGC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.888G>T	17.37:g.2203159C>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	19.0	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Silent	SNP	ENST00000263073.6	37	CCDS11016.1																																																																																			.		0.522	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
SMOX	54498	ucsc.edu;bcgsc.ca	37	20	4164179	4164179	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:4164179T>C	ENST00000305958.4	+	6	1633	c.1408T>C	c.(1408-1410)Tcg>Ccg	p.S470P	SMOX_ENST00000379460.2_Missense_Mutation_p.S470P|SMOX_ENST00000278795.3_Missense_Mutation_p.S417P|SMOX_ENST00000346595.2_Intron|SMOX_ENST00000339123.6_Missense_Mutation_p.S417P	NM_175839.2	NP_787033.1	Q9NWM0	SMOX_HUMAN	spermine oxidase	470					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	N1-acetylspermine:oxygen oxidoreductase (N1-acetylspermidine-forming) activity (GO:0052895)|norspermine:oxygen oxidoreductase activity (GO:0052894)|polyamine oxidase activity (GO:0046592)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(7)|lung(5)|skin(2)|urinary_tract(1)	26					Spermine(DB00127)	AATCTTGCGCTCGGCCTGGGG	0.577																																					p.S470P		.											.	SMOX	153	0			c.T1408C						.						84.0	90.0	88.0					20																	4164179		2203	4300	6503	SO:0001583	missense	54498	exon6			TTGCGCTCGGCCT	AK000753	CCDS13075.1, CCDS13076.1, CCDS13077.1, CCDS13078.1, CCDS74702.1	20p13	2003-10-15	2003-10-15	2003-10-15	ENSG00000088826	ENSG00000088826			15862	protein-coding gene	gene with protein product		615854	"""chromosome 20 open reading frame 16"""	C20orf16		11454677, 12398765	Standard	NM_175839		Approved	FLJ20746, dJ779E11.1, PAO, PAOh1, MGC1010, SMO	uc002wkp.3	Q9NWM0	OTTHUMG00000031777	ENST00000305958.4:c.1408T>C	20.37:g.4164179T>C	ENSP00000307252:p.Ser470Pro	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_175839	A2A2P5|A2A2P6|A8BE87|D3DVZ4|Q5TE26|Q5TE27|Q6UY28|Q8IX00|Q96LC3|Q96LC4|Q96QT3|Q9BW38|Q9H6H1|Q9NP51|Q9NPY1|Q9NPY2	Missense_Mutation	SNP	ENST00000305958.4	37	CCDS13075.1	.	.	.	.	.	.	.	.	.	.	T	19.62	3.862043	0.71949	.	.	ENSG00000088826	ENST00000339123;ENST00000305958;ENST00000278795;ENST00000379460;ENST00000457205	D;D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29;-3.29	5.22	5.22	0.72569	Amine oxidase (1);	0.117336	0.64402	D	0.000012	D	0.95680	0.8595	M	0.63169	1.94	0.58432	D	0.999996	D;D;D;P;D	0.89917	0.999;1.0;1.0;0.849;1.0	D;D;D;P;D	0.91635	0.995;0.999;0.999;0.555;0.987	D	0.96009	0.9000	10	0.87932	D	0	-5.3406	13.0675	0.59043	0.0:0.0:0.0:1.0	.	394;470;470;417;417	B4DE63;Q9NWM0-6;Q9NWM0;Q9NWM0-2;Q9NWM0-4	.;.;SMOX_HUMAN;.;.	P	417;470;417;470;327	ENSP00000344595:S417P;ENSP00000307252:S470P;ENSP00000278795:S417P;ENSP00000368773:S470P;ENSP00000407269:S327P	ENSP00000278795:S417P	S	+	1	0	SMOX	4112179	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.135000	0.71696	1.972000	0.57404	0.533000	0.62120	TCG	.		0.577	SMOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077806.1	NM_175842	
SNX18	112574	ucsc.edu;bcgsc.ca	37	5	53814671	53814671	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr5:53814671T>C	ENST00000326277.3	+	1	1079	c.889T>C	c.(889-891)Tcc>Ccc	p.S297P	SNX18_ENST00000381410.4_Missense_Mutation_p.S297P|SNX18_ENST00000343017.6_Missense_Mutation_p.S297P	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	297	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				GAGCTACATCTCCTACAAGCT	0.622																																					p.S297P		.											.	SNX18	226	0			c.T889C						.						82.0	75.0	77.0					5																	53814671		2203	4300	6503	SO:0001583	missense	112574	exon1			TACATCTCCTACA	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.889T>C	5.37:g.53814671T>C	ENSP00000317332:p.Ser297Pro	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_052870	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Missense_Mutation	SNP	ENST00000326277.3	37	CCDS3962.1	.	.	.	.	.	.	.	.	.	.	T	18.36	3.606281	0.66445	.	.	ENSG00000178996	ENST00000343017;ENST00000381410;ENST00000326277	T;T;T	0.39997	1.05;1.05;1.05	4.8	4.8	0.61643	Phox homologous domain (5);	0.064363	0.64402	D	0.000004	T	0.64080	0.2566	M	0.86740	2.835	0.54753	D	0.99998	D;P	0.69078	0.997;0.941	P;P	0.62089	0.898;0.708	T	0.70579	-0.4833	10	0.72032	D	0.01	-32.7422	10.9526	0.47339	0.0:0.0:0.203:0.797	.	297;297	Q96RF0;Q96RF0-2	SNX18_HUMAN;.	P	297	ENSP00000342276:S297P;ENSP00000370817:S297P;ENSP00000317332:S297P	ENSP00000317332:S297P	S	+	1	0	SNX18	53850428	0.999000	0.42202	1.000000	0.80357	0.969000	0.65631	2.836000	0.48183	2.013000	0.59113	0.455000	0.32223	TCC	.		0.622	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
SP5	389058	ucsc.edu;bcgsc.ca	37	2	171573770	171573770	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:171573770G>A	ENST00000375281.3	+	2	1215	c.1053G>A	c.(1051-1053)acG>acA	p.T351T	AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	351					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(2)|lung(1)|prostate(1)	5						GGACTCACACGGGCGAGAAGC	0.632																																					p.T351T		.											.	SP5	90	0			c.G1053A						.						26.0	26.0	26.0					2																	171573770		2199	4298	6497	SO:0001819	synonymous_variant	389058	exon2			TCACACGGGCGAG		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.1053G>A	2.37:g.171573770G>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	39.0	5.0	NM_001003845		Silent	SNP	ENST00000375281.3	37	CCDS33322.1																																																																																			.		0.632	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
SPATA20	64847	ucsc.edu;bcgsc.ca	37	17	48625120	48625120	+	Intron	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:48625120T>C	ENST00000356488.4	+	1	160				SPATA20_ENST00000006658.6_Silent_p.S39S|SPATA20_ENST00000393244.3_5'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			cccacaggagtcccagcaggt	0.602																																					p.S39S		.											.	SPATA20	90	0			c.T117C						.						75.0	81.0	79.0					17																	48625120		2203	4300	6503	SO:0001627	intron_variant	64847	exon2			CAGGAGTCCCAGC		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.77+474T>C	17.37:g.48625120T>C		Somatic	81.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	37	CCDS58563.1																																																																																			.		0.602	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
SPATA2L	124044	ucsc.edu;bcgsc.ca	37	16	89764258	89764258	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:89764258G>A	ENST00000289805.5	-	3	827	c.759C>T	c.(757-759)ccC>ccT	p.P253P	SPATA2L_ENST00000335360.7_Intron	NM_152339.3	NP_689552.2	Q8IUW3	SPA2L_HUMAN	spermatogenesis associated 2-like	253										breast(1)|cervix(1)|endometrium(1)|lung(2)|skin(1)	6		Lung NSC(15;0.00043)|all_lung(18;0.000665)|all_hematologic(23;0.0355)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		GCTCCGCCGGGGGCGAGTCAG	0.692																																					p.P253P		.											.	SPATA2L	90	0			c.C759T						.						11.0	12.0	11.0					16																	89764258		2189	4271	6460	SO:0001819	synonymous_variant	124044	exon3			CGCCGGGGGCGAG	AF070574	CCDS10985.1	16q24.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000158792	ENSG00000158792			28393	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 76"""	C16orf76		8619474	Standard	NM_152339		Approved	MGC26885, tamo	uc002foj.3	Q8IUW3	OTTHUMG00000138047	ENST00000289805.5:c.759C>T	16.37:g.89764258G>A		Somatic	26.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_152339	D3DX85|Q8NHV3	Silent	SNP	ENST00000289805.5	37	CCDS10985.1																																																																																			.		0.692	SPATA2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269923.1	NM_152339	
SPHK2	56848	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49131441	49131441	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:49131441G>A	ENST00000245222.4	+	6	1145	c.779G>A	c.(778-780)cGc>cAc	p.R260H	SPHK2_ENST00000600537.1_Missense_Mutation_p.R201H|SPHK2_ENST00000601712.1_Missense_Mutation_p.R224H|SPHK2_ENST00000340932.3_Missense_Mutation_p.R224H|SPHK2_ENST00000443164.1_Missense_Mutation_p.R322H|SPHK2_ENST00000598088.1_Missense_Mutation_p.R260H|SPHK2_ENST00000599748.1_Missense_Mutation_p.R224H|SPHK2_ENST00000599029.1_Missense_Mutation_p.R224H	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	260	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CTCCTAGATCGCCCTGACTGG	0.667																																					p.R260H		.											.	SPHK2	658	0			c.G779A						.						39.0	40.0	39.0					19																	49131441		2203	4300	6503	SO:0001583	missense	56848	exon6			TAGATCGCCCTGA	AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.779G>A	19.37:g.49131441G>A	ENSP00000245222:p.Arg260His	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	8.0	NM_020126	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Missense_Mutation	SNP	ENST00000245222.4	37	CCDS12727.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753038	0.89753	.	.	ENSG00000063176	ENST00000245222;ENST00000406269;ENST00000340932;ENST00000443164	T;T;T	0.25250	1.81;1.81;1.81	4.45	4.45	0.53987	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.51092	0.1654	M	0.75447	2.3	0.80722	D	1	D;D;D;D	0.89917	0.986;1.0;1.0;1.0	D;D;D;D	0.91635	0.918;0.999;0.999;0.999	T	0.57033	-0.7880	10	0.87932	D	0	-18.3874	14.9404	0.70989	0.0:0.0:1.0:0.0	.	201;322;224;260	B4DU87;A0T4C8;Q9NRA0-3;Q9NRA0	.;.;.;SPHK2_HUMAN	H	260;233;224;322	ENSP00000245222:R260H;ENSP00000341091:R224H;ENSP00000413369:R322H	ENSP00000245222:R260H	R	+	2	0	SPHK2	53823253	1.000000	0.71417	0.591000	0.28745	0.827000	0.46813	9.341000	0.97041	2.195000	0.70347	0.563000	0.77884	CGC	.		0.667	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466153.1		
SPOCK2	9806	ucsc.edu;bcgsc.ca	37	10	73831975	73831975	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:73831975T>A	ENST00000373109.2	-	4	730	c.286A>T	c.(286-288)Agc>Tgc	p.S96C	SPOCK2_ENST00000536168.1_Missense_Mutation_p.S96C|SPOCK2_ENST00000317376.4_Missense_Mutation_p.S96C	NM_001244950.1	NP_001231879.1	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2	96					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of cell differentiation (GO:0045595)|signal transduction (GO:0007165)|synapse assembly (GO:0007416)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)			endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						TTGTGGCGGCTGCACTTCACC	0.632																																					p.S96C		.											.	SPOCK2	90	0			c.A286T						.						55.0	49.0	51.0					10																	73831975		2192	4277	6469	SO:0001583	missense	9806	exon5			GGCGGCTGCACTT	AJ001453	CCDS7313.1, CCDS44431.1	10q22.1	2013-09-19			ENSG00000107742	ENSG00000107742			13564	protein-coding gene	gene with protein product		607988				10386950	Standard	NM_014767		Approved	KIAA0275, testican-2	uc001jso.2	Q92563	OTTHUMG00000018430	ENST00000373109.2:c.286A>T	10.37:g.73831975T>A	ENSP00000362201:p.Ser96Cys	Somatic	64.0	1.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_014767	C9J767|Q6UW87	Missense_Mutation	SNP	ENST00000373109.2	37	CCDS7313.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855632	0.91355	.	.	ENSG00000107742	ENST00000373109;ENST00000317376;ENST00000536168	T;T	0.57107	0.42;0.42	5.02	5.02	0.67125	.	0.043233	0.85682	D	0.000000	T	0.71031	0.3292	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.74948	-0.3490	10	0.72032	D	0.01	.	14.4283	0.67230	0.0:0.0:0.0:1.0	.	96	Q92563	TICN2_HUMAN	C	93;96;96	ENSP00000321108:S96C;ENSP00000439445:S96C	ENSP00000321108:S96C	S	-	1	0	SPOCK2	73501981	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.102000	0.71486	1.880000	0.54463	0.460000	0.39030	AGC	.		0.632	SPOCK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048560.2		
SPTBN2	6712	ucsc.edu;bcgsc.ca	37	11	66482855	66482855	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:66482855T>C	ENST00000533211.1	-	5	652	c.321A>G	c.(319-321)acA>acG	p.T107T	RN7SL12P_ENST00000473849.2_RNA|SPTBN2_ENST00000529997.1_Silent_p.T107T|SPTBN2_ENST00000309996.2_Silent_p.T107T			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	107	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TGCGGCCCTTTGTAGGCTTTG	0.587																																					p.T107T		.											.	SPTBN2	155	0			c.A321G						.						65.0	63.0	64.0					11																	66482855		2200	4295	6495	SO:0001819	synonymous_variant	6712	exon4			GCCCTTTGTAGGC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.321A>G	11.37:g.66482855T>C		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_006946	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																			.		0.587	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
SPTBN5	51332	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42182309	42182309	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:42182309A>G	ENST00000320955.6	-	4	706	c.479T>C	c.(478-480)aTc>aCc	p.I160T	RP11-23P13.6_ENST00000309874.2_RNA|RP11-23P13.6_ENST00000564432.2_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	160	Actin-binding.				actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GATGTGGGAGATCTGGAAACG	0.587																																					p.I125T		.											.	SPTBN5	91	0			c.T374C						.						111.0	113.0	113.0					15																	42182309		2061	4202	6263	SO:0001583	missense	51332	exon4			TGGGAGATCTGGA	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.479T>C	15.37:g.42182309A>G	ENSP00000317790:p.Ile160Thr	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	7.0	NM_016642		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	A	21.7	4.189473	0.78789	.	.	ENSG00000137877	ENST00000320955	D	0.96168	-3.93	4.65	4.65	0.58169	Calponin homology domain (2);	0.000000	0.64402	D	0.000004	D	0.97745	0.9260	M	0.86573	2.825	0.31886	N	0.617764	D	0.89917	1.0	D	0.97110	1.0	D	0.98029	1.0375	10	0.87932	D	0	.	13.7878	0.63121	1.0:0.0:0.0:0.0	.	160	Q9NRC6	SPTN5_HUMAN	T	160	ENSP00000317790:I160T	ENSP00000317790:I160T	I	-	2	0	SPTBN5	39969601	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.095000	0.89535	1.734000	0.51633	0.533000	0.62120	ATC	.		0.587	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
ST8SIA3	51046	ucsc.edu;bcgsc.ca	37	18	55024608	55024608	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:55024608T>C	ENST00000324000.3	+	3	2801	c.767T>C	c.(766-768)gTg>gCg	p.V256A		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	256					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		TCAGCAACTGTGACCAGGACA	0.418																																					p.V256A		.											.	ST8SIA3	136	0			c.T767C						.						58.0	59.0	59.0					18																	55024608		2164	4239	6403	SO:0001583	missense	51046	exon3			CAACTGTGACCAG	AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.767T>C	18.37:g.55024608T>C	ENSP00000320431:p.Val256Ala	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_015879	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	ENST00000324000.3	37	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	T	11.59	1.683300	0.29872	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.29142	1.58	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.28400	0.0702	L	0.42632	1.34	0.80722	D	1	B	0.26975	0.165	B	0.28385	0.089	T	0.05886	-1.0858	10	0.17369	T	0.5	-29.0145	15.897	0.79341	0.0:0.0:0.0:1.0	.	256	O43173	SIA8C_HUMAN	A	363;256	ENSP00000320431:V256A	ENSP00000320431:V256A	V	+	2	0	ST8SIA3	53175606	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.677000	0.84024	2.238000	0.73509	0.533000	0.62120	GTG	.		0.418	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879	
STEAP1B	256227	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	22533059	22533059	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr7:22533059T>C	ENST00000406890.2	-	3	518	c.424A>G	c.(424-426)Aga>Gga	p.R142G	STEAP1B_ENST00000404369.4_Missense_Mutation_p.R161G	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B	142						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(2)	4						AACTGCTTTCTTGTTAACATC	0.388																																					p.R161G		.											.	.	.	0			c.A481G						.						167.0	141.0	149.0					7																	22533059		692	1591	2283	SO:0001583	missense	256227	exon3			GCTTTCTTGTTAA		CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.424A>G	7.37:g.22533059T>C	ENSP00000385239:p.Arg142Gly	Somatic	149.0	1.0		WXS	Illumina HiSeq	Phase_I	179.0	71.0	NM_001164460	B5MCI2	Missense_Mutation	SNP	ENST00000406890.2	37	CCDS55094.1	.	.	.	.	.	.	.	.	.	.	t	8.990	0.977534	0.18812	.	.	ENSG00000105889	ENST00000406890;ENST00000404369;ENST00000424363;ENST00000439708	D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08	1.23	1.23	0.21249	Flavoprotein transmembrane component (1);	0.000000	0.44483	U	0.000443	D	0.94453	0.8215	M	0.83603	2.65	0.26503	N	0.974733	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86400	0.1741	10	0.87932	D	0	-15.7648	4.184	0.10390	0.0:0.0:0.3687:0.6313	.	161;142	B5MCI2;Q6NZ63	.;STEAL_HUMAN	G	142;161;161;161	ENSP00000385239:R142G;ENSP00000384370:R161G;ENSP00000416608:R161G;ENSP00000408954:R161G	ENSP00000384370:R161G	R	-	1	2	STEAP1B	22499584	0.996000	0.38824	0.999000	0.59377	0.186000	0.23388	1.091000	0.30915	0.847000	0.35167	0.102000	0.15555	AGA	.		0.388	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326617.2		
STXBP6	29091	broad.mit.edu;bcgsc.ca	37	14	25281918	25281918	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr14:25281918A>G	ENST00000323944.5	-	6	1081	c.630T>C	c.(628-630)tgT>tgC	p.C210C	STXBP6_ENST00000548369.1_Silent_p.C108C|STXBP6_ENST00000419632.2_Silent_p.C210C|STXBP6_ENST00000546511.1_Silent_p.C210C|STXBP6_ENST00000548724.1_Silent_p.C210C|STXBP6_ENST00000550887.1_Silent_p.C210C|STXBP6_ENST00000396700.1_Silent_p.C210C			Q8NFX7	STXB6_HUMAN	syntaxin binding protein 6 (amisyn)	210	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				negative regulation of exocytosis (GO:0045920)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|large_intestine(3)	7				GBM - Glioblastoma multiforme(265;0.0296)		CAGTTTCTCAACATTTGTGCT	0.418																																					p.C210C		.											.	STXBP6	90	0			c.T630C						.						93.0	91.0	92.0					14																	25281918		2203	4300	6503	SO:0001819	synonymous_variant	29091	exon6			TTCTCAACATTTG	AF161505	CCDS9634.1	14q11.2	2002-12-18			ENSG00000168952	ENSG00000168952			19666	protein-coding gene	gene with protein product		607958				12145319	Standard	NM_014178		Approved	amisyn, HSPC156	uc001wpu.3	Q8NFX7	OTTHUMG00000140186	ENST00000323944.5:c.630T>C	14.37:g.25281918A>G		Somatic	42.0	1.0		WXS	Illumina HiSeq	Phase_I	51.0	6.0	NM_014178	D3DS78|Q8N3H1|Q8N8D5|Q96GF3|Q9P008	Silent	SNP	ENST00000323944.5	37	CCDS9634.1																																																																																			.		0.418	STXBP6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409166.1		
TAS2R16	50833	ucsc.edu;bcgsc.ca	37	7	122634852	122634852	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr7:122634852G>T	ENST00000249284.2	-	1	902	c.837C>A	c.(835-837)agC>agA	p.S279R		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	279					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACGTAGGGCTGCTCAGCATCA	0.418																																					p.S279R		.											.	TAS2R16	92	0			c.C837A						.						114.0	116.0	115.0					7																	122634852		2203	4300	6503	SO:0001583	missense	50833	exon1			AGGGCTGCTCAGC	AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.837C>A	7.37:g.122634852G>T	ENSP00000249284:p.Ser279Arg	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_016945	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	ENST00000249284.2	37	CCDS5785.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929407	0.34096	.	.	ENSG00000128519	ENST00000249284	T	0.00808	5.67	4.34	0.481	0.16809	.	0.197681	0.42053	D	0.000767	T	0.02455	0.0075	M	0.66939	2.045	0.09310	N	1	D	0.52996	0.957	P	0.58928	0.848	T	0.41431	-0.9509	10	0.31617	T	0.26	.	6.6115	0.22753	0.4149:0.0:0.5851:0.0	.	279	Q9NYV7	T2R16_HUMAN	R	279	ENSP00000249284:S279R	ENSP00000249284:S279R	S	-	3	2	TAS2R16	122422088	0.926000	0.31397	0.004000	0.12327	0.030000	0.12068	1.170000	0.31883	-0.020000	0.14032	-0.229000	0.12294	AGC	.		0.418	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347409.1	NM_016945	
TAS2R30	259293	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	11286203	11286203	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:11286203T>A	ENST00000539585.1	-	1	1040	c.641A>T	c.(640-642)aAa>aTa	p.K214I	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	214					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TTGAGATCCTTTGCCATGGAG	0.423																																					p.K214I		.											.	.	.	0			c.A641T						.						215.0	230.0	225.0					12																	11286203		2203	4300	6503	SO:0001583	missense	259293	exon1			GATCCTTTGCCAT	AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.641A>T	12.37:g.11286203T>A	ENSP00000444736:p.Lys214Ile	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	22.0	NM_001097643	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	37	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	12.77	2.038617	0.35989	.	.	ENSG00000256188	ENST00000539585	T	0.38560	1.13	2.6	1.35	0.21983	.	.	.	.	.	T	0.59445	0.2194	M	0.79693	2.465	0.09310	N	1	D	0.64830	0.994	D	0.73708	0.981	T	0.45600	-0.9250	9	0.62326	D	0.03	.	4.7585	0.13095	0.278:0.0:0.0:0.722	.	214	P59541	T2R30_HUMAN	I	214	ENSP00000444736:K214I	ENSP00000444736:K214I	K	-	2	0	TAS2R30	11177470	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.060000	0.11712	0.205000	0.20568	0.260000	0.18958	AAA	.		0.423	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
TENM4	26011	ucsc.edu;bcgsc.ca	37	11	78369384	78369384	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:78369384T>A	ENST00000278550.7	-	34	8491	c.8029A>T	c.(8029-8031)Aca>Tca	p.T2677S		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2677					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CCGTAGCGTGTGTTCAAGCAC	0.602																																					p.T2677S		.											.	.	.	0			c.A8029T						.						63.0	68.0	66.0					11																	78369384		2125	4239	6364	SO:0001583	missense	26011	exon34			AGCGTGTGTTCAA	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.8029A>T	11.37:g.78369384T>A	ENSP00000278550:p.Thr2677Ser	Somatic	67.0	0.0		WXS	Illumina HiSeq	.	55.0	5.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.658273	0.47467	.	.	ENSG00000149256	ENST00000278550	D	0.89270	-2.49	5.58	5.58	0.84498	.	0.111113	0.64402	D	0.000011	D	0.82834	0.5123	L	0.36672	1.1	0.39435	D	0.967148	P	0.42039	0.769	B	0.35182	0.197	T	0.83322	-0.0017	9	.	.	.	.	15.9198	0.79552	0.0:0.0:0.0:1.0	.	2677	Q6N022	TEN4_HUMAN	S	2677	ENSP00000278550:T2677S	.	T	-	1	0	ODZ4	78047032	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.192000	0.50989	2.343000	0.79666	0.533000	0.62120	ACA	.		0.602	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
THEMIS	387357	ucsc.edu;bcgsc.ca	37	6	128134525	128134525	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:128134525A>G	ENST00000368248.2	-	4	1409	c.1261T>C	c.(1261-1263)Tat>Cat	p.Y421H	THEMIS_ENST00000368250.1_Missense_Mutation_p.Y342H|THEMIS_ENST00000537166.1_Missense_Mutation_p.Y386H|THEMIS_ENST00000543064.1_Missense_Mutation_p.Y421H	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	421	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						GCAGCCTCATAGGACTTTTTG	0.448																																					p.Y421H		.											.	THEMIS	94	0			c.T1261C						.						84.0	89.0	87.0					6																	128134525		2203	4300	6503	SO:0001583	missense	387357	exon4			CCTCATAGGACTT	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1261T>C	6.37:g.128134525A>G	ENSP00000357231:p.Tyr421His	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	37	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.506797	0.00992	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	5.69	0.582	0.17412	.	0.770042	0.12908	N	0.429162	T	0.03959	0.0111	L	0.54323	1.7	0.09310	N	1	B;B	0.24721	0.11;0.003	B;B	0.24701	0.055;0.007	T	0.41378	-0.9512	10	0.32370	T	0.25	-0.1996	5.3175	0.15864	0.5053:0.0:0.3626:0.1321	.	421;421	F5H1J9;Q8N1K5	.;THMS1_HUMAN	H	342;421;421;386	ENSP00000357233:Y342H;ENSP00000439594:Y421H;ENSP00000357231:Y421H;ENSP00000439863:Y386H	ENSP00000357231:Y421H	Y	-	1	0	THEMIS	128176218	0.090000	0.21635	0.007000	0.13788	0.030000	0.12068	0.786000	0.26844	-0.114000	0.11936	-0.490000	0.04691	TAT	.		0.448	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
TLE3	7090	ucsc.edu;bcgsc.ca	37	15	70368485	70368485	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:70368485T>C	ENST00000558939.1	-	5	1624	c.247A>G	c.(247-249)Aag>Gag	p.K83E	TLE3_ENST00000557907.1_Missense_Mutation_p.K83E|TLE3_ENST00000557997.1_Missense_Mutation_p.K83E|TLE3_ENST00000451782.2_Missense_Mutation_p.K83E|TLE3_ENST00000559048.1_Missense_Mutation_p.K89E|TLE3_ENST00000560589.1_Missense_Mutation_p.K27E|TLE3_ENST00000317509.8_Missense_Mutation_p.K83E|TLE3_ENST00000539550.1_Missense_Mutation_p.K17E|TLE3_ENST00000440567.3_Missense_Mutation_p.K76E|TLE3_ENST00000442299.2_Missense_Mutation_p.K83E|TLE3_ENST00000558379.1_Missense_Mutation_p.K83E|TLE3_ENST00000559929.1_Missense_Mutation_p.K83E|TLE3_ENST00000560939.1_Missense_Mutation_p.K89E|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000558201.1_Missense_Mutation_p.K89E	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	83	Gln-rich.				Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTCAGTCTCTTCGCAATCTCT	0.423																																					p.K83E		.											.	TLE3	522	0			c.A247G						.						154.0	150.0	151.0					15																	70368485		1956	4150	6106	SO:0001583	missense	7090	exon5			GTCTCTTCGCAAT	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.247A>G	15.37:g.70368485T>C	ENSP00000452871:p.Lys83Glu	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_001105192	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	ENST00000558939.1	37	CCDS45293.1	.	.	.	.	.	.	.	.	.	.	T	33	5.238658	0.95240	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550	T;T;T;T;T	0.71461	-0.1;-0.07;-0.02;-0.13;-0.57	5.85	5.85	0.93711	Groucho/TLE, N-terminal Q-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.87462	0.6183	H	0.94503	3.545	0.80722	D	1	P;P;D;D;P;P;P;P	0.63880	0.744;0.91;0.993;0.972;0.891;0.784;0.744;0.889	P;P;P;P;P;P;P;P	0.61800	0.575;0.79;0.894;0.861;0.61;0.7;0.69;0.782	D	0.90967	0.4817	10	0.87932	D	0	-27.1595	16.2303	0.82332	0.0:0.0:0.0:1.0	.	76;83;83;83;83;83;89;17	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	E	83;83;83;76;17	ENSP00000390007:K83E;ENSP00000394717:K83E;ENSP00000319233:K83E;ENSP00000415057:K76E;ENSP00000442594:K17E	ENSP00000319233:K83E	K	-	1	0	TLE3	68155539	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.924000	0.87555	2.233000	0.73108	0.533000	0.62120	AAG	.		0.423	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078	
TMC7	79905	ucsc.edu;bcgsc.ca	37	16	19070791	19070791	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:19070791T>C	ENST00000304381.5	+	15	2211	c.2081T>C	c.(2080-2082)aTc>aCc	p.I694T	TMC7_ENST00000421369.3_Missense_Mutation_p.I584T|TMC7_ENST00000569532.1_Missense_Mutation_p.I694T	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	694					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						CGGGTGGTCATCCAGCTCCGA	0.512																																					p.I694T		.											.	TMC7	93	0			c.T2081C						.						180.0	159.0	166.0					16																	19070791		2197	4300	6497	SO:0001583	missense	79905	exon15			TGGTCATCCAGCT	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.2081T>C	16.37:g.19070791T>C	ENSP00000304710:p.Ile694Thr	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	43.0	5.0	NM_024847	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	37	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	T	7.973	0.749479	0.15778	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.70986	-0.41;-0.53	5.6	-11.2	0.00127	.	1.502220	0.04000	N	0.296327	T	0.43299	0.1241	N	0.04508	-0.205	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.0;0.003	T	0.39643	-0.9604	10	0.14656	T	0.56	.	14.7401	0.69448	0.8072:0.0624:0.0:0.1305	.	694;694	Q7Z402;B3KSZ3	TMC7_HUMAN;.	T	694;584	ENSP00000304710:I694T;ENSP00000397081:I584T	ENSP00000304710:I694T	I	+	2	0	TMC7	18978292	0.000000	0.05858	0.000000	0.03702	0.948000	0.59901	-0.617000	0.05584	-2.420000	0.00564	-0.327000	0.08410	ATC	.		0.512	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
TMCC1	23023	hgsc.bcm.edu;broad.mit.edu	37	3	129389772	129389772	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:129389772delC	ENST00000393238.3	-	4	1252	c.912delG	c.(910-912)aggfs	p.R304fs	TMCC1_ENST00000329333.5_Frame_Shift_Del_p.R125fs|TMCC1_ENST00000426664.2_Frame_Shift_Del_p.R190fs|TMCC1_ENST00000432054.2_5'UTR	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	304						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CTCTGAGCTTCCTGTGGTAGT	0.517																																					p.R304fs		.											.	TMCC1	91	0			c.912delG						.						136.0	126.0	129.0					3																	129389772		2203	4300	6503	SO:0001589	frameshift_variant	23023	exon4			GAGCTTCCTGTGG	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.912delG	3.37:g.129389772delC	ENSP00000376930:p.Arg304fs	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	11.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Frame_Shift_Del	DEL	ENST00000393238.3	37	CCDS33855.1																																																																																			.		0.517	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
TMCC1	23023	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	129389775	129389787	+	Frame_Shift_Del	DEL	GTGGTAGTGCTCA	GTGGTAGTGCTCA	-	rs147183682		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	GTGGTAGTGCTCA	GTGGTAGTGCTCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:129389775_129389787delGTGGTAGTGCTCA	ENST00000393238.3	-	4	1237_1249	c.897_909delTGAGCACTACCAC	c.(895-909)cttgagcactaccacfs	p.LEHYH299fs	TMCC1_ENST00000329333.5_Frame_Shift_Del_p.LEHYH120fs|TMCC1_ENST00000426664.2_Frame_Shift_Del_p.LEHYH185fs|TMCC1_ENST00000432054.2_5'UTR	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	299						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.H301D(1)	PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TGAGCTTCCTGTGGTAGTGCTCAAGTTTCTTTT	0.516																																					p.299_303del		.											.	TMCC1	91	1	Substitution - Missense(1)	skin(1)	c.897_909del						.																																			SO:0001589	frameshift_variant	23023	exon4			CTTCCTGTGGTAG	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.897_909delTGAGCACTACCAC	3.37:g.129389775_129389787delGTGGTAGTGCTCA	ENSP00000376930:p.Leu299fs	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	11.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Frame_Shift_Del	DEL	ENST00000393238.3	37	CCDS33855.1																																																																																			.		0.516	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
TMEM234	56063	ucsc.edu;bcgsc.ca	37	1	32686739	32686739	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:32686739T>C	ENST00000344461.3	-	3	243	c.228A>G	c.(226-228)gcA>gcG	p.A76A	TMEM234_ENST00000545122.1_Silent_p.A76A|TMEM234_ENST00000373593.1_Silent_p.A76A|EIF3I_ENST00000373586.1_5'Flank|TMEM234_ENST00000309777.6_Silent_p.A76A			Q8WY98	TM234_HUMAN	transmembrane protein 234	76						integral component of membrane (GO:0016021)				kidney(2)|lung(3)	5						CACCTGTCGATGCCAAGGTGA	0.542																																					p.A76A		.											.	TMEM234	90	0			c.A228G						.						128.0	99.0	109.0					1																	32686739		2203	4300	6503	SO:0001819	synonymous_variant	56063	exon3			TGTCGATGCCAAG	AY358586	CCDS356.2	1p36.11-p34.2	2011-02-14	2011-02-14	2011-02-14	ENSG00000160055	ENSG00000160055			28837	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 91"""	C1orf91		12477932	Standard	XM_005271045		Approved	RP4-622L5, dJ622L5.7, FLJ90779	uc001buq.4	Q8WY98	OTTHUMG00000005742	ENST00000344461.3:c.228A>G	1.37:g.32686739T>C		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_019118	B2R535|D3DPP7|Q6UWY9|Q8N2H6|Q9BSR2|Q9NU76	Silent	SNP	ENST00000344461.3	37																																																																																				.		0.542	TMEM234-009	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000092260.2	NM_019118	
TNK1	8711	ucsc.edu;bcgsc.ca	37	17	7291786	7291786	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:7291786A>G	ENST00000576812.1	+	11	1923	c.1554A>G	c.(1552-1554)tcA>tcG	p.S518S	TNK1_ENST00000311668.2_Silent_p.S513S|TNK1_ENST00000570896.1_Silent_p.S513S	NM_001251902.1	NP_001238831.1			tyrosine kinase, non-receptor, 1											central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(2)|pancreas(1)	16		Prostate(122;0.157)				GGGGTGGTTCAAGCCCCCCTG	0.602																																					p.S518S		.											.	TNK1	547	0			c.A1554G						.						42.0	52.0	49.0					17																	7291786		2037	4177	6214	SO:0001819	synonymous_variant	8711	exon11			TGGTTCAAGCCCC	U43408	CCDS45602.1, CCDS58510.1	17p13.1	2005-09-22				ENSG00000174292			11940	protein-coding gene	gene with protein product		608076				8632913	Standard	NM_003985		Approved		uc002ggi.4	Q13470		ENST00000576812.1:c.1554A>G	17.37:g.7291786A>G		Somatic	63.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001251902		Silent	SNP	ENST00000576812.1	37	CCDS58510.1																																																																																			.		0.602	TNK1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000440832.2	NM_003985	
TNR	7143	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175372511	175372511	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:175372511G>A	ENST00000367674.2	-	4	1449	c.741C>T	c.(739-741)gaC>gaT	p.D247D	TNR_ENST00000263525.2_Silent_p.D247D			Q92752	TENR_HUMAN	tenascin R	247	Cys-rich.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CACACTCCCCGTCCACGCAGA	0.627																																					p.D247D		.											.	TNR	324	0			c.C741T						.						94.0	76.0	82.0					1																	175372511		2203	4300	6503	SO:0001819	synonymous_variant	7143	exon4			CTCCCCGTCCACG	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.741C>T	1.37:g.175372511G>A		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	15.0	NM_003285	C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	CCDS1318.1																																																																																			.		0.627	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
TRERF1	55809	ucsc.edu;bcgsc.ca	37	6	42237051	42237051	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:42237051T>C	ENST00000372922.4	-	5	840	c.278A>G	c.(277-279)aAc>aGc	p.N93S	TRERF1_ENST00000372917.4_Missense_Mutation_p.N93S|TRERF1_ENST00000541110.1_Missense_Mutation_p.N93S|TRERF1_ENST00000354325.2_Missense_Mutation_p.N93S|TRERF1_ENST00000340840.2_Missense_Mutation_p.N93S	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	93					cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTGGACATGGTTTCCAGGCCC	0.577																																					p.N93S		.											.	TRERF1	230	0			c.A278G						.						155.0	151.0	152.0					6																	42237051		2203	4300	6503	SO:0001583	missense	55809	exon5			ACATGGTTTCCAG	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.278A>G	6.37:g.42237051T>C	ENSP00000362013:p.Asn93Ser	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	22.0	4.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.110979	0.37242	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.19669	2.5;2.13;2.41;2.13;2.14	5.63	3.17	0.36434	.	0.087970	0.48767	N	0.000169	T	0.08980	0.0222	N	0.20986	0.625	0.41206	D	0.986401	P;P;P	0.46784	0.884;0.49;0.49	P;B;B	0.46510	0.519;0.172;0.172	T	0.06285	-1.0835	10	0.62326	D	0.03	-17.3314	10.1751	0.42933	0.0:0.137:0.0:0.863	.	93;93;93	Q96PN7-4;Q05GC8;Q96PN7	.;.;TREF1_HUMAN	S	93	ENSP00000439689:N93S;ENSP00000362008:N93S;ENSP00000362013:N93S;ENSP00000339438:N93S;ENSP00000346285:N93S	ENSP00000339438:N93S	N	-	2	0	TRERF1	42345029	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.576000	0.60915	0.394000	0.25230	0.459000	0.35465	AAC	.		0.577	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
TSC22D3	1831	broad.mit.edu;bcgsc.ca	37	X	106959961	106959961	+	Silent	SNP	A	A	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:106959961A>T	ENST00000372397.2	-	1	404	c.81T>A	c.(79-81)tcT>tcA	p.S27S	TSC22D3_ENST00000372383.4_Intron|TSC22D3_ENST00000514426.1_Intron|TSC22D3_ENST00000372382.4_Intron|TSC22D3_ENST00000315660.4_Intron|TSC22D3_ENST00000506081.1_Intron|TSC22D3_ENST00000372390.4_5'Flank|TSC22D3_ENST00000372384.2_Intron	NM_004089.3	NP_004080.2	Q99576	T22D3_HUMAN	TSC22 domain family, member 3	27	AP1-binding. {ECO:0000250}.				body fluid secretion (GO:0007589)|ion transmembrane transport (GO:0034220)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)|lung(3)	6						CTCCAAGCAGAGAAGAGAAGA	0.617																																					p.S27S		.											.	TSC22D3	197	0			c.T81A						.						76.0	73.0	74.0					X																	106959961		2203	4300	6503	SO:0001819	synonymous_variant	1831	exon1			AAGCAGAGAAGAG	Z50781	CCDS14530.1, CCDS14531.1, CCDS35365.1	Xq22.3	2008-02-15	2005-03-01	2005-03-03	ENSG00000157514	ENSG00000157514			3051	protein-coding gene	gene with protein product	"""glucocorticoid-induced leucine zipper"""	300506	"""delta sleep inducing peptide, immunoreactor"""	DSIPI		8982256	Standard	XM_005262098		Approved	DIP, GILZ, TSC-22R, hDIP	uc004enh.3	Q99576	OTTHUMG00000022168	ENST00000372397.2:c.81T>A	X.37:g.106959961A>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	8.0	NM_004089	Q5H9S3|Q5JRI9|Q6FIH6|Q8NAI1|Q8WVB9|Q9UBN5|Q9UG13	Silent	SNP	ENST00000372397.2	37	CCDS14531.1																																																																																			.		0.617	TSC22D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057843.2	NM_198057	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179430304	179430304	+	Missense_Mutation	SNP	C	C	T	rs202149931|rs397517716		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:179430304C>T	ENST00000591111.1	-	276	75856	c.75632G>A	c.(75631-75633)cGt>cAt	p.R25211H	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R26852H|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R17912H|TTN_ENST00000460472.2_Missense_Mutation_p.R17787H|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R17979H|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R24284H|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25211	Fibronectin type-III 83. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCCTTGACACGGAACTGATA	0.418													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22005	0.0		0.0	False		,,,				2504	0.0				p.R26852H		.											.	TTN	636	0			c.G80555A						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	2,3760		0,2,1879	190.0	188.0	189.0		53936,53735,72851,53360	3.7	1.0	2		189	1,8237		0,1,4118	no	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	29,29,29,29	0,3,5997	TT,TC,CC		0.0121,0.0532,0.025	benign,benign,benign,benign	17979/27119,17912/27052,24284/33424,17787/26927	179430304	3,11997	1881	4119	6000	SO:0001583	missense	7273	exon326			TTGACACGGAACT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75632G>A	2.37:g.179430304C>T	ENSP00000465570:p.Arg25211His	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	26.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	10.81	1.454795	0.26161	5.32E-4	1.21E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.48	3.65	0.41850	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67258	0.2874	H	0.96142	3.775	0.48696	D	0.999696	B;B;B;B	0.29909	0.261;0.261;0.261;0.261	B;B;B;B	0.20184	0.028;0.028;0.028;0.028	T	0.76334	-0.2997	9	0.87932	D	0	.	12.1629	0.54113	0.0:0.8355:0.0:0.1645	.	17787;17912;17979;25211	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	24284;17787;17979;17912;17785	ENSP00000343764:R24284H;ENSP00000434586:R17787H;ENSP00000340554:R17979H;ENSP00000352154:R17912H	ENSP00000340554:R17979H	R	-	2	0	TTN	179138550	0.893000	0.30496	1.000000	0.80357	0.631000	0.37964	1.834000	0.39171	2.589000	0.87451	0.484000	0.47621	CGT	C|0.999;T|0.001		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179610836	179610836	+	Intron	SNP	C	C	T	rs141483365		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:179610836C>T	ENST00000591111.1	-	46	10585				TTN_ENST00000360870.5_Missense_Mutation_p.E5431K|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCTTCTCCTCGCTAATCACG	0.393													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19328	0.0		0.0	False		,,,				2504	0.0				p.E5431K		.											.	TTN	636	0			c.G16291A						.	C	,,LYS/GLU,,	0,4406		0,0,2203	120.0	124.0	123.0		,,16291,,	5.0	1.0	2	dbSNP_134	123	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,missense,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,56,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	,,5431/5605,,	179610836	1,13005	2203	4300	6503	SO:0001627	intron_variant	7273	exon46			TCTCCTCGCTAAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4188G>A	2.37:g.179610836C>T		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	23.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	4.889	0.165308	0.09339	0.0	1.16E-4	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.66815	-0.23	5.88	5.01	0.66863	.	.	.	.	.	T	0.48021	0.1477	L	0.40543	1.245	0.20926	N	0.999822	P	0.38280	0.625	B	0.31337	0.128	T	0.36335	-0.9752	9	0.07813	T	0.8	.	7.0279	0.24950	0.0:0.6947:0.153:0.1523	.	5431	Q8WZ42-6	.	K	5431;712	ENSP00000354117:E5431K	ENSP00000304714:E712K	E	-	1	0	TTN	179319081	0.994000	0.37717	0.998000	0.56505	0.745000	0.42441	2.399000	0.44495	1.506000	0.48736	-0.123000	0.14984	GAG	C|1.000;T|0.000		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TVP23A	780776	ucsc.edu;bcgsc.ca	37	16	10912025	10912025	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:10912025A>G	ENST00000299866.8	-	2	315	c.24T>C	c.(22-24)gaT>gaC	p.D8D	TVP23A_ENST00000572980.1_Intron	NM_001079512.2	NP_001072980.1	A6NH52	TV23A_HUMAN	trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)	8						integral component of membrane (GO:0016021)											CATCCTCGGTATCGTCCACCA	0.637																																					p.D8D		.											.	.	.	0			c.T24C						.						46.0	51.0	50.0					16																	10912025		2008	4161	6169	SO:0001819	synonymous_variant	780776	exon2			CTCGGTATCGTCC		CCDS45408.1	16p13.3	2012-11-29	2012-11-29	2012-11-29	ENSG00000166676	ENSG00000166676			20398	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member A"""	FAM18A			Standard	NM_001079512		Approved	YDR084C	uc010buo.1	A6NH52	OTTHUMG00000177389	ENST00000299866.8:c.24T>C	16.37:g.10912025A>G		Somatic	18.0	0.0		WXS	Illumina HiSeq	.	17.0	4.0	NM_001079512	B2RUV4|B7ZW18	Silent	SNP	ENST00000299866.8	37	CCDS45408.1																																																																																			.		0.637	TVP23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436680.1	NM_001079512	
TYR	7299	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	88911776	88911776	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:88911776G>C	ENST00000263321.5	+	1	1157	c.655G>C	c.(655-657)Gaa>Caa	p.E219Q	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	219					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GTTGCGGTGGGAACAAGAAAT	0.463																																					p.E219Q		.											.	TYR	92	0			c.G655C	GRCh37	CM085760|HM050006	TYR	M		.						131.0	126.0	127.0					11																	88911776		2201	4299	6500	SO:0001583	missense	7299	exon1			CGGTGGGAACAAG	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.655G>C	11.37:g.88911776G>C	ENSP00000263321:p.Glu219Gln	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	8.0	NM_000372	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	ENST00000263321.5	37	CCDS8284.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890151	0.91889	.	.	ENSG00000077498	ENST00000263321	D	0.99820	-6.93	6.07	6.07	0.98685	Tyrosinase (3);Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.99914	0.9959	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96444	0.9329	9	.	.	.	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	219	P14679	TYRO_HUMAN	Q	219	ENSP00000263321:E219Q	.	E	+	1	0	TYR	88551424	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.357000	0.97099	2.885000	0.99019	0.655000	0.94253	GAA	.		0.463	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394045.2	NM_000372	
UFM1	51569	ucsc.edu;bcgsc.ca	37	13	38933458	38933458	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:38933458G>T	ENST00000239878.4	+	5	217	c.178G>T	c.(178-180)Gca>Tca	p.A60S	UFM1_ENST00000379641.1_Missense_Mutation_p.A78S|UFM1_ENST00000379649.1_Missense_Mutation_p.A78S	NM_016617.2	NP_057701.1	P61960	UFM1_HUMAN	ubiquitin-fold modifier 1	60					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(2)|ovary(1)	3		Lung NSC(96;3.18e-06)|Prostate(109;0.00314)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;1.05e-08)|Epithelial(112;1.44e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000855)|BRCA - Breast invasive adenocarcinoma(63;0.00342)|GBM - Glioblastoma multiforme(144;0.0132)		AATAAATCCTGCACAGACTGC	0.333																																					p.A60S		.											.	UFM1	68	0			c.G178T						.						108.0	120.0	116.0					13																	38933458		2203	4297	6500	SO:0001583	missense	51569	exon5			AATCCTGCACAGA	AF208844	CCDS9366.1, CCDS66533.1	13q13.3	2008-02-05	2005-05-27	2005-05-27	ENSG00000120686	ENSG00000120686			20597	protein-coding gene	gene with protein product		610553	"""chromosome 13 open reading frame 20"""	C13orf20		15071506	Standard	NM_001286706		Approved	bA131P10.1	uc001uwu.3	P61960	OTTHUMG00000017409	ENST00000239878.4:c.178G>T	13.37:g.38933458G>T	ENSP00000239878:p.Ala60Ser	Somatic	74.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_016617	Q14346|Q5VXS0|Q6IAG6|Q9CPX2|Q9NZF2	Missense_Mutation	SNP	ENST00000239878.4	37	CCDS9366.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.17|12.17	1.857156|1.857156	0.32791|0.32791	.|.	.|.	ENSG00000120686|ENSG00000120686	ENST00000379649;ENST00000239878;ENST00000379641|ENST00000437952	.|.	.|.	.|.	5.37|5.37	4.53|4.53	0.55603|0.55603	.|.	0.054243|.	0.64402|.	N|.	0.000001|.	T|T	0.63129|0.63129	0.2485|0.2485	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B;B;B|.	0.16166|.	0.011;0.016;0.0|.	B;B;B|.	0.17433|.	0.018;0.015;0.006|.	T|T	0.61187|0.61187	-0.7113|-0.7113	8|4	0.06891|.	T|.	0.86|.	-19.0416|-19.0416	11.6344|11.6344	0.51196|0.51196	0.0867:0.0:0.9133:0.0|0.0867:0.0:0.9133:0.0	.|.	78;60;60|.	P61960-2;Q5VXS2;P61960|.	.;.;UFM1_HUMAN|.	S|F	78;60;78|60	.|.	ENSP00000239878:A60S|.	A|C	+|+	1|2	0|0	UFM1|UFM1	37831458|37831458	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.275000|3.275000	0.51639|0.51639	1.257000|1.257000	0.44085|0.44085	0.557000|0.557000	0.71058|0.71058	GCA|TGC	.		0.333	UFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045989.1	NM_016617	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	54306377	54306377	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:54306377C>T	ENST00000260323.11	+	1	1277	c.1277C>T	c.(1276-1278)aCa>aTa	p.T426I	UNC13C_ENST00000537900.1_Missense_Mutation_p.T426I|UNC13C_ENST00000545554.1_Missense_Mutation_p.T426I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	426					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCCTCCCAGACATATGAGAGC	0.393																																					p.T426I		.											.	UNC13C	51	0			c.C1277T						.						101.0	97.0	98.0					15																	54306377		1861	4098	5959	SO:0001583	missense	440279	exon1			CCCAGACATATGA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1277C>T	15.37:g.54306377C>T	ENSP00000260323:p.Thr426Ile	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	36.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309250	0.40895	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83755	-1.75;-1.76;-1.75	5.64	5.64	0.86602	.	.	.	.	.	D	0.82628	0.5078	L	0.27053	0.805	0.48087	D	0.999588	D	0.58620	0.983	P	0.53490	0.727	T	0.82275	-0.0538	9	0.39692	T	0.17	.	18.6946	0.91596	0.0:1.0:0.0:0.0	.	426	Q8NB66	UN13C_HUMAN	I	426	ENSP00000260323:T426I;ENSP00000438156:T426I;ENSP00000442569:T426I	ENSP00000260323:T426I	T	+	2	0	UNC13C	52093669	1.000000	0.71417	0.987000	0.45799	0.394000	0.30568	6.086000	0.71352	2.665000	0.90641	0.655000	0.94253	ACA	.		0.393	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
UNC13C	440279	broad.mit.edu;bcgsc.ca	37	15	54825170	54825170	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:54825170A>G	ENST00000260323.11	+	25	5602	c.5602A>G	c.(5602-5604)Atg>Gtg	p.M1868V	UNC13C_ENST00000537900.1_Missense_Mutation_p.M1866V|UNC13C_ENST00000545554.1_Missense_Mutation_p.M1868V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1868					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACTAAATCAAATGAGAGCAAA	0.294																																					p.M1868V		.											.	UNC13C	51	0			c.A5602G						.						80.0	78.0	79.0					15																	54825170		1820	4087	5907	SO:0001583	missense	440279	exon24			AATCAAATGAGAG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5602A>G	15.37:g.54825170A>G	ENSP00000260323:p.Met1868Val	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	8.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	A	4.315	0.057800	0.08339	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.77229	-1.08;-1.08;-1.08	5.59	5.59	0.84812	.	0.040279	0.85682	D	0.000000	T	0.64983	0.2648	L	0.33137	0.985	0.44373	D	0.997276	B	0.26195	0.144	B	0.21546	0.035	T	0.61262	-0.7098	10	0.05833	T	0.94	.	14.9504	0.71067	1.0:0.0:0.0:0.0	.	1868	Q8NB66	UN13C_HUMAN	V	1868;1868;1866	ENSP00000260323:M1868V;ENSP00000438156:M1868V;ENSP00000442569:M1866V	ENSP00000260323:M1868V	M	+	1	0	UNC13C	52612462	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.913000	0.87471	2.125000	0.65367	0.459000	0.35465	ATG	.		0.294	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
UQCC1	55245	ucsc.edu;bcgsc.ca	37	20	33902530	33902530	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:33902530C>A	ENST00000374385.5	-	8	789	c.612G>T	c.(610-612)atG>atT	p.M204I	UQCC1_ENST00000374380.2_Missense_Mutation_p.M136I|UQCC1_ENST00000359226.2_Missense_Mutation_p.M124I|UQCC1_ENST00000374384.2_Intron|UQCC1_ENST00000542501.1_3'UTR|UQCC1_ENST00000397556.3_Missense_Mutation_p.M105I|UQCC1_ENST00000540457.1_Missense_Mutation_p.M49I|UQCC1_ENST00000407996.2_Intron|UQCC1_ENST00000349714.5_Missense_Mutation_p.M177I|UQCC1_ENST00000374377.5_Missense_Mutation_p.M92I	NM_018244.4	NP_060714.3	Q9NVA1	UQCC1_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 1	204						cytoplasmic membrane-bounded vesicle (GO:0016023)|mitochondrion (GO:0005739)											AATGATTTGTCATGAGGATCA	0.398																																					p.M204I		.											.	UQCC	153	0			c.G612T						.						123.0	108.0	113.0					20																	33902530		2203	4300	6503	SO:0001583	missense	55245	exon8			ATTTGTCATGAGG	AK001712	CCDS13252.1, CCDS13253.1, CCDS13253.2, CCDS54458.1	20q11.22	2013-09-20	2013-09-20	2013-09-20	ENSG00000101019	ENSG00000101019		"""Mitochondrial respiratory chain complex assembly factors"""	15891	protein-coding gene	gene with protein product	"""Basic FGF-repressed Zic-binding protein"", ""cytochrome B protein synthesis 3 homolog (S. cerevisiae)"""	611797	"""chromosome 20 open reading frame 44"", ""ubiquinol-cytochrome c reductase complex chaperone"""	C20orf44, UQCC			Standard	NM_018244		Approved	FLJ10850, CBP3, BFZB	uc002xcd.3	Q9NVA1	OTTHUMG00000032335	ENST00000374385.5:c.612G>T	20.37:g.33902530C>A	ENSP00000363506:p.Met204Ile	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_018244	B1AKV5|Q0VF37|Q5T348|Q5T351|Q5T353|Q86YU3|Q86YU4|Q96H66|Q9H438|Q9H452|Q9H9K8|Q9H9R5	Missense_Mutation	SNP	ENST00000374385.5	37	CCDS13252.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507780	0.85282	.	.	ENSG00000101019	ENST00000349714;ENST00000359226;ENST00000374380;ENST00000374385;ENST00000374377;ENST00000397556;ENST00000540457;ENST00000424405;ENST00000438533	T;T;T;T;T	0.44083	1.52;1.48;1.47;0.93;1.4	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.48150	0.1484	L	0.53249	1.67	0.80722	D	1	P;P;P;P;B	0.49307	0.922;0.577;0.732;0.644;0.129	P;B;B;P;B	0.46758	0.525;0.195;0.416;0.526;0.113	T	0.51911	-0.8645	10	0.66056	D	0.02	-9.1243	17.8333	0.88689	0.0:1.0:0.0:0.0	.	136;89;105;177;204	B1AKV5;Q9NVA1-3;B7Z314;B7ZBG4;Q9NVA1	.;.;.;.;UQCC_HUMAN	I	177;124;136;204;92;105;49;172;218	ENSP00000335364:M177I;ENSP00000352161:M124I;ENSP00000363506:M204I;ENSP00000399713:M172I;ENSP00000398531:M218I	ENSP00000335364:M177I	M	-	3	0	UQCC	33365944	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.296000	0.72751	2.769000	0.95229	0.650000	0.86243	ATG	.		0.398	UQCC1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078866.1	NM_018244	
UTP20	27340	ucsc.edu;bcgsc.ca	37	12	101689334	101689334	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:101689334T>A	ENST00000261637.4	+	12	1502	c.1328T>A	c.(1327-1329)cTg>cAg	p.L443Q		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	443					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GATGAAGCTCTGGCCATTCTG	0.413																																					p.L443Q		.											.	UTP20	155	0			c.T1328A						.						63.0	57.0	59.0					12																	101689334		2203	4300	6503	SO:0001583	missense	27340	exon12			AAGCTCTGGCCAT	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.1328T>A	12.37:g.101689334T>A	ENSP00000261637:p.Leu443Gln	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	T	14.63	2.591607	0.46214	.	.	ENSG00000120800	ENST00000261637	T	0.70516	-0.49	5.06	5.06	0.68205	Armadillo-type fold (1);	0.160086	0.43416	D	0.000571	T	0.72495	0.3467	L	0.34521	1.04	0.43719	D	0.996194	D	0.59357	0.985	P	0.60345	0.873	T	0.74858	-0.3521	10	0.62326	D	0.03	-7.8475	10.9113	0.47110	0.0:0.0759:0.0:0.9241	.	443	O75691	UTP20_HUMAN	Q	443	ENSP00000261637:L443Q	ENSP00000261637:L443Q	L	+	2	0	UTP20	100213465	1.000000	0.71417	1.000000	0.80357	0.285000	0.27093	5.171000	0.64996	1.909000	0.55274	0.528000	0.53228	CTG	.		0.413	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
VCAN	1462	ucsc.edu;bcgsc.ca	37	5	82817434	82817434	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr5:82817434T>C	ENST00000265077.3	+	7	3874	c.3309T>C	c.(3307-3309)tcT>tcC	p.S1103S	VCAN_ENST00000342785.4_Silent_p.S1103S|VCAN_ENST00000512590.2_Silent_p.S1055S|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1103	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ACAGTGTGTCTTATCCACCAG	0.433																																					p.S1103S		.											.	VCAN	238	0			c.T3309C						.						64.0	58.0	60.0					5																	82817434		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon7			TGTGTCTTATCCA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3309T>C	5.37:g.82817434T>C		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																			.		0.433	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
VNN2	8875	ucsc.edu;bcgsc.ca	37	6	133078849	133078849	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr6:133078849T>C	ENST00000326499.6	-	1	298	c.174A>G	c.(172-174)atA>atG	p.I58M	VNN2_ENST00000525270.1_Missense_Mutation_p.I5M|VNN2_ENST00000525289.1_Missense_Mutation_p.I58M|VNN2_ENST00000526192.1_5'UTR	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	58	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CCAGAATGTCTATATTCTCGT	0.433																																					p.I58M		.											.	VNN2	90	0			c.A174G						.						132.0	128.0	129.0					6																	133078849		2203	4300	6503	SO:0001583	missense	8875	exon1			AATGTCTATATTC	AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.174A>G	6.37:g.133078849T>C	ENSP00000322276:p.Ile58Met	Somatic	71.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_004665	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	ENST00000326499.6	37	CCDS5161.1	.	.	.	.	.	.	.	.	.	.	t	7.065	0.567071	0.13560	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289;ENST00000524919;ENST00000530536;ENST00000532012	D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.41	5.59	1.9	0.25705	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.269957	0.36893	N	0.002352	T	0.63498	0.2516	L	0.27053	0.805	0.23906	N	0.996506	B;B	0.28850	0.225;0.119	B;B	0.28553	0.048;0.091	T	0.56275	-0.8006	10	0.41790	T	0.15	-9.7553	3.8881	0.09107	0.2379:0.2708:0.0:0.4913	.	58;58	O95498-2;O95498	.;VNN2_HUMAN	M	58;5;58;58;5;58	ENSP00000322276:I58M;ENSP00000436822:I5M;ENSP00000436935:I58M;ENSP00000431451:I58M;ENSP00000434210:I5M;ENSP00000431680:I58M	ENSP00000322276:I58M	I	-	3	3	VNN2	133120542	0.096000	0.21769	0.989000	0.46669	0.126000	0.20510	0.079000	0.14782	0.484000	0.27630	0.492000	0.49549	ATA	.		0.433	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042264.2		
WDR47	22911	ucsc.edu;bcgsc.ca	37	1	109553939	109553939	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:109553939A>G	ENST00000369962.3	-	5	951	c.729T>C	c.(727-729)agT>agC	p.S243S	WDR47_ENST00000361054.3_Silent_p.S215S|WDR47_ENST00000400794.3_Silent_p.S250S|WDR47_ENST00000369965.4_Silent_p.S243S|WDR47_ENST00000357672.3_Silent_p.S215S			O94967	WDR47_HUMAN	WD repeat domain 47	243					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		ATGACAGTAAACTCAGATCCA	0.378																																					p.S250S		.											.	WDR47	91	0			c.T750C						.						193.0	195.0	194.0					1																	109553939		2203	4296	6499	SO:0001819	synonymous_variant	22911	exon5			CAGTAAACTCAGA	AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.729T>C	1.37:g.109553939A>G		Somatic	50.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_001142550	A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Silent	SNP	ENST00000369962.3	37	CCDS44187.1																																																																																			.		0.378	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032414.2	NM_014969	
XRN2	22803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	21346075	21346075	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:21346075C>T	ENST00000377191.3	+	25	2367	c.2272C>T	c.(2272-2274)Cca>Tca	p.P758S	XRN2_ENST00000430571.2_Missense_Mutation_p.P682S|XRN2_ENST00000539513.1_Missense_Mutation_p.P704S	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	758					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TTTTAAAGACCCACAGTTTGC	0.308																																					p.P758S		.											.	XRN2	515	0			c.C2272T						.						79.0	79.0	79.0					20																	21346075		2203	4299	6502	SO:0001583	missense	22803	exon25			AAAGACCCACAGT	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.2272C>T	20.37:g.21346075C>T	ENSP00000366396:p.Pro758Ser	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	40.0	NM_012255	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	37	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504704	0.85176	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.57273	0.5;0.41;0.46	5.56	5.56	0.83823	.	0.048216	0.85682	D	0.000000	T	0.77315	0.4112	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80560	-0.1328	10	0.87932	D	0	-8.1355	19.5261	0.95208	0.0:1.0:0.0:0.0	.	758	Q9H0D6	XRN2_HUMAN	S	758;682;704	ENSP00000366396:P758S;ENSP00000413548:P682S;ENSP00000441113:P704S	ENSP00000366396:P758S	P	+	1	0	XRN2	21294075	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.616000	0.74205	2.632000	0.89209	0.655000	0.94253	CCA	.		0.308	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
ZBTB48	3104	ucsc.edu;bcgsc.ca	37	1	6646059	6646059	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr1:6646059A>G	ENST00000377674.4	+	4	1171	c.1013A>G	c.(1012-1014)gAa>gGa	p.E338G		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	338					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		CTGGAGCATGAAGCCCGGAAT	0.567																																					p.E338G	Esophageal Squamous(125;1449 1657 4031 29866 49542)	.											.	ZBTB48	514	0			c.A1013G						.						99.0	101.0	100.0					1																	6646059		2203	4300	6503	SO:0001583	missense	3104	exon4			AGCATGAAGCCCG	BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.1013A>G	1.37:g.6646059A>G	ENSP00000366902:p.Glu338Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_005341	Q5SY19	Missense_Mutation	SNP	ENST00000377674.4	37	CCDS84.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.707247	0.89018	.	.	ENSG00000204859	ENST00000377674	T	0.29142	1.58	5.27	5.27	0.74061	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.54935	0.1889	M	0.73372	2.23	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.59563	-0.7431	10	0.87932	D	0	-14.7202	14.393	0.66991	1.0:0.0:0.0:0.0	.	338	P10074	ZBT48_HUMAN	G	338	ENSP00000366902:E338G	ENSP00000366902:E338G	E	+	2	0	ZBTB48	6568646	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	8.765000	0.91724	1.998000	0.58463	0.379000	0.24179	GAA	.		0.567	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004193.1	NM_005341	
ZDHHC3	51304	ucsc.edu;bcgsc.ca	37	3	44986740	44986740	+	Silent	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:44986740A>G	ENST00000424952.2	-	3	619	c.351T>C	c.(349-351)agT>agC	p.S117S	ZDHHC3_ENST00000342790.4_Silent_p.S151S|ZDHHC3_ENST00000296127.3_Silent_p.S117S	NM_001135179.1	NP_001128651.1	Q9NYG2	ZDHC3_HUMAN	zinc finger, DHHC-type containing 3	117					protein palmitoylation (GO:0018345)|protein targeting (GO:0006605)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)		TCAACTGTAAACTCTCGATGA	0.542																																					p.S117S		.											.	ZDHHC3	90	0			c.T351C						.						150.0	150.0	150.0					3																	44986740		2203	4300	6503	SO:0001819	synonymous_variant	51304	exon3			CTGTAAACTCTCG	AF247703	CCDS2724.1, CCDS46811.1	3p21.31	2010-02-09			ENSG00000163812	ENSG00000163812		"""Zinc fingers, DHHC-type"""	18470	protein-coding gene	gene with protein product	"""golgi-specific DHHC Zinc Finger Protein"""					19955568	Standard	NM_016598		Approved	ZNF373, GODZ	uc003cod.3	Q9NYG2	OTTHUMG00000133093	ENST00000424952.2:c.351T>C	3.37:g.44986740A>G		Somatic	105.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_016598	Q53A17|Q96BL0	Silent	SNP	ENST00000424952.2	37	CCDS46811.1																																																																																			.		0.542	ZDHHC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347004.1	NM_016598	
ZNF20	7568	ucsc.edu;bcgsc.ca	37	19	12243668	12243668	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:12243668G>A	ENST00000334213.5	-	4	1557	c.1333C>T	c.(1333-1335)Cac>Tac	p.H445Y	ZNF20_ENST00000600335.1_Intron|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000485451.1_5'Flank	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						TCTCCAGTGTGTGTCCTTTCA	0.428																																					p.H445Y		.											.	ZNF20	22	0			c.C1333T						.						98.0	105.0	103.0					19																	12243668		2199	4297	6496	SO:0001583	missense	7568	exon4			CAGTGTGTGTCCT	X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1333C>T	19.37:g.12243668G>A	ENSP00000335437:p.His445Tyr	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484634	0.63962	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	T	0.67523	-0.27	0.94	0.94	0.19513	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.82250	0.4996	M	0.92923	3.36	0.37142	D	0.90175	D	0.76494	0.999	D	0.81914	0.995	D	0.83921	0.0301	9	0.87932	D	0	.	7.7068	0.28655	0.0:0.0:1.0:0.0	.	445	P17024	ZNF20_HUMAN	Y	445	ENSP00000335437:H445Y	ENSP00000292241:H445Y	H	-	1	0	ZNF20	12104668	1.000000	0.71417	0.019000	0.16419	0.951000	0.60555	5.813000	0.69201	0.783000	0.33636	0.313000	0.20887	CAC	.		0.428	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
ZNF433	163059	ucsc.edu;bcgsc.ca	37	19	12128986	12128986	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:12128986G>T	ENST00000344980.6	-	2	304	c.134C>A	c.(133-135)tCt>tAt	p.S45Y	CTD-2006C1.2_ENST00000406892.2_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|ZNF433_ENST00000419886.2_Missense_Mutation_p.S10Y|CTD-2006C1.10_ENST00000547473.1_3'UTR|CTD-2006C1.2_ENST00000495324.1_RNA	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	45	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						CTTACCTATAGAGGCCAGGTT	0.418																																					p.S45Y		.											.	.	.	0			c.C134A						.						64.0	67.0	66.0					19																	12128986		2190	4295	6485	SO:0001583	missense	163059	exon2			CCTATAGAGGCCA	AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.134C>A	19.37:g.12128986G>T	ENSP00000339767:p.Ser45Tyr	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_001080411	Q86VX3	Missense_Mutation	SNP	ENST00000344980.6	37	CCDS45983.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920255	0.33908	.	.	ENSG00000197647	ENST00000419886;ENST00000344980;ENST00000550507;ENST00000455504;ENST00000552904;ENST00000478765;ENST00000547560;ENST00000550745	T;T;T;T;T;T;T;T	0.26373	3.22;3.98;3.98;3.98;4.35;3.98;1.74;3.98	1.03	-0.119	0.13543	Krueppel-associated box (4);	.	.	.	.	T	0.42381	0.1200	M	0.93898	3.47	0.09310	N	1	P	0.46952	0.887	P	0.49140	0.601	T	0.34378	-0.9831	9	0.56958	D	0.05	.	3.8235	0.08845	0.4888:0.0:0.5112:0.0	.	45	Q8N7K0	ZN433_HUMAN	Y	10;45;42;56;10;56;10;44	ENSP00000393416:S10Y;ENSP00000339767:S45Y;ENSP00000448099:S42Y;ENSP00000414857:S56Y;ENSP00000448233:S10Y;ENSP00000447951:S56Y;ENSP00000448806:S10Y;ENSP00000447205:S44Y	ENSP00000339767:S45Y	S	-	2	0	ZNF433	11989986	0.000000	0.05858	0.057000	0.19452	0.463000	0.32649	-0.002000	0.12924	0.005000	0.14708	0.306000	0.20318	TCT	.		0.418	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403716.1	NM_152602	
ZNF416	55659	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58084146	58084146	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:58084146G>C	ENST00000196489.3	-	4	1348	c.1126C>G	c.(1126-1128)Cac>Gac	p.H376D		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	376					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		TCTCCTGTGTGAGTTCTCTGG	0.443																																					p.H376D		.											.	ZNF416	90	0			c.C1126G						.						101.0	94.0	96.0					19																	58084146		2203	4300	6503	SO:0001583	missense	55659	exon4			CTGTGTGAGTTCT	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1126C>G	19.37:g.58084146G>C	ENSP00000196489:p.His376Asp	Somatic	82.0	1.0		WXS	Illumina HiSeq	Phase_I	115.0	29.0	NM_017879	Q9NWW8	Missense_Mutation	SNP	ENST00000196489.3	37	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086713	0.76642	.	.	ENSG00000083817	ENST00000196489;ENST00000359489	T	0.67698	-0.28	3.73	3.73	0.42828	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.86764	0.6011	H	0.96301	3.8	0.52099	D	0.999947	D	0.89917	1.0	D	0.91635	0.999	D	0.91234	0.5016	9	0.87932	D	0	.	14.8052	0.69948	0.0:0.0:1.0:0.0	.	376	Q9BWM5	ZN416_HUMAN	D	376;335	ENSP00000196489:H376D	ENSP00000196489:H376D	H	-	1	0	ZNF416	62775958	1.000000	0.71417	0.887000	0.34795	0.998000	0.95712	8.345000	0.90057	2.082000	0.62665	0.655000	0.94253	CAC	.		0.443	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
ZNF445	353274	ucsc.edu;bcgsc.ca	37	3	44492406	44492406	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:44492406G>T	ENST00000396077.2	-	5	994	c.647C>A	c.(646-648)cCg>cAg	p.P216Q	ZNF445_ENST00000425708.2_Missense_Mutation_p.P216Q	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	216					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CTGGTCTCCCGGGCACCCCTC	0.592																																					p.P216Q		.											.	ZNF445	91	0			c.C647A						.						80.0	72.0	75.0					3																	44492406		2203	4300	6503	SO:0001583	missense	353274	exon5			TCTCCCGGGCACC	AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.647C>A	3.37:g.44492406G>T	ENSP00000379387:p.Pro216Gln	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_181489	Q3MJD1	Missense_Mutation	SNP	ENST00000396077.2	37	CCDS2713.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177252	0.57692	.	.	ENSG00000185219	ENST00000425708;ENST00000396077;ENST00000340674;ENST00000430301	T;T	0.06371	3.31;3.31	4.34	2.51	0.30379	.	0.521937	0.16257	N	0.222423	T	0.04272	0.0118	N	0.14661	0.345	0.09310	N	1	P;P	0.45768	0.777;0.866	B;B	0.44163	0.443;0.443	T	0.34750	-0.9816	10	0.54805	T	0.06	.	4.1385	0.10183	0.2155:0.1949:0.5896:0.0	.	216;216	B7ZKX2;P59923	.;ZN445_HUMAN	Q	216;216;209;214	ENSP00000413073:P216Q;ENSP00000379387:P216Q	ENSP00000342436:P209Q	P	-	2	0	ZNF445	44467410	0.000000	0.05858	0.004000	0.12327	0.295000	0.27426	0.356000	0.20181	0.746000	0.32786	0.491000	0.48974	CCG	.		0.592	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256647.2	NM_181489	
ZNF462	58499	ucsc.edu;bcgsc.ca	37	9	109690181	109690181	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:109690181C>G	ENST00000277225.5	+	3	4277	c.3988C>G	c.(3988-3990)Cat>Gat	p.H1330D	ZNF462_ENST00000457913.1_Missense_Mutation_p.H1330D|ZNF462_ENST00000441147.2_Missense_Mutation_p.H175D			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1330					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TTTGCTCCTGCATTACCAACG	0.532																																					p.H1330D		.											.	ZNF462	95	0			c.C3988G						.						123.0	110.0	115.0					9																	109690181		2203	4300	6503	SO:0001583	missense	58499	exon3			CTCCTGCATTACC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3988C>G	9.37:g.109690181C>G	ENSP00000277225:p.His1330Asp	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725915	0.89298	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.18338	2.22;2.64;2.7;2.7	5.36	5.36	0.76844	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.30386	0.0763	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.997	T	0.14980	-1.0453	10	0.87932	D	0	.	19.0895	0.93221	0.0:1.0:0.0:0.0	.	1330;1330	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	D	1330;1330;213;175	ENSP00000277225:H1330D;ENSP00000414570:H1330D;ENSP00000363818:H213D;ENSP00000397306:H175D	ENSP00000277225:H1330D	H	+	1	0	ZNF462	108730002	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.428000	0.80296	2.509000	0.84616	0.561000	0.74099	CAT	.		0.532	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
ZNF462	58499	ucsc.edu;bcgsc.ca	37	9	109734383	109734383	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr9:109734383T>C	ENST00000277225.5	+	8	6814	c.6525T>C	c.(6523-6525)ccT>ccC	p.P2175P	ZNF462_ENST00000457913.1_Silent_p.P2235P|ZNF462_ENST00000542028.1_Silent_p.P132P|ZNF462_ENST00000441147.2_Silent_p.P1081P|RP11-508N12.2_ENST00000439901.1_RNA			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2175					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GCCCTGTGCCTCTTTCTGGGG	0.542																																					p.P2175P		.											.	ZNF462	95	0			c.T6525C						.						81.0	83.0	82.0					9																	109734383		2203	4300	6503	SO:0001819	synonymous_variant	58499	exon8			TGTGCCTCTTTCT	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.6525T>C	9.37:g.109734383T>C		Somatic	57.0	0.0		WXS	Illumina HiSeq	.	40.0	5.0	NM_021224	Q5T0T4|Q8N408	Silent	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	T	10.68	1.418091	0.25552	.	.	ENSG00000148143	ENST00000427098	.	.	.	6.17	2.53	0.30540	.	.	.	.	.	T	0.45397	0.1340	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27191	-1.0081	4	.	.	.	.	2.4518	0.04520	0.1462:0.1344:0.1067:0.6126	.	.	.	.	P	77	.	.	S	+	1	0	ZNF462	108774204	0.022000	0.18835	0.987000	0.45799	0.997000	0.91878	-0.226000	0.09139	0.185000	0.20105	0.533000	0.62120	TCT	.		0.542	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
ZNF469	84627	ucsc.edu;bcgsc.ca	37	16	88498440	88498440	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr16:88498440G>T	ENST00000437464.1	+	2	4478	c.4478G>T	c.(4477-4479)gGa>gTa	p.G1493V	ZNF469_ENST00000565624.1_Missense_Mutation_p.G1521V	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1493	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CTCTCGGGGGGAAAGGTGCTC	0.582																																					p.G1493V		.											.	.	.	0			c.G4478T						.						107.0	84.0	91.0					16																	88498440		692	1591	2283	SO:0001583	missense	84627	exon2			CGGGGGGAAAGGT	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.4478G>T	16.37:g.88498440G>T	ENSP00000402343:p.Gly1493Val	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.646183	0.29246	.	.	ENSG00000225614	ENST00000437464	T	0.05996	3.36	4.69	-0.786	0.10946	.	.	.	.	.	T	0.04272	0.0118	N	0.19112	0.55	0.09310	N	0.999999	P	0.50943	0.94	B	0.43680	0.427	T	0.37888	-0.9686	9	0.52906	T	0.07	.	3.8357	0.08893	0.3926:0.4003:0.2071:0.0	.	1493	Q96JG9	ZN469_HUMAN	V	1493	ENSP00000402343:G1493V	ENSP00000402343:G1493V	G	+	2	0	ZNF469	87025941	1.000000	0.71417	0.001000	0.08648	0.003000	0.03518	1.355000	0.34068	-0.025000	0.13918	0.561000	0.74099	GGA	.		0.582	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF502	91392	ucsc.edu;bcgsc.ca	37	3	44763562	44763562	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:44763562A>G	ENST00000296091.4	+	4	1509	c.1253A>G	c.(1252-1254)cAg>cGg	p.Q418R	ZNF502_ENST00000449836.1_Missense_Mutation_p.Q418R|ZNF502_ENST00000436624.2_Missense_Mutation_p.Q418R	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		GCCTTCATTCAGAGCATTTGC	0.448																																					p.Q418R		.											.	ZNF502	90	0			c.A1253G						.						84.0	87.0	86.0					3																	44763562		2203	4300	6503	SO:0001583	missense	91392	exon4			TCATTCAGAGCAT	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.1253A>G	3.37:g.44763562A>G	ENSP00000296091:p.Gln418Arg	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001134440		Missense_Mutation	SNP	ENST00000296091.4	37	CCDS2719.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.65|13.65	2.299781|2.299781	0.40694|0.40694	.|.	.|.	ENSG00000196653|ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624|ENST00000427783	T;T;T|.	0.35605|.	1.3;1.3;1.3|.	4.19|4.19	3.05|3.05	0.35203|0.35203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.16811|0.16811	0.0404|0.0404	N|N	0.02286|0.02286	-0.61|-0.61	0.09310|0.09310	N|N	1|1	P|.	0.34639|.	0.461|.	B|.	0.35931|.	0.214|.	T|T	0.11916|0.11916	-1.0568|-1.0568	9|6	0.24483|0.46703	T|T	0.36|0.11	-7.843|-7.843	9.0267|9.0267	0.36234|0.36234	0.9045:0.0:0.0954:0.0|0.9045:0.0:0.0954:0.0	.|.	418|.	Q8TBZ5|.	ZN502_HUMAN|.	R|G	418|418	ENSP00000397390:Q418R;ENSP00000296091:Q418R;ENSP00000406469:Q418R|.	ENSP00000296091:Q418R|ENSP00000397812:R418G	Q|R	+|+	2|1	0|2	ZNF502|ZNF502	44738566|44738566	0.001000|0.001000	0.12720|0.12720	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.581000|1.581000	0.36558|0.36558	1.899000|1.899000	0.54978|0.54978	0.533000|0.533000	0.62120|0.62120	CAG|AGA	.		0.448	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
ZNF503	84858	broad.mit.edu;bcgsc.ca	37	10	77159617	77159617	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr10:77159617C>T	ENST00000372524.4	-	2	1317	c.831G>A	c.(829-831)acG>acA	p.T277T	ZNF503_ENST00000535216.1_Silent_p.T277T|ZNF503-AS2_ENST00000466942.2_RNA|RP11-399K21.11_ENST00000418818.2_lincRNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	277	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					GTGCCAGCCCCGTGGGTCCCC	0.716																																					p.T277T		.											.	ZNF503	91	0			c.G831A						.						11.0	14.0	13.0					10																	77159617		2195	4283	6478	SO:0001819	synonymous_variant	84858	exon2			CAGCCCCGTGGGT	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.831G>A	10.37:g.77159617C>T		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	4.0	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Silent	SNP	ENST00000372524.4	37	CCDS7350.1																																																																																			.		0.716	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
ZNF532	55205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	56585829	56585829	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:56585829A>G	ENST00000336078.4	+	4	1086	c.310A>G	c.(310-312)Aaa>Gaa	p.K104E	ZNF532_ENST00000591230.1_Missense_Mutation_p.K104E|ZNF532_ENST00000591083.1_Missense_Mutation_p.K104E|ZNF532_ENST00000589288.1_Missense_Mutation_p.K104E|ZNF532_ENST00000591808.1_Missense_Mutation_p.K104E	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CAGTTACAGTAAAGATGGAGC	0.512																																					p.K104E		.											.	ZNF532	154	0			c.A310G						.						86.0	71.0	76.0					18																	56585829		2203	4300	6503	SO:0001583	missense	55205	exon4			TACAGTAAAGATG	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.310A>G	18.37:g.56585829A>G	ENSP00000338217:p.Lys104Glu	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	14.0	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582931	0.46006	.	.	ENSG00000074657	ENST00000336078	T	0.01838	4.61	5.47	5.47	0.80525	.	0.053528	0.64402	D	0.000001	T	0.08179	0.0204	M	0.72894	2.215	0.50039	D	0.999847	D	0.57899	0.981	P	0.53224	0.721	T	0.04693	-1.0933	10	0.49607	T	0.09	-0.6041	15.2263	0.73354	1.0:0.0:0.0:0.0	.	104	Q9HCE3	ZN532_HUMAN	E	104	ENSP00000338217:K104E	ENSP00000338217:K104E	K	+	1	0	ZNF532	54736809	1.000000	0.71417	0.382000	0.26119	0.135000	0.20990	8.854000	0.92228	2.071000	0.62044	0.454000	0.30748	AAA	.		0.512	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
ZNF554	115196	ucsc.edu;bcgsc.ca	37	19	2827728	2827728	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:2827728C>T	ENST00000317243.5	+	3	438	c.240C>T	c.(238-240)aaC>aaT	p.N80N	ZNF554_ENST00000591265.1_Silent_p.N80N	NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	80	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTACAGGAACGTGGTCTCCC	0.468																																					p.N80N		.											.	ZNF554	91	0			c.C240T						.						84.0	94.0	90.0					19																	2827728		2201	4300	6501	SO:0001819	synonymous_variant	115196	exon3			CAGGAACGTGGTC	AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.240C>T	19.37:g.2827728C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001102651	Q8NAT3|Q9BWN3	Silent	SNP	ENST00000317243.5	37	CCDS42462.1																																																																																			.		0.468	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451598.3	NM_152303	
ZZEF1	23140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	3957431	3957431	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:3957431C>A	ENST00000381638.2	-	34	5478	c.5354G>T	c.(5353-5355)gGg>gTg	p.G1785V	RNA5SP434_ENST00000516647.1_RNA	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1785							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CTCATCACACCCATCACAAGA	0.438																																					p.G1785V		.											.	ZZEF1	93	0			c.G5354T						.						156.0	132.0	140.0					17																	3957431		2203	4300	6503	SO:0001583	missense	23140	exon34			TCACACCCATCAC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.5354G>T	17.37:g.3957431C>A	ENSP00000371051:p.Gly1785Val	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	16.0	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	33	5.244446	0.95272	.	.	ENSG00000074755	ENST00000381638	D	0.91295	-2.82	6.17	6.17	0.99709	Zinc finger, ZZ-type (3);	0.000000	0.85682	D	0.000000	D	0.93822	0.8024	L	0.41710	1.295	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.995;1.0	D	0.93624	0.6950	10	0.87932	D	0	-19.6938	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1785;1785	O43149-2;O43149	.;ZZEF1_HUMAN	V	1785	ENSP00000371051:G1785V	ENSP00000371051:G1785V	G	-	2	0	ZZEF1	3904180	1.000000	0.71417	0.960000	0.40013	0.990000	0.78478	7.441000	0.80485	2.941000	0.99782	0.655000	0.94253	GGG	.		0.438	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
