#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A2ML1	144568	ucsc.edu;bcgsc.ca	37	12	9010546	9010546	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:9010546A>T	ENST00000299698.7	+	26	3292	c.3112A>T	c.(3112-3114)Aca>Tca	p.T1038S	A2ML1_ENST00000539547.1_Missense_Mutation_p.T547S	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						ATGTAGGCTGACAGCGTTTGT	0.438																																					p.T1038S		.											.	A2ML1	93	0			c.A3112T						.						135.0	126.0	129.0					12																	9010546		1935	4139	6074	SO:0001583	missense	144568	exon26			AGGCTGACAGCGT	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.3112A>T	12.37:g.9010546A>T	ENSP00000299698:p.Thr1038Ser	Somatic	68.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_144670		Missense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	A	17.49	3.403562	0.62288	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547	T;T;T	0.64438	-0.1;-0.1;-0.1	3.91	2.74	0.32292	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.000000	0.56097	D	0.000021	T	0.73953	0.3653	M	0.72576	2.205	0.34461	D	0.701761	D	0.89917	1.0	D	0.97110	1.0	T	0.79514	-0.1772	10	0.87932	D	0	.	8.1837	0.31326	0.9:0.0:0.1:0.0	.	1038	A8K2U0	A2ML1_HUMAN	S	1038;1038;588;547	ENSP00000299698:T1038S;ENSP00000443174:T588S;ENSP00000438292:T547S	ENSP00000299698:T1038S	T	+	1	0	A2ML1	8901813	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	5.479000	0.66813	0.647000	0.30713	0.459000	0.35465	ACA	.		0.438	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
AADAC	13	ucsc.edu;bcgsc.ca	37	3	151545758	151545758	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:151545758C>A	ENST00000232892.7	+	5	1124	c.998C>A	c.(997-999)cCc>cAc	p.P333H	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	333					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CGTGGCTTACCCCTGACCTAT	0.463																																					p.P333H	Ovarian(30;839 841 2699 32801 46334)	.											.	AADAC	280	0			c.C998A						.						83.0	73.0	77.0					3																	151545758		2203	4300	6503	SO:0001583	missense	13	exon5			GCTTACCCCTGAC	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.998C>A	3.37:g.151545758C>A	ENSP00000232892:p.Pro333His	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	ENST00000232892.7	37	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.267243	0.59540	.	.	ENSG00000114771	ENST00000232892	T	0.17370	2.28	4.69	3.81	0.43845	Alpha/beta hydrolase fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.62612	0.2442	H	0.99675	4.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80130	-0.1511	10	0.87932	D	0	-20.0798	14.1799	0.65566	0.1509:0.8491:0.0:0.0	.	333	P22760	AAAD_HUMAN	H	333	ENSP00000232892:P333H	ENSP00000232892:P333H	P	+	2	0	AADAC	153028448	1.000000	0.71417	0.216000	0.23742	0.745000	0.42441	6.906000	0.75719	0.940000	0.37473	0.591000	0.81541	CCC	.		0.463	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
ABR	29	ucsc.edu;bcgsc.ca	37	17	975919	975919	+	Missense_Mutation	SNP	A	A	G	rs200320950		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:975919A>G	ENST00000302538.5	-	8	975	c.829T>C	c.(829-831)Ttc>Ctc	p.F277L	ABR_ENST00000574437.1_Missense_Mutation_p.F231L|ABR_ENST00000536794.2_Missense_Mutation_p.F59L|ABR_ENST00000291107.2_Missense_Mutation_p.F240L|ABR_ENST00000544583.2_Missense_Mutation_p.F231L	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	277	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CTGGACAGGAAGTTCTGGGAG	0.657																																					p.F277L	Esophageal Squamous(197;2016 2115 4129 29033 46447)	.											.	ABR	91	0			c.T829C						.						111.0	87.0	96.0					17																	975919		2203	4300	6503	SO:0001583	missense	29	exon8			ACAGGAAGTTCTG	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.829T>C	17.37:g.975919A>G	ENSP00000303909:p.Phe277Leu	Somatic	83.0	0.0		WXS	Illumina HiSeq	.	31.0	5.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	37	CCDS10999.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	A	36	5.753534	0.96890	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000382259	T;T;T;T	0.60548	0.18;0.18;0.18;0.18	5.88	5.88	0.94601	Dbl homology (DH) domain (5);	0.046050	0.85682	D	0.000000	T	0.69646	0.3134	L	0.44542	1.39	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.988;0.974;1.0	D;D;D;D	0.87578	0.988;0.925;0.969;0.998	T	0.70554	-0.4840	10	0.52906	T	0.07	.	15.4693	0.75429	1.0:0.0:0.0:0.0	.	59;161;240;277	B7Z683;Q6ZT60;Q12979-2;Q12979	.;.;.;ABR_HUMAN	L	277;231;240;59;161	ENSP00000303909:F277L;ENSP00000442048:F231L;ENSP00000291107:F240L;ENSP00000437429:F59L	ENSP00000291107:F240L	F	-	1	0	ABR	922669	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.257000	0.95545	2.227000	0.72691	0.528000	0.53228	TTC	A|1.000;G|0.000		0.657	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
ADAMTS7	11173	ucsc.edu;bcgsc.ca	37	15	79058506	79058506	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:79058506G>A	ENST00000388820.4	-	19	3957	c.3747C>T	c.(3745-3747)acC>acT	p.T1249T	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1249					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GAGAGGAGTGGGTGCTGCCAA	0.652																																					p.T1249T		.											.	ADAMTS7	226	0			c.C3747T						.						19.0	22.0	21.0					15																	79058506		2190	4288	6478	SO:0001819	synonymous_variant	11173	exon19			GGAGTGGGTGCTG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3747C>T	15.37:g.79058506G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_014272	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			.		0.652	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ADORA2B	136	ucsc.edu;bcgsc.ca	37	17	15878047	15878047	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:15878047G>T	ENST00000304222.2	+	2	722	c.390G>T	c.(388-390)tgG>tgT	p.W130C	ZSWIM7_ENST00000399280.2_5'Flank	NM_000676.2	NP_000667.1	P29275	AA2BR_HUMAN	adenosine A2b receptor	130					activation of adenylate cyclase activity (GO:0007190)|activation of MAPK activity (GO:0000187)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)|JNK cascade (GO:0007254)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to non-antigenic stimulus (GO:0002882)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation vascular endothelial growth factor production (GO:0010575)|relaxation of vascular smooth muscle (GO:0060087)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	9				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Adenosine(DB00640)|Defibrotide(DB04932)|Enprofylline(DB00824)|Theophylline(DB00277)	CTGTCCTCTGGGTCCTTGCCT	0.502																																					p.W130C		.											.	ADORA2B	228	0			c.G390T						.						118.0	112.0	114.0					17																	15878047		2203	4300	6503	SO:0001583	missense	136	exon2			CCTCTGGGTCCTT	M97759	CCDS11173.1	17p12	2012-08-08			ENSG00000170425	ENSG00000170425		"""GPCR / Class A : Adenosine receptors"""	264	protein-coding gene	gene with protein product		600446				7558011	Standard	NM_000676		Approved		uc002gpd.1	P29275	OTTHUMG00000059140	ENST00000304222.2:c.390G>T	17.37:g.15878047G>T	ENSP00000304501:p.Trp130Cys	Somatic	87.0	0.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_000676		Missense_Mutation	SNP	ENST00000304222.2	37	CCDS11173.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233807	0.79688	.	.	ENSG00000170425	ENST00000304222	D	0.88818	-2.43	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97071	0.9043	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98312	1.0524	10	0.87932	D	0	-4.1548	18.8723	0.92320	0.0:0.0:1.0:0.0	.	130	P29275	AA2BR_HUMAN	C	130	ENSP00000304501:W130C	ENSP00000304501:W130C	W	+	3	0	ADORA2B	15818772	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.713000	0.92767	0.655000	0.94253	TGG	.		0.502	ADORA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131032.1		
AGO1	26523	ucsc.edu;bcgsc.ca	37	1	36367825	36367825	+	Silent	SNP	C	C	T	rs199936275		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:36367825C>T	ENST00000373204.4	+	11	1497	c.1284C>T	c.(1282-1284)ccC>ccT	p.P428P	AGO1_ENST00000373206.1_Silent_p.P353P	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	428					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TTGCCACACCCAATCAGGGTG	0.572																																					p.P428P		.											.	.	.	0			c.C1284T						.						104.0	116.0	112.0					1																	36367825		2203	4300	6503	SO:0001819	synonymous_variant	26523	exon11			CACACCCAATCAG	AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.1284C>T	1.37:g.36367825C>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_012199	Q5TA57|Q6P4S0	Silent	SNP	ENST00000373204.4	37	CCDS398.1																																																																																			C|0.999;A|0.000		0.572	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019337.3		
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	62290411	62290411	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:62290411C>A	ENST00000378024.4	-	5	11752	c.11478G>T	c.(11476-11478)gtG>gtT	p.V3826V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3826					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGGCAGGTTCACATCCACAT	0.522																																					p.V3826V		.											.	AHNAK	109	0			c.G11478T						.						196.0	204.0	201.0					11																	62290411		2202	4296	6498	SO:0001819	synonymous_variant	79026	exon5			CAGGTTCACATCC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.11478G>T	11.37:g.62290411C>A		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	34.0	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	37	CCDS31584.1																																																																																			.		0.522	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
ALDH1A2	8854	ucsc.edu;bcgsc.ca	37	15	58247428	58247428	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:58247428C>A	ENST00000249750.4	-	13	2291	c.1524G>T	c.(1522-1524)acG>acT	p.T508T	ALDH1A2_ENST00000347587.3_Silent_p.T470T|ALDH1A2_ENST00000537372.1_Silent_p.T487T|ALDH1A2_ENST00000558231.1_Silent_p.T479T|ALDH1A2_ENST00000559517.1_Silent_p.T412T	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	508					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	TTACTGTCACCGTCTTAACTT	0.537																																					p.T508T		.											.	ALDH1A2	226	0			c.G1524T						.						178.0	176.0	177.0					15																	58247428		2192	4292	6484	SO:0001819	synonymous_variant	8854	exon13			TGTCACCGTCTTA	AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.1524G>T	15.37:g.58247428C>A		Somatic	77.0	0.0		WXS	Illumina HiSeq	.	76.0	6.0	NM_003888	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Silent	SNP	ENST00000249750.4	37	CCDS10163.1																																																																																			.		0.537	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255869.1		
AMER1	139285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	63410591	63410591	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:63410591T>A	ENST00000330258.3	-	2	2848	c.2576A>T	c.(2575-2577)tAc>tTc	p.Y859F	AMER1_ENST00000403336.1_Intron|AMER1_ENST00000374869.3_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	859					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									CAGGCCTTGGTAGAATCGACT	0.552																																					p.Y859F		.											.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.A2576T						.						40.0	43.0	42.0					X																	63410591		2116	4204	6320	SO:0001583	missense	139285	exon2			CCTTGGTAGAATC	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2576A>T	X.37:g.63410591T>A	ENSP00000329117:p.Tyr859Phe	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	36.0	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	T	8.304	0.820525	0.16678	.	.	ENSG00000184675	ENST00000330258	T	0.39056	1.1	4.79	0.735	0.18300	.	.	.	.	.	T	0.17323	0.0416	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.08249	-1.0731	8	.	.	.	-0.6102	4.4958	0.11837	0.3703:0.0941:0.0:0.5356	.	859	Q5JTC6	F123B_HUMAN	F	859	ENSP00000329117:Y859F	.	Y	-	2	0	FAM123B	63327316	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	1.635000	0.37134	0.252000	0.21531	0.430000	0.28490	TAC	.		0.552	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
ANGPT4	51378	ucsc.edu;bcgsc.ca	37	20	896833	896833	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr20:896833G>T	ENST00000381922.3	-	1	127	c.25C>A	c.(25-27)Cag>Aag	p.Q9K	ANGPT4_ENST00000546022.1_Missense_Mutation_p.Q9K	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	9					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						AGGCTGCCCTGCAGCATGGCT	0.602																																					p.Q9K	Pancreas(181;481 2077 3259 31286 49856)	.											.	ANGPT4	92	0			c.C25A						.						69.0	63.0	65.0					20																	896833		2203	4300	6503	SO:0001583	missense	51378	exon1			TGCCCTGCAGCAT	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.25C>A	20.37:g.896833G>T	ENSP00000371347:p.Gln9Lys	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_015985	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	ENST00000381922.3	37	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	G	0.213	-1.035217	0.02029	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.48201	0.82;1.65	4.27	-1.68	0.08212	.	1.727610	0.04055	N	0.305437	T	0.21921	0.0528	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.08411	-1.0723	10	0.17832	T	0.49	.	0.8401	0.01148	0.2874:0.1595:0.3898:0.1632	.	9;9	B4E3J9;Q9Y264	.;ANGP4_HUMAN	K	9	ENSP00000371347:Q9K;ENSP00000439605:Q9K	ENSP00000371347:Q9K	Q	-	1	0	ANGPT4	844833	0.005000	0.15991	0.075000	0.20258	0.006000	0.05464	0.509000	0.22707	-0.052000	0.13311	-1.855000	0.00564	CAG	.		0.602	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985	
APAF1	317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	99117014	99117014	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:99117014A>G	ENST00000551964.1	+	23	3864	c.3128A>G	c.(3127-3129)cAt>cGt	p.H1043R	APAF1_ENST00000339433.3_Missense_Mutation_p.H1000R|APAF1_ENST00000550527.1_Missense_Mutation_p.H1032R|APAF1_ENST00000357310.1_Missense_Mutation_p.H1000R|APAF1_ENST00000549007.1_Missense_Mutation_p.H1000R|APAF1_ENST00000547045.1_Missense_Mutation_p.H1000R|APAF1_ENST00000359972.2_Missense_Mutation_p.H989R|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000552268.1_Intron	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	1043					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CTACGAGGCCATCAGGAAACA	0.353																																					p.H1043R		.											.	APAF1	229	0			c.A3128G						.						129.0	133.0	132.0					12																	99117014		2203	4300	6503	SO:0001583	missense	317	exon23			GAGGCCATCAGGA	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.3128A>G	12.37:g.99117014A>G	ENSP00000448165:p.His1043Arg	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	48.0	NM_181861	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.829789	0.50845	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.091058	0.85682	D	0.000000	D	0.94315	0.8173	H	0.99379	4.54	0.80722	D	1	D;D;D;D;P	0.89917	1.0;0.999;1.0;0.999;0.925	D;D;D;D;P	0.91635	0.998;0.999;0.996;0.975;0.793	D	0.96041	0.9024	10	0.51188	T	0.08	-3.8213	14.6627	0.68885	1.0:0.0:0.0:0.0	.	1000;1000;989;1043;1032	C9JLV4;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	R	1043;989;1000;1000;1032;1000;1000	ENSP00000448165:H1043R;ENSP00000353059:H989R;ENSP00000349862:H1000R;ENSP00000341830:H1000R;ENSP00000448449:H1032R;ENSP00000449791:H1000R;ENSP00000448161:H1000R	ENSP00000341830:H1000R	H	+	2	0	APAF1	97641145	1.000000	0.71417	0.999000	0.59377	0.161000	0.22273	7.094000	0.76944	2.186000	0.69663	0.533000	0.62120	CAT	.		0.353	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	
ARAP1	116985	ucsc.edu;bcgsc.ca	37	11	72407664	72407664	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:72407664G>T	ENST00000393609.3	-	23	3404	c.3202C>A	c.(3202-3204)Cga>Aga	p.R1068R	ARAP1_ENST00000359373.5_Silent_p.R1068R|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000426523.1_Silent_p.R823R|ARAP1_ENST00000334211.8_Silent_p.R823R|ARAP1_ENST00000455638.2_Silent_p.R1068R|ARAP1_ENST00000393605.3_Silent_p.R828R|ARAP1_ENST00000429686.1_Silent_p.R762R|ARAP1-AS1_ENST00000542022.1_RNA	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1068	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						AGCAGCTCTCGGTACCTGGAG	0.577																																					p.R1068R	Ovarian(102;1198 1520 13195 17913 37529)	.											.	ARAP1	91	0			c.C3202A						.						66.0	60.0	62.0					11																	72407664		2200	4293	6493	SO:0001819	synonymous_variant	116985	exon23			GCTCTCGGTACCT	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3202C>A	11.37:g.72407664G>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	.	34.0	5.0	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	ENST00000393609.3	37	CCDS41687.1																																																																																			.		0.577	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
ARHGAP33	115703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36272086	36272086	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:36272086T>G	ENST00000007510.4	+	12	1161	c.1017T>G	c.(1015-1017)atT>atG	p.I339M	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.I339M|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.I203M			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	339	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CCGAGTTCATTGAGGCCCACG	0.657																																					p.I339M		.											.	ARHGAP33	229	0			c.T1017G						.						75.0	74.0	74.0					19																	36272086		2203	4300	6503	SO:0001583	missense	115703	exon12			GTTCATTGAGGCC	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.1017T>G	19.37:g.36272086T>G	ENSP00000007510:p.Ile339Met	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	19.0	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	T	17.70	3.454980	0.63290	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.27557	1.66;1.66;1.66	5.3	-4.36	0.03645	.	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	H	0.96604	3.85	0.34950	D	0.751159	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.996	T	0.72584	-0.4249	10	0.87932	D	0	.	13.0487	0.58942	0.1181:0.7333:0.0:0.1486	.	203;339	O14559-10;O14559-11	.;.	M	339;339;203	ENSP00000007510:I339M;ENSP00000320038:I339M;ENSP00000368227:I203M	ENSP00000007510:I339M	I	+	3	3	ARHGAP33	40963926	0.001000	0.12720	0.923000	0.36655	0.973000	0.67179	-1.984000	0.01487	-1.103000	0.03019	-0.366000	0.07423	ATT	.		0.657	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
ARHGEF39	84904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35662720	35662720	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr9:35662720T>A	ENST00000378387.3	-	7	809	c.692A>T	c.(691-693)cAg>cTg	p.Q231L	ARHGEF39_ENST00000343259.3_Intron|ARHGEF39_ENST00000490970.1_5'UTR|ARHGEF39_ENST00000378395.2_Missense_Mutation_p.Q195L	NM_032818.2	NP_116207.2	Q8N4T4	ARG39_HUMAN	Rho guanine nucleotide exchange factor (GEF) 39	231	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell migration (GO:0030335)	plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)										CAGCCAGCCCTGGCGTAGGAA	0.592																																					p.Q231L		.											.	.	.	0			c.A692T						.						13.0	14.0	13.0					9																	35662720		2183	4256	6439	SO:0001583	missense	84904	exon7			CAGCCCTGGCGTA	AK001187	CCDS6584.2	9p13.3	2012-08-08	2012-08-08	2012-08-08	ENSG00000137135	ENSG00000137135			25909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 100"""	C9orf100		22327280	Standard	XR_242516		Approved	FLJ14642	uc003zxm.1	Q8N4T4	OTTHUMG00000019869	ENST00000378387.3:c.692A>T	9.37:g.35662720T>A	ENSP00000367638:p.Gln231Leu	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	34.0	NM_032818	Q49AG0|Q6TPQ2|Q96ST6	Missense_Mutation	SNP	ENST00000378387.3	37	CCDS6584.2	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498025	0.85069	.	.	ENSG00000137135	ENST00000378387;ENST00000378395	T;T	0.44881	0.91;0.91	5.94	5.94	0.96194	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.050478	0.85682	D	0.000000	T	0.41903	0.1179	L	0.44542	1.39	0.80722	D	1	D	0.54207	0.965	P	0.46758	0.526	T	0.29671	-1.0004	10	0.45353	T	0.12	-26.927	12.7916	0.57537	0.0:0.0:0.0:1.0	.	231	Q8N4T4	CI100_HUMAN	L	231;195	ENSP00000367638:Q231L;ENSP00000367648:Q195L	ENSP00000367638:Q231L	Q	-	2	0	C9orf100	35652720	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	5.581000	0.67471	2.275000	0.75901	0.528000	0.53228	CAG	.		0.592	ARHGEF39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052330.1	NM_032818	
ARHGEF40	55701	ucsc.edu;bcgsc.ca	37	14	21550138	21550138	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr14:21550138C>A	ENST00000298694.4	+	14	3238	c.3111C>A	c.(3109-3111)atC>atA	p.I1037I	ARHGEF40_ENST00000298693.3_Silent_p.I1037I			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1037						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						CTGTGCTGATCCGAGGCCTGG	0.657																																					p.I1037I		.											.	ARHGEF40	228	0			c.C3111A						.						19.0	19.0	19.0					14																	21550138		2193	4289	6482	SO:0001819	synonymous_variant	55701	exon14			GCTGATCCGAGGC		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.3111C>A	14.37:g.21550138C>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	ENST00000298694.4	37	CCDS32041.1																																																																																			.		0.657	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
ARID1B	57492	ucsc.edu;bcgsc.ca	37	6	157502181	157502181	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:157502181T>A	ENST00000350026.5	+	11	3176	c.3175T>A	c.(3175-3177)Tgg>Agg	p.W1059R	ARID1B_ENST00000275248.4_Missense_Mutation_p.W1054R|ARID1B_ENST00000367148.1_Missense_Mutation_p.W1112R|ARID1B_ENST00000478761.2_3'UTR|ARID1B_ENST00000346085.5_Missense_Mutation_p.W1072R	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1059	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GAGAAAGCTCTGGGTCGACCG	0.562																																					p.W1072R		.											.	ARID1B	154	0			c.T3214A						.						94.0	79.0	84.0					6																	157502181		2203	4296	6499	SO:0001583	missense	57492	exon12			AAGCTCTGGGTCG	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3175T>A	6.37:g.157502181T>A	ENSP00000055163:p.Trp1059Arg	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	T	26.2	4.711606	0.89112	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000414678;ENST00000319584;ENST00000400790	T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.76	5.76	0.90799	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.999	T	0.59440	-0.7454	10	0.87932	D	0	.	16.0796	0.80995	0.0:0.0:0.0:1.0	.	309;1059;1072;1054	Q8NFD5-4;Q8NFD5;Q8NFD5-2;G3XAA0	.;ARI1B_HUMAN;.;.	R	1072;1059;1112;1054;529;581;534;126	ENSP00000344546:W1072R;ENSP00000055163:W1059R;ENSP00000356116:W1112R;ENSP00000275248:W1054R;ENSP00000412835:W581R;ENSP00000313006:W534R;ENSP00000383596:W126R	ENSP00000275248:W1054R	W	+	1	0	ARID1B	157543873	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.195000	0.70347	0.528000	0.53228	TGG	.		0.562	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
ATP5G2	517	ucsc.edu;bcgsc.ca	37	12	54063081	54063081	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:54063081G>A	ENST00000549164.1	-	4	349	c.162C>T	c.(160-162)gtC>gtT	p.V54V	ATP5G2_ENST00000338662.5_Silent_p.V70V|ATP5G2_ENST00000550241.1_5'Flank|ATP5G2_ENST00000602871.1_Silent_p.V54V|ATP5G2_ENST00000394349.3_Silent_p.V111V			Q06055	AT5G2_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)	54					ATP hydrolysis coupled proton transport (GO:0015991)|ATP synthesis coupled proton transport (GO:0015986)|response to ethanol (GO:0045471)	integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	6						TGCGGCTAGAGACAAGTGAGG	0.517																																					p.V111V		.											.	ATP5G2	91	0			c.C333T						.						49.0	46.0	47.0					12																	54063081		2203	4300	6503	SO:0001819	synonymous_variant	517	exon4			GCTAGAGACAAGT	X69908	CCDS8863.2, CCDS31812.1	12q13.13	2012-10-12	2010-06-11		ENSG00000135390	ENSG00000135390		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	842	protein-coding gene	gene with protein product		603193	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9)"""			8328972	Standard	NM_005176		Approved		uc001sec.3	Q06055	OTTHUMG00000133442	ENST00000549164.1:c.162C>T	12.37:g.54063081G>A		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_005176	B3KQQ6	Silent	SNP	ENST00000549164.1	37																																																																																				.		0.517	ATP5G2-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000407403.1	NM_005176	
BEST4	266675	ucsc.edu;bcgsc.ca	37	1	45251285	45251285	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:45251285G>T	ENST00000372207.3	-	5	699	c.700C>A	c.(700-702)Ctc>Atc	p.L234I		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	234						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					GTGTAGACGAGGGGGATGCTG	0.537											OREG0013447	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L234I		.											.	BEST4	91	0			c.C700A						.						108.0	67.0	81.0					1																	45251285		2182	4242	6424	SO:0001583	missense	266675	exon5			AGACGAGGGGGAT	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.700C>A	1.37:g.45251285G>T	ENSP00000361281:p.Leu234Ile	Somatic	52.0	0.0	930	WXS	Illumina HiSeq	.	56.0	4.0	NM_153274	Q5JR93	Missense_Mutation	SNP	ENST00000372207.3	37	CCDS514.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766880	0.90020	.	.	ENSG00000142959	ENST00000372207	D	0.99042	-5.36	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.99293	0.9753	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99305	1.0902	10	0.49607	T	0.09	-10.6163	18.2398	0.89963	0.0:0.0:1.0:0.0	.	234	Q8NFU0	BEST4_HUMAN	I	234	ENSP00000361281:L234I	ENSP00000361281:L234I	L	-	1	0	BEST4	45023872	1.000000	0.71417	0.986000	0.45419	0.999000	0.98932	4.714000	0.61902	2.894000	0.99253	0.655000	0.94253	CTC	.		0.537	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023425.1	NM_153274	
BICD1	636	ucsc.edu;bcgsc.ca	37	12	32520626	32520626	+	Silent	SNP	C	C	A	rs202246949		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:32520626C>A	ENST00000281474.5	+	9	2890	c.2787C>A	c.(2785-2787)tcC>tcA	p.S929S	BICD1_ENST00000548411.1_Missense_Mutation_p.P828Q	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	929					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			CTGCTGCCTCCGTACCGCCAC	0.488																																					p.P828Q		.											.	BICD1	153	0			c.C2483A						.						107.0	95.0	99.0					12																	32520626		2203	4300	6503	SO:0001819	synonymous_variant	636	exon8			TGCCTCCGTACCG	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2787C>A	12.37:g.32520626C>A		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_001003398	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183780	0.57800	.	.	ENSG00000151746	ENST00000548411	T	0.39229	1.09	5.25	5.25	0.73442	.	.	.	.	.	T	0.30198	0.0757	.	.	.	0.80722	D	1	B	0.19583	0.037	B	0.17722	0.019	T	0.08973	-1.0696	8	0.13108	T	0.6	.	17.0377	0.86480	0.0:1.0:0.0:0.0	.	828	F8W113	.	Q	828	ENSP00000446793:P828Q	ENSP00000446793:P828Q	P	+	2	0	BICD1	32411893	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.064000	0.57506	2.448000	0.82819	0.591000	0.81541	CCG	.		0.488	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
BIRC3	330	ucsc.edu;bcgsc.ca	37	11	102206714	102206714	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:102206714C>T	ENST00000263464.3	+	7	4092	c.1342C>T	c.(1342-1344)Cgg>Tgg	p.R448W	BIRC3_ENST00000532808.1_Missense_Mutation_p.R448W	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	448	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		ATTATTAATCCGGAAGAATAG	0.318			T	MALT1	MALT																																p.R448W		.		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	.	BIRC3	662	0			c.C1342T						.						66.0	71.0	69.0					11																	102206714		2202	4299	6501	SO:0001583	missense	330	exon7			TTAATCCGGAAGA	L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1342C>T	11.37:g.102206714C>T	ENSP00000263464:p.Arg448Trp	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_001165	Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	ENST00000263464.3	37	CCDS8315.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201054	0.58234	.	.	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609	T;T	0.24151	1.87;1.87	5.27	4.37	0.52481	DEATH-like (2);Caspase Recruitment (3);	0.051514	0.85682	D	0.000000	T	0.40619	0.1124	M	0.81802	2.56	0.45762	D	0.998659	P	0.38148	0.62	B	0.44315	0.446	T	0.47114	-0.9142	10	0.87932	D	0	.	14.0812	0.64922	0.2738:0.7262:0.0:0.0	.	448	Q13489	BIRC3_HUMAN	W	448;448;216	ENSP00000263464:R448W;ENSP00000432907:R448W	ENSP00000263464:R448W	R	+	1	2	BIRC3	101711924	0.979000	0.34478	1.000000	0.80357	0.956000	0.61745	1.458000	0.35223	1.480000	0.48289	-0.127000	0.14921	CGG	.		0.318	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394159.1	NM_001165	
BOC	91653	broad.mit.edu;ucsc.edu	37	3	112991401	112991401	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:112991401T>C	ENST00000495514.1	+	7	1516	c.812T>C	c.(811-813)gTc>gCc	p.V271A	BOC_ENST00000273395.4_Missense_Mutation_p.V271A|BOC_ENST00000355385.3_Missense_Mutation_p.V271A			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	271	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GGGTCCAGTGTCACCGGCTAC	0.602																																					p.V271A		.											.	BOC	157	0			c.T812C						.						142.0	139.0	140.0					3																	112991401		2203	4300	6503	SO:0001583	missense	91653	exon7			CCAGTGTCACCGG	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.812T>C	3.37:g.112991401T>C	ENSP00000418663:p.Val271Ala	Somatic	84.0	1.0		WXS	Illumina HiSeq	Phase_I	63.0	7.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.306832	0.40795	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.68903	-0.36;-0.36;-0.36	5.92	5.92	0.95590	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.290034	0.33057	N	0.005330	T	0.61800	0.2376	L	0.39898	1.24	0.27537	N	0.950909	B;B	0.15141	0.012;0.007	B;B	0.22152	0.023;0.038	T	0.59021	-0.7532	10	0.62326	D	0.03	.	16.3636	0.83296	0.0:0.0:0.0:1.0	.	271;271	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	A	271	ENSP00000418663:V271A;ENSP00000273395:V271A;ENSP00000347546:V271A	ENSP00000273395:V271A	V	+	2	0	BOC	114474091	0.992000	0.36948	0.280000	0.24747	0.381000	0.30169	2.916000	0.48813	2.267000	0.75376	0.528000	0.53228	GTC	.		0.602	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
BTK	695	broad.mit.edu;bcgsc.ca	37	X	100611053	100611053	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:100611053A>G	ENST00000308731.7	-	15	1716	c.1553T>C	c.(1552-1554)cTt>cCt	p.L518P	BTK_ENST00000372880.1_Intron	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	518	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> R (in XLA).		adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GTCTCGGTGAAGGAACTGCTT	0.532									Agammaglobulinemia, X-linked																												p.L518P		.											.	BTK	1395	0			c.T1553C	GRCh37	CM984168	BTK	M		.						149.0	125.0	133.0					X																	100611053		2203	4300	6503	SO:0001583	missense	695	exon15	Familial Cancer Database	Bruton Type Agammaglobulinemia	CGGTGAAGGAACT	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1553T>C	X.37:g.100611053A>G	ENSP00000308176:p.Leu518Pro	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	5.0	NM_000061	B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	A	18.95	3.732598	0.69189	.	.	ENSG00000010671	ENST00000372855;ENST00000443591;ENST00000308731	D	0.84070	-1.8	5.49	5.49	0.81192	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.057753	0.64402	D	0.000001	D	0.89736	0.6801	M	0.69185	2.1	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.79784	0.986;0.973;0.993;0.989	D	0.90816	0.4705	10	0.87932	D	0	.	14.3091	0.66403	1.0:0.0:0.0:0.0	.	189;189;518;518	Q3MS94;Q3MS96;B2RAW1;Q06187	.;.;.;BTK_HUMAN	P	67;189;518	ENSP00000308176:L518P	ENSP00000308176:L518P	L	-	2	0	BTK	100497709	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.838000	0.53458	0.486000	0.48141	CTT	.		0.532	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061	
C10orf12	26148	ucsc.edu;bcgsc.ca	37	10	98741664	98741664	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:98741664C>A	ENST00000286067.2	+	1	624	c.517C>A	c.(517-519)Cac>Aac	p.H173N		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	173										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AACAGAATGCCACTTTGAGAA	0.388																																					p.H173N		.											.	C10orf12	92	0			c.C517A						.						84.0	80.0	82.0					10																	98741664		2203	4300	6503	SO:0001583	missense	26148	exon1			GAATGCCACTTTG	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.517C>A	10.37:g.98741664C>A	ENSP00000286067:p.His173Asn	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_015652	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281031	0.59758	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.19938	2.11	5.95	5.95	0.96441	.	0.000000	0.52532	D	0.000063	T	0.26085	0.0636	N	0.24115	0.695	0.33962	D	0.645793	D;D	0.56746	0.96;0.977	P;P	0.53593	0.643;0.73	T	0.20907	-1.0261	10	0.87932	D	0	-1.8212	15.1279	0.72497	0.1413:0.8586:0.0:0.0	.	7;173	A0PJI9;Q8N655	.;CJ012_HUMAN	N	173;7	ENSP00000286067:H173N	ENSP00000286067:H173N	H	+	1	0	C10orf12	98731654	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.166000	0.42406	2.822000	0.97130	0.655000	0.94253	CAC	.		0.388	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
C10orf35	219738	ucsc.edu;bcgsc.ca	37	10	71392795	71392795	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:71392795T>C	ENST00000373279.4	+	4	505	c.346T>C	c.(346-348)Tcc>Ccc	p.S116P	C10orf35_ENST00000491890.1_3'UTR	NM_145306.2	NP_660349.1	Q96D05	CJ035_HUMAN	chromosome 10 open reading frame 35	116						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						CTACCTGGTGTCCCACCTGAG	0.587																																					p.S116P		.											.	C10orf35	92	0			c.T346C						.						193.0	154.0	167.0					10																	71392795		2203	4300	6503	SO:0001583	missense	219738	exon4			CTGGTGTCCCACC	BC013587	CCDS7295.1	10q22.2	2003-11-21			ENSG00000171224	ENSG00000171224			23519	protein-coding gene	gene with protein product						12477932	Standard	NM_145306		Approved		uc001jpq.4	Q96D05	OTTHUMG00000018383	ENST00000373279.4:c.346T>C	10.37:g.71392795T>C	ENSP00000362376:p.Ser116Pro	Somatic	112.0	0.0		WXS	Illumina HiSeq	.	58.0	8.0	NM_145306		Missense_Mutation	SNP	ENST00000373279.4	37	CCDS7295.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.296562	0.81025	.	.	ENSG00000171224	ENST00000373279	.	.	.	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000004	T	0.70996	0.3288	L	0.56769	1.78	0.40154	D	0.976984	D	0.69078	0.997	D	0.78314	0.991	T	0.71649	-0.4529	9	0.40728	T	0.16	-49.3817	13.5111	0.61513	0.0:0.0:0.0:1.0	.	116	Q96D05	CJ035_HUMAN	P	116	.	ENSP00000362376:S116P	S	+	1	0	C10orf35	71062801	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.264000	0.51553	2.080000	0.62538	0.533000	0.62120	TCC	.		0.587	C10orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048454.1	NM_145306	
C10orf2	56652	ucsc.edu;bcgsc.ca	37	10	102750244	102750244	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:102750244T>C	ENST00000311916.2	+	3	1721	c.1536T>C	c.(1534-1536)caT>caC	p.H512H	MRPL43_ENST00000299179.5_5'Flank|C10orf2_ENST00000370228.1_Silent_p.H512H|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000342071.1_5'Flank|MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000318325.2_5'Flank|C10orf2_ENST00000473656.1_3'UTR	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	512	SF4 helicase. {ECO:0000255|PROSITE- ProRule:PRU00596}.				cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACATTTGTCATGTGATCATCG	0.488																																					p.H512H		.											.	C10orf2	69	0			c.T1536C						.						252.0	214.0	227.0					10																	102750244		2203	4300	6503	SO:0001819	synonymous_variant	56652	exon3			TTGTCATGTGATC	AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.1536T>C	10.37:g.102750244T>C		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_021830	B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Silent	SNP	ENST00000311916.2	37	CCDS7506.1																																																																																			.		0.488	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049886.1	NM_021830	
LMNTD2	256329	ucsc.edu;bcgsc.ca	37	11	557033	557033	+	Missense_Mutation	SNP	G	G	A	rs147157097	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:557033G>A	ENST00000329451.3	-	8	840	c.778C>T	c.(778-780)Cgg>Tgg	p.R260W	RP11-496I9.1_ENST00000527113.1_RNA|RP11-496I9.1_ENST00000527620.1_RNA	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		260										NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGTGATGCCGCTCGGAATGC	0.677																																					p.R260W		.											.	C11orf35	69	0			c.C778T						.	G	TRP/ARG	0,4386		0,0,2193	25.0	26.0	26.0		778	-2.6	0.0	11	dbSNP_134	26	11,8581		0,11,4285	yes	missense	C11orf35	NM_173573.2	101	0,11,6478	AA,AG,GG		0.128,0.0,0.0848	probably-damaging	260/635	557033	11,12967	2193	4296	6489	SO:0001583	missense	256329	exon8			GATGCCGCTCGGA																												ENST00000329451.3:c.778C>T	11.37:g.557033G>A	ENSP00000331167:p.Arg260Trp	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_173573		Missense_Mutation	SNP	ENST00000329451.3	37	CCDS7701.1	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502102	0.44455	0.0	0.00128	ENSG00000185522	ENST00000329451;ENST00000441853	T;T	0.32988	1.43;1.43	3.3	-2.59	0.06209	.	3.162860	0.01176	N	0.006963	T	0.21674	0.0522	N	0.08118	0	0.09310	N	1	D	0.63880	0.993	P	0.47134	0.539	T	0.28038	-1.0056	10	0.72032	D	0.01	-0.0295	8.2966	0.31988	0.0:0.161:0.6576:0.1814	.	260	Q8IXW0	CK035_HUMAN	W	260;267	ENSP00000331167:R260W;ENSP00000393529:R267W	ENSP00000331167:R260W	R	-	1	2	C11orf35	547033	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.022000	0.12480	-0.388000	0.07797	-0.574000	0.04147	CGG	G|1.000;A|0.000		0.677	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254973.2		
C12orf56	115749	ucsc.edu;bcgsc.ca	37	12	64661044	64661044	+	Silent	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:64661044C>T	ENST00000543942.2	-	13	2414	c.1788G>A	c.(1786-1788)ttG>ttA	p.L596L	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000536975.1_5'UTR|C12orf56_ENST00000333722.5_Silent_p.L436L	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	596										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		GCCTTTTCTGCAAGGCTGGCA	0.348																																					p.L596L		.											.	C12orf56	68	0			c.G1788A						.						61.0	58.0	59.0					12																	64661044		1833	4069	5902	SO:0001819	synonymous_variant	115749	exon13			TTTCTGCAAGGCT		CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.1788G>A	12.37:g.64661044C>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_001170633		Silent	SNP	ENST00000543942.2	37																																																																																				.		0.348	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000401058.2	NM_001099676	
CACNA1A	773	broad.mit.edu;bcgsc.ca	37	19	13476249	13476249	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:13476249C>A	ENST00000360228.5	-	5	665	c.666G>T	c.(664-666)gcG>gcT	p.A222A	CACNA1A_ENST00000573710.2_Silent_p.A222A	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	222					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGGGATCATCGCCTTCATGA	0.473																																					p.A222A		.											.	CACNA1A	67	0			c.G666T						.						63.0	63.0	63.0					19																	13476249		1919	4133	6052	SO:0001819	synonymous_variant	773	exon5			GATCATCGCCTTC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.666G>T	19.37:g.13476249C>A		Somatic	85.0	2.0		WXS	Illumina HiSeq	Phase_I	83.0	6.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	37	CCDS45998.1																																																																																			.		0.473	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CALCR	799	broad.mit.edu;bcgsc.ca	37	7	93072939	93072939	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:93072939C>A	ENST00000394441.1	-	8	1094	c.779G>T	c.(778-780)cGg>cTg	p.R260L	CALCR_ENST00000360249.4_Missense_Mutation_p.R276L|CALCR_ENST00000359558.2_Missense_Mutation_p.R294L|CALCR_ENST00000426151.1_Missense_Mutation_p.R260L|CALCR_ENST00000421592.1_Missense_Mutation_p.R276L	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	294					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	ATAATACCACCGCAAGCGTTG	0.443																																					p.R294L		.											.	CALCR	664	0			c.G881T						.						118.0	111.0	113.0					7																	93072939		2203	4300	6503	SO:0001583	missense	799	exon11			TACCACCGCAAGC	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.779G>T	7.37:g.93072939C>A	ENSP00000377959:p.Arg260Leu	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	6.0	NM_001164737	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Missense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	C	6.450	0.451207	0.12223	.	.	ENSG00000004948	ENST00000359558;ENST00000360249;ENST00000421592;ENST00000394441;ENST00000426151	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	4.94	1.03	0.20045	.	.	.	.	.	T	0.14917	0.0360	N	0.04959	-0.14	0.31762	N	0.633197	B;B	0.12013	0.001;0.005	B;B	0.14023	0.006;0.01	T	0.16129	-1.0413	9	0.36615	T	0.2	.	2.9017	0.05707	0.1953:0.3698:0.0:0.4348	.	294;260	F5H605;A4D1G6	.;.	L	294;276;276;260;260	ENSP00000352561:R294L;ENSP00000353385:R276L;ENSP00000399552:R276L;ENSP00000377959:R260L;ENSP00000389295:R260L	ENSP00000352561:R294L	R	-	2	0	CALCR	92910875	0.010000	0.17322	0.009000	0.14445	0.106000	0.19336	0.171000	0.16685	0.350000	0.24002	0.557000	0.71058	CGG	.		0.443	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
CAP2	10486	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	17463259	17463259	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:17463259G>A	ENST00000229922.2	+	4	787	c.255G>A	c.(253-255)caG>caA	p.Q85Q	CAP2_ENST00000378990.2_Intron|CAP2_ENST00000489374.1_Silent_p.Q85Q|CAP2_ENST00000493172.1_Intron|CAP2_ENST00000465994.1_Silent_p.Q85Q	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	85					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			TCCAGGCCCAGCGGGCTTTCC	0.502																																					p.Q85Q		.											.	CAP2	91	0			c.G255A						.						90.0	82.0	84.0					6																	17463259		2203	4300	6503	SO:0001819	synonymous_variant	10486	exon4			GGCCCAGCGGGCT	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.255G>A	6.37:g.17463259G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	34.0	NM_006366	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Silent	SNP	ENST00000229922.2	37	CCDS4539.1																																																																																			.		0.502	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2		
CAPNS2	84290	ucsc.edu;bcgsc.ca	37	16	55601229	55601229	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:55601229A>G	ENST00000457326.2	+	1	646	c.561A>G	c.(559-561)gaA>gaG	p.E187E	LPCAT2_ENST00000565056.1_Intron|LPCAT2_ENST00000262134.5_Intron	NM_032330.1	NP_115706.1	Q96L46	CPNS2_HUMAN	calpain, small subunit 2	187	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|large_intestine(1)|lung(3)|prostate(2)	7						AGCTAAATGAACAACTTTACC	0.488																																					p.E187E		.											.	.	.	0			c.A561G						.						133.0	131.0	132.0					16																	55601229		1892	4109	6001	SO:0001819	synonymous_variant	84290	exon1			AAATGAACAACTT	AY052551	CCDS54010.1	16q12.2	2013-01-10						"""EF-hand domain containing"""	16371	protein-coding gene	gene with protein product						11853546	Standard	NM_032330		Approved	MGC12536, MGC14804	uc002eid.1	Q96L46		ENST00000457326.2:c.561A>G	16.37:g.55601229A>G		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_032330	Q9BPV4	Silent	SNP	ENST00000457326.2	37	CCDS54010.1																																																																																			.		0.488	CAPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396391.1	NM_032330	
CATSPER1	117144	ucsc.edu;bcgsc.ca	37	11	65786337	65786337	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:65786337T>C	ENST00000312106.5	-	10	2299	c.2162A>G	c.(2161-2163)aAg>aGg	p.K721R		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	721					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						GATGAGCCGCTTCAGCATGGT	0.587																																					p.K721R		.											.	CATSPER1	92	0			c.A2162G						.						104.0	98.0	100.0					11																	65786337		2201	4296	6497	SO:0001583	missense	117144	exon10			AGCCGCTTCAGCA	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.2162A>G	11.37:g.65786337T>C	ENSP00000309052:p.Lys721Arg	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_053054	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	T	14.55	2.569671	0.45798	.	.	ENSG00000175294	ENST00000312106	D	0.97138	-4.26	4.68	-2.5	0.06384	.	0.683574	0.12089	N	0.500594	D	0.90689	0.7079	L	0.29908	0.895	0.09310	N	1	B	0.25441	0.126	B	0.23275	0.045	T	0.82155	-0.0597	10	0.37606	T	0.19	-21.3908	1.3826	0.02233	0.4449:0.0924:0.1527:0.31	.	721	Q8NEC5	CTSR1_HUMAN	R	721	ENSP00000309052:K721R	ENSP00000309052:K721R	K	-	2	0	CATSPER1	65542913	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.223000	0.09177	-0.192000	0.10432	0.533000	0.62120	AAG	.		0.587	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
CCDC13	152206	ucsc.edu;bcgsc.ca	37	3	42750572	42750572	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:42750572C>A	ENST00000310232.6	-	16	2131	c.2048G>T	c.(2047-2049)cGg>cTg	p.R683L	HHATL-AS1_ENST00000600839.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	683										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CTCCTTTCCCCGCAGGGCACT	0.592																																					p.R683L		.											.	CCDC13	91	0			c.G2048T						.						91.0	80.0	84.0					3																	42750572		2203	4300	6503	SO:0001583	missense	152206	exon16			TTTCCCCGCAGGG	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.2048G>T	3.37:g.42750572C>A	ENSP00000309836:p.Arg683Leu	Somatic	62.0	0.0		WXS	Illumina HiSeq	.	34.0	5.0	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	37	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422574	0.62622	.	.	ENSG00000244607	ENST00000310232	T	0.30182	1.54	4.58	0.44	0.16572	.	0.485362	0.18883	N	0.128511	T	0.25717	0.0626	L	0.60455	1.87	0.22479	N	0.999067	P	0.35226	0.491	B	0.32724	0.151	T	0.13522	-1.0506	10	0.56958	D	0.05	.	8.3589	0.32346	0.0:0.4752:0.0:0.5248	.	683	Q8IYE1	CCD13_HUMAN	L	683	ENSP00000309836:R683L	ENSP00000309836:R683L	R	-	2	0	CCDC13	42725576	0.009000	0.17119	0.986000	0.45419	0.989000	0.77384	0.095000	0.15127	0.189000	0.20188	0.563000	0.77884	CGG	.		0.592	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
CCR7	1236	ucsc.edu;bcgsc.ca	37	17	38715178	38715178	+	Missense_Mutation	SNP	G	G	T	rs193282140	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:38715178G>T	ENST00000246657.2	-	2	89	c.27C>A	c.(25-27)agC>agA	p.S9R	CCR7_ENST00000579344.1_Missense_Mutation_p.S3R	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	9					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				CCACCAGCACGCTTTTCATTG	0.507																																					p.S9R		.											.	CCR7	659	0			c.C27A						.						75.0	69.0	71.0					17																	38715178		2203	4300	6503	SO:0001583	missense	1236	exon2			CAGCACGCTTTTC		CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.27C>A	17.37:g.38715178G>T	ENSP00000246657:p.Ser9Arg	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	39.0	5.0	NM_001838		Missense_Mutation	SNP	ENST00000246657.2	37	CCDS11369.1	.	.	.	.	.	.	.	.	.	.	G	5.350	0.249951	0.10130	.	.	ENSG00000126353	ENST00000246657	T	0.59906	0.23	4.9	-2.3	0.06785	.	1.009950	0.07944	N	0.979703	T	0.24005	0.0581	N	0.03608	-0.345	0.09310	N	1	B	0.28082	0.2	B	0.17098	0.017	T	0.10660	-1.0620	10	0.28530	T	0.3	.	0.9393	0.01351	0.3818:0.1546:0.3054:0.1581	.	9	P32248	CCR7_HUMAN	R	9	ENSP00000246657:S9R	ENSP00000246657:S9R	S	-	3	2	CCR7	35968704	0.000000	0.05858	0.085000	0.20634	0.475000	0.33008	0.473000	0.22132	-0.205000	0.10219	-1.359000	0.01217	AGC	G|0.999;A|0.001		0.507	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257222.1		
CELF3	11189	ucsc.edu;bcgsc.ca	37	1	151681762	151681762	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:151681762T>C	ENST00000290583.4	-	4	1133	c.340A>G	c.(340-342)Atg>Gtg	p.M114V	AL589765.1_ENST00000442233.2_5'Flank|CELF3_ENST00000290585.4_Missense_Mutation_p.M114V|CELF3_ENST00000470688.1_5'UTR|RIIAD1_ENST00000326413.3_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000392706.3_5'Flank	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	114	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						GGCTCAAACATCTTCCGGACG	0.622																																					p.M114V		.											.	CELF3	91	0			c.A340G						.						228.0	214.0	219.0					1																	151681762		2203	4300	6503	SO:0001583	missense	11189	exon4			CAAACATCTTCCG	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.340A>G	1.37:g.151681762T>C	ENSP00000290583:p.Met114Val	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	43.0	5.0	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	37	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	.	10.73	1.432812	0.25813	.	.	ENSG00000159409	ENST00000290585;ENST00000290583;ENST00000368833	D;D	0.85411	-1.98;-1.98	4.39	4.39	0.52855	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.089994	0.64402	D	0.000001	T	0.59252	0.2180	N	0.11756	0.17	0.80722	D	1	B;B;B;B;B	0.21520	0.003;0.011;0.057;0.023;0.018	B;B;B;B;B	0.21546	0.035;0.009;0.013;0.018;0.007	T	0.65323	-0.6196	10	0.87932	D	0	-18.3077	8.0003	0.30293	0.0:0.0:0.2074:0.7926	.	114;114;113;114;113	Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3	.;.;.;CELF3_HUMAN;.	V	114;114;113	ENSP00000290585:M114V;ENSP00000290583:M114V	ENSP00000290583:M114V	M	-	1	0	CELF3	149948386	0.072000	0.21174	1.000000	0.80357	0.623000	0.37688	0.288000	0.18939	1.837000	0.53436	0.379000	0.24179	ATG	.		0.622	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
CD1E	913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158325802	158325802	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:158325802G>A	ENST00000368167.3	+	4	1050	c.811G>A	c.(811-813)Gca>Aca	p.A271T	CD1E_ENST00000368166.3_Missense_Mutation_p.A82T|CD1E_ENST00000368160.3_Missense_Mutation_p.A271T|CD1E_ENST00000368163.3_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368156.1_Missense_Mutation_p.A181T|CD1E_ENST00000434258.1_Missense_Mutation_p.A269T|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368161.3_Intron|CD1E_ENST00000368165.3_Missense_Mutation_p.A181T|CD1E_ENST00000452291.2_Missense_Mutation_p.A82T|CD1E_ENST00000444681.2_Missense_Mutation_p.A172T	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	271	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GTATCTCCGAGCAACCCTGGA	0.607																																					p.A271T		.											.	CD1E	93	0			c.G811A						.						100.0	99.0	99.0					1																	158325802		2203	4300	6503	SO:0001583	missense	913	exon4			CTCCGAGCAACCC	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.811G>A	1.37:g.158325802G>A	ENSP00000357149:p.Ala271Thr	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	41.0	NM_030893	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220546	0.58560	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368160;ENST00000368156	T;T;T;T;T;T;T;T	0.02863	4.13;4.13;4.13;4.13;4.13;4.13;4.13;4.13	4.38	4.38	0.52667	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.588914	0.14197	N	0.334970	T	0.05364	0.0142	L	0.60012	1.86	0.09310	N	1	P;D;D;P;P;D;P;P;P;B;D	0.61697	0.917;0.985;0.985;0.91;0.657;0.981;0.89;0.798;0.91;0.405;0.99	P;P;P;P;P;P;P;P;P;B;P	0.62885	0.908;0.841;0.841;0.688;0.688;0.851;0.456;0.561;0.688;0.357;0.851	T	0.15009	-1.0452	10	0.72032	D	0.01	-5.0189	12.3045	0.54893	0.0:0.0:1.0:0.0	.	82;172;269;271;172;181;82;271;271;82;181	B4E057;B4E042;E7ET31;A2RRL5;E7EP01;P15812-5;P15812-9;P15812-2;P15812;P15812-8;P15812-6	.;.;.;.;.;.;.;.;CD1E_HUMAN;.;.	T	269;172;271;82;181;82;271;181	ENSP00000401957:A269T;ENSP00000402906:A172T;ENSP00000357149:A271T;ENSP00000416228:A82T;ENSP00000357147:A181T;ENSP00000357148:A82T;ENSP00000357142:A271T;ENSP00000357138:A181T	ENSP00000357138:A181T	A	+	1	0	CD1E	156592426	0.045000	0.20229	0.006000	0.13384	0.565000	0.35776	2.831000	0.48144	2.277000	0.76020	0.563000	0.77884	GCA	.		0.607	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
CEP70	80321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	138219253	138219253	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:138219253G>A	ENST00000264982.3	-	15	1791	c.1525C>T	c.(1525-1527)Ctc>Ttc	p.L509F	CEP70_ENST00000542237.1_Missense_Mutation_p.L489F|CEP70_ENST00000489254.1_Missense_Mutation_p.L357F|CEP70_ENST00000481834.1_Missense_Mutation_p.L509F|CEP70_ENST00000484888.1_Missense_Mutation_p.L509F	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	509					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						AATTCTAAGAGTTCTTGGAGG	0.318																																					p.L509F		.											.	CEP70	69	0			c.C1525T						.						100.0	112.0	108.0					3																	138219253		2203	4300	6503	SO:0001583	missense	80321	exon15			CTAAGAGTTCTTG	AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1525C>T	3.37:g.138219253G>A	ENSP00000264982:p.Leu509Phe	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	76.0	NM_024491	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	ENST00000264982.3	37	CCDS3102.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100107	0.56183	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000481834	T;T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62;1.62	4.88	3.93	0.45458	Tetratricopeptide repeat-containing (1);	0.326421	0.29838	N	0.011079	T	0.50103	0.1596	M	0.66939	2.045	0.42564	D	0.993153	D;P;D;P	0.69078	0.96;0.904;0.997;0.904	P;P;D;P	0.68192	0.663;0.625;0.956;0.625	T	0.52866	-0.8518	10	0.72032	D	0.01	-0.9042	12.1533	0.54062	0.0:0.0:0.8187:0.1813	.	357;489;509;509	B7Z2D2;F5GZX8;Q8NHQ1-2;Q8NHQ1	.;.;.;CEP70_HUMAN	F	509;489;357;509;491;509	ENSP00000264982:L509F;ENSP00000444128:L489F;ENSP00000417821:L357F;ENSP00000419231:L509F;ENSP00000419833:L491F;ENSP00000417465:L509F	ENSP00000264982:L509F	L	-	1	0	CEP70	139701943	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.310000	0.43708	2.552000	0.86080	0.655000	0.94253	CTC	.		0.318	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491	
CERKL	375298	ucsc.edu;bcgsc.ca	37	2	182423419	182423419	+	Missense_Mutation	SNP	C	C	T	rs78484040		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:182423419C>T	ENST00000339098.5	-	6	771	c.772G>A	c.(772-774)Gga>Aga	p.G258R	CERKL_ENST00000374970.2_Intron|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000410087.3_Missense_Mutation_p.G232R|CERKL_ENST00000374969.2_Intron|CERKL_ENST00000409440.3_Missense_Mutation_p.G214R			Q49MI3	CERKL_HUMAN	ceramide kinase-like	258	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			GATCCATCTCCACCAACACAG	0.413																																					p.G258R		.											.	CERKL	228	0			c.G772A						.						111.0	108.0	109.0					2																	182423419		1958	4156	6114	SO:0001583	missense	375298	exon6			CATCTCCACCAAC	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.772G>A	2.37:g.182423419C>T	ENSP00000341159:p.Gly258Arg	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001030311	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	ENST00000339098.5	37	CCDS42789.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	32	5.159569	0.94686	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000339098	D;D;D	0.83837	-1.77;-1.77;-1.77	5.69	5.69	0.88448	Diacylglycerol kinase, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.94889	0.8348	H	0.97635	4.045	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96221	0.9160	10	0.87932	D	0	.	19.7949	0.96477	0.0:1.0:0.0:0.0	.	214;232;258	B4DEY1;Q49MI3-2;Q49MI3	.;.;CERKL_HUMAN	R	232;214;258	ENSP00000386725:G232R;ENSP00000387080:G214R;ENSP00000341159:G258R	ENSP00000341159:G258R	G	-	1	0	CERKL	182131664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.128000	0.77217	2.691000	0.91804	0.591000	0.81541	GGA	C|0.999;T|0.000		0.413	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1		
CFHR5	81494	ucsc.edu;bcgsc.ca	37	1	196965240	196965240	+	Silent	SNP	C	C	A	rs375290756	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:196965240C>A	ENST00000256785.4	+	6	988	c.879C>A	c.(877-879)gtC>gtA	p.V293V	CFHR5_ENST00000367414.5_Silent_p.V317V			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	293	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						GAGTTTCAGTCGAGGTGAATT	0.388																																					p.V293V		.											.	CFHR5	154	0			c.C879A						.						143.0	136.0	138.0					1																	196965240		2203	4300	6503	SO:0001819	synonymous_variant	81494	exon6			TTCAGTCGAGGTG	AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.879C>A	1.37:g.196965240C>A		Somatic	43.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_030787	Q2NKK2	Silent	SNP	ENST00000256785.4	37	CCDS1387.1																																																																																			.		0.388	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787	
CHD8	57680	ucsc.edu;bcgsc.ca	37	14	21859752	21859752	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr14:21859752T>C	ENST00000557364.1	-	36	7198	c.6935A>G	c.(6934-6936)gAg>gGg	p.E2312G	SNORD9_ENST00000362566.1_RNA|CHD8_ENST00000430710.3_Missense_Mutation_p.E2033G|CHD8_ENST00000399982.2_Missense_Mutation_p.E2312G			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2312					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GATCCGGGTCTCCAGGTCCAC	0.557																																					p.E2312G		.											.	CHD8	277	0			c.A6935G						.						39.0	39.0	39.0					14																	21859752		2010	4177	6187	SO:0001583	missense	57680	exon35			CGGGTCTCCAGGT	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.6935A>G	14.37:g.21859752T>C	ENSP00000451601:p.Glu2312Gly	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	53.0	4.0	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.348577	0.61183	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	T;T;T	0.54866	0.55;0.55;0.55	5.42	5.42	0.78866	.	0.504108	0.21562	N	0.072556	T	0.44603	0.1301	N	0.25485	0.75	0.47737	D	0.999504	P	0.46784	0.884	B	0.42916	0.402	T	0.50608	-0.8808	10	0.87932	D	0	-16.2484	14.5778	0.68262	0.0:0.0:0.0:1.0	.	2033	Q9HCK8-2	.	G	2033;2312;2032;2312	ENSP00000406288:E2033G;ENSP00000382863:E2312G;ENSP00000451601:E2312G	ENSP00000262707:E2032G	E	-	2	0	CHD8	20929592	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.172000	0.77604	2.274000	0.75844	0.533000	0.62120	GAG	.		0.557	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
CLCN7	1186	ucsc.edu;bcgsc.ca	37	16	1510868	1510868	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:1510868C>A	ENST00000382745.4	-	5	1038	c.433G>T	c.(433-435)Gac>Tac	p.D145Y	CLCN7_ENST00000262318.8_Missense_Mutation_p.D121Y|CLCN7_ENST00000448525.1_Missense_Mutation_p.D121Y	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	145					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				ACCACGATGTCAATGAAGCAG	0.647																																					p.D145Y		.											.	CLCN7	92	0			c.G433T						.						88.0	77.0	81.0					16																	1510868		2199	4300	6499	SO:0001583	missense	1186	exon5			CGATGTCAATGAA	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.433G>T	16.37:g.1510868C>A	ENSP00000372193:p.Asp145Tyr	Somatic	56.0	1.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001287	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	ENST00000382745.4	37	CCDS32361.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604958	0.87157	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.81996	-1.56;-1.56	4.7	4.7	0.59300	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.89364	0.6694	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.71184	0.957;0.972	D	0.90756	0.4661	10	0.87932	D	0	-44.6523	16.2084	0.82142	0.0:1.0:0.0:0.0	.	121;145	E9PDB9;P51798	.;CLCN7_HUMAN	Y	121;98;145;87	ENSP00000410907:D121Y;ENSP00000372193:D145Y	ENSP00000262318:D98Y	D	-	1	0	CLCN7	1450869	1.000000	0.71417	0.989000	0.46669	0.979000	0.70002	5.983000	0.70540	2.156000	0.67533	0.591000	0.81541	GAC	.		0.647	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
CLIP2	7461	ucsc.edu;bcgsc.ca	37	7	73753180	73753180	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:73753180C>A	ENST00000395060.1	+	2	524	c.524C>A	c.(523-525)aCg>aAg	p.T175K	CLIP2_ENST00000361545.5_Missense_Mutation_p.T175K|CLIP2_ENST00000223398.6_Missense_Mutation_p.T175K			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	175						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CATTCGGGCACGGCCACGCCC	0.672																																					p.T175K		.											.	CLIP2	93	0			c.C524A						.						24.0	23.0	23.0					7																	73753180		2196	4291	6487	SO:0001583	missense	7461	exon3			CGGGCACGGCCAC	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.524C>A	7.37:g.73753180C>A	ENSP00000378500:p.Thr175Lys	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_032421	O14527|O43611	Missense_Mutation	SNP	ENST00000395060.1	37	CCDS5569.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527472	0.44969	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.74526	-0.85;-0.85;-0.85	4.82	3.91	0.45181	Cytoskeleton-associated protein, Gly-rich domain (1);	0.282486	0.33691	N	0.004654	T	0.57902	0.2085	N	0.14661	0.345	0.37259	D	0.906902	B;B	0.33857	0.429;0.304	B;B	0.32393	0.145;0.042	T	0.64546	-0.6382	10	0.48119	T	0.1	-19.9742	13.7619	0.62971	0.0:0.8446:0.1554:0.0	.	175;175	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	K	175	ENSP00000223398:T175K;ENSP00000355151:T175K;ENSP00000378500:T175K	ENSP00000223398:T175K	T	+	2	0	CLIP2	73391116	0.996000	0.38824	0.995000	0.50966	0.922000	0.55478	4.017000	0.57167	1.229000	0.43630	0.456000	0.33151	ACG	.		0.672	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252556.1	NM_003388	
COASY	80347	ucsc.edu;bcgsc.ca	37	17	40717936	40717936	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:40717936T>C	ENST00000393818.2	+	9	2101	c.1645T>C	c.(1645-1647)Tgg>Cgg	p.W549R	COASY_ENST00000590958.1_Missense_Mutation_p.W578R|MLX_ENST00000346833.4_5'Flank|COASY_ENST00000420359.1_Missense_Mutation_p.W549R|COASY_ENST00000449624.1_Missense_Mutation_p.W254R|COASY_ENST00000421097.2_Missense_Mutation_p.W549R|MLX_ENST00000435881.2_5'Flank|MLX_ENST00000246912.4_5'Flank	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	549	DPCK.				cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GGAGAAAGCCTGGGCCCTCTT	0.612																																					p.W578R		.											.	COASY	115	0			c.T1732C						.						157.0	152.0	153.0					17																	40717936		2203	4300	6503	SO:0001583	missense	80347	exon11			AAAGCCTGGGCCC	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.1645T>C	17.37:g.40717936T>C	ENSP00000377406:p.Trp549Arg	Somatic	51.0	1.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001042532	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	ENST00000393818.2	37	CCDS11429.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.244567	0.79912	.	.	ENSG00000068120	ENST00000421097;ENST00000449624;ENST00000420359;ENST00000393818	T;T;T	0.49720	0.77;1.35;1.35	5.01	5.01	0.66863	.	0.066602	0.64402	D	0.000003	T	0.72170	0.3427	M	0.88031	2.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.78107	-0.2333	10	0.87932	D	0	-10.3702	12.7211	0.57142	0.0:0.0:0.0:1.0	.	578;549	Q13057-2;Q13057	.;COASY_HUMAN	R	578;254;549;549	ENSP00000407740:W254R;ENSP00000413338:W549R;ENSP00000377406:W549R	ENSP00000377406:W549R	W	+	1	0	COASY	37971462	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.657000	0.67996	2.124000	0.65301	0.459000	0.35465	TGG	.		0.612	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	NM_025233	
COL15A1	1306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	101778304	101778304	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr9:101778304C>T	ENST00000375001.3	+	11	1973	c.1550C>T	c.(1549-1551)cCc>cTc	p.P517L		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	517	4 X tandem repeats.|Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				ACAGAGGAGCCCCTCATCACA	0.592																																					p.P517L		.											.	COL15A1	96	0			c.C1550T						.						44.0	45.0	45.0					9																	101778304		2203	4300	6503	SO:0001583	missense	1306	exon11			AGGAGCCCCTCAT	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.1550C>T	9.37:g.101778304C>T	ENSP00000364140:p.Pro517Leu	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	30.0	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.567139	0.28003	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.90955	-2.76	3.1	3.1	0.35709	.	.	.	.	.	D	0.84356	0.5454	L	0.46157	1.445	0.18873	N	0.999984	P	0.37781	0.608	B	0.29862	0.108	T	0.74902	-0.3506	9	0.34782	T	0.22	-0.6635	9.8268	0.40916	0.0:1.0:0.0:0.0	.	517	P39059	COFA1_HUMAN	L	517;487	ENSP00000364140:P517L	ENSP00000364140:P517L	P	+	2	0	COL15A1	100818125	0.000000	0.05858	0.005000	0.12908	0.024000	0.10985	0.321000	0.19558	1.736000	0.51660	0.650000	0.86243	CCC	.		0.592	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
COL22A1	169044	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	139736874	139736874	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr8:139736874C>T	ENST00000303045.6	-	25	2677	c.2231G>A	c.(2230-2232)gGa>gAa	p.G744E	COL22A1_ENST00000435777.1_Missense_Mutation_p.G744E|COL22A1_ENST00000341807.4_5'Flank	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	744	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCAGGAGGTCCAGGCTTTCC	0.602										HNSCC(7;0.00092)																											p.G744E		.											.	COL22A1	103	0			c.G2231A						.						84.0	65.0	71.0					8																	139736874		2203	4300	6503	SO:0001583	missense	169044	exon25			GGAGGTCCAGGCT	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2231G>A	8.37:g.139736874C>T	ENSP00000303153:p.Gly744Glu	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	11.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.858074	0.32791	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.99532	-6.1;-6.1	4.72	4.72	0.59763	.	0.000000	0.47852	U	0.000212	D	0.99616	0.9860	M	0.89030	3	0.47341	D	0.999393	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97712	1.0191	10	0.87932	D	0	.	13.9041	0.63823	0.0:1.0:0.0:0.0	.	744;744	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	E	744;744;457	ENSP00000303153:G744E;ENSP00000387655:G744E	ENSP00000303153:G744E	G	-	2	0	COL22A1	139806056	0.979000	0.34478	0.875000	0.34327	0.178000	0.23041	3.651000	0.54431	2.542000	0.85734	0.655000	0.94253	GGA	.		0.602	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
CORO2B	10391	ucsc.edu;bcgsc.ca	37	15	68937510	68937510	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:68937510T>C	ENST00000566799.1	+	2	56	c.27T>C	c.(25-27)cgT>cgC	p.R9R	CORO2B_ENST00000540068.1_Silent_p.R4R|CORO2B_ENST00000543950.1_Silent_p.R4R|CORO2B_ENST00000261861.5_Silent_p.R4R			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	9					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						TGTCCTGGCGTCCGCAATACC	0.622																																					p.R9R		.											.	CORO2B	158	0			c.T27C						.						66.0	58.0	61.0					15																	68937510		2200	4298	6498	SO:0001819	synonymous_variant	10391	exon2			CTGGCGTCCGCAA	AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.27T>C	15.37:g.68937510T>C		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	43.0	5.0	NM_006091	A8K0W3|O94767|Q8TAN1	Silent	SNP	ENST00000566799.1	37	CCDS10229.2																																																																																			.		0.622	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
COX15	1355	ucsc.edu;bcgsc.ca	37	10	101487248	101487248	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:101487248C>A	ENST00000016171.5	-	3	395	c.345G>T	c.(343-345)gaG>gaT	p.E115D	CUTC_ENST00000493385.1_Intron|COX15_ENST00000370483.5_Missense_Mutation_p.E115D			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	115					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		CTTCCCATTCCTCTTGGCTTG	0.398																																					p.E115D		.											COX15,NS,carcinoma,-2	COX15	227	0			c.G345T						.						191.0	189.0	190.0					10																	101487248		2203	4300	6503	SO:0001583	missense	1355	exon3			CCATTCCTCTTGG	AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.345G>T	10.37:g.101487248C>A	ENSP00000016171:p.Glu115Asp	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_004376	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Missense_Mutation	SNP	ENST00000016171.5	37	CCDS7482.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.361636	0.41801	.	.	ENSG00000014919	ENST00000370483;ENST00000016171	D;D	0.83419	-1.72;-1.72	4.49	0.317	0.15861	Peptidase cysteine/serine, trypsin-like (1);	0.227915	0.42964	D	0.000629	T	0.77116	0.4083	M	0.64080	1.96	0.44579	D	0.997542	B;B	0.12013	0.005;0.001	B;B	0.18263	0.02;0.021	T	0.67841	-0.5566	10	0.37606	T	0.19	-9.5272	9.1997	0.37251	0.0:0.5646:0.0:0.4354	.	115;115	Q7KZN9-2;Q7KZN9	.;COX15_HUMAN	D	115	ENSP00000359514:E115D;ENSP00000016171:E115D	ENSP00000016171:E115D	E	-	3	2	COX15	101477238	0.988000	0.35896	1.000000	0.80357	0.997000	0.91878	0.187000	0.16998	0.193000	0.20303	0.563000	0.77884	GAG	.		0.398	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870	
CTSS	1520	broad.mit.edu;bcgsc.ca	37	1	150722588	150722588	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:150722588T>C	ENST00000368985.3	-	6	947	c.687A>G	c.(685-687)gaA>gaG	p.E229E	CTSS_ENST00000480760.1_Intron|CTSS_ENST00000448301.2_Silent_p.E179E	NM_001199739.1|NM_004079.4	NP_001186668.1|NP_004070.3	P25774	CATS_HUMAN	cathepsin S	229					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|basement membrane disassembly (GO:0034769)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of inflammatory response (GO:0050729)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	15	all_cancers(9;6.17e-52)|all_epithelial(9;9.7e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.00146)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|Epithelial(6;5.02e-21)|all cancers(9;1.28e-20)|OV - Ovarian serous cystadenocarcinoma(6;1.09e-14)|BRCA - Breast invasive adenocarcinoma(12;0.00501)|LUSC - Lung squamous cell carcinoma(543;0.171)			CATAAGGAAGTTCAGTGTACT	0.403																																					p.E229E		.											.	CTSS	90	0			c.A687G						.						115.0	93.0	100.0					1																	150722588		2203	4300	6503	SO:0001819	synonymous_variant	1520	exon6			AGGAAGTTCAGTG	M90696	CCDS968.1, CCDS55634.1	1q21	2008-02-05			ENSG00000163131	ENSG00000163131	3.4.22.27	"""Cathepsins"""	2545	protein-coding gene	gene with protein product		116845				1373132	Standard	NM_001199739		Approved		uc001evn.3	P25774	OTTHUMG00000035010	ENST00000368985.3:c.687A>G	1.37:g.150722588T>C		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	7.0	NM_004079	B4DWC9|D3DV05|Q5T5I0|Q6FHS5|Q9BUG3	Silent	SNP	ENST00000368985.3	37	CCDS968.1																																																																																			.		0.403	CTSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084737.1	NM_004079	
CTSZ	1522	ucsc.edu;bcgsc.ca	37	20	57570753	57570753	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr20:57570753T>C	ENST00000217131.5	-	6	981	c.863A>G	c.(862-864)tAc>tGc	p.Y288C		NM_001336.3	NP_001327.2	Q9UBR2	CATZ_HUMAN	cathepsin Z	288					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	10	all_lung(29;0.00711)		Colorectal(105;0.109)			GGCAAGGTTGTATCTGGCGCC	0.562																																					p.Y288C		.											.	CTSZ	226	0			c.A863G						.						207.0	152.0	170.0					20																	57570753		2203	4300	6503	SO:0001583	missense	1522	exon6			AGGTTGTATCTGG	AF032906	CCDS13474.1	20q13.32	2012-02-10			ENSG00000101160	ENSG00000101160		"""Cathepsins"""	2547	protein-coding gene	gene with protein product	"""cathepsin X"", ""carboxypeptidase LB"", ""cathepsin IV"", ""cathepsin B2"", ""cathepsin Y"", ""cathepsin Z1"", ""cysteine-type carboxypeptidase"", ""lysosomal carboxypeptidase B"""	603169				9642240	Standard	NM_001336		Approved	CTSX	uc002yai.2	Q9UBR2	OTTHUMG00000032858	ENST00000217131.5:c.863A>G	20.37:g.57570753T>C	ENSP00000217131:p.Tyr288Cys	Somatic	72.0	0.0		WXS	Illumina HiSeq	.	63.0	5.0	NM_001336	B2RC40|O75331|Q9UQV5|Q9UQV6	Missense_Mutation	SNP	ENST00000217131.5	37	CCDS13474.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.441612	0.63067	.	.	ENSG00000101160	ENST00000217131	T	0.44482	0.92	5.57	5.57	0.84162	Peptidase C1A, papain C-terminal (1);	0.213211	0.41938	D	0.000791	T	0.67813	0.2933	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.73212	-0.4054	10	0.56958	D	0.05	.	11.4775	0.50306	0.1345:0.0:0.0:0.8655	.	288	Q9UBR2	CATZ_HUMAN	C	288	ENSP00000217131:Y288C	ENSP00000217131:Y288C	Y	-	2	0	CTSZ	57004148	1.000000	0.71417	0.992000	0.48379	0.609000	0.37215	5.075000	0.64407	2.119000	0.64992	0.528000	0.53228	TAC	.		0.562	CTSZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079899.1	NM_001336	
CYP3A5	1577	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	99247719	99247721	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:99247719_99247721delAGG	ENST00000222982.4	-	12	1487_1489	c.1388_1390delCCT	c.(1387-1392)tccttc>ttc	p.S463del	CYP3A5_ENST00000343703.5_In_Frame_Del_p.S453del|CYP3A5_ENST00000339843.2_3'UTR	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	463					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CAAGGTTTGAAGGAGAAGTTCTG	0.35																																					p.463_464del		.											.	CYP3A5	90	0			c.1388_1390del						.																																			SO:0001651	inframe_deletion	1577	exon12			GTTTGAAGGAGAA	L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.1388_1390delCCT	7.37:g.99247719_99247721delAGG	ENSP00000222982:p.Ser463del	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	69.0	NM_000777	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	In_Frame_Del	DEL	ENST00000222982.4	37	CCDS5672.1																																																																																			.		0.350	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1		
DDX41	51428	ucsc.edu;bcgsc.ca	37	5	176939387	176939387	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:176939387C>A	ENST00000507955.1	-	15	2080	c.1557G>T	c.(1555-1557)cgG>cgT	p.R519R	DOK3_ENST00000312943.6_5'Flank|DOK3_ENST00000501403.2_5'Flank|DOK3_ENST00000357198.4_5'Flank|DDX41_ENST00000506965.1_5'Flank|DOK3_ENST00000377112.4_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	519	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TGCGGCCAATCCGGTGTACTG	0.607																																					p.R519R		.											.	DDX41	226	0			c.G1557T						.						81.0	77.0	78.0					5																	176939387		2203	4300	6503	SO:0001819	synonymous_variant	51428	exon15			GCCAATCCGGTGT	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1557G>T	5.37:g.176939387C>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_016222	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Silent	SNP	ENST00000507955.1	37	CCDS4427.1																																																																																			.		0.607	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	NM_016222	
DEF6	50619	ucsc.edu;bcgsc.ca	37	6	35289121	35289121	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:35289121G>T	ENST00000316637.5	+	11	1835	c.1830G>T	c.(1828-1830)ggG>ggT	p.G610G	DEF6_ENST00000542066.1_Silent_p.G355G	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	610						cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						TCAATGGTGGGGATGAGGCTC	0.577																																					p.G610G		.											.	DEF6	227	0			c.G1830T						.						64.0	71.0	69.0					6																	35289121		2203	4300	6503	SO:0001819	synonymous_variant	50619	exon11			TGGTGGGGATGAG	AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.1830G>T	6.37:g.35289121G>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_022047	Q86VF4	Silent	SNP	ENST00000316637.5	37	CCDS4802.1																																																																																			.		0.577	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040276.1	NM_022047	
DEFA6	1671	ucsc.edu;bcgsc.ca	37	8	6782381	6782381	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr8:6782381A>G	ENST00000297436.2	-	2	302	c.262T>C	c.(262-264)Tgc>Cgc	p.C88R		NM_001926.3	NP_001917.1	Q01524	DEF6_HUMAN	defensin, alpha 6, Paneth cell-specific	88					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)				lung(4)	4			STAD - Stomach adenocarcinoma(24;0.0322)	COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		ATGACAGTGCAGGTCCCATAG	0.428																																					p.C88R		.											.	DEFA6	90	0			c.T262C						.						116.0	109.0	111.0					8																	6782381		2203	4300	6503	SO:0001583	missense	1671	exon2			CAGTGCAGGTCCC	M98331	CCDS5960.1	8p23.1	2007-02-20			ENSG00000164822	ENSG00000164822		"""Defensins, alpha"""	2765	protein-coding gene	gene with protein product		600471				8417977	Standard	NM_001926		Approved	HD-6, DEF6	uc003wqt.3	Q01524	OTTHUMG00000149984	ENST00000297436.2:c.262T>C	8.37:g.6782381A>G	ENSP00000297436:p.Cys88Arg	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_001926	Q6EZF9	Missense_Mutation	SNP	ENST00000297436.2	37	CCDS5960.1	.	.	.	.	.	.	.	.	.	.	.	11.28	1.592250	0.28357	.	.	ENSG00000164822	ENST00000297436	D	0.94046	-3.34	1.84	1.84	0.25277	Beta defensin/Neutrophil defensin (1);Mammalian defensins (2);	.	.	.	.	D	0.95762	0.8621	M	0.85197	2.74	0.23969	N	0.99631	D	0.71674	0.998	D	0.68621	0.959	D	0.87579	0.2483	9	0.87932	D	0	.	5.6915	0.17833	1.0:0.0:0.0:0.0	.	88	Q01524	DEF6_HUMAN	R	88	ENSP00000297436:C88R	ENSP00000297436:C88R	C	-	1	0	DEFA6	6769791	0.014000	0.17966	0.012000	0.15200	0.074000	0.17049	0.817000	0.27281	1.083000	0.41159	0.421000	0.28195	TGC	.		0.428	DEFA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206739.1	NM_001926	
DENND4C	55667	broad.mit.edu;bcgsc.ca	37	9	19360349	19360349	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr9:19360349G>T	ENST00000380432.2	+	24	4446	c.4413G>T	c.(4411-4413)caG>caT	p.Q1471H	DENND4C_ENST00000434457.2_Missense_Mutation_p.Q1756H|DENND4C_ENST00000602925.1_Missense_Mutation_p.Q1707H			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1471					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						AAGGTGATCAGGTGATTCATA	0.418																																					p.Q1707H		.											.	DENND4C	92	0			c.G5121T						.						166.0	155.0	158.0					9																	19360349		2203	4300	6503	SO:0001583	missense	55667	exon28			TGATCAGGTGATT	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4413G>T	9.37:g.19360349G>T	ENSP00000369797:p.Gln1471His	Somatic	117.0	1.0		WXS	Illumina HiSeq	Phase_I	168.0	8.0	NM_017925	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	37		.	.	.	.	.	.	.	.	.	.	G	8.604	0.887450	0.17540	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427;ENST00000361024	T;T	0.23348	1.92;1.91	5.89	-2.84	0.05751	.	0.405775	0.30464	N	0.009572	T	0.12646	0.0307	L	0.35487	1.065	0.39846	D	0.973175	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.15052	0.007;0.012;0.001	T	0.12734	-1.0536	9	.	.	.	-3.2891	3.9314	0.09286	0.5948:0.124:0.1561:0.1251	.	801;653;1471	B7Z660;Q5VZ89-3;Q5VZ89	.;.;DEN4C_HUMAN	H	1471;944;653;801;944;653;468	ENSP00000305795:Q944H;ENSP00000443804:Q801H	.	Q	+	3	2	DENND4C	19350349	0.998000	0.40836	0.984000	0.44739	0.981000	0.71138	0.487000	0.22356	-0.372000	0.07992	-0.140000	0.14226	CAG	.		0.418	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925	
DHODH	1723	ucsc.edu;bcgsc.ca	37	16	72045982	72045982	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:72045982G>A	ENST00000219240.4	+	2	76	c.55G>A	c.(55-57)Gga>Aga	p.G19R	DHODH_ENST00000572887.1_Missense_Mutation_p.G19R	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	19			G -> E (in POADS). {ECO:0000269|PubMed:19915526}.		'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	CATCCTGGGGGGAGGAGGACT	0.607																																					p.G19R		.											.	DHODH	227	0			c.G55A						.						79.0	84.0	82.0					16																	72045982		2115	4226	6341	SO:0001583	missense	1723	exon2			CTGGGGGGAGGAG		CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.55G>A	16.37:g.72045982G>A	ENSP00000219240:p.Gly19Arg	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_001361	A8K8C8|Q6P176	Missense_Mutation	SNP	ENST00000219240.4	37	CCDS42192.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.799897	0.31869	.	.	ENSG00000102967	ENST00000219240	D	0.84800	-1.9	4.42	4.42	0.53409	.	0.113194	0.64402	D	0.000015	D	0.89466	0.6723	L	0.61218	1.895	0.58432	D	0.999993	P	0.49358	0.923	P	0.57502	0.822	D	0.90434	0.4426	10	0.59425	D	0.04	-15.0289	16.1845	0.81939	0.0:0.0:1.0:0.0	.	19	Q02127	PYRD_HUMAN	R	19	ENSP00000219240:G19R	ENSP00000219240:G19R	G	+	1	0	DHODH	70603483	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	5.597000	0.67577	2.292000	0.77174	0.563000	0.77884	GGA	.		0.607	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001361	
DHX38	9785	ucsc.edu;bcgsc.ca	37	16	72142233	72142233	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:72142233C>A	ENST00000268482.3	+	22	3581	c.3072C>A	c.(3070-3072)tcC>tcA	p.S1024S	DHX38_ENST00000536867.1_Silent_p.S336S	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	1024					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				ATAATTACTCCACCATCTGGT	0.488																																					p.S1024S	Melanoma(97;711 1442 7855 13832 28836)	.											.	DHX38	227	0			c.C3072A						.						118.0	99.0	105.0					16																	72142233		2198	4300	6498	SO:0001819	synonymous_variant	9785	exon22			TTACTCCACCATC	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.3072C>A	16.37:g.72142233C>A		Somatic	68.0	0.0		WXS	Illumina HiSeq	.	40.0	6.0	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	ENST00000268482.3	37	CCDS10907.1																																																																																			.		0.488	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
DHX9	1660	ucsc.edu;bcgsc.ca	37	1	182849641	182849641	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:182849641C>T	ENST00000367549.3	+	22	2632	c.2522C>T	c.(2521-2523)gCa>gTa	p.A841V	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	841					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GAGCTTGATGCATTAGATGCC	0.393																																					p.A841V	Colon(69;210 1162 3697 13559 39565)	.											.	DHX9	92	0			c.C2522T						.						106.0	101.0	103.0					1																	182849641		1915	4131	6046	SO:0001583	missense	1660	exon22			TTGATGCATTAGA	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.2522C>T	1.37:g.182849641C>T	ENSP00000356520:p.Ala841Val	Somatic	79.0	0.0		WXS	Illumina HiSeq	.	40.0	5.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	33	5.279491	0.95489	.	.	ENSG00000135829	ENST00000367549	T	0.55413	0.52	5.55	5.55	0.83447	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.80088	0.4559	M	0.92880	3.355	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.73380	0.964;0.98	D	0.84618	0.0682	10	0.72032	D	0.01	.	19.5106	0.95140	0.0:1.0:0.0:0.0	.	120;841	B3KU66;Q08211	.;DHX9_HUMAN	V	841	ENSP00000356520:A841V	ENSP00000356520:A841V	A	+	2	0	DHX9	181116264	1.000000	0.71417	0.971000	0.41717	0.996000	0.88848	7.229000	0.78088	2.587000	0.87381	0.650000	0.86243	GCA	.		0.393	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
DISP2	85455	ucsc.edu;bcgsc.ca	37	15	40659780	40659780	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:40659780G>T	ENST00000267889.3	+	8	1554	c.1467G>T	c.(1465-1467)acG>acT	p.T489T	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	489	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TCCAGGACACGGTGTACCCCT	0.627																																					p.T489T		.											.	DISP2	92	0			c.G1467T						.						109.0	102.0	104.0					15																	40659780		2203	4300	6503	SO:0001819	synonymous_variant	85455	exon8			GGACACGGTGTAC	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.1467G>T	15.37:g.40659780G>T		Somatic	67.0	0.0		WXS	Illumina HiSeq	.	39.0	5.0	NM_033510	Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	CCDS10056.1																																																																																			.		0.627	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
DNAH8	1769	ucsc.edu;bcgsc.ca	37	6	38690904	38690904	+	5'UTR	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:38690904C>A	ENST00000359357.3	+	0	7				DNAH8_ENST00000449981.2_Silent_p.R107R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GCCGTCTTCCCGGAGGTCCTC	0.493																																					p.R107R		.											.	DNAH8	615	0			c.C319A						.						102.0	93.0	96.0					6																	38690904		876	1991	2867	SO:0001623	5_prime_UTR_variant	1769	exon2			TCTTCCCGGAGGT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.-248C>A	6.37:g.38690904C>A		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	60.0	6.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	ENST00000359357.3	37																																																																																				.		0.493	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
CUL9	23113	ucsc.edu;bcgsc.ca	37	6	43193533	43193533	+	IGR	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:43193533C>A	ENST00000252050.4	+	0	7780				RP3-330M21.5_ENST00000500590.1_RNA|DNPH1_ENST00000393987.2_3'UTR|DNPH1_ENST00000230431.6_Missense_Mutation_p.D155Y	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9						microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AAGTATCGATCCAGCAGGGCC	0.557																																					p.D155Y		.											.	.	.	0			c.G463T						.						99.0	79.0	86.0					6																	43193533		2203	4300	6503	SO:0001628	intergenic_variant	10591	exon4			ATCGATCCAGCAG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723		6.37:g.43193533C>A		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	31.0	5.0	NM_006443	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276638	0.59758	.	.	ENSG00000112667	ENST00000230431;ENST00000509253	.	.	.	4.86	3.99	0.46301	.	0.239336	0.33005	N	0.005381	T	0.25606	0.0623	L	0.27053	0.805	0.80722	D	1	P	0.41131	0.739	B	0.39217	0.294	T	0.19516	-1.0303	9	0.87932	D	0	-0.0287	11.2595	0.49074	0.0:0.8167:0.1833:0.0	.	155	O43598	RCL_HUMAN	Y	155;224	.	ENSP00000230431:D155Y	D	-	1	0	C6orf108	43301511	1.000000	0.71417	0.485000	0.27403	0.479000	0.33129	3.223000	0.51231	1.249000	0.43950	0.462000	0.41574	GAT	.		0.557	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
DOCK1	1793	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	129141983	129141983	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:129141983G>A	ENST00000280333.6	+	31	3243	c.3134G>A	c.(3133-3135)aGt>aAt	p.S1045N	DOCK1_ENST00000484400.1_3'UTR	NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1045					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AATTTTTCAAGTGCCAAGAGA	0.428																																					p.S1045N		.											.	DOCK1	698	0			c.G3134A						.						85.0	77.0	80.0					10																	129141983		1850	4103	5953	SO:0001583	missense	1793	exon31			TTTCAAGTGCCAA	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.3134G>A	10.37:g.129141983G>A	ENSP00000280333:p.Ser1045Asn	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	6.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	13.04	2.118813	0.37436	.	.	ENSG00000150760	ENST00000280333	T	0.22539	1.95	4.55	4.55	0.56014	.	0.095490	0.64402	D	0.000001	T	0.20455	0.0492	L	0.39898	1.24	0.50171	D	0.999859	B;P;P	0.38922	0.305;0.651;0.61	B;B;B	0.38616	0.191;0.212;0.277	T	0.03130	-1.1069	10	0.26408	T	0.33	.	17.1745	0.86838	0.0:0.0:1.0:0.0	.	1045;1111;1045	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	N	1045	ENSP00000280333:S1045N	ENSP00000280333:S1045N	S	+	2	0	DOCK1	129031973	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.358000	0.66064	2.371000	0.80710	0.456000	0.33151	AGT	.		0.428	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
DOCK5	80005	ucsc.edu;bcgsc.ca	37	8	25174644	25174644	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr8:25174644G>A	ENST00000276440.7	+	14	1484	c.1440G>A	c.(1438-1440)ttG>ttA	p.L480L		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	480	DHR-1.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GCAAGCTCTTGGAGGTGCGCG	0.493																																					p.L480L	Pancreas(145;34 1887 3271 10937 30165)	.											.	DOCK5	71	0			c.G1440A						.						233.0	207.0	216.0					8																	25174644		2203	4300	6503	SO:0001819	synonymous_variant	80005	exon14			GCTCTTGGAGGTG		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.1440G>A	8.37:g.25174644G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Silent	SNP	ENST00000276440.7	37	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	G	0.681	-0.798064	0.02862	.	.	ENSG00000147459	ENST00000444569	.	.	.	5.25	-7.3	0.01446	.	.	.	.	.	T	0.52565	0.1742	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59397	-0.7462	4	.	.	.	.	11.9047	0.52703	0.7021:0.0:0.21:0.0879	.	.	.	.	R	252	.	.	G	+	1	0	DOCK5	25230561	0.982000	0.34865	0.101000	0.21167	0.053000	0.15095	0.214000	0.17541	-1.090000	0.03069	0.558000	0.71614	GGA	.		0.493	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
DOCK6	57572	ucsc.edu;bcgsc.ca	37	19	11346345	11346345	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:11346345T>C	ENST00000294618.7	-	21	2494	c.2483A>G	c.(2482-2484)cAc>cGc	p.H828R	DOCK6_ENST00000319867.7_Missense_Mutation_p.H132R|C19orf80_ENST00000591200.1_5'Flank|RN7SL298P_ENST00000581369.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	828					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CTGTGGGCAGTGACCGCGGGC	0.617																																					p.H828R		.											.	DOCK6	93	0			c.A2483G						.						19.0	24.0	22.0					19																	11346345		2114	4235	6349	SO:0001583	missense	57572	exon21			GGGCAGTGACCGC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2483A>G	19.37:g.11346345T>C	ENSP00000294618:p.His828Arg	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	T	0.596	-0.830896	0.02713	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.27402	1.67;1.67	4.96	3.94	0.45596	.	0.141857	0.53938	D	0.000058	T	0.07369	0.0186	N	0.01277	-0.915	0.28995	N	0.887801	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35943	-0.9768	10	0.02654	T	1	-28.6452	3.6623	0.08244	0.0:0.1693:0.2035:0.6272	.	132;828	C9IZV6;Q96HP0	.;DOCK6_HUMAN	R	828;132	ENSP00000294618:H828R;ENSP00000321556:H132R	ENSP00000294618:H828R	H	-	2	0	DOCK6	11207345	1.000000	0.71417	1.000000	0.80357	0.332000	0.28634	2.831000	0.48144	1.875000	0.54330	0.454000	0.30748	CAC	.		0.617	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
DPYSL5	56896	ucsc.edu;bcgsc.ca	37	2	27162930	27162930	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:27162930C>A	ENST00000288699.6	+	9	1137	c.979C>A	c.(979-981)Cgg>Agg	p.R327R	DPYSL5_ENST00000401478.1_Silent_p.R327R	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	327					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCAGATCACCGGCCTTTCAC	0.532																																					p.R327R		.											.	DPYSL5	92	0			c.C979A						.						160.0	146.0	151.0					2																	27162930		2203	4300	6503	SO:0001819	synonymous_variant	56896	exon9			GATCACCGGCCTT	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.979C>A	2.37:g.27162930C>A		Somatic	74.0	0.0		WXS	Illumina HiSeq	.	69.0	6.0	NM_001253724	Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	ENST00000288699.6	37	CCDS1730.1																																																																																			.		0.532	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
DUSP27	92235	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167096471	167096471	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:167096471C>A	ENST00000361200.2	+	6	2269	c.2103C>A	c.(2101-2103)tcC>tcA	p.S701S	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Silent_p.S701S|DUSP27_ENST00000443333.1_Silent_p.S701S			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	701					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GTTCAACCTCCAACCCCACCA	0.587																																					p.S701S		.											.	DUSP27	71	0			c.C2103A						.						58.0	62.0	61.0					1																	167096471		2203	4300	6503	SO:0001819	synonymous_variant	92235	exon5			AACCTCCAACCCC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2103C>A	1.37:g.167096471C>A		Somatic	38.0	1.0		WXS	Illumina HiSeq	Phase_I	29.0	6.0	NM_001080426	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	CCDS30932.1																																																																																			.		0.587	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
DUSP6	1848	ucsc.edu;bcgsc.ca	37	12	89745641	89745641	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:89745641G>T	ENST00000279488.7	-	1	1407	c.176C>A	c.(175-177)cCg>cAg	p.P59Q	DUSP6_ENST00000547140.1_5'Flank|DUSP6_ENST00000308385.6_Missense_Mutation_p.P59Q|DUSP6_ENST00000547291.1_5'Flank	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	59	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						CATGATGCCCGGGATGGCCAC	0.692																																					p.P59Q	Colon(132;3456 5224)	.											.	DUSP6	846	0			c.C176A						.						23.0	20.0	21.0					12																	89745641		2196	4291	6487	SO:0001583	missense	1848	exon1			ATGCCCGGGATGG	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.176C>A	12.37:g.89745641G>T	ENSP00000279488:p.Pro59Gln	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001946	O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	37	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	G	31	5.077015	0.94000	.	.	ENSG00000139318	ENST00000279488;ENST00000308385;ENST00000548755	T;T;T	0.46451	0.87;0.87;0.87	5.24	5.24	0.73138	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	T	0.70859	0.3272	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	1.0;1.0	T	0.75795	-0.3192	10	0.72032	D	0.01	.	19.0263	0.92934	0.0:0.0:1.0:0.0	.	59;59	Q16828-2;Q16828	.;DUS6_HUMAN	Q	59	ENSP00000279488:P59Q;ENSP00000307835:P59Q;ENSP00000446858:P59Q	ENSP00000279488:P59Q	P	-	2	0	DUSP6	88269772	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.662000	0.83803	2.723000	0.93209	0.655000	0.94253	CCG	.		0.692	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
DYNLT3	6990	ucsc.edu;bcgsc.ca	37	X	37701140	37701140	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:37701140C>A	ENST00000378578.4	-	3	217	c.91G>T	c.(91-93)Ggt>Tgt	p.G31C	DYNLT3_ENST00000378581.3_Missense_Mutation_p.G31C|DYNLT3_ENST00000432389.2_Missense_Mutation_p.G37C|TM4SF2_ENST00000465127.1_Intron	NM_006520.2	NP_006511.1	P51808	DYLT3_HUMAN	dynein, light chain, Tctex-type 3	31					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)|transport (GO:0006810)	cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	motor activity (GO:0003774)			endometrium(1)|lung(1)|skin(1)	3						TCTTCACCACCTAAAACCCCA	0.353																																					p.G31C		.											.	DYNLT3	130	0			c.G91T						.						118.0	93.0	101.0					X																	37701140		2202	4300	6502	SO:0001583	missense	6990	exon3			CACCACCTAAAAC	U02556	CCDS14243.1	Xp21	2013-01-18	2005-11-25	2005-11-25	ENSG00000165169	ENSG00000165169		"""Cytoplasmic dyneins"""	11694	protein-coding gene	gene with protein product		300302	"""t-complex-associated-testis-expressed 1-like"""	TCTE1L		8004092	Standard	NM_006520		Approved	TCTEX1L	uc004dds.3	P51808	OTTHUMG00000033172	ENST00000378578.4:c.91G>T	X.37:g.37701140C>A	ENSP00000367841:p.Gly31Cys	Somatic	95.0	0.0		WXS	Illumina HiSeq	.	47.0	5.0	NM_006520	Q6ICS3	Missense_Mutation	SNP	ENST00000378578.4	37	CCDS14243.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659277	0.67586	.	.	ENSG00000165169	ENST00000378581;ENST00000378578;ENST00000432389	T;T;T	0.33438	1.41;1.41;1.41	5.4	4.51	0.55191	.	0.100604	0.64402	D	0.000002	T	0.61664	0.2365	M	0.91818	3.245	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.69146	-0.5222	10	0.72032	D	0.01	-12.3652	11.7545	0.51868	0.1765:0.8235:0.0:0.0	.	31	P51808	DYLT3_HUMAN	C	31;31;37	ENSP00000367844:G31C;ENSP00000367841:G31C;ENSP00000402695:G37C	ENSP00000367841:G31C	G	-	1	0	DYNLT3	37586084	1.000000	0.71417	0.251000	0.24312	0.994000	0.84299	5.064000	0.64338	1.097000	0.41459	0.513000	0.50165	GGT	.		0.353	DYNLT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080876.1	NM_006520	
EFEMP1	2202	broad.mit.edu;bcgsc.ca	37	2	56104946	56104946	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:56104946G>T	ENST00000394555.2	-	6	1130	c.695C>A	c.(694-696)cCa>cAa	p.P232Q	EFEMP1_ENST00000394554.1_Missense_Mutation_p.P232Q|EFEMP1_ENST00000424836.2_Intron|EFEMP1_ENST00000355426.3_Missense_Mutation_p.P232Q	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	232	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AAATGAGCCTGGTGTATTCAC	0.418																																					p.P232Q	GBM(92;934 1319 7714 28760 40110)	.											.	EFEMP1	520	0			c.C695A						.						195.0	181.0	186.0					2																	56104946		2203	4300	6503	SO:0001583	missense	2202	exon6			GAGCCTGGTGTAT	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.695C>A	2.37:g.56104946G>T	ENSP00000378058:p.Pro232Gln	Somatic	70.0	1.0		WXS	Illumina HiSeq	Phase_I	86.0	7.0	NM_001039349	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	37	CCDS1857.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033045	0.54896	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000355426	D;D;D	0.91521	-2.86;-2.86;-2.86	5.65	5.65	0.86999	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000006	D	0.87144	0.6104	L	0.58101	1.795	0.80722	D	1	B	0.27229	0.172	B	0.16289	0.015	T	0.82957	-0.0199	10	0.27082	T	0.32	.	12.995	0.58642	0.0735:0.0:0.9265:0.0	.	232	Q12805	FBLN3_HUMAN	Q	232;232;88;232	ENSP00000378058:P232Q;ENSP00000378057:P232Q;ENSP00000347596:P232Q	ENSP00000347596:P232Q	P	-	2	0	EFEMP1	55958450	1.000000	0.71417	0.984000	0.44739	0.964000	0.63967	4.587000	0.60991	2.672000	0.90937	0.655000	0.94253	CCA	.		0.418	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
ELF5	2001	ucsc.edu;bcgsc.ca	37	11	34527177	34527177	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:34527177T>C	ENST00000312319.2	-	2	379	c.150A>G	c.(148-150)acA>acG	p.T50T	ELF5_ENST00000257832.2_Splice_Site_p.T40T|ELF5_ENST00000429939.2_Splice_Site_p.T40T|ELF5_ENST00000528709.1_5'UTR|ELF5_ENST00000532417.1_Splice_Site_p.T40T	NM_001243081.1|NM_198381.1	NP_001230010.1|NP_938195.1	Q9UKW6	ELF5_HUMAN	E74-like factor 5 (ets domain transcription factor)	50	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|ectoderm development (GO:0007398)|mammary gland epithelial cell differentiation (GO:0060644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(4)|skin(1)	5		Acute lymphoblastic leukemia(5;0.0087)|all_hematologic(20;0.0384)				TGTACGCACCTGTCTGATGCT	0.562																																					p.T50T	Melanoma(61;202 1660 4348 21594)	.											.	ELF5	227	0			c.A150G						.						167.0	135.0	146.0					11																	34527177		2202	4298	6500	SO:0001630	splice_region_variant	2001	exon2			CGCACCTGTCTGA	AF049703	CCDS7892.1, CCDS7893.1, CCDS58129.1, CCDS73273.1	11p13-p12	2008-05-14			ENSG00000135374	ENSG00000135374			3320	protein-coding gene	gene with protein product		605169				9840936	Standard	NM_001422		Approved		uc001mvp.2	Q9UKW6	OTTHUMG00000166451	ENST00000312319.2:c.151+1A>G	11.37:g.34527177T>C		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_198381	A6XAE6|A8K452|O95175|Q8N2K9|Q96QY3|Q9UKW5	Silent	SNP	ENST00000312319.2	37	CCDS7892.1																																																																																			.		0.562	ELF5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389845.1	NM_198381	Silent
EMC8	10328	ucsc.edu;bcgsc.ca	37	16	85832837	85832837	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:85832837G>T	ENST00000253457.3	-	1	309	c.65C>A	c.(64-66)cCg>cAg	p.P22Q	COX4I1_ENST00000564903.1_5'Flank|COX4I1_ENST00000561569.1_5'Flank|COX4I1_ENST00000253452.2_5'Flank|COX4I1_ENST00000562336.1_5'Flank|EMC8_ENST00000435200.2_Missense_Mutation_p.P22Q|COX4I1_ENST00000568794.1_5'Flank	NM_006067.4	NP_006058.1	O43402	EMC8_HUMAN	ER membrane protein complex subunit 8	22						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											GGCGCAGTGCGGGTACTTGGC	0.716																																					p.P22Q		.											.	.	.	0			c.C65A						.						26.0	26.0	26.0					16																	85832837		2198	4298	6496	SO:0001583	missense	10328	exon1			CAGTGCGGGTACT	AF005888	CCDS10954.1, CCDS45541.1	16q24	2012-05-30	2012-05-30	2012-05-30	ENSG00000131148	ENSG00000131148			7864	protein-coding gene	gene with protein product	"""family with sequence similarity 158, member B"""	604886	"""chromosome 16 open reading frame 4"", ""neighbor of COX4"", ""chromosome 16 open reading frame 2"", ""COX4 neighbor"""	C16orf4, NOC4, C16orf2, COX4NB		10337626, 22119785	Standard	NM_006067		Approved	FAM158B	uc002fjd.3	O43402	OTTHUMG00000137647	ENST00000253457.3:c.65C>A	16.37:g.85832837G>T	ENSP00000253457:p.Pro22Gln	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	17.0	4.0	NM_006067	C9JB21	Missense_Mutation	SNP	ENST00000253457.3	37	CCDS10954.1	.	.	.	.	.	.	.	.	.	.	G	33	5.238042	0.95240	.	.	ENSG00000131148	ENST00000253457;ENST00000435200	T;T	0.53640	0.61;0.61	5.43	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.71896	0.3394	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77370	-0.2613	10	0.62326	D	0.03	-24.6077	14.2043	0.65725	0.0721:0.0:0.9279:0.0	.	22	O43402	CX4NB_HUMAN	Q	22	ENSP00000253457:P22Q;ENSP00000391730:P22Q	ENSP00000253457:P22Q	P	-	2	0	COX4NB	84390338	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	8.853000	0.92222	1.289000	0.44618	0.650000	0.86243	CCG	.		0.716	EMC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269099.1	NM_006067	
EML4	27436	broad.mit.edu;bcgsc.ca	37	2	42490410	42490410	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:42490410C>A	ENST00000318522.5	+	5	867	c.605C>A	c.(604-606)cCc>cAc	p.P202H	EML4_ENST00000402711.2_Missense_Mutation_p.P144H|EML4_ENST00000401738.3_Missense_Mutation_p.P202H	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	202					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						CCTTCAACACCCAAATTAATA	0.323			T	ALK	NSCLC																																p.P202H		.		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	.	EML4	3734	0			c.C605A						.						86.0	83.0	84.0					2																	42490410		2203	4300	6503	SO:0001583	missense	27436	exon5			CAACACCCAAATT	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.605C>A	2.37:g.42490410C>A	ENSP00000320663:p.Pro202His	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	10.0	NM_019063	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	ENST00000318522.5	37	CCDS1807.1	.	.	.	.	.	.	.	.	.	.	c	15.85	2.955644	0.53293	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738	T;T;D	0.97752	1.19;1.18;-4.52	5.36	5.36	0.76844	.	0.532201	0.17791	N	0.161884	D	0.93989	0.8075	N	0.08118	0	0.80722	D	1	B;B	0.31989	0.08;0.35	B;B	0.32928	0.139;0.155	D	0.92723	0.6193	10	0.59425	D	0.04	-2.4835	19.1108	0.93315	0.0:1.0:0.0:0.0	.	144;202	B5MCW9;Q9HC35	.;EMAL4_HUMAN	H	202;144;202	ENSP00000320663:P202H;ENSP00000385059:P144H;ENSP00000384939:P202H	ENSP00000320663:P202H	P	+	2	0	EML4	42343914	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	5.331000	0.65905	2.527000	0.85204	0.558000	0.71614	CCC	.		0.323	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063	
EPHA10	284656	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	38192825	38192825	+	Missense_Mutation	SNP	G	G	A	rs34409053	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:38192825G>A	ENST00000373048.4	-	8	1720	c.1721C>T	c.(1720-1722)tCg>tTg	p.S574L	EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000330210.7_Missense_Mutation_p.S69L|EPHA10_ENST00000427468.2_Missense_Mutation_p.S574L|EPHA10_ENST00000540011.1_Missense_Mutation_p.S69L	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	574					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GAGGAGGGCCGAGATGGTCAC	0.637													G|||	73	0.0145767	0.0545	0.0014	5008	,	,		19486	0.0		0.0	False		,,,				2504	0.0				p.S574L		.											.	EPHA10	1246	0			c.C1721T						.	G	LEU/SER	188,3970		7,174,1898	61.0	75.0	70.0		1721	4.3	1.0	1	dbSNP_126	70	0,8414		0,0,4207	yes	missense	EPHA10	NM_001099439.1	145	7,174,6105	AA,AG,GG		0.0,4.5214,1.4954	benign	574/1009	38192825	188,12384	2079	4207	6286	SO:0001583	missense	284656	exon8			AGGGCCGAGATGG	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.1721C>T	1.37:g.38192825G>A	ENSP00000362139:p.Ser574Leu	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	21.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	37	CCDS41305.1	20	0.009157509157509158	20	0.04065040650406504	0	0.0	0	0.0	0	0.0	G	16.69	3.193481	0.58017	0.045214	0.0	ENSG00000183317	ENST00000330210;ENST00000427468;ENST00000540011;ENST00000373048	T;T;T;T	0.11063	2.81;2.81;2.81;2.81	5.27	4.3	0.51218	.	0.000000	0.35615	N	0.003092	T	0.01353	0.0044	M	0.64997	1.995	0.25272	N	0.989509	P	0.35745	0.518	B	0.26517	0.07	T	0.21314	-1.0249	10	0.34782	T	0.22	.	8.2683	0.31829	0.0861:0.1587:0.7552:0.0	rs34409053	574	Q5JZY3	EPHAA_HUMAN	L	69;574;69;574	ENSP00000330379:S69L;ENSP00000397746:S574L;ENSP00000441822:S69L;ENSP00000362139:S574L	ENSP00000330379:S69L	S	-	2	0	EPHA10	37965412	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	4.197000	0.58413	2.468000	0.83385	0.462000	0.41574	TCG	G|0.991;A|0.009		0.637	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
EPS8	2059	broad.mit.edu;bcgsc.ca	37	12	15784587	15784587	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:15784587C>A	ENST00000281172.5	-	18	2269	c.1833G>T	c.(1831-1833)atG>atT	p.M611I	EPS8_ENST00000542903.1_Missense_Mutation_p.M351I|EPS8_ENST00000543612.1_Missense_Mutation_p.M611I|EPS8_ENST00000540613.1_Missense_Mutation_p.M351I|EPS8_ENST00000543523.1_Missense_Mutation_p.M611I	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	611					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		GGCCATACTCCATCCTTTGTT	0.423																																					p.M611I		.											.	EPS8	94	0			c.G1833T						.						66.0	54.0	58.0					12																	15784587		2203	4300	6503	SO:0001583	missense	2059	exon18			ATACTCCATCCTT	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1833G>T	12.37:g.15784587C>A	ENSP00000281172:p.Met611Ile	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	6.0	NM_004447	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	ENST00000281172.5	37	CCDS31753.1	.	.	.	.	.	.	.	.	.	.	C	9.712	1.157370	0.21454	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903;ENST00000543223	T;T;T;T;T	0.06449	3.44;3.44;3.44;3.3;3.3	5.75	4.85	0.62838	.	0.434011	0.25130	N	0.032912	T	0.04272	0.0118	N	0.14661	0.345	0.24539	N	0.994072	B	0.09022	0.002	B	0.08055	0.003	T	0.37753	-0.9692	10	0.31617	T	0.26	-5.1074	10.0123	0.41995	0.0:0.7954:0.0:0.2046	.	611	Q12929	EPS8_HUMAN	I	611;611;611;351;351;611	ENSP00000441867:M611I;ENSP00000281172:M611I;ENSP00000442388:M611I;ENSP00000441888:M351I;ENSP00000437806:M351I	ENSP00000281172:M611I	M	-	3	0	EPS8	15675854	0.988000	0.35896	1.000000	0.80357	0.998000	0.95712	0.547000	0.23299	1.399000	0.46721	0.650000	0.86243	ATG	.		0.423	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
ERBB4	2066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	212615384	212615384	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:212615384G>T	ENST00000342788.4	-	5	912	c.602C>A	c.(601-603)aCa>aAa	p.T201K	ERBB4_ENST00000484474.1_5'UTR|ERBB4_ENST00000402597.1_Missense_Mutation_p.T201K|ERBB4_ENST00000436443.1_Missense_Mutation_p.T201K	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	201	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T201K(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ATGATTTTCTGTGGGTCCCCA	0.458										TSP Lung(8;0.080)																											p.T201K		.											.	ERBB4	1461	1	Substitution - Missense(1)	endometrium(1)	c.C602A						.						136.0	113.0	121.0					2																	212615384		2203	4300	6503	SO:0001583	missense	2066	exon5			TTTTCTGTGGGTC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.602C>A	2.37:g.212615384G>T	ENSP00000342235:p.Thr201Lys	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	24.0	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.73|17.73	3.462532|3.462532	0.63513|0.63513	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597	.|D;D;D	.|0.82081	.|-1.57;-1.57;-1.57	5.58|5.58	5.58|5.58	0.84498|0.84498	.|Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	.|0.211367	.|0.49916	.|D	.|0.000132	T|T	0.69557|0.69557	0.3124|0.3124	N|N	0.08118|0.08118	0|0	0.43559|0.43559	D|D	0.995878|0.995878	.|B;B;B;B;B	.|0.06786	.|0.0;0.001;0.0;0.0;0.0	.|B;B;B;B;B	.|0.09377	.|0.001;0.004;0.001;0.001;0.0	T|T	0.64041|0.64041	-0.6500|-0.6500	5|9	.|.	.|.	.|.	.|.	19.6257|19.6257	0.95677|0.95677	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|201;201;60;201;201	.|Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.|.;.;.;.;ERBB4_HUMAN	K|K	201|201	.|ENSP00000342235:T201K;ENSP00000403204:T201K;ENSP00000385565:T201K	.|.	Q|T	-|-	1|2	0|0	ERBB4|ERBB4	212323629|212323629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	5.303000|5.303000	0.65738|0.65738	2.625000|2.625000	0.88918|0.88918	0.650000|0.650000	0.86243|0.86243	CAG|ACA	.		0.458	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ESR2	2100	ucsc.edu;bcgsc.ca	37	14	64749351	64749351	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr14:64749351G>T	ENST00000341099.4	-	2	770	c.353C>A	c.(352-354)cCt>cAt	p.P118H	ESR2_ENST00000554572.1_Missense_Mutation_p.P118H|ESR2_ENST00000353772.3_Missense_Mutation_p.P118H|ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000542956.1_Missense_Mutation_p.P118H|ESR2_ENST00000358599.5_Missense_Mutation_p.P118H|ESR2_ENST00000553796.1_Missense_Mutation_p.P118H|ESR2_ENST00000555278.1_Missense_Mutation_p.P118H|ESR2_ENST00000557772.1_Missense_Mutation_p.P118H|ESR2_ENST00000267525.6_Missense_Mutation_p.P118H|ESR2_ENST00000357782.2_Missense_Mutation_p.P118H	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	118	Modulating.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CCTGTTTACAGGTAAGGTGTG	0.413																																					p.P118H		.											.	ESR2	611	0			c.C353A						.						84.0	81.0	82.0					14																	64749351		2203	4300	6503	SO:0001583	missense	2100	exon1			TTTACAGGTAAGG	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.353C>A	14.37:g.64749351G>T	ENSP00000343925:p.Pro118His	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_001214902	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	37	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059007	0.55325	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;D	0.91068	-2.76;-2.72;-2.7;-2.7;-2.7;-2.78;-2.77;-2.78;-2.76;-2.62;-2.32	5.56	4.65	0.58169	Estrogen receptor beta, N-terminal (1);	0.924863	0.09395	N	0.807967	D	0.94909	0.8354	M	0.75264	2.295	0.38016	D	0.934702	D;B;D;D;D	0.89917	1.0;0.122;0.998;0.998;0.995	D;B;D;D;D	0.72625	0.976;0.236;0.978;0.97;0.948	D	0.90970	0.4819	10	0.22109	T	0.4	.	15.6719	0.77286	0.0:0.0:0.8619:0.1381	.	118;118;118;118;118	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	H	118	ENSP00000452485:P118H;ENSP00000441792:P118H;ENSP00000450699:P118H;ENSP00000335551:P118H;ENSP00000351412:P118H;ENSP00000450488:P118H;ENSP00000452426:P118H;ENSP00000350427:P118H;ENSP00000451582:P118H;ENSP00000343925:P118H;ENSP00000267525:P118H	ENSP00000267525:P118H	P	-	2	0	ESR2	63819104	0.998000	0.40836	0.876000	0.34364	0.925000	0.55904	3.641000	0.54360	1.305000	0.44909	0.563000	0.77884	CCT	.		0.413	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
EXOC3L2	90332	ucsc.edu;bcgsc.ca	37	19	45716529	45716529	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:45716529A>G	ENST00000252482.3	-	9	1055	c.1028T>C	c.(1027-1029)cTg>cCg	p.L343P	AC006126.3_ENST00000591569.1_Intron|EXOC3L2_ENST00000413988.1_Missense_Mutation_p.L343P			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	343					exocytosis (GO:0006887)	exocyst (GO:0000145)				endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		AGAGAGTTCCAGGTCCCGGGC	0.667																																					p.L343P		.											.	EXOC3L2	91	0			c.T1028C						.						40.0	41.0	41.0					19																	45716529		2203	4300	6503	SO:0001583	missense	90332	exon10			AGTTCCAGGTCCC	AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.1028T>C	19.37:g.45716529A>G	ENSP00000252482:p.Leu343Pro	Somatic	63.0	0.0		WXS	Illumina HiSeq	.	58.0	5.0	NM_138568	Q8N9W2|Q96GV2	Missense_Mutation	SNP	ENST00000252482.3	37	CCDS12657.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.839928	0.71488	.	.	ENSG00000130201	ENST00000252482;ENST00000413988	T;T	0.08102	3.13;3.13	4.53	4.53	0.55603	.	0.167201	0.40640	N	0.001059	T	0.24005	0.0581	M	0.66939	2.045	0.58432	D	0.999992	D	0.89917	1.0	D	0.79784	0.993	T	0.00536	-1.1683	10	0.52906	T	0.07	.	10.2578	0.43408	1.0:0.0:0.0:0.0	.	343	Q2M3D2	EX3L2_HUMAN	P	343	ENSP00000252482:L343P;ENSP00000400713:L343P	ENSP00000252482:L343P	L	-	2	0	EXOC3L2	50408369	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.399000	0.73248	1.685000	0.51034	0.374000	0.22700	CTG	.		0.667	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568	
FAM124A	220108	ucsc.edu;bcgsc.ca	37	13	51855053	51855053	+	Silent	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr13:51855053C>T	ENST00000322475.8	+	4	1437	c.1302C>T	c.(1300-1302)ccC>ccT	p.P434P	FAM124A_ENST00000280057.6_Silent_p.P470P	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	434										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		ATTCTGCACCCAGTAGGTTCT	0.607																																					p.P470P		.											.	FAM124A	90	0			c.C1410T						.						53.0	53.0	53.0					13																	51855053		2203	4300	6503	SO:0001819	synonymous_variant	220108	exon5			TGCACCCAGTAGG	AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.1302C>T	13.37:g.51855053C>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_145019	A2A324|Q8N8P9|Q8NE66|Q96NJ9	Silent	SNP	ENST00000322475.8	37	CCDS55900.1																																																																																			.		0.607	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045019.3	NM_145019	
FAT3	120114	ucsc.edu;bcgsc.ca	37	11	92087568	92087568	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:92087568A>T	ENST00000298047.6	+	1	2307	c.2290A>T	c.(2290-2292)Aca>Tca	p.T764S	FAT3_ENST00000525166.1_Missense_Mutation_p.T614S|FAT3_ENST00000541502.1_Missense_Mutation_p.T764S|FAT3_ENST00000409404.2_Missense_Mutation_p.T764S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	764	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGTGCTATTTACAATATCAGA	0.418										TCGA Ovarian(4;0.039)																											p.T764S		.											.	FAT3	73	0			c.A2290T						.						117.0	118.0	117.0					11																	92087568		1912	4128	6040	SO:0001583	missense	120114	exon1			CTATTTACAATAT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2290A>T	11.37:g.92087568A>T	ENSP00000298047:p.Thr764Ser	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	A	3.659	-0.069937	0.07228	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.77	4.64	0.57946	.	.	.	.	.	T	0.13457	0.0326	N	0.00683	-1.26	0.28217	N	0.926681	B	0.17465	0.022	B	0.18871	0.023	T	0.23368	-1.0190	9	0.12103	T	0.63	.	8.4308	0.32757	0.8501:0.0:0.1499:0.0	.	764	Q8TDW7-3	.	S	764;764;764;614	ENSP00000298047:T764S;ENSP00000387040:T764S;ENSP00000443786:T764S;ENSP00000432586:T614S	ENSP00000298047:T764S	T	+	1	0	FAT3	91727216	1.000000	0.71417	0.924000	0.36721	0.991000	0.79684	3.729000	0.54999	1.008000	0.39264	0.383000	0.25322	ACA	.		0.418	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FBN2	2201	ucsc.edu;bcgsc.ca	37	5	127712541	127712541	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:127712541C>A	ENST00000508053.1	-	20	2829	c.1855G>T	c.(1855-1857)Gat>Tat	p.D619Y	FBN2_ENST00000262464.4_Missense_Mutation_p.D619Y|FBN2_ENST00000508989.1_Missense_Mutation_p.D586Y|FBN2_ENST00000511489.1_5'UTR			P35556	FBN2_HUMAN	fibrillin 2	619	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GTACATTCATCATGATCTGCA	0.428																																					p.D619Y		.											.	FBN2	146	0			c.G1855T						.						207.0	171.0	183.0					5																	127712541		2203	4300	6503	SO:0001583	missense	2201	exon14			ATTCATCATGATC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1855G>T	5.37:g.127712541C>A	ENSP00000424571:p.Asp619Tyr	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612520	0.87258	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.95656	-3.77;-3.77;-3.77	4.63	4.63	0.57726	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	D	0.98488	0.9496	H	0.95780	3.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	D	0.99066	1.0832	10	0.87932	D	0	.	18.8146	0.92072	0.0:1.0:0.0:0.0	.	586;619	D6RJI3;P35556	.;FBN2_HUMAN	Y	619;619;586	ENSP00000262464:D619Y;ENSP00000424571:D619Y;ENSP00000425596:D586Y	ENSP00000262464:D619Y	D	-	1	0	FBN2	127740440	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.872000	0.69636	2.865000	0.98341	0.655000	0.94253	GAT	.		0.428	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FBN3	84467	ucsc.edu;bcgsc.ca	37	19	8154496	8154496	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:8154496G>T	ENST00000600128.1	-	51	6723	c.6309C>A	c.(6307-6309)acC>acA	p.T2103T	FBN3_ENST00000601739.1_Silent_p.T2103T|FBN3_ENST00000270509.2_Silent_p.T2103T			Q75N90	FBN3_HUMAN	fibrillin 3	2103	EGF-like 33; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGGATCCATCGGTGTTGACAC	0.582																																					p.T2103T		.											.	FBN3	100	0			c.C6309A						.						212.0	180.0	191.0					19																	8154496		2203	4300	6503	SO:0001819	synonymous_variant	84467	exon50			TCCATCGGTGTTG		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6309C>A	19.37:g.8154496G>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	CCDS12196.1																																																																																			.		0.582	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
FERMT1	55612	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	6096555	6096555	+	Missense_Mutation	SNP	C	C	A	rs184921922		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr20:6096555C>A	ENST00000217289.4	-	3	1076	c.288G>T	c.(286-288)atG>atT	p.M96I	FERMT1_ENST00000536936.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	96	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						GAAGGCGCAGCATTTTATGCT	0.488																																					p.M96I		.											.	FERMT1	495	0			c.G288T						.						86.0	87.0	87.0					20																	6096555		2203	4300	6503	SO:0001583	missense	55612	exon3			GCGCAGCATTTTA	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.288G>T	20.37:g.6096555C>A	ENSP00000217289:p.Met96Ile	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	10.0	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	37	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.826000	0.32237	.	.	ENSG00000101311	ENST00000217289;ENST00000339538;ENST00000378844	T;T	0.10477	2.87;2.87	5.52	2.53	0.30540	Band 4.1 domain (1);	0.295574	0.43919	N	0.000502	T	0.06142	0.0159	N	0.19112	0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.35773	-0.9775	10	0.33141	T	0.24	-3.8721	5.9823	0.19413	0.131:0.5479:0.2529:0.0682	.	96;96	Q9BQL6-4;Q9BQL6	.;FERM1_HUMAN	I	96	ENSP00000217289:M96I;ENSP00000368121:M96I	ENSP00000217289:M96I	M	-	3	0	FERMT1	6044555	0.973000	0.33851	0.986000	0.45419	0.907000	0.53573	0.316000	0.19469	0.383000	0.24910	0.650000	0.86243	ATG	C|0.999;T|0.001		0.488	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	
FHOD3	80206	ucsc.edu;bcgsc.ca	37	18	34289290	34289290	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr18:34289290G>A	ENST00000359247.4	+	14	1893	c.1893G>A	c.(1891-1893)tcG>tcA	p.S631S	FHOD3_ENST00000445677.1_Silent_p.S610S|FHOD3_ENST00000257209.4_Silent_p.S648S|FHOD3_ENST00000590592.1_Silent_p.S823S|FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000591635.1_Intron	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	631	Poly-Ser.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CCAGCGTCTCGTCCTCCAGCA	0.567																																					p.S648S		.											.	FHOD3	139	0			c.G1944A						.						60.0	48.0	52.0					18																	34289290		2203	4300	6503	SO:0001819	synonymous_variant	80206	exon15			CGTCTCGTCCTCC	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1893G>A	18.37:g.34289290G>A		Somatic	72.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																				.		0.567	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
FICD	11153	ucsc.edu;bcgsc.ca	37	12	108912413	108912413	+	Missense_Mutation	SNP	C	C	A	rs139799946		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:108912413C>A	ENST00000552695.1	+	3	773	c.538C>A	c.(538-540)Cgc>Agc	p.R180S	FICD_ENST00000361549.2_3'UTR	NM_007076.2	NP_009007.2	Q9BVA6	FICD_HUMAN	FIC domain containing	180					negative regulation of Rho GTPase activity (GO:0034259)|protein adenylylation (GO:0018117)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein adenylyltransferase activity (GO:0070733)			NS(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|upper_aerodigestive_tract(2)	15						ACTGGTCAACCGCGATCGGAC	0.512																																					p.R180S		.											.	FICD	68	0			c.C538A						.						136.0	108.0	117.0					12																	108912413		2203	4300	6503	SO:0001583	missense	11153	exon3			GTCAACCGCGATC	AF049611	CCDS9116.1	12q24.1	2007-12-05				ENSG00000198855			18416	protein-coding gene	gene with protein product	"""huntingtin interacting protein 13"", ""fic S-phase protein cell division homolog (E. coli)"""					9700202	Standard	NM_007076		Approved	HYPE, HIP13	uc001tmx.1	Q9BVA6		ENST00000552695.1:c.538C>A	12.37:g.108912413C>A	ENSP00000446479:p.Arg180Ser	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_007076	O75406	Missense_Mutation	SNP	ENST00000552695.1	37	CCDS9116.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847343	0.32606	.	.	ENSG00000198855	ENST00000552695	T	0.78364	-1.17	5.62	3.64	0.41730	Tetratricopeptide-like helical (1);	0.049638	0.85682	D	0.000000	T	0.77864	0.4194	L	0.54323	1.7	0.80722	D	1	P	0.51449	0.945	P	0.48063	0.565	T	0.80130	-0.1511	10	0.51188	T	0.08	-17.9864	14.9972	0.71443	0.274:0.726:0.0:0.0	.	180	Q9BVA6	FICD_HUMAN	S	180	ENSP00000446479:R180S	ENSP00000446479:R180S	R	+	1	0	FICD	107436543	1.000000	0.71417	0.993000	0.49108	0.013000	0.08279	2.503000	0.45407	1.438000	0.47492	0.655000	0.94253	CGC	C|1.000;T|0.000		0.512	FICD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404842.1	NM_007076	
FLNA	2316	ucsc.edu;bcgsc.ca	37	X	153592415	153592415	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:153592415A>G	ENST00000369850.3	-	15	2491	c.2255T>C	c.(2254-2256)gTc>gCc	p.V752A	FLNA_ENST00000344736.4_Missense_Mutation_p.V752A|FLNA_ENST00000360319.4_Missense_Mutation_p.V752A|FLNA_ENST00000422373.1_Missense_Mutation_p.V752A	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	752					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGGGATGCTGACGCCTCCCCA	0.582																																					p.V752A		.											.	FLNA	599	0			c.T2255C						.						86.0	93.0	90.0					X																	153592415		2095	4188	6283	SO:0001583	missense	2316	exon15			ATGCTGACGCCTC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.2255T>C	X.37:g.153592415A>G	ENSP00000358866:p.Val752Ala	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001456	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.971407	0.53614	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86	4.95	4.95	0.65309	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000007	D	0.87795	0.6267	L	0.59436	1.845	0.80722	D	1	B;D	0.53462	0.075;0.96	B;P	0.59115	0.31;0.852	D	0.87352	0.2338	10	0.51188	T	0.08	.	8.7608	0.34674	0.9017:0.0:0.0983:0.0	.	752;752	P21333-2;P21333	.;FLNA_HUMAN	A	752;725;752;752;752	ENSP00000353467:V752A;ENSP00000416926:V752A;ENSP00000358866:V752A;ENSP00000358863:V752A	ENSP00000358863:V752A	V	-	2	0	FLNA	153245609	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	3.212000	0.51145	1.645000	0.50612	0.427000	0.28365	GTC	.		0.582	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
FMNL2	114793	ucsc.edu;bcgsc.ca	37	2	153475551	153475551	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:153475551G>A	ENST00000288670.9	+	14	1873	c.1506G>A	c.(1504-1506)ttG>ttA	p.L502L	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	502					cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CTGGCACATTGTCCATGGGGT	0.527																																					p.L502L		.											.	FMNL2	516	0			c.G1506A						.						67.0	70.0	69.0					2																	153475551		1940	4139	6079	SO:0001819	synonymous_variant	114793	exon14			CACATTGTCCATG	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1506G>A	2.37:g.153475551G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Silent	SNP	ENST00000288670.9	37	CCDS46429.1																																																																																			.		0.527	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
FSCN1	6624	ucsc.edu;bcgsc.ca	37	7	5643635	5643635	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:5643635T>C	ENST00000382361.3	+	4	1367	c.1253T>C	c.(1252-1254)tTc>tCc	p.F418S	FSCN1_ENST00000340250.6_Missense_Mutation_p.F397S	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	418					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		CAGCTGGAGTTCAACGATGGC	0.647																																					p.F418S		.											.	FSCN1	91	0			c.T1253C						.						74.0	63.0	67.0					7																	5643635		2203	4300	6503	SO:0001583	missense	6624	exon4			TGGAGTTCAACGA	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1253T>C	7.37:g.5643635T>C	ENSP00000371798:p.Phe418Ser	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_003088	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	ENST00000382361.3	37	CCDS5342.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.264223	0.59431	.	.	ENSG00000075618	ENST00000340250;ENST00000382361;ENST00000535097	T;T	0.47869	0.83;0.83	4.43	4.43	0.53597	Fascin domain (1);Actin cross-linking (1);	0.188361	0.46442	N	0.000294	T	0.61999	0.2392	L	0.60845	1.875	0.53688	D	0.999979	D;D	0.71674	0.983;0.998	P;D	0.65443	0.832;0.935	T	0.66048	-0.6020	10	0.87932	D	0	-9.4436	12.8603	0.57910	0.0:0.0:0.0:1.0	.	397;418	B3KTA3;Q16658	.;FSCN1_HUMAN	S	397;418;140	ENSP00000339729:F397S;ENSP00000371798:F418S	ENSP00000339729:F397S	F	+	2	0	FSCN1	5610161	1.000000	0.71417	0.996000	0.52242	0.663000	0.39108	5.809000	0.69172	1.623000	0.50342	0.368000	0.22195	TTC	.		0.647	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	NM_003088	
GABRB2	2561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	160972296	160972296	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:160972296G>A	ENST00000393959.1	-	3	173	c.174C>T	c.(172-174)ccC>ccT	p.P58P	GABRB2_ENST00000517547.1_5'UTR|GABRB2_ENST00000517901.1_5'UTR|GABRB2_ENST00000274547.2_Silent_p.P58P|GABRB2_ENST00000523730.1_5'Flank|GABRB2_ENST00000520240.1_Silent_p.P58P|GABRB2_ENST00000353437.6_Silent_p.P58P			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	58					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CAGCCACGGGGGGACCTGCAA	0.453																																					p.P58P		.											.	GABRB2	91	0			c.C174T						.						55.0	49.0	51.0					5																	160972296		2203	4300	6503	SO:0001819	synonymous_variant	2561	exon4			CACGGGGGGACCT		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.174C>T	5.37:g.160972296G>A		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	26.0	NM_021911	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Silent	SNP	ENST00000393959.1	37	CCDS4355.1																																																																																			.		0.453	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
GIMAP7	168537	ucsc.edu;bcgsc.ca	37	7	150217195	150217195	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:150217195A>G	ENST00000313543.4	+	2	290	c.133A>G	c.(133-135)Aag>Gag	p.K45E		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	45	AIG1-type G.				GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGCTGTTACCAAGAACTGTCA	0.502																																					p.K45E		.											.	GIMAP7	228	0			c.A133G						.						63.0	58.0	60.0					7																	150217195		2203	4300	6503	SO:0001583	missense	168537	exon2			GTTACCAAGAACT	BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.133A>G	7.37:g.150217195A>G	ENSP00000315474:p.Lys45Glu	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_153236		Missense_Mutation	SNP	ENST00000313543.4	37	CCDS5903.1	.	.	.	.	.	.	.	.	.	.	A	15.93	2.976910	0.53720	.	.	ENSG00000179144	ENST00000313543	T	0.64438	-0.1	5.09	-0.343	0.12632	AIG1 (1);	1.037690	0.07582	N	0.920442	T	0.66046	0.2750	M	0.63208	1.945	0.09310	N	1	P	0.52842	0.956	P	0.53006	0.715	T	0.55153	-0.8185	10	0.46703	T	0.11	.	6.659	0.23004	0.4313:0.4812:0.0875:0.0	.	45	Q8NHV1	GIMA7_HUMAN	E	45	ENSP00000315474:K45E	ENSP00000315474:K45E	K	+	1	0	GIMAP7	149848128	0.000000	0.05858	0.002000	0.10522	0.038000	0.13279	-0.367000	0.07553	-0.177000	0.10690	-0.256000	0.11100	AAG	.		0.502	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349277.1	NM_153236	
GJA1	2697	broad.mit.edu;bcgsc.ca	37	6	121768405	121768405	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:121768405G>T	ENST00000282561.3	+	2	569	c.412G>T	c.(412-414)Ggt>Tgt	p.G138C		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	138			G -> R (in ODDD). {ECO:0000269|PubMed:12457340}.		adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	GTTCAAGTACGGTATTGAAGA	0.443																																					p.G138C		.											.	GJA1	92	0			c.G412T	GRCh37	CM030464|CM086823	GJA1	M		.						128.0	123.0	125.0					6																	121768405		2203	4300	6503	SO:0001583	missense	2697	exon2			AAGTACGGTATTG	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.412G>T	6.37:g.121768405G>T	ENSP00000282561:p.Gly138Cys	Somatic	125.0	1.0		WXS	Illumina HiSeq	Phase_I	109.0	9.0	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784395	0.49997	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	D	0.97352	-4.35	5.42	5.42	0.78866	.	0.055392	0.64402	D	0.000001	D	0.98108	0.9376	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97554	1.0094	10	0.39692	T	0.17	.	19.2126	0.93763	0.0:0.0:1.0:0.0	.	138	P17302	CXA1_HUMAN	C	122;138	ENSP00000282561:G138C	ENSP00000282561:G138C	G	+	1	0	GJA1	121810104	1.000000	0.71417	0.142000	0.22268	0.148000	0.21650	9.420000	0.97426	2.565000	0.86533	0.460000	0.39030	GGT	.		0.443	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
GLYR1	84656	ucsc.edu;bcgsc.ca	37	16	4861199	4861199	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:4861199G>T	ENST00000321919.9	-	15	1635	c.1559C>A	c.(1558-1560)cCg>cAg	p.P520Q	GLYR1_ENST00000381983.3_Missense_Mutation_p.P503Q|GLYR1_ENST00000436648.5_Missense_Mutation_p.P439Q|GLYR1_ENST00000591451.1_Missense_Mutation_p.P514Q	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	520					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						CATGGGAGTCGGATGGTTGAC	0.458																																					p.P520Q		.											.	GLYR1	90	0			c.C1559A						.						124.0	118.0	120.0					16																	4861199		2197	4300	6497	SO:0001583	missense	84656	exon15			GGAGTCGGATGGT	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1559C>A	16.37:g.4861199G>T	ENSP00000322716:p.Pro520Gln	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_032569	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	37	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268534	0.59540	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.35048	1.33;1.33;1.33	5.72	5.72	0.89469	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.65439	0.2691	M	0.85777	2.775	0.80722	D	1	D;D;P;D	0.89917	0.97;0.971;0.892;1.0	P;P;P;D	0.74023	0.806;0.794;0.612;0.982	T	0.66594	-0.5884	10	0.45353	T	0.12	-12.2917	18.6366	0.91380	0.0:0.0:1.0:0.0	.	439;514;503;520	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	Q	520;503;439	ENSP00000322716:P520Q;ENSP00000371413:P503Q;ENSP00000390276:P439Q	ENSP00000322716:P520Q	P	-	2	0	GLYR1	4801200	1.000000	0.71417	0.956000	0.39512	0.282000	0.26991	7.795000	0.85887	2.700000	0.92200	0.561000	0.74099	CCG	.		0.458	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
GMPPA	29926	ucsc.edu;bcgsc.ca	37	2	220371496	220371496	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:220371496C>A	ENST00000358215.3	+	13	1608	c.1239C>A	c.(1237-1239)agC>agA	p.S413R	GMPPA_ENST00000373917.3_Missense_Mutation_p.S466R|GMPPA_ENST00000313597.5_Missense_Mutation_p.S413R|GMPPA_ENST00000373908.1_Missense_Mutation_p.S413R|GMPPA_ENST00000341142.3_Missense_Mutation_p.S413R|AC053503.11_ENST00000429882.1_RNA	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	413					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		TGAGCCGAAGCTTCACCAACC	0.617																																					p.S413R		.											.	GMPPA	90	0			c.C1239A						.						97.0	78.0	84.0					2																	220371496		2203	4300	6503	SO:0001583	missense	29926	exon13			CCGAAGCTTCACC	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.1239C>A	2.37:g.220371496C>A	ENSP00000350949:p.Ser413Arg	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	22.0	6.0	NM_205847	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	37	CCDS2441.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517496	0.85495	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000341142	T;T;T;T;T	0.20200	2.12;2.09;2.12;2.12;2.12	4.08	4.08	0.47627	.	0.045801	0.85682	D	0.000000	T	0.50292	0.1607	M	0.86268	2.805	0.80722	D	1	D;D	0.69078	0.997;0.992	D;D	0.71870	0.975;0.917	T	0.61603	-0.7029	10	0.72032	D	0.01	-4.3254	16.2645	0.82568	0.0:1.0:0.0:0.0	.	466;413	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	R	413;466;413;413;413	ENSP00000315925:S413R;ENSP00000363027:S466R;ENSP00000350949:S413R;ENSP00000363016:S413R;ENSP00000340760:S413R	ENSP00000315925:S413R	S	+	3	2	GMPPA	220079740	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.558000	0.45879	1.977000	0.57605	0.467000	0.42956	AGC	.		0.617	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	NM_013335	
GORASP1	64689	ucsc.edu;bcgsc.ca	37	3	39140363	39140363	+	Missense_Mutation	SNP	A	A	G	rs140610726	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:39140363A>G	ENST00000319283.3	-	8	1759	c.938T>C	c.(937-939)aTt>aCt	p.I313T	GORASP1_ENST00000422110.2_Missense_Mutation_p.I158T|GORASP1_ENST00000476334.1_5'UTR|GORASP1_ENST00000479927.1_Missense_Mutation_p.I218T	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa	313					Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CAAGAGAGAAATTCCCGACAC	0.577																																					p.I313T		.											.	GORASP1	92	0			c.T938C						.						98.0	89.0	92.0					3																	39140363		2203	4300	6503	SO:0001583	missense	64689	exon8			AGAGAAATTCCCG	AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.938T>C	3.37:g.39140363A>G	ENSP00000313869:p.Ile313Thr	Somatic	74.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_031899	B3KWC8|Q3SYG7|Q8N272|Q96H42	Missense_Mutation	SNP	ENST00000319283.3	37	CCDS2681.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.594208	0.66219	.	.	ENSG00000114745	ENST00000319283;ENST00000422110;ENST00000479927	T;T;T	0.55234	0.66;0.53;0.62	4.68	4.68	0.58851	.	0.542979	0.20457	N	0.091975	T	0.53642	0.1809	L	0.56769	1.78	0.30935	N	0.726442	P;P;B	0.40731	0.651;0.728;0.361	B;P;B	0.44359	0.15;0.447;0.081	T	0.63260	-0.6677	10	0.66056	D	0.02	-11.2718	10.7558	0.46237	1.0:0.0:0.0:0.0	.	218;158;313	B4E1H8;B3KPY8;Q9BQQ3	.;.;GORS1_HUMAN	T	313;158;218	ENSP00000313869:I313T;ENSP00000395709:I158T;ENSP00000419123:I218T	ENSP00000313869:I313T	I	-	2	0	GORASP1	39115367	1.000000	0.71417	0.998000	0.56505	0.709000	0.40893	4.303000	0.59098	2.107000	0.64212	0.529000	0.55759	ATT	A|0.999;C|0.000		0.577	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254060.1		
GUCA1B	2979	ucsc.edu;bcgsc.ca	37	6	42152641	42152641	+	Missense_Mutation	SNP	C	C	T	rs141880594		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:42152641C>T	ENST00000230361.3	-	4	610	c.515G>A	c.(514-516)cGg>cAg	p.R172Q		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	172	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			CCACTTGTCCCGACGGGCACC	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20221	0.0		0.0	False		,,,				2504	0.0				p.R172Q		.											.	GUCA1B	92	0			c.G515A						.	C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	115.0	102.0	106.0		515	4.1	0.9	6	dbSNP_134	106	0,8600		0,0,4300	no	missense	GUCA1B	NM_002098.5	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	172/201	42152641	2,13004	2203	4300	6503	SO:0001583	missense	2979	exon4			TTGTCCCGACGGG	AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.515G>A	6.37:g.42152641C>T	ENSP00000230361:p.Arg172Gln	Somatic	41.0	1.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_002098	Q9NU15	Missense_Mutation	SNP	ENST00000230361.3	37	CCDS4865.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905928	0.52333	4.54E-4	0.0	ENSG00000112599	ENST00000230361;ENST00000372949	T	0.55413	0.52	4.12	4.12	0.48240	EF-hand-like domain (1);	0.100234	0.64402	D	0.000008	T	0.12944	0.0314	N	0.14661	0.345	0.27615	N	0.948539	B	0.33171	0.4	B	0.22152	0.038	T	0.04090	-1.0978	10	0.25106	T	0.35	.	8.4815	0.33045	0.0:0.8887:0.0:0.1113	.	172	Q9UMX6	GUC1B_HUMAN	Q	172;164	ENSP00000230361:R172Q	ENSP00000230361:R172Q	R	-	2	0	GUCA1B	42260619	0.964000	0.33143	0.864000	0.33941	0.974000	0.67602	2.089000	0.41672	2.243000	0.73865	0.655000	0.94253	CGG	C|1.000;T|0.000		0.582	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040550.1	NM_002098	
GUCY2C	2984	ucsc.edu;bcgsc.ca	37	12	14827660	14827660	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:14827660C>T	ENST00000261170.3	-	8	1119	c.983G>A	c.(982-984)gGa>gAa	p.G328E	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	328					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GAGCAGGATTCCATTCAAATA	0.348																																					p.G328E		.											.	GUCY2C	338	0			c.G983A						.						81.0	86.0	84.0					12																	14827660		2203	4300	6503	SO:0001583	missense	2984	exon8			AGGATTCCATTCA		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.983G>A	12.37:g.14827660C>T	ENSP00000261170:p.Gly328Glu	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783037	0.70222	.	.	ENSG00000070019	ENST00000261170	T	0.75938	-0.98	5.68	4.79	0.61399	Extracellular ligand-binding receptor (1);	0.217971	0.46442	D	0.000286	D	0.82697	0.5093	M	0.68952	2.095	0.40138	D	0.976802	D	0.59767	0.986	D	0.62955	0.909	D	0.85095	0.0954	10	0.87932	D	0	.	12.798	0.57569	0.0:0.8361:0.1639:0.0	.	328	P25092	GUC2C_HUMAN	E	328	ENSP00000261170:G328E	ENSP00000261170:G328E	G	-	2	0	GUCY2C	14718927	1.000000	0.71417	0.953000	0.39169	0.926000	0.56050	1.890000	0.39728	1.394000	0.46624	0.655000	0.94253	GGA	.		0.348	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
HADHB	3032	ucsc.edu;bcgsc.ca	37	2	26502181	26502181	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:26502181C>A	ENST00000317799.5	+	9	913	c.809C>A	c.(808-810)cCa>cAa	p.P270Q	HADHB_ENST00000405867.3_Intron|HADHB_ENST00000494615.1_3'UTR|HADHB_ENST00000545822.1_Missense_Mutation_p.P248Q|HADHB_ENST00000537713.1_Missense_Mutation_p.P255Q	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	270			Missing (in TFP deficiency). {ECO:0000269|PubMed:12754706}.		cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCAAAGTACCAGGTGAAATG	0.433																																					p.P270Q		.											.	HADHB	154	0			c.C809A						.						75.0	72.0	73.0					2																	26502181		2203	4300	6503	SO:0001583	missense	3032	exon9			AAGTACCAGGTGA		CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.809C>A	2.37:g.26502181C>A	ENSP00000325136:p.Pro270Gln	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_000183	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	ENST00000317799.5	37	CCDS1722.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.512930	0.64522	.	.	ENSG00000138029	ENST00000317799;ENST00000537713;ENST00000545822	D;D;D	0.87571	-2.27;-2.27;-2.27	5.62	5.62	0.85841	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.92616	0.7654	M	0.83118	2.625	0.80722	D	1	P;P;P	0.44344	0.691;0.635;0.833	P;P;P	0.53760	0.517;0.612;0.734	D	0.92708	0.6180	10	0.59425	D	0.04	-14.9775	18.5989	0.91240	0.0:1.0:0.0:0.0	.	255;248;270	F5GZQ3;B4E2W0;P55084	.;.;ECHB_HUMAN	Q	270;255;248	ENSP00000325136:P270Q;ENSP00000444295:P255Q;ENSP00000442665:P248Q	ENSP00000325136:P270Q	P	+	2	0	HADHB	26355685	1.000000	0.71417	1.000000	0.80357	0.117000	0.20001	7.473000	0.81007	2.805000	0.96524	0.655000	0.94253	CCA	.		0.433	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
HCRTR1	3061	ucsc.edu;bcgsc.ca	37	1	32092400	32092400	+	Missense_Mutation	SNP	G	G	T	rs202193411		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:32092400G>T	ENST00000373706.5	+	7	1250	c.1097G>T	c.(1096-1098)cGg>cTg	p.R366L	HCRTR1_ENST00000403528.2_Missense_Mutation_p.R366L|HCRTR1_ENST00000468521.1_Intron|HCRTR1_ENST00000373705.1_Intron			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	366					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		GGCAAATTCCGGGAGCAGTTT	0.617																																					p.R366L		.											.	HCRTR1	523	0			c.G1097T						.						76.0	74.0	75.0					1																	32092400		2203	4300	6503	SO:0001583	missense	3061	exon9			AATTCCGGGAGCA	AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.1097G>T	1.37:g.32092400G>T	ENSP00000362810:p.Arg366Leu	Somatic	49.0	1.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001525	A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	37	CCDS344.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454504	0.84209	.	.	ENSG00000121764	ENST00000403528;ENST00000373706	T;T	0.57595	0.39;0.39	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.61776	0.2374	L	0.34521	1.04	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	T	0.64837	-0.6313	10	0.87932	D	0	.	13.8657	0.63588	0.0:0.0:1.0:0.0	.	366	O43613	OX1R_HUMAN	L	366	ENSP00000384387:R366L;ENSP00000362810:R366L	ENSP00000362810:R366L	R	+	2	0	HCRTR1	31864987	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.773000	0.68898	2.550000	0.86006	0.655000	0.94253	CGG	G|0.999;A|0.000		0.617	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525	
HIPK3	10114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	33358704	33358704	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:33358704A>T	ENST00000303296.4	+	4	1610	c.1305A>T	c.(1303-1305)aaA>aaT	p.K435N	HIPK3_ENST00000379016.3_Missense_Mutation_p.K435N|HIPK3_ENST00000534262.1_3'UTR|HIPK3_ENST00000456517.1_Missense_Mutation_p.K435N|HIPK3_ENST00000525975.1_Missense_Mutation_p.K435N	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	435	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TTTTTTGCAAAGAAACAGATA	0.313																																					p.K435N		.											.	HIPK3	336	0			c.A1305T						.						66.0	67.0	67.0					11																	33358704		2201	4295	6496	SO:0001583	missense	10114	exon4			TTGCAAAGAAACA	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1305A>T	11.37:g.33358704A>T	ENSP00000304226:p.Lys435Asn	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	33.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	A	14.50	2.552904	0.45487	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	4.88	2.53	0.30540	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.090432	0.48286	D	0.000187	T	0.12475	0.0303	N	0.20845	0.615	0.38943	D	0.958193	B;B	0.15141	0.008;0.012	B;B	0.22152	0.022;0.038	T	0.09143	-1.0688	10	0.87932	D	0	.	5.5243	0.16949	0.7032:0.1447:0.1521:0.0	.	435;435	Q9H422-2;Q9H422	.;HIPK3_HUMAN	N	435	ENSP00000431710:K435N;ENSP00000304226:K435N;ENSP00000368301:K435N;ENSP00000398241:K435N	ENSP00000304226:K435N	K	+	3	2	HIPK3	33315280	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.372000	0.52387	0.302000	0.22762	-0.371000	0.07208	AAA	.		0.313	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
HIPK3	10114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	33358706	33358706	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:33358706A>C	ENST00000303296.4	+	4	1612	c.1307A>C	c.(1306-1308)gAa>gCa	p.E436A	HIPK3_ENST00000379016.3_Missense_Mutation_p.E436A|HIPK3_ENST00000534262.1_3'UTR|HIPK3_ENST00000456517.1_Missense_Mutation_p.E436A|HIPK3_ENST00000525975.1_Missense_Mutation_p.E436A	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	436	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TTTTGCAAAGAAACAGATATG	0.308																																					p.E436A		.											.	HIPK3	336	0			c.A1307C						.						65.0	66.0	65.0					11																	33358706		2201	4295	6496	SO:0001583	missense	10114	exon4			GCAAAGAAACAGA	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1307A>C	11.37:g.33358706A>C	ENSP00000304226:p.Glu436Ala	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	32.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	A	19.21	3.782867	0.70222	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	4.88	4.88	0.63580	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000013	T	0.16342	0.0393	N	0.20986	0.625	0.80722	D	1	B;P	0.35527	0.198;0.507	B;B	0.34346	0.171;0.18	T	0.05767	-1.0865	10	0.72032	D	0.01	.	14.7855	0.69800	1.0:0.0:0.0:0.0	.	436;436	Q9H422-2;Q9H422	.;HIPK3_HUMAN	A	436	ENSP00000431710:E436A;ENSP00000304226:E436A;ENSP00000368301:E436A;ENSP00000398241:E436A	ENSP00000304226:E436A	E	+	2	0	HIPK3	33315282	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.426000	0.80270	1.952000	0.56665	0.460000	0.39030	GAA	.		0.308	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
HK1	3098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71148962	71148962	+	Silent	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:71148962C>T	ENST00000359426.6	+	14	2049	c.1945C>T	c.(1945-1947)Ctg>Ttg	p.L649L	HK1_ENST00000360289.2_Silent_p.L637L|HK1_ENST00000448642.2_Silent_p.L684L|HK1_ENST00000298649.3_Silent_p.L648L|HK1_ENST00000404387.2_Silent_p.L653L	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	649	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GGAATTTGACCTGGACGTGGT	0.517																																					p.L653L		.											.	HK1	252	0			c.C1957T						.						169.0	129.0	143.0					10																	71148962		2203	4300	6503	SO:0001819	synonymous_variant	3098	exon17			TTTGACCTGGACG	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1945C>T	10.37:g.71148962C>T		Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	46.0	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Silent	SNP	ENST00000359426.6	37	CCDS7292.1																																																																																			.		0.517	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
HM13	81502	ucsc.edu;bcgsc.ca	37	20	30137135	30137135	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr20:30137135G>T	ENST00000340852.5	+	6	790	c.666G>T	c.(664-666)tgG>tgT	p.W222C	HM13_ENST00000398174.3_Splice_Site_p.W222C|HM13_ENST00000492709.1_3'UTR|HM13_ENST00000335574.5_Splice_Site_p.W222C|HM13_ENST00000376127.3_Intron	NM_030789.2	NP_110416.1	Q8TCT9	HM13_HUMAN	histocompatibility (minor) 13	222					membrane protein proteolysis (GO:0033619)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			ATGTCTTCTGGGTGAGTCAGG	0.572																																					p.W222C		.											.	HM13	153	0			c.G666T						.						122.0	120.0	121.0					20																	30137135		2203	4300	6503	SO:0001630	splice_region_variant	81502	exon6			CTTCTGGGTGAGT	AL110115	CCDS13182.1, CCDS13183.1, CCDS42861.1	20q11.21	2012-02-21			ENSG00000101294	ENSG00000101294			16435	protein-coding gene	gene with protein product	"""signal peptide peptidase beta"", ""presenilin-like protein 3"", ""intramembrane protease"", ""signal peptide peptidase like 1"""	607106				12077416, 14704149	Standard	NM_030789		Approved	H13, dJ324O17.1, SPP, PSL3, IMP1, IMPAS, PSENL3, SPPL1	uc002wwc.3	Q8TCT9	OTTHUMG00000032175	ENST00000340852.5:c.666+1G>T	20.37:g.30137135G>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_178581	B2RAY5|E1P5L3|Q15K36|Q540H8|Q5JWP2|Q5JWP3|Q5JWP4|Q5JWP5|Q7Z4F2|Q86Y35|Q95H87|Q9H110|Q9H111	Missense_Mutation	SNP	ENST00000340852.5	37	CCDS13182.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316903	0.81469	.	.	ENSG00000101294	ENST00000335574;ENST00000340852;ENST00000398174	T;T;T	0.23348	1.91;1.91;1.91	4.8	4.8	0.61643	.	0.052759	0.85682	D	0.000000	T	0.66268	0.2772	H	0.97103	3.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.994;0.996	T	0.79009	-0.1978	10	0.87932	D	0	-4.0979	17.4503	0.87590	0.0:0.0:1.0:0.0	.	222;222;222	Q8TCT9;Q8TCT9-4;Q8TCT9-2	HM13_HUMAN;.;.	C	222	ENSP00000335294:W222C;ENSP00000343032:W222C;ENSP00000381237:W222C	ENSP00000335294:W222C	W	+	3	0	HM13	29600796	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.936000	0.92931	2.661000	0.90470	0.650000	0.86243	TGG	.		0.572	HM13-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078527.2	NM_178580	Missense_Mutation
HYAL1	3373	ucsc.edu;bcgsc.ca	37	3	50340219	50340219	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:50340219C>A	ENST00000266031.4	-	1	784	c.169G>T	c.(169-171)Gat>Tat	p.D57Y	HYAL1_ENST00000457214.2_Intron|HYAL1_ENST00000320295.8_Missense_Mutation_p.D57Y|HYAL1_ENST00000447605.2_Intron|HYAL1_ENST00000395144.2_Missense_Mutation_p.D57Y|HYAL1_ENST00000395143.2_Missense_Mutation_p.D57Y			Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1	57					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to pH (GO:0071467)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal joint morphogenesis (GO:0060272)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|negative regulation of cell growth (GO:0030308)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of growth (GO:0045927)|positive regulation of hyaluranon cable assembly (GO:1900106)|response to antibiotic (GO:0046677)|response to reactive oxygen species (GO:0000302)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|hyaluranon cable (GO:0036117)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	hyaluronan synthase activity (GO:0050501)|hyalurononglucosaminidase activity (GO:0004415)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GCTACCACATCGAAGACACTG	0.607																																					p.D57Y		.											.	HYAL1	278	0			c.G169T						.						85.0	72.0	76.0					3																	50340219		2203	4300	6503	SO:0001583	missense	3373	exon2			CCACATCGAAGAC	U90094	CCDS2816.1, CCDS2817.1, CCDS46832.1, CCDS46833.1	3p21.31	2014-07-17			ENSG00000114378	ENSG00000114378	3.2.1.35		5320	protein-coding gene	gene with protein product		607071				9223416, 9409739	Standard	NM_153281		Approved	LUCA1, HYAL-1, FUS2, NAT6	uc003czp.4	Q12794	OTTHUMG00000156941	ENST00000266031.4:c.169G>T	3.37:g.50340219C>A	ENSP00000266031:p.Asp57Tyr	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_033159	Q6FH23|Q6PIZ6|Q7KYU2|Q7LE34|Q8NFK5|Q8NFK6|Q8NFK7|Q8NFK8|Q8NFK9|Q93013|Q9UKD5|Q9UNI8	Missense_Mutation	SNP	ENST00000266031.4	37	CCDS2816.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168190	0.57476	.	.	ENSG00000114378	ENST00000395144;ENST00000266031;ENST00000320295;ENST00000395143;ENST00000418723;ENST00000452672	T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42	5.6	3.71	0.42584	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.146089	0.64402	D	0.000009	T	0.56499	0.1989	M	0.84585	2.705	0.80722	D	1	D;D;D	0.89917	0.999;0.994;1.0	D;D;D	0.71414	0.937;0.937;0.973	T	0.63611	-0.6598	10	0.66056	D	0.02	-10.2122	12.0023	0.53237	0.0:0.7906:0.133:0.0763	.	57;57;57	Q12794-7;Q12794-2;Q12794	.;.;HYAL1_HUMAN	Y	57	ENSP00000378576:D57Y;ENSP00000266031:D57Y;ENSP00000346068:D57Y;ENSP00000378575:D57Y;ENSP00000394526:D57Y;ENSP00000391666:D57Y	ENSP00000266031:D57Y	D	-	1	0	HYAL1	50315223	0.949000	0.32298	0.985000	0.45067	0.734000	0.41952	2.067000	0.41461	1.378000	0.46305	-0.136000	0.14681	GAT	.		0.607	HYAL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346703.1		
HYDIN	54768	broad.mit.edu;bcgsc.ca	37	16	70841965	70841965	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:70841965T>C	ENST00000393567.2	-	86	15034	c.14884A>G	c.(14884-14886)Acc>Gcc	p.T4962A		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4962					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTACAGTCGGTCTGAAAGGGG	0.542																																					p.T4962A		.											.	HYDIN	92	0			c.A14884G						.						55.0	57.0	56.0					16																	70841965		1984	4151	6135	SO:0001630	splice_region_variant	54768	exon86			AGTCGGTCTGAAA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.14884-1A>G	16.37:g.70841965T>C		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	6.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.753470	0.31046	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00932	5.53	5.91	2.23	0.28157	.	0.000000	0.32301	U	0.006300	T	0.00936	0.0031	L	0.45137	1.4	0.80722	D	1	B	0.33826	0.427	B	0.32022	0.139	T	0.67722	-0.5597	10	0.39692	T	0.17	.	3.9819	0.09498	0.2625:0.1401:0.0:0.5974	.	4961	F8WD23	.	A	4962;4961	ENSP00000377197:T4962A	ENSP00000313052:T4961A	T	-	1	0	HYDIN	69399466	1.000000	0.71417	0.992000	0.48379	0.547000	0.35210	2.980000	0.49321	0.469000	0.27268	0.533000	0.62120	ACC	.		0.542	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		Missense_Mutation
IL16	3603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81589305	81589305	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:81589305G>A	ENST00000302987.4	+	12	1939	c.1939G>A	c.(1939-1941)Gaa>Aaa	p.E647K	IL16_ENST00000394652.2_5'UTR|IL16_ENST00000394660.2_Missense_Mutation_p.E647K			Q14005	IL16_HUMAN	interleukin 16	647					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GCTACCACAGGAAGACACAGC	0.602																																					p.E647K		.											.	IL16	653	0			c.G1939A						.						35.0	39.0	38.0					15																	81589305		1963	4158	6121	SO:0001583	missense	3603	exon13			CCACAGGAAGACA	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.1939G>A	15.37:g.81589305G>A	ENSP00000302935:p.Glu647Lys	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	22.0	NM_001172128	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	37	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460644	0.43736	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653	T;T	0.11063	2.81;2.81	4.7	4.7	0.59300	.	0.582759	0.14620	N	0.308470	T	0.15912	0.0383	M	0.65975	2.015	0.80722	D	1	B;B;B;B;B	0.26635	0.089;0.155;0.155;0.016;0.027	B;B;B;B;B	0.32864	0.034;0.043;0.154;0.021;0.047	T	0.07083	-1.0791	10	0.10636	T	0.68	.	15.7839	0.78286	0.0:0.0:1.0:0.0	.	141;184;37;647;647	Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;IL16_HUMAN;.	K	647;479;647;184;37	ENSP00000378155:E647K;ENSP00000302935:E647K	ENSP00000302935:E647K	E	+	1	0	IL16	79376360	1.000000	0.71417	0.985000	0.45067	0.317000	0.28152	2.648000	0.46647	2.305000	0.77605	0.655000	0.94253	GAA	.		0.602	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217	
ITGA8	8516	ucsc.edu;bcgsc.ca	37	10	15658547	15658547	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:15658547C>A	ENST00000378076.3	-	14	1764	c.1411G>T	c.(1411-1413)Ggt>Tgt	p.G471C		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	471					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						CCAAATGCACCCACAATCAAA	0.338																																					p.G471C		.											.	ITGA8	230	0			c.G1411T						.						116.0	103.0	107.0					10																	15658547		2203	4300	6503	SO:0001583	missense	8516	exon14			ATGCACCCACAAT	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1411G>T	10.37:g.15658547C>A	ENSP00000367316:p.Gly471Cys	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_003638	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	C	19.97	3.924356	0.73213	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.65178	-0.14	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.86883	0.6040	H	0.97440	4.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91276	0.5048	10	0.87932	D	0	.	17.2875	0.87146	0.0:1.0:0.0:0.0	.	456;471	F5H818;P53708	.;ITA8_HUMAN	C	471;456	ENSP00000367316:G471C	ENSP00000367316:G471C	G	-	1	0	ITGA8	15698553	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	5.208000	0.65203	2.618000	0.88619	0.655000	0.94253	GGT	.		0.338	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
ITGB7	3695	ucsc.edu;bcgsc.ca	37	12	53589937	53589937	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:53589937G>A	ENST00000267082.5	-	7	1094	c.863C>T	c.(862-864)tCa>tTa	p.S288L	ITGB7_ENST00000550743.2_Missense_Mutation_p.S288L|ITGB7_ENST00000338737.4_Missense_Mutation_p.S288L|ITGB7_ENST00000422257.3_Missense_Mutation_p.S288L	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	288	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGTGTCGTCTGAAGTGAACAC	0.577																																					p.S288L		.											.	ITGB7	231	0			c.C863T						.						91.0	83.0	86.0					12																	53589937		2203	4300	6503	SO:0001583	missense	3695	exon7			TCGTCTGAAGTGA		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.863C>T	12.37:g.53589937G>A	ENSP00000267082:p.Ser288Leu	Somatic	46.0	1.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_000889	Q9UCP7|Q9UCS7	Missense_Mutation	SNP	ENST00000267082.5	37	CCDS8849.1	.	.	.	.	.	.	.	.	.	.	G	35	5.469723	0.96274	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737;ENST00000542497	D;D;D;D	0.98178	-4.77;-4.77;-4.77;-4.77	4.55	4.55	0.56014	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.285486	0.19041	N	0.124296	D	0.98729	0.9573	M	0.82823	2.61	0.80722	D	1	D	0.61697	0.99	P	0.59487	0.858	D	0.99867	1.1091	10	0.87932	D	0	.	16.9491	0.86239	0.0:0.0:1.0:0.0	.	288	P26010	ITB7_HUMAN	L	288	ENSP00000408741:S288L;ENSP00000267082:S288L;ENSP00000345501:S288L;ENSP00000437375:S288L	ENSP00000267082:S288L	S	-	2	0	ITGB7	51876204	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.813000	0.99286	2.440000	0.82611	0.563000	0.77884	TCA	.		0.577	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2		
KANSL1	284058	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	44249095	44249095	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:44249095T>C	ENST00000262419.6	-	2	885	c.415A>G	c.(415-417)Aga>Gga	p.R139G	KANSL1_ENST00000432791.1_Missense_Mutation_p.R139G|KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000575318.1_Missense_Mutation_p.R139G|KANSL1_ENST00000574590.1_Missense_Mutation_p.R139G|KANSL1_ENST00000572904.1_Missense_Mutation_p.R139G|KANSL1_ENST00000576248.1_5'Flank	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	139					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TTCATGGTTCTAAGATTTTCT	0.428																																					p.R139G		.											.	.	.	0			c.A415G						.						141.0	203.0	182.0					17																	44249095		2203	4300	6503	SO:0001583	missense	284058	exon2			TGGTTCTAAGATT	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.415A>G	17.37:g.44249095T>C	ENSP00000262419:p.Arg139Gly	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	10.0	NM_001193466	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	37	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.714273	0.48622	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.10668	2.85;2.85	5.74	5.74	0.90152	.	0.050934	0.85682	D	0.000000	T	0.06781	0.0173	N	0.08118	0	0.80722	D	1	B;B	0.30281	0.275;0.275	B;B	0.27715	0.082;0.082	T	0.33675	-0.9859	10	0.72032	D	0.01	-12.0094	13.419	0.60985	0.0:0.0:0.0:1.0	.	139;139	C9JHY2;Q7Z3B3	.;K1267_HUMAN	G	139	ENSP00000262419:R139G;ENSP00000387393:R139G	ENSP00000262419:R139G	R	-	1	2	KIAA1267	41604872	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.160000	0.77495	2.190000	0.69967	0.459000	0.35465	AGA	.		0.428	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
KBTBD12	166348	ucsc.edu;bcgsc.ca	37	3	127682104	127682104	+	Missense_Mutation	SNP	C	C	A	rs149769275		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:127682104C>A	ENST00000405109.1	+	5	2032	c.1565C>A	c.(1564-1566)cCa>cAa	p.P522Q	KBTBD12_ENST00000492025.1_3'UTR|KBTBD12_ENST00000407609.3_Missense_Mutation_p.P129Q|KBTBD12_ENST00000405256.1_Missense_Mutation_p.P522Q|KBTBD12_ENST00000343941.4_Missense_Mutation_p.P97Q|RNA5SP139_ENST00000364340.1_RNA			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	522										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						ATCTACAACCCAGATGGGGAC	0.537																																					p.P522Q		.											.	KBTBD12	23	0			c.C1565A						.						70.0	61.0	64.0					3																	127682104		2203	4300	6503	SO:0001583	missense	166348	exon4			ACAACCCAGATGG		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1565C>A	3.37:g.127682104C>A	ENSP00000385957:p.Pro522Gln	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_207335	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	ENST00000405109.1	37	CCDS33848.2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046267	0.93740	.	.	ENSG00000187715	ENST00000405109;ENST00000407609;ENST00000405256;ENST00000343941	T;T;T;T	0.71341	-0.5;-0.5;-0.5;-0.56	5.41	5.41	0.78517	Kelch-type beta propeller (1);	0.000000	0.56097	D	0.000022	D	0.87305	0.6144	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	D	0.89435	0.3719	10	0.87932	D	0	.	19.1945	0.93681	0.0:1.0:0.0:0.0	.	522;97	Q3ZCT8;Q3ZCT8-2	KBTBC_HUMAN;.	Q	522;129;522;97	ENSP00000385957:P522Q;ENSP00000385830:P129Q;ENSP00000385879:P522Q;ENSP00000345478:P97Q	ENSP00000345478:P97Q	P	+	2	0	KBTBD12	129164794	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	5.747000	0.68689	2.531000	0.85337	0.591000	0.81541	CCA	C|1.000;T|0.000		0.537	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
KCNMA1	3778	ucsc.edu;bcgsc.ca	37	10	79010979	79010979	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:79010979A>G	ENST00000286628.8	-	3	575	c.576T>C	c.(574-576)ctT>ctC	p.L192L	KCNMA1_ENST00000406533.3_Silent_p.L192L|KCNMA1_ENST00000404857.1_Silent_p.L192L|KCNMA1_ENST00000286627.5_Silent_p.L192L|KCNMA1_ENST00000372443.1_Silent_p.L192L|KCNMA1_ENST00000404771.3_Silent_p.L192L|KCNMA1_ENST00000372440.1_Silent_p.L192L|KCNMA1_ENST00000354353.5_Silent_p.L192L	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	192					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	AGTATATTACAAGTGCACCGA	0.363											OREG0020289	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L192L		.											.	KCNMA1	93	0			c.T576C						.						124.0	123.0	123.0					10																	79010979		2203	4300	6503	SO:0001819	synonymous_variant	3778	exon3			TATTACAAGTGCA	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.576T>C	10.37:g.79010979A>G		Somatic	54.0	0.0	1187	WXS	Illumina HiSeq	.	33.0	6.0	NM_002247	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Silent	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.837|9.837	1.190001|1.190001	0.21954|0.21954	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372421|ENST00000372403	.|T	.|0.50548	.|0.74	5.33|5.33	4.15|4.15	0.48705|0.48705	.|.	.|0.065122	.|0.64402	.|D	.|0.000006	T|T	0.58807|0.58807	0.2148|0.2148	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.61197|0.61197	-0.7111|-0.7111	4|7	.|0.87932	.|D	.|0	-8.9936|-8.9936	10.3422|10.3422	0.43884|0.43884	0.9238:0.0:0.0762:0.0|0.9238:0.0:0.0762:0.0	.|.	.|.	.|.	.|.	R|S	181|143	.|ENSP00000361480:L143S	.|ENSP00000361480:L143S	C|L	-|-	1|2	0|0	KCNMA1|KCNMA1	78680985|78680985	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.717000|4.717000	0.61923|0.61923	0.924000|0.924000	0.37069|0.37069	0.528000|0.528000	0.53228|0.53228	TGT|TTG	.		0.363	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
KCNU1	157855	ucsc.edu;bcgsc.ca	37	8	36763242	36763242	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr8:36763242G>A	ENST00000399881.3	+	20	2063	c.2026G>A	c.(2026-2028)Gta>Ata	p.V676I		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	676					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TCAACATGATGTAGAACAAGA	0.428																																					p.V676I		.											.	KCNU1	23	0			c.G2026A						.						147.0	138.0	141.0					8																	36763242		1910	4116	6026	SO:0001583	missense	157855	exon20			CATGATGTAGAAC	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2026G>A	8.37:g.36763242G>A	ENSP00000382770:p.Val676Ile	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001031836		Missense_Mutation	SNP	ENST00000399881.3	37	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	G	10.03	1.238989	0.22711	.	.	ENSG00000215262	ENST00000399881	T	0.30182	1.54	4.77	-9.35	0.00633	.	.	.	.	.	T	0.17023	0.0409	L	0.34521	1.04	0.09310	N	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.21245	-1.0251	9	0.36615	T	0.2	-2.7597	7.3314	0.26584	0.3403:0.2323:0.4274:0.0	.	676	A8MYU2	KCNU1_HUMAN	I	676	ENSP00000382770:V676I	ENSP00000382770:V676I	V	+	1	0	KCNU1	36882400	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.898000	0.04105	-1.922000	0.01067	-1.512000	0.00943	GTA	.		0.428	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
KCNU1	157855	ucsc.edu;bcgsc.ca	37	8	36776402	36776402	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr8:36776402C>A	ENST00000399881.3	+	23	2620	c.2583C>A	c.(2581-2583)atC>atA	p.I861I		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	861					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AAGTCCCTATCCTTACTGAAC	0.358																																					p.I861I		.											.	KCNU1	23	0			c.C2583A						.						115.0	107.0	110.0					8																	36776402		1835	4085	5920	SO:0001819	synonymous_variant	157855	exon23			CCCTATCCTTACT	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2583C>A	8.37:g.36776402C>A		Somatic	37.0	0.0		WXS	Illumina HiSeq	.	44.0	5.0	NM_001031836		Silent	SNP	ENST00000399881.3	37	CCDS55220.1																																																																																			.		0.358	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
AREL1	9870	ucsc.edu;bcgsc.ca	37	14	75139644	75139644	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr14:75139644T>C	ENST00000356357.4	-	11	1827	c.1312A>G	c.(1312-1314)Acc>Gcc	p.T438A	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	438					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TCCTGAAAGGTCTCAGAGCCT	0.512																																					p.T438A		.											.	KIAA0317	525	0			c.A1312G						.						108.0	104.0	105.0					14																	75139644		2005	4182	6187	SO:0001583	missense	9870	exon11			GAAAGGTCTCAGA	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1312A>G	14.37:g.75139644T>C	ENSP00000348714:p.Thr438Ala	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	52.0	4.0	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	CCDS41971.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.830764	0.91036	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.51817	0.69;0.69	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.66925	0.2839	M	0.69358	2.11	0.80722	D	1	D;P	0.61697	0.99;0.947	D;P	0.70935	0.971;0.471	T	0.67757	-0.5588	10	0.52906	T	0.07	.	16.2215	0.82262	0.0:0.0:0.0:1.0	.	438;438	O15033-2;O15033	.;K0317_HUMAN	A	438;277;277	ENSP00000348714:T438A;ENSP00000452101:T277A	ENSP00000348714:T438A	T	-	1	0	KIAA0317	74209397	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.972000	0.88022	2.367000	0.80283	0.529000	0.55759	ACC	.		0.512	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
KIAA1211L	343990	ucsc.edu;bcgsc.ca	37	2	99443572	99443572	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:99443572T>C	ENST00000397899.2	-	6	932	c.601A>G	c.(601-603)Aac>Gac	p.N201D	KIAA1211L_ENST00000462314.1_5'UTR	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	201																	GCCAGGCTGTTGTCTGAGATC	0.567																																					p.N201D		.											.	.	.	0			c.A601G						.						96.0	102.0	100.0					2																	99443572		2137	4260	6397	SO:0001583	missense	343990	exon6			GGCTGTTGTCTGA	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.601A>G	2.37:g.99443572T>C	ENSP00000380996:p.Asn201Asp	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_207362		Missense_Mutation	SNP	ENST00000397899.2	37	CCDS42720.1	.	.	.	.	.	.	.	.	.	.	T	7.277	0.608391	0.14002	.	.	ENSG00000196872	ENST00000397899;ENST00000423771	T	0.42513	0.97	5.05	1.37	0.22104	.	0.300453	0.29616	N	0.011658	T	0.20536	0.0494	N	0.08118	0	0.20403	N	0.9999	B	0.22211	0.066	B	0.21708	0.036	T	0.15838	-1.0423	10	0.54805	T	0.06	-2.1243	7.1778	0.25755	0.0:0.2713:0.0:0.7287	.	201	Q6NV74	CB055_HUMAN	D	201;229	ENSP00000380996:N201D	ENSP00000380996:N201D	N	-	1	0	C2orf55	98810004	1.000000	0.71417	0.881000	0.34555	0.039000	0.13416	1.413000	0.34725	0.084000	0.17077	-0.441000	0.05720	AAC	.		0.567	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
KIAA1804	84451	ucsc.edu;bcgsc.ca	37	1	233489583	233489583	+	Silent	SNP	C	C	A	rs373750664		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:233489583C>A	ENST00000366624.3	+	3	1278	c.1017C>A	c.(1015-1017)acC>acA	p.T339T	MLK4_ENST00000366623.3_Silent_p.T339T	NM_032435.2	NP_115811.2																					AACTGCTCACCGGAGAAGTCC	0.507																																					p.T339T		.											.	KIAA1804	523	0			c.C1017A						.						102.0	98.0	99.0					1																	233489583		2203	4300	6503	SO:0001819	synonymous_variant	0	exon3			GCTCACCGGAGAA																												ENST00000366624.3:c.1017C>A	1.37:g.233489583C>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	.	54.0	5.0	NM_032435		Silent	SNP	ENST00000366624.3	37	CCDS1598.1																																																																																			.		0.507	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
KIAA1958	158405	ucsc.edu;bcgsc.ca	37	9	115337283	115337283	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr9:115337283T>C	ENST00000337530.6	+	2	1219	c.923T>C	c.(922-924)aTg>aCg	p.M308T	KIAA1958_ENST00000374244.3_Missense_Mutation_p.M308T|KIAA1958_ENST00000536272.1_Missense_Mutation_p.M308T	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	308										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CAGGTGGCCATGCAAATGCCT	0.532																																					p.M308T		.											.	KIAA1958	91	0			c.T923C						.						279.0	258.0	265.0					9																	115337283		2203	4300	6503	SO:0001583	missense	158405	exon2			TGGCCATGCAAAT	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.923T>C	9.37:g.115337283T>C	ENSP00000336940:p.Met308Thr	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	37	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.889794	0.33348	.	.	ENSG00000165185	ENST00000337530;ENST00000374244;ENST00000536272	T;T;T	0.40476	1.03;1.03;1.03	5.92	5.92	0.95590	.	0.205916	0.44483	D	0.000455	T	0.27349	0.0671	N	0.14661	0.345	0.43798	D	0.996344	B;B	0.25904	0.007;0.137	B;B	0.20767	0.012;0.031	T	0.09662	-1.0664	10	0.17832	T	0.49	-13.8043	16.3648	0.83312	0.0:0.0:0.0:1.0	.	308;308	B7ZKW6;Q8N8K9	.;K1958_HUMAN	T	308	ENSP00000336940:M308T;ENSP00000363362:M308T;ENSP00000440504:M308T	ENSP00000336940:M308T	M	+	2	0	KIAA1958	114377104	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.598000	0.67585	2.263000	0.75096	0.533000	0.62120	ATG	.		0.532	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
KIF20B	9585	ucsc.edu;bcgsc.ca	37	10	91469127	91469127	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:91469127A>G	ENST00000371728.3	+	4	325	c.260A>G	c.(259-261)cAg>cGg	p.Q87R	KIF20B_ENST00000260753.4_Missense_Mutation_p.Q87R|KIF20B_ENST00000416354.1_Missense_Mutation_p.Q87R|KIF20B_ENST00000394289.2_Missense_Mutation_p.Q87R	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	87	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CTGGATTCACAGACTGTTGTG	0.358																																					p.Q87R		.											.	KIF20B	93	0			c.A260G						.						124.0	122.0	122.0					10																	91469127		2203	4300	6503	SO:0001583	missense	9585	exon4			ATTCACAGACTGT	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.260A>G	10.37:g.91469127A>G	ENSP00000360793:p.Gln87Arg	Somatic	87.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	18.79	3.698827	0.68501	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728;ENST00000439656;ENST00000447580	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;2.34	5.26	1.25	0.21368	Kinesin, motor domain (4);	0.928896	0.08949	N	0.870346	T	0.60689	0.2288	N	0.12569	0.235	0.23994	N	0.996234	D;B	0.53462	0.96;0.037	P;B	0.56563	0.801;0.184	T	0.51309	-0.8722	10	0.17832	T	0.49	0.0171	5.9564	0.19275	0.453:0.3587:0.1883:0.0	.	87;87	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	R	87	ENSP00000260753:Q87R;ENSP00000411545:Q87R;ENSP00000377830:Q87R;ENSP00000360793:Q87R;ENSP00000390946:Q87R	ENSP00000260753:Q87R	Q	+	2	0	KIF20B	91459107	0.998000	0.40836	0.992000	0.48379	0.855000	0.48748	2.041000	0.41213	0.404000	0.25506	0.533000	0.62120	CAG	.		0.358	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
KIF20B	9585	ucsc.edu;bcgsc.ca	37	10	91469218	91469218	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:91469218G>T	ENST00000371728.3	+	4	416	c.351G>T	c.(349-351)aaG>aaT	p.K117N	KIF20B_ENST00000260753.4_Splice_Site_p.K117N|KIF20B_ENST00000416354.1_Splice_Site_p.K117N|KIF20B_ENST00000394289.2_Splice_Site_p.K117N	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	117	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GTTTTTCCAAGGTAAAACTGA	0.348																																					p.K117N		.											.	KIF20B	93	0			c.G351T						.						72.0	73.0	73.0					10																	91469218		2203	4300	6503	SO:0001630	splice_region_variant	9585	exon4			TTCCAAGGTAAAA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.351+1G>T	10.37:g.91469218G>T		Somatic	70.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	G	19.10	3.761310	0.69763	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728;ENST00000439656;ENST00000447580	T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98	5.13	3.27	0.37495	Kinesin, motor domain (4);	0.000000	0.49916	D	0.000121	T	0.70055	0.3180	N	0.25957	0.775	0.38362	D	0.944646	D;B	0.61697	0.99;0.108	P;B	0.60012	0.867;0.107	T	0.68450	-0.5405	10	0.37606	T	0.19	-3.1717	5.2161	0.15344	0.2449:0.0:0.612:0.1432	.	117;117	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	N	117	ENSP00000260753:K117N;ENSP00000411545:K117N;ENSP00000377830:K117N;ENSP00000360793:K117N;ENSP00000390946:K117N	ENSP00000260753:K117N	K	+	3	2	KIF20B	91459198	0.334000	0.24739	0.988000	0.46212	0.921000	0.55340	0.315000	0.19451	0.662000	0.31006	0.561000	0.74099	AAG	.		0.348	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	Missense_Mutation
KRT76	51350	ucsc.edu;bcgsc.ca	37	12	53169279	53169279	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:53169279G>T	ENST00000332411.2	-	2	761	c.708C>A	c.(706-708)tcC>tcA	p.S236S		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	236	Linker 1.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						AGCTGATGTAGGATTCAAAAC	0.552																																					p.S236S		.											.	KRT76	154	0			c.C708A						.						140.0	142.0	141.0					12																	53169279		2203	4300	6503	SO:0001819	synonymous_variant	51350	exon2			GATGTAGGATTCA	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.708C>A	12.37:g.53169279G>T		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	49.0	5.0	NM_015848	B4DRR3|Q7Z795	Silent	SNP	ENST00000332411.2	37	CCDS8838.1																																																																																			.		0.552	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405928.1	NM_015848	
LAS1L	81887	ucsc.edu;bcgsc.ca	37	X	64744886	64744886	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:64744886G>T	ENST00000374811.3	-	8	1041	c.1001C>A	c.(1000-1002)cCc>cAc	p.P334H	LAS1L_ENST00000312391.8_3'UTR|LAS1L_ENST00000374807.5_Missense_Mutation_p.P334H|LAS1L_ENST00000374804.5_Missense_Mutation_p.P292H	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	334					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						TTCAAATGTGGGGACAAGGAA	0.507																																					p.P334H		.											.	LAS1L	196	0			c.C1001A						.						109.0	86.0	93.0					X																	64744886		2203	4300	6503	SO:0001583	missense	81887	exon8			AATGTGGGGACAA	BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1001C>A	X.37:g.64744886G>T	ENSP00000363944:p.Pro334His	Somatic	71.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_031206	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	ENST00000374811.3	37	CCDS14381.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293581	0.60086	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.77391	0.4123	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.997	T	0.80044	-0.1547	9	0.87932	D	0	.	13.4085	0.60929	0.0:0.0:1.0:0.0	.	292;334;334	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2	.;.;LAS1L_HUMAN	H	334;334;292	.	ENSP00000363937:P292H	P	-	2	0	LAS1L	64661611	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.096000	0.71446	2.229000	0.72834	0.600000	0.82982	CCC	.		0.507	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206	
LINGO3	645191	ucsc.edu;bcgsc.ca	37	19	2290770	2290770	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:2290770T>C	ENST00000585527.1	-	1	1253	c.1006A>G	c.(1006-1008)Agc>Ggc	p.S336G	LINGO3_ENST00000404279.1_Missense_Mutation_p.S336G			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	336						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						TGGAAGGTGCTCTCCTCCAAC	0.667																																					p.S336G		.											.	.	.	0			c.A1006G						.						26.0	31.0	29.0					19																	2290770		2048	4179	6227	SO:0001583	missense	645191	exon2			AGGTGCTCTCCTC	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1006A>G	19.37:g.2290770T>C	ENSP00000467753:p.Ser336Gly	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	47.0	5.0	NM_001101391		Missense_Mutation	SNP	ENST00000585527.1	37	CCDS45905.1	.	.	.	.	.	.	.	.	.	.	t	8.860	0.946803	0.18356	.	.	ENSG00000220008	ENST00000404279	T	0.79749	-1.3	4.62	-2.39	0.06602	.	.	.	.	.	T	0.48995	0.1531	N	0.02225	-0.63	0.34119	D	0.663947	B	0.10296	0.003	B	0.14578	0.011	T	0.32877	-0.9890	9	0.18710	T	0.47	.	3.3686	0.07212	0.3147:0.2503:0.0:0.435	.	336	P0C6S8	LIGO3_HUMAN	G	336	ENSP00000384979:S336G	ENSP00000384979:S336G	S	-	1	0	LINGO3	2241770	0.998000	0.40836	0.611000	0.29010	0.992000	0.81027	0.776000	0.26704	-0.640000	0.05495	0.379000	0.24179	AGC	.		0.667	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391	
LONRF3	79836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	118148215	118148215	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:118148215G>A	ENST00000371628.3	+	10	2051	c.2020G>A	c.(2020-2022)Gtc>Atc	p.V674I	LONRF3_ENST00000422289.2_Missense_Mutation_p.V418I|LONRF3_ENST00000304778.7_Missense_Mutation_p.V633I|LONRF3_ENST00000472173.1_3'UTR	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	674	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						ACATAACTGTGTCTATCAGCA	0.448																																					p.V674I		.											.	LONRF3	289	0			c.G2020A						.						332.0	266.0	288.0					X																	118148215		2203	4300	6503	SO:0001583	missense	79836	exon10			AACTGTGTCTATC	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.2020G>A	X.37:g.118148215G>A	ENSP00000360690:p.Val674Ile	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	60.0	NM_001031855	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	CCDS35374.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.224584|5.224584	0.95139|0.95139	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000439603|ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289	T|T;T;T;T	0.40756|0.36340	1.02|1.26;1.26;1.26;1.26	5.7|5.7	5.7|5.7	0.88788|0.88788	.|Peptidase S16, lon N-terminal (1);PUA-like domain (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.67785|0.67785	0.2930|0.2930	M|M	0.88310|0.88310	2.945|2.945	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.995;0.996;0.999	T|T	0.74657|0.74657	-0.3592|-0.3592	7|10	0.56958|0.87932	D|D	0.05|0	-47.094|-47.094	17.6221|17.6221	0.88084|0.88084	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|418;633;674	.|B3KUN7;Q496Y0-2;Q496Y0	.|.;.;LONF3_HUMAN	Y|I	439|633;633;674;418	ENSP00000414519:C439Y|ENSP00000360691:V633I;ENSP00000307732:V633I;ENSP00000360690:V674I;ENSP00000408894:V418I	ENSP00000414519:C439Y|ENSP00000307732:V633I	C|V	+|+	2|1	0|0	LONRF3|LONRF3	118032243|118032243	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	9.869000|9.869000	0.99810|0.99810	2.377000|2.377000	0.81083|0.81083	0.600000|0.600000	0.82982|0.82982	TGT|GTC	.		0.448	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778	
LRP1	4035	ucsc.edu;bcgsc.ca	37	12	57548458	57548458	+	Missense_Mutation	SNP	C	C	A	rs551728223		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:57548458C>A	ENST00000243077.3	+	8	1667	c.1201C>A	c.(1201-1203)Cgc>Agc	p.R401S	LRP1_ENST00000554174.1_Missense_Mutation_p.R401S	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	401					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGGCAAGGGCCGCCAGACCAT	0.577																																					p.R401S		.											.	LRP1	596	0			c.C1201A						.						42.0	37.0	39.0					12																	57548458		2198	4295	6493	SO:0001583	missense	4035	exon8			AAGGGCCGCCAGA	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.1201C>A	12.37:g.57548458C>A	ENSP00000243077:p.Arg401Ser	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084357	0.55861	.	.	ENSG00000123384	ENST00000243077;ENST00000554174	D;D	0.91631	-2.88;-2.88	4.53	4.53	0.55603	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000008	D	0.96396	0.8824	M	0.92833	3.35	0.51233	D	0.999917	D;D	0.89917	0.993;1.0	D;D	0.91635	0.972;0.999	D	0.96223	0.9162	10	0.62326	D	0.03	.	10.2449	0.43334	0.1976:0.8024:0.0:0.0	.	401;401	Q07954;Q6PJ72	LRP1_HUMAN;.	S	401	ENSP00000243077:R401S;ENSP00000451737:R401S	ENSP00000243077:R401S	R	+	1	0	LRP1	55834725	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	1.324000	0.33712	2.521000	0.84997	0.650000	0.86243	CGC	.		0.577	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRRC10	376132	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	70004150	70004150	+	Missense_Mutation	SNP	G	G	T	rs201257055		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:70004150G>T	ENST00000361484.3	-	1	792	c.469C>A	c.(469-471)Cgt>Agt	p.R157S		NM_201550.2	NP_963844.2	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	157					cardiac muscle cell development (GO:0055013)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sarcomere (GO:0030017)				large_intestine(2)|lung(6)	8	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GGCAGCAAACGCAGGGCGTTG	0.627																																					p.R157S		.											.	LRRC10	514	0			c.C469A						.						45.0	46.0	45.0					12																	70004150		2203	4300	6503	SO:0001583	missense	376132	exon1			GCAAACGCAGGGC	AK095935	CCDS31856.1	12q15	2009-09-08				ENSG00000198812			20264	protein-coding gene	gene with protein product		610846				14751244	Standard	NM_201550		Approved	HRLRRP, LRRC10A	uc001svc.3	Q5BKY1		ENST00000361484.3:c.469C>A	12.37:g.70004150G>T	ENSP00000355166:p.Arg157Ser	Somatic	35.0	1.0		WXS	Illumina HiSeq	Phase_I	43.0	18.0	NM_201550	Q6ZVY4	Missense_Mutation	SNP	ENST00000361484.3	37	CCDS31856.1	.	.	.	.	.	.	.	.	.	.	G	15.66	2.898837	0.52227	.	.	ENSG00000198812	ENST00000361484	T	0.21361	2.01	5.62	4.73	0.59995	.	0.201056	0.53938	D	0.000047	T	0.22551	0.0544	M	0.71036	2.16	0.45439	D	0.998411	P	0.37276	0.589	B	0.35278	0.199	T	0.05321	-1.0892	10	0.08381	T	0.77	.	14.5997	0.68432	0.07:0.0:0.93:0.0	.	157	Q5BKY1	LRC10_HUMAN	S	157	ENSP00000355166:R157S	ENSP00000355166:R157S	R	-	1	0	LRRC10	68290417	1.000000	0.71417	0.992000	0.48379	0.892000	0.51952	3.988000	0.56951	1.518000	0.48934	0.555000	0.69702	CGT	G|0.999;A|0.001		0.627	LRRC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403834.1	NM_201550	
LRRC45	201255	ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79984801	79984801	+	Missense_Mutation	SNP	C	C	T	rs202017922	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:79984801C>T	ENST00000306688.3	+	6	1030	c.688C>T	c.(688-690)Cgg>Tgg	p.R230W		NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	230						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CAGCCAGGACCGGCTCACCAC	0.637													C|||	3	0.000599042	0.0	0.0043	5008	,	,		18961	0.0		0.0	False		,,,				2504	0.0				p.R230W		.											.	LRRC45	91	0			c.C688T						.						62.0	44.0	50.0					17																	79984801		2187	4292	6479	SO:0001583	missense	201255	exon6			CAGGACCGGCTCA	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.688C>T	17.37:g.79984801C>T	ENSP00000306760:p.Arg230Trp	Somatic	24.0	0.0		WXS	Illumina HiSeq	.	31.0	8.0	NM_144999		Missense_Mutation	SNP	ENST00000306688.3	37	CCDS11797.1	16	0.007326007326007326	6	0.012195121951219513	5	0.013812154696132596	2	0.0034965034965034965	3	0.00395778364116095	C	12.26	1.885864	0.33348	.	.	ENSG00000169683	ENST00000306688	T	0.54279	0.58	4.2	0.622	0.17648	.	0.188727	0.39687	N	0.001281	T	0.59932	0.2230	M	0.76328	2.33	0.34572	D	0.713505	D	0.89917	1.0	D	0.67548	0.952	T	0.74774	-0.3551	9	.	.	.	-33.8073	13.3548	0.60621	0.5058:0.4942:0.0:0.0	.	230	Q96CN5	LRC45_HUMAN	W	230	ENSP00000306760:R230W	.	R	+	1	2	LRRC45	77578090	0.426000	0.25506	0.384000	0.26145	0.091000	0.18340	0.740000	0.26188	0.382000	0.24878	-0.291000	0.09656	CGG	C|0.993;T|0.007		0.637	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442058.1	NM_144999	
LTBP3	4054	ucsc.edu;bcgsc.ca	37	11	65314942	65314942	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:65314942C>A	ENST00000301873.5	-	14	2343	c.2075G>T	c.(2074-2076)cGg>cTg	p.R692L	LTBP3_ENST00000532932.1_Missense_Mutation_p.R122L|LTBP3_ENST00000322147.4_Missense_Mutation_p.R692L|LTBP3_ENST00000530785.1_5'Flank|LTBP3_ENST00000529189.1_5'Flank|LTBP3_ENST00000536982.1_Missense_Mutation_p.R318L	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	692	Cys-rich.|EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						GGCTTTGAGCCGGTAGCCGGG	0.622																																					p.R692L		.											.	LTBP3	91	0			c.G2075T						.						72.0	81.0	78.0					11																	65314942		2201	4297	6498	SO:0001583	missense	4054	exon14			TTGAGCCGGTAGC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.2075G>T	11.37:g.65314942C>A	ENSP00000301873:p.Arg692Leu	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	51.0	5.0	NM_001130144	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	37	CCDS44647.1	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208731	0.39003	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866;ENST00000527339	T;T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76;1.76	4.78	4.78	0.61160	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.407995	0.23551	N	0.046964	T	0.38746	0.1052	L	0.45698	1.435	0.44619	D	0.997591	P;D;D;D;D;P	0.69078	0.929;0.997;0.982;0.964;0.997;0.941	P;P;P;P;P;P	0.61328	0.644;0.842;0.7;0.644;0.887;0.758	T	0.04737	-1.0930	10	0.33141	T	0.24	.	13.3157	0.60405	0.0:1.0:0.0:0.0	.	603;318;575;692;692;122	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2	.;.;.;LTBP3_HUMAN;.;.	L	692;692;122;318;603;32	ENSP00000326647:R692L;ENSP00000301873:R692L;ENSP00000435530:R122L;ENSP00000441912:R318L;ENSP00000435276:R603L;ENSP00000432121:R32L	ENSP00000301873:R692L	R	-	2	0	LTBP3	65071518	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	4.508000	0.60441	2.199000	0.70637	0.313000	0.20887	CGG	.		0.622	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
LZIC	84328	ucsc.edu;bcgsc.ca	37	1	9992006	9992006	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:9992006A>G	ENST00000377223.1	-	7	704	c.457T>C	c.(457-459)Ttg>Ctg	p.L153L	LZIC_ENST00000541052.1_Silent_p.L174L|LZIC_ENST00000400903.2_Silent_p.L153L|LZIC_ENST00000377213.1_Silent_p.L153L	NM_032368.3	NP_115744.2	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing	153					response to ionizing radiation (GO:0010212)					breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		TTTGCTGACAAGAAGGCCTCA	0.428																																					p.L153L		.											.	LZIC	90	0			c.T457C						.						94.0	85.0	88.0					1																	9992006		2203	4300	6503	SO:0001819	synonymous_variant	84328	exon6			CTGACAAGAAGGC	AB060688	CCDS107.1	1p36.22	2008-02-05			ENSG00000162441	ENSG00000162441			17497	protein-coding gene	gene with protein product		610458				11712074	Standard	NM_032368		Approved	MGC15436	uc001aqm.3	Q8WZA0	OTTHUMG00000001804	ENST00000377223.1:c.457T>C	1.37:g.9992006A>G		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_032368	B2R6F0|B4E2N0|Q96IU1	Silent	SNP	ENST00000377223.1	37	CCDS107.1																																																																																			.		0.428	LZIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005037.1	NM_032368	
MAEA	10296	ucsc.edu;bcgsc.ca	37	4	1321427	1321427	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:1321427T>C	ENST00000303400.4	+	5	655	c.592T>C	c.(592-594)Ttc>Ctc	p.F198L	MAEA_ENST00000510794.1_Missense_Mutation_p.F197L|MAEA_ENST00000505177.2_Missense_Mutation_p.F236L|MAEA_ENST00000505839.1_Missense_Mutation_p.F150L|MAEA_ENST00000514708.1_Intron|MAEA_ENST00000452175.2_Missense_Mutation_p.F119L|MAEA_ENST00000264750.6_Missense_Mutation_p.F157L	NM_001017405.1	NP_001017405.1	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher	198	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cytoskeleton organization (GO:0007010)|enucleate erythrocyte development (GO:0048822)|erythrocyte maturation (GO:0043249)|negative regulation of myeloid cell apoptotic process (GO:0033033)|regulation of mitotic cell cycle (GO:0007346)	actomyosin contractile ring (GO:0005826)|cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(23;0.0201)		WF10(DB05389)	CTGCCTGGAGTTCAGCCTCAG	0.597																																					p.F198L		.											.	MAEA	91	0			c.T592C						.						110.0	96.0	101.0					4																	1321427		2203	4300	6503	SO:0001583	missense	10296	exon5			CTGGAGTTCAGCC	AF084928	CCDS33936.1, CCDS33937.1, CCDS75090.1	4p16.3	2012-07-20			ENSG00000090316	ENSG00000090316			13731	protein-coding gene	gene with protein product	"""GID complex subunit 9, FYV10 homolog (S. cerevisiae)"""	606801				9763581	Standard	XM_005272243		Approved	EMP, GID9	uc003gda.3	Q7L5Y9	OTTHUMG00000160169	ENST00000303400.4:c.592T>C	4.37:g.1321427T>C	ENSP00000302830:p.Phe198Leu	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_001017405	O95285|Q5JB54|Q6ZRD6|Q9BQ11|Q9H9V6|Q9H9Z4|Q9NW84	Missense_Mutation	SNP	ENST00000303400.4	37	CCDS33936.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.351984	0.82132	.	.	ENSG00000090316	ENST00000303400;ENST00000505177;ENST00000264750;ENST00000539495;ENST00000502558;ENST00000452175;ENST00000510794;ENST00000505839	T;T;T;T;T;T	0.60040	0.22;0.35;0.64;0.4;0.38;0.22	5.43	5.43	0.79202	CTLH, C-terminal LisH motif (2);	0.048118	0.85682	N	0.000000	T	0.60586	0.2280	M	0.76727	2.345	0.80722	D	1	B;B;P;P;B	0.42296	0.009;0.007;0.658;0.775;0.051	B;B;B;B;B	0.40602	0.059;0.042;0.251;0.334;0.077	T	0.65977	-0.6037	10	0.51188	T	0.08	-2.3255	15.1288	0.72503	0.0:0.0:0.0:1.0	.	197;236;157;157;198	B4DVN3;E7ESC7;Q7L5Y9-2;Q7L5Y9-3;Q7L5Y9	.;.;.;.;MAEA_HUMAN	L	198;236;157;177;130;119;197;150	ENSP00000302830:F198L;ENSP00000422215:F236L;ENSP00000264750:F157L;ENSP00000426903:F130L;ENSP00000411415:F119L;ENSP00000426807:F197L	ENSP00000264750:F157L	F	+	1	0	MAEA	1311427	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.479000	0.81095	2.053000	0.61076	0.523000	0.50628	TTC	.		0.597	MAEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359511.1	NM_005882	
MAGI2	9863	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	77649287	77649287	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:77649287G>T	ENST00000354212.4	-	22	3966	c.3713C>A	c.(3712-3714)cCc>cAc	p.P1238H	MAGI2_ENST00000419488.1_Missense_Mutation_p.P1224H|MAGI2_ENST00000522391.1_Missense_Mutation_p.P1268T	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1238					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CCAGGGGGCGGGTTCGTCTGT	0.692																																					p.P1238H		.											.	MAGI2	461	0			c.C3713A						.						17.0	23.0	21.0					7																	77649287		2199	4298	6497	SO:0001583	missense	9863	exon22			GGGGCGGGTTCGT	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3713C>A	7.37:g.77649287G>T	ENSP00000346151:p.Pro1238His	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	6.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	16.72|16.72	3.201054|3.201054	0.58234|0.58234	.|.	.|.	ENSG00000187391|ENSG00000187391	ENST00000419488;ENST00000354212|ENST00000522391	T;T|T	0.11604|0.10573	2.76;2.76|2.86	4.17|4.17	4.17|4.17	0.49024|0.49024	PDZ/DHR/GLGF (1);|.	.|.	.|.	.|.	.|.	T|T	0.13543|0.13543	0.0328|0.0328	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	P;D|.	0.69078|.	0.535;0.997|.	B;P|.	0.53912|.	0.087;0.737|.	T|T	0.17018|0.17018	-1.0383|-1.0383	9|7	0.38643|0.44086	T|T	0.18|0.13	.|.	16.8995|16.8995	0.86109|0.86109	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1224;1238|.	Q86UL8-2;Q86UL8|.	.;MAGI2_HUMAN|.	H|T	1224;1238|1268	ENSP00000405766:P1224H;ENSP00000346151:P1238H|ENSP00000428389:P1268T	ENSP00000346151:P1238H|ENSP00000428389:P1268T	P|P	-|-	2|1	0|0	MAGI2|MAGI2	77487223|77487223	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.902000|0.902000	0.53008|0.53008	8.610000|8.610000	0.90902|0.90902	2.030000|2.030000	0.59900|0.59900	0.639000|0.639000	0.83563|0.83563	CCC|CCG	.		0.692	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
MAN2B2	23324	ucsc.edu;bcgsc.ca	37	4	6611693	6611693	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:6611693C>A	ENST00000285599.3	+	13	2211	c.2175C>A	c.(2173-2175)agC>agA	p.S725R	MAN2B2_ENST00000504248.1_Missense_Mutation_p.S674R|MAN2B2_ENST00000504960.1_3'UTR	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	725					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						ACCTAAACAGCCAGCAGGTCA	0.592																																					p.S725R		.											.	MAN2B2	92	0			c.C2175A						.						89.0	82.0	84.0					4																	6611693		2203	4300	6503	SO:0001583	missense	23324	exon13			AAACAGCCAGCAG	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.2175C>A	4.37:g.6611693C>A	ENSP00000285599:p.Ser725Arg	Somatic	98.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_015274	Q66MP2|Q86T67	Missense_Mutation	SNP	ENST00000285599.3	37	CCDS33951.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	8.065|8.065	0.768889|0.768889	0.15983|0.15983	.|.	.|.	ENSG00000013288|ENSG00000013288	ENST00000505907|ENST00000285599;ENST00000504248	.|D;D	.|0.85955	.|-2.05;-2.05	3.98|3.98	2.0|2.0	0.26442|0.26442	.|Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	.|0.452872	.|0.24561	.|N	.|0.037478	T|T	0.80747|0.80747	0.4682|0.4682	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	1|1	.|B;P;P	.|0.44877	.|0.25;0.724;0.845	.|B;B;P	.|0.44860	.|0.309;0.424;0.462	T|T	0.72874|0.72874	-0.4160|-0.4160	5|10	.|0.87932	.|D	.|0	-15.7897|-15.7897	4.7345|4.7345	0.12981|0.12981	0.1559:0.5476:0.0:0.2965|0.1559:0.5476:0.0:0.2965	.|.	.|674;725;725	.|E9PCD7;Q9Y2E5;Q9Y2E5-2	.|.;MA2B2_HUMAN;.	D|R	724|725;674	.|ENSP00000285599:S725R;ENSP00000423129:S674R	.|ENSP00000285599:S725R	A|S	+|+	2|3	0|2	MAN2B2|MAN2B2	6662594|6662594	0.001000|0.001000	0.12720|0.12720	0.006000|0.006000	0.13384|0.13384	0.257000|0.257000	0.26127|0.26127	0.043000|0.043000	0.13971|0.13971	0.676000|0.676000	0.31285|0.31285	0.558000|0.558000	0.71614|0.71614	GCC|AGC	.		0.592	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
MAP1A	4130	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43816465	43816465	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:43816465T>C	ENST00000300231.5	+	4	3244	c.2794T>C	c.(2794-2796)Ttg>Ctg	p.L932L	MAP1A_ENST00000382031.1_Silent_p.L1170L|MAP1A_ENST00000399453.1_Silent_p.L932L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	932					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGGGAAAGGCTTGTCTGGAGA	0.493																																					p.L932L		.											.	MAP1A	141	0			c.T2794C						.						77.0	78.0	78.0					15																	43816465		1978	4159	6137	SO:0001819	synonymous_variant	4130	exon4			AAAGGCTTGTCTG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.2794T>C	15.37:g.43816465T>C		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	7.0	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Silent	SNP	ENST00000300231.5	37	CCDS42031.1																																																																																			.		0.493	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
MCHR1	2847	ucsc.edu;bcgsc.ca	37	22	41077417	41077417	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr22:41077417A>G	ENST00000249016.4	+	2	1450	c.754A>G	c.(754-756)Aga>Gga	p.R252G	MCHR1_ENST00000381433.2_Intron|MCHR1_ENST00000498400.1_3'UTR	NM_005297.3	NP_005288.3	Q99705	MCHR1_HUMAN	melanin-concentrating hormone receptor 1	252					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|melanin-concentrating hormone receptor activity (GO:0030273)|neuropeptide receptor activity (GO:0008188)			endometrium(5)|large_intestine(7)|lung(6)|pancreas(1)|urinary_tract(1)	20						GCTGTATGCCAGACTCATCCC	0.602																																					p.R252G		.											.	MCHR1	90	0			c.A754G						.						96.0	77.0	83.0					22																	41077417		2203	4300	6503	SO:0001583	missense	2847	exon2			TATGCCAGACTCA		CCDS14004.1	22q13.3	2014-06-05	2006-02-15	2006-02-15	ENSG00000128285	ENSG00000128285		"""GPCR / Class A : MCH receptors"""	4479	protein-coding gene	gene with protein product		601751	"""G protein-coupled receptor 24"""	GPR24			Standard	XM_005261581		Approved	SLC1, MCH1R	uc003ayz.3	Q99705	OTTHUMG00000150256	ENST00000249016.4:c.754A>G	22.37:g.41077417A>G	ENSP00000249016:p.Arg252Gly	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_005297	B2RBX6|Q5R3J1|Q96S47|Q9BV08	Missense_Mutation	SNP	ENST00000249016.4	37	CCDS14004.1	.	.	.	.	.	.	.	.	.	.	A	2.995	-0.207239	0.06180	.	.	ENSG00000128285	ENST00000249016	T	0.71579	-0.58	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.182530	0.64402	D	0.000014	T	0.42877	0.1222	N	0.02865	-0.47	0.80722	D	1	B	0.12013	0.005	B	0.16289	0.015	T	0.47249	-0.9132	10	0.02654	T	1	.	14.0955	0.65019	1.0:0.0:0.0:0.0	.	252	Q99705	MCHR1_HUMAN	G	252	ENSP00000249016:R252G	ENSP00000249016:R252G	R	+	1	2	MCHR1	39407363	0.071000	0.21146	1.000000	0.80357	0.983000	0.72400	0.543000	0.23237	2.070000	0.61991	0.533000	0.62120	AGA	.		0.602	MCHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317142.1	NM_005297	
MEF2A	4205	ucsc.edu;bcgsc.ca	37	15	100230447	100230447	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:100230447G>A	ENST00000557785.1	+	8	1021	c.672G>A	c.(670-672)ggG>ggA	p.G224G	MEF2A_ENST00000558812.1_Splice_Site_p.G156G|MEF2A_ENST00000449277.2_Splice_Site_p.G156G|MEF2A_ENST00000557942.1_Splice_Site_p.G224G|MEF2A_ENST00000453228.2_Splice_Site_p.G224G|MEF2A_ENST00000338042.6_Splice_Site_p.G224G|MEF2A_ENST00000354410.5_Splice_Site_p.G226G	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	226					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			TCCCCCCAGGGAATGGATTTG	0.388																																					p.G226G		.											.	MEF2A	455	0			c.G678A						.						30.0	27.0	28.0					15																	100230447		1794	4067	5861	SO:0001630	splice_region_variant	4205	exon8			CCCAGGGAATGGA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.671-1G>A	15.37:g.100230447G>A		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Silent	SNP	ENST00000557785.1	37	CCDS53978.1																																																																																			.		0.388	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		Silent
METTL21B	25895	ucsc.edu;bcgsc.ca	37	12	58163641	58163641	+	5'Flank	SNP	C	C	A	rs373817508		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:58163641C>A	ENST00000300209.8	+	0	0				METTL1_ENST00000548681.1_5'Flank|METTL1_ENST00000324871.7_Missense_Mutation_p.A125S|METTL21B_ENST00000333012.5_5'Flank|CYP27B1_ENST00000228606.4_5'Flank|METTL21B_ENST00000551420.1_5'Flank|METTL1_ENST00000257848.7_Intron|METTL21B_ENST00000548256.1_5'Flank	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						GCAGGAGCTGCGCGTAGGGCC	0.572																																					p.A125S		.											.	METTL1	492	0			c.G373T						.						61.0	56.0	58.0					12																	58163641		2203	4300	6503	SO:0001631	upstream_gene_variant	4234	exon3			GAGCTGCGCGTAG	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		12.37:g.58163641C>A	Exception_encountered	Somatic	68.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_005371	Q9H749|Q9Y3W2	Missense_Mutation	SNP	ENST00000300209.8	37	CCDS8957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.233|7.233	0.599731|0.599731	0.13939|0.13939	.|.	.|.	ENSG00000037897|ENSG00000037897	ENST00000324871|ENST00000548504	.|.	.|.	.|.	5.12|5.12	3.08|3.08	0.35506|0.35506	.|.	0.174320|.	0.48767|.	D|.	0.000170|.	T|T	0.51907|0.51907	0.1702|0.1702	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	B|.	0.18741|.	0.03|.	B|.	0.19666|.	0.026|.	T|T	0.56123|0.56123	-0.8031|-0.8031	9|6	0.09843|0.87932	T|D	0.71|0	-4.5997|-4.5997	10.4845|10.4845	0.44713|0.44713	0.1419:0.7759:0.0:0.0822|0.1419:0.7759:0.0:0.0822	.|.	125|.	Q9UBP6|.	TRMB_HUMAN|.	S|L	125|3	.|.	ENSP00000314441:A125S|ENSP00000449397:R3L	A|R	-|-	1|2	0|0	METTL1|METTL1	56449908|56449908	0.999000|0.999000	0.42202|0.42202	0.986000|0.986000	0.45419|0.45419	0.998000|0.998000	0.95712|0.95712	4.088000|4.088000	0.57678|0.57678	1.160000|1.160000	0.42584|0.42584	0.655000|0.655000	0.94253|0.94253	GCA|CGC	.		0.572	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
MEX3B	84206	ucsc.edu;bcgsc.ca	37	15	82336703	82336703	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:82336703G>T	ENST00000329713.4	-	2	943	c.508C>A	c.(508-510)Cgc>Agc	p.R170S	AC026956.1_ENST00000410589.1_RNA|MEX3B_ENST00000558133.1_3'UTR	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	170	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						CCCACCACGCGGTAGGGTACC	0.672																																					p.R170S		.											.	MEX3B	226	0			c.C508A						.						62.0	66.0	65.0					15																	82336703		2203	4300	6503	SO:0001583	missense	84206	exon2			CCACGCGGTAGGG	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.508C>A	15.37:g.82336703G>T	ENSP00000329918:p.Arg170Ser	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_032246	Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	ENST00000329713.4	37	CCDS10319.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000771	0.93227	.	.	ENSG00000183496	ENST00000329713	T	0.39406	1.08	4.5	4.5	0.54988	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.65333	0.2681	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.68432	-0.5410	10	0.49607	T	0.09	-32.0362	16.1203	0.81346	0.0:0.0:1.0:0.0	.	170	Q6ZN04	MEX3B_HUMAN	S	170	ENSP00000329918:R170S	ENSP00000329918:R170S	R	-	1	0	MEX3B	80123758	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.803000	0.69129	2.339000	0.79563	0.561000	0.74099	CGC	.		0.672	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304000.1	XM_290645	
MICAL1	64780	ucsc.edu;bcgsc.ca	37	6	109771587	109771587	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:109771587C>T	ENST00000358807.3	-	8	1418	c.1107G>A	c.(1105-1107)atG>atA	p.M369I	MICAL1_ENST00000368952.4_Missense_Mutation_p.M388I|MICAL1_ENST00000483856.1_5'Flank|MICAL1_ENST00000358577.3_Intron	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	369	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CTGCCCGCATCATGCTCGTGA	0.607																																					p.M369I		.											.	MICAL1	154	0			c.G1107A						.						53.0	56.0	55.0					6																	109771587		2203	4300	6503	SO:0001583	missense	64780	exon8			CCGCATCATGCTC	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1107G>A	6.37:g.109771587C>T	ENSP00000351664:p.Met369Ile	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580487	0.65992	.	.	ENSG00000135596	ENST00000358807;ENST00000368952	T;T	0.10860	2.83;2.83	4.5	4.5	0.54988	.	0.049259	0.85682	D	0.000000	T	0.16642	0.0400	L	0.61387	1.9	0.80722	D	1	B;D	0.52996	0.013;0.957	B;P	0.57101	0.008;0.813	T	0.00339	-1.1805	10	0.52906	T	0.07	.	15.0887	0.72177	0.0:1.0:0.0:0.0	.	388;369	B7Z3R5;Q8TDZ2	.;MICA1_HUMAN	I	369;388	ENSP00000351664:M369I;ENSP00000357948:M388I	ENSP00000351664:M369I	M	-	3	0	MICAL1	109878280	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.521000	0.81832	2.497000	0.84241	0.563000	0.77884	ATG	.		0.607	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
MIEN1	84299	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	37886014	37886014	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:37886014C>T	ENST00000394231.3	-	3	479	c.188G>A	c.(187-189)gGt>gAt	p.G63D	MIEN1_ENST00000474210.1_5'UTR|MIEN1_ENST00000577810.1_Splice_Site_p.G63D|ERBB2_ENST00000584888.1_Intron			Q9BRT3	MIEN1_HUMAN	migration and invasion enhancer 1	63					apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell migration (GO:0030335)|positive regulation of filopodium assembly (GO:0051491)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	selenium binding (GO:0008430)										CTCAAAGGCACCTGGTAAGAA	0.488																																					p.G63D		.											.	.	.	0			c.G188A						.						100.0	101.0	101.0					17																	37886014		2203	4300	6503	SO:0001630	splice_region_variant	84299	exon3			AAGGCACCTGGTA	AJ308025	CCDS11344.1	17q12	2011-09-21	2011-09-21	2011-09-21	ENSG00000141741	ENSG00000141741			28230	protein-coding gene	gene with protein product		611802	"""chromosome 17 open reading frame 37"""	C17orf37		17121940, 12739007, 17503775, 21628459	Standard	NM_032339		Approved	MGC14832, ORB3, XTP4, C35, Rdx12	uc002hsq.3	Q9BRT3	OTTHUMG00000133252	ENST00000394231.3:c.188-1G>A	17.37:g.37886014C>T		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	8.0	NM_032339		Missense_Mutation	SNP	ENST00000394231.3	37	CCDS11344.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861583	0.51482	.	.	ENSG00000141741	ENST00000394231	D	0.83163	-1.69	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.93223	0.7841	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.94089	0.7351	10	0.87932	D	0	.	18.8259	0.92119	0.0:1.0:0.0:0.0	.	63	Q9BRT3	MIEN1_HUMAN	D	63	ENSP00000377778:G63D	ENSP00000377778:G63D	G	-	2	0	C17orf37	35139540	1.000000	0.71417	1.000000	0.80357	0.531000	0.34715	5.115000	0.64655	2.746000	0.94184	0.591000	0.81541	GGT	.		0.488	MIEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257020.3	NM_032339	Missense_Mutation
MIR892A	100126342	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	145076315	145076315	+	RNA	SNP	A	A	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:145076315A>C	ENST00000401124.1	-	0	75				MIR888_ENST00000401186.1_RNA|hsa-mir-892c_ENST00000516410.1_RNA|MIR890_ENST00000401256.1_RNA|MIR892B_ENST00000401279.1_RNA	NR_030584.1				microRNA 892a																		GCCTTCCTTCACCCAAAGAGG	0.498																																					.		.											.	.	.	0			.						.						62.0	45.0	50.0					X																	145076315		1568	3582	5150			100126306	.			TCCTTCACCCAAA			Xq27.3	2011-09-12		2008-12-18	ENSG00000215943	ENSG00000215943		"""ncRNAs / Micro RNAs"""	33639	non-coding RNA	RNA, micro				MIRN892A			Standard	NR_030584		Approved	hsa-mir-892a	uc022cfq.1				X.37:g.145076315A>C		Somatic	78.0	1.0		WXS	Illumina HiSeq	Phase_I	54.0	28.0	.		RNA	SNP	ENST00000401124.1	37																																																																																				.		0.498	MIR892A-201	KNOWN	basic	miRNA	miRNA		NR_030584	
KMT2B	9757	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	36216120	36216120	+	Splice_Site	SNP	G	G	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:36216120G>C	ENST00000222270.7	+	11	3528		c.e11-1		KMT2B_ENST00000420124.1_Splice_Site|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B						chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCTTCCCCCAGGAGGATTGTG	0.597																																					.		.											.	MLL4	697	0			c.3529-1G>C						.						24.0	27.0	26.0					19																	36216120		1993	4162	6155	SO:0001630	splice_region_variant	8085	exon11			CCCCCAGGAGGAT	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.3529-1G>C	19.37:g.36216120G>C		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	15.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Splice_Site	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071173	0.76301	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.114	0.89545	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AD000671.1	40907960	1.000000	0.71417	0.999000	0.59377	0.887000	0.51463	8.940000	0.92958	2.884000	0.98904	0.655000	0.94253	.	.		0.597	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	Intron
MPHOSPH9	10198	ucsc.edu;bcgsc.ca	37	12	123647656	123647656	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:123647656T>C	ENST00000606320.1	-	20	3140	c.2934A>G	c.(2932-2934)ccA>ccG	p.P978P	MPHOSPH9_ENST00000392425.3_Silent_p.P826P|MPHOSPH9_ENST00000541076.2_Silent_p.P948P|MPHOSPH9_ENST00000302349.5_Silent_p.P826P			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	978						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		CCACAGTCACTGGTGTTAGCA	0.363																																					p.P826P		.											.	MPHOSPH9	514	0			c.A2478G						.						92.0	87.0	89.0					12																	123647656		2203	4300	6503	SO:0001819	synonymous_variant	10198	exon16			AGTCACTGGTGTT	X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.2934A>G	12.37:g.123647656T>C		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_022782	A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Silent	SNP	ENST00000606320.1	37																																																																																				.		0.363	MPHOSPH9-030	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000471390.2		
MPHOSPH9	10198	ucsc.edu;bcgsc.ca	37	12	123699320	123699320	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:123699320G>T	ENST00000606320.1	-	7	1264	c.1058C>A	c.(1057-1059)cCa>cAa	p.P353Q	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.P201Q|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.P323Q|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.P201Q			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	353						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		CCAAGCATTTGGAGTTTCATC	0.343																																					p.P201Q		.											.	MPHOSPH9	514	0			c.C602A						.						191.0	206.0	201.0					12																	123699320		2203	4300	6503	SO:0001583	missense	10198	exon3			GCATTTGGAGTTT	X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.1058C>A	12.37:g.123699320G>T	ENSP00000475489:p.Pro353Gln	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_022782	A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	ENST00000606320.1	37		.	.	.	.	.	.	.	.	.	.	G	14.22	2.469188	0.43839	.	.	ENSG00000051825	ENST00000302349;ENST00000541076	T;T	0.32988	1.43;1.44	5.09	5.09	0.68999	.	0.302985	0.28338	N	0.015706	T	0.39733	0.1089	M	0.64997	1.995	0.41391	D	0.987615	P	0.50943	0.94	P	0.49421	0.61	T	0.24476	-1.0159	10	0.46703	T	0.11	-14.7009	12.3069	0.54908	0.0:0.0:0.8313:0.1687	.	201	Q99550	MPP9_HUMAN	Q	201	ENSP00000303597:P201Q;ENSP00000445859:P201Q	ENSP00000303597:P201Q	P	-	2	0	MPHOSPH9	122265273	1.000000	0.71417	0.689000	0.30133	0.996000	0.88848	4.337000	0.59310	2.377000	0.81083	0.549000	0.68633	CCA	.		0.343	MPHOSPH9-030	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000471390.2		
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9006378	9006378	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:9006378G>C	ENST00000397910.4	-	45	39843	c.39640C>G	c.(39640-39642)Cct>Gct	p.P13214A	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13216	SEA 8. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAATACAGAGGGCCAACACTG	0.537																																					p.P13214A		.											.	MUC16	566	0			c.C39640G						.						104.0	85.0	92.0					19																	9006378		2013	4185	6198	SO:0001583	missense	94025	exon45			ACAGAGGGCCAAC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39640C>G	19.37:g.9006378G>C	ENSP00000381008:p.Pro13214Ala	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	19.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	10.87	1.472614	0.26423	.	.	ENSG00000181143	ENST00000397910;ENST00000441155	T	0.38077	1.16	2.73	-5.18	0.02840	SEA (1);	.	.	.	.	T	0.50701	0.1631	M	0.82517	2.595	.	.	.	B;P	0.52577	0.245;0.954	B;D	0.65140	0.096;0.932	T	0.53648	-0.8409	7	.	.	.	0.3711	3.9091	0.09196	0.5296:0.0:0.2947:0.1757	.	20859;13214	Q8WXI7;B5ME49	MUC16_HUMAN;.	A	13214;345	ENSP00000381008:P13214A	.	P	-	1	0	MUC16	8867378	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-3.466000	0.00461	-1.005000	0.03417	0.305000	0.20034	CCT	.		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27442787	27442787	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:27442787C>T	ENST00000527372.1	-	12	2302	c.2122G>A	c.(2122-2124)Gag>Aag	p.E708K	MYO18A_ENST00000533112.1_Missense_Mutation_p.E708K|MYO18A_ENST00000531253.1_Missense_Mutation_p.E708K|MYO18A_ENST00000354329.4_Missense_Mutation_p.E708K	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	708	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GAGGACAGCTCCTCCAGGCTG	0.642																																					p.E708K	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A	22	0			c.G2122A						.						30.0	37.0	35.0					17																	27442787		2041	4187	6228	SO:0001583	missense	399687	exon12			ACAGCTCCTCCAG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2122G>A	17.37:g.27442787C>T	ENSP00000437073:p.Glu708Lys	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	15.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	C	37	6.113689	0.97296	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000458428	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	5.84	5.84	0.93424	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93006	0.7774	M	0.64170	1.965	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.999;0.998;0.998;0.998;1.0	D;D;D;D;D	0.91635	0.966;0.994;0.994;0.994;0.999	D	0.92946	0.6376	10	0.87932	D	0	.	20.1379	0.98040	0.0:1.0:0.0:0.0	.	377;320;708;708;708	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	K	708;708;708;708;708;320	ENSP00000346291:E708K;ENSP00000435932:E708K;ENSP00000434228:E708K;ENSP00000437073:E708K	ENSP00000346291:E708K	E	-	1	0	MYO18A	24466913	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.453000	0.80700	2.779000	0.95612	0.655000	0.94253	GAG	.		0.642	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
MYO1D	4642	ucsc.edu;bcgsc.ca	37	17	31075959	31075959	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:31075959A>G	ENST00000318217.5	-	12	1837	c.1533T>C	c.(1531-1533)gaT>gaC	p.D511D	MYO1D_ENST00000579584.1_Silent_p.D511D|MYO1D_ENST00000394649.4_Silent_p.D423D|MYO1D_ENST00000584232.1_5'UTR	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	511	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CTCACACTACATCGCCTGCAT	0.363																																					p.D511D		.											.	MYO1D	137	0			c.T1533C						.						155.0	139.0	144.0					17																	31075959		2203	4300	6503	SO:0001819	synonymous_variant	4642	exon12			CACTACATCGCCT	AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1533T>C	17.37:g.31075959A>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	55.0	5.0	NM_015194	A6H8V3|Q8NHP9	Silent	SNP	ENST00000318217.5	37	CCDS32615.1																																																																																			.		0.363	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447457.1		
MYO9B	4650	ucsc.edu;bcgsc.ca	37	19	17317097	17317097	+	Silent	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:17317097C>T	ENST00000594824.1	+	33	5445	c.5298C>T	c.(5296-5298)gcC>gcT	p.A1766A	MYO9B_ENST00000595618.1_Silent_p.A1766A|MYO9B_ENST00000397274.2_Silent_p.A1766A|CTD-3032J10.3_ENST00000601929.1_RNA			Q13459	MYO9B_HUMAN	myosin IXB	1766	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.|Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CCATCCACGCCATCACAGGGG	0.677																																					p.A1766A		.											.	MYO9B	67	0			c.C5298T						.						21.0	24.0	23.0					19																	17317097		2019	4163	6182	SO:0001819	synonymous_variant	4650	exon33			CCACGCCATCACA		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.5298C>T	19.37:g.17317097C>T		Somatic	60.0	0.0		WXS	Illumina HiSeq	.	33.0	5.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Silent	SNP	ENST00000594824.1	37																																																																																				.		0.677	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
MYOF	26509	ucsc.edu;bcgsc.ca	37	10	95191205	95191205	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:95191205T>C	ENST00000359263.4	-	4	304	c.305A>G	c.(304-306)aAg>aGg	p.K102R	MYOF_ENST00000358334.5_Missense_Mutation_p.K102R|MYOF_ENST00000371501.4_Missense_Mutation_p.K102R|MYOF_ENST00000371488.3_Missense_Mutation_p.K102R|MYOF_ENST00000371502.4_Missense_Mutation_p.K102R|MYOF_ENST00000371489.1_Missense_Mutation_p.K102R	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	102					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GGAGATCAGCTTGTACGGCAG	0.468																																					p.K102R		.											.	MYOF	93	0			c.A305G						.						93.0	89.0	90.0					10																	95191205		1953	4161	6114	SO:0001583	missense	26509	exon4			ATCAGCTTGTACG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.305A>G	10.37:g.95191205T>C	ENSP00000352208:p.Lys102Arg	Somatic	65.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_133337	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	T	8.368	0.834582	0.16820	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502;ENST00000371489;ENST00000371488	D;D;D;D;D;T	0.83914	-1.78;-1.78;-1.78;-1.78;-1.58;0.02	5.73	4.6	0.57074	C2 calcium/lipid-binding domain, CaLB (1);	0.182081	0.51477	D	0.000089	T	0.75525	0.3861	L	0.31752	0.955	0.49798	D	0.999822	B;B;B	0.25048	0.117;0.002;0.046	B;B;B	0.35859	0.212;0.015;0.032	T	0.71189	-0.4666	10	0.34782	T	0.22	-22.1672	9.1865	0.37174	0.0:0.0831:0.0:0.9169	.	84;102;102	Q9NZM1-8;Q9NZM1-6;Q9NZM1	.;.;MYOF_HUMAN	R	102	ENSP00000351094:K102R;ENSP00000352208:K102R;ENSP00000360556:K102R;ENSP00000360557:K102R;ENSP00000360544:K102R;ENSP00000360543:K102R	ENSP00000351094:K102R	K	-	2	0	MYOF	95181195	1.000000	0.71417	0.987000	0.45799	0.128000	0.20619	2.989000	0.49393	2.313000	0.78055	0.455000	0.32223	AAG	.		0.468	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	35731313	35731313	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr13:35731313A>G	ENST00000400445.3	+	21	3284	c.2750A>G	c.(2749-2751)tAc>tGc	p.Y917C	NBEA_ENST00000540320.1_Missense_Mutation_p.Y917C|NBEA_ENST00000310336.4_Missense_Mutation_p.Y917C|NBEA_ENST00000379939.2_Missense_Mutation_p.Y917C	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	917					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GAAATGGTCTACAATATCTTC	0.408																																					p.Y917C		.											.	NBEA	144	0			c.A2750G						.						115.0	113.0	114.0					13																	35731313		1826	4081	5907	SO:0001583	missense	26960	exon21			TGGTCTACAATAT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2750A>G	13.37:g.35731313A>G	ENSP00000383295:p.Tyr917Cys	Somatic	111.0	1.0		WXS	Illumina HiSeq	Phase_I	116.0	109.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898496	0.72639	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.77280	0.4107	M	0.69248	2.105	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.79022	-0.1973	10	0.56958	D	0.05	.	15.6702	0.77267	1.0:0.0:0.0:0.0	.	917	Q5T321	.	C	917	ENSP00000440951:Y917C;ENSP00000383295:Y917C;ENSP00000369271:Y917C;ENSP00000308534:Y917C	ENSP00000308534:Y917C	Y	+	2	0	NBEA	34629313	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.171000	0.68590	0.528000	0.53228	TAC	.		0.408	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NISCH	11188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52513791	52513791	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:52513791A>G	ENST00000479054.1	+	13	1401	c.1329A>G	c.(1327-1329)acA>acG	p.T443T	NISCH_ENST00000488380.1_Silent_p.T443T|NISCH_ENST00000345716.4_Silent_p.T443T|NISCH_ENST00000420808.2_Silent_p.T443T			Q9Y2I1	NISCH_HUMAN	nischarin	443	Interaction with PAK1. {ECO:0000250}.|Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	CAGTGACCACAGAGAAGGAGC	0.512																																					p.T443T		.											.	NISCH	93	0			c.A1329G						.						84.0	66.0	72.0					3																	52513791		2203	4300	6503	SO:0001819	synonymous_variant	11188	exon12			GACCACAGAGAAG	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.1329A>G	3.37:g.52513791A>G		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	42.0	NM_001276293	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Silent	SNP	ENST00000479054.1	37	CCDS33767.1																																																																																			.		0.512	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351357.1	NM_007184	
NLGN3	54413	ucsc.edu;bcgsc.ca	37	X	70389119	70389119	+	Silent	SNP	G	G	A	rs370836243		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:70389119G>A	ENST00000358741.3	+	8	2022	c.1719G>A	c.(1717-1719)ccG>ccA	p.P573P	NLGN3_ENST00000374051.3_Silent_p.P553P|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Silent_p.P533P	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	573					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CCAACAAGCCGGTCCCCCAGG	0.527																																					p.P573P	Esophageal Squamous(103;760 1488 16849 22250 40351)	.											.	NLGN3	131	0			c.G1719A						.	G	,,	1,3834		0,1,1631,571	48.0	39.0	42.0		1599,1659,1719	-0.1	1.0	X		42	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	NLGN3	NM_001166660.1,NM_018977.3,NM_181303.1	,,	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	,,	533/809,553/829,573/849	70389119	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	54413	exon8			CAAGCCGGTCCCC	AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1719G>A	X.37:g.70389119G>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_181303	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	ENST00000358741.3	37	CCDS55441.1																																																																																			.		0.527	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057121.1	NM_018977	
NLRP5	126206	broad.mit.edu;bcgsc.ca	37	19	56545050	56545050	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:56545050C>A	ENST00000390649.3	+	9	2590	c.2590C>A	c.(2590-2592)Cca>Aca	p.P864T		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	864					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CTTAAAACACCCAAAATGTTT	0.438																																					p.P864T		.											.	NLRP5	162	0			c.C2590A						.						264.0	252.0	256.0					19																	56545050		1913	4137	6050	SO:0001583	missense	126206	exon9			AAACACCCAAAAT	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.2590C>A	19.37:g.56545050C>A	ENSP00000375063:p.Pro864Thr	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	11.0	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249511	0.39797	.	.	ENSG00000171487	ENST00000390649	T	0.54071	0.59	3.07	3.07	0.35406	.	0.270429	0.19954	N	0.102352	T	0.72137	0.3423	M	0.89287	3.02	0.19575	N	0.999963	D	0.71674	0.998	D	0.67900	0.954	T	0.62431	-0.6856	10	0.72032	D	0.01	.	9.9103	0.41401	0.0:1.0:0.0:0.0	.	864	P59047	NALP5_HUMAN	T	864	ENSP00000375063:P864T	ENSP00000375063:P864T	P	+	1	0	NLRP5	61236862	0.125000	0.22332	0.356000	0.25785	0.107000	0.19398	2.337000	0.43947	2.035000	0.60131	0.555000	0.69702	CCA	.		0.438	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
NOS2	4843	ucsc.edu;bcgsc.ca	37	17	26099445	26099445	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:26099445C>A	ENST00000313735.6	-	14	1826	c.1593G>T	c.(1591-1593)aaG>aaT	p.K531N		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	531					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	ACGCCATTGTCTTGCGCATCA	0.577																																					p.K531N		.											.	NOS2	156	0			c.G1593T						.						73.0	62.0	65.0					17																	26099445		2203	4300	6503	SO:0001583	missense	4843	exon14			CATTGTCTTGCGC	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1593G>T	17.37:g.26099445C>A	ENSP00000327251:p.Lys531Asn	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183748	0.57800	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.01871	4.59	5.97	2.65	0.31530	.	0.134805	0.51477	D	0.000097	T	0.05868	0.0153	M	0.75615	2.305	0.20074	N	0.999933	P;P	0.45011	0.593;0.848	B;P	0.48270	0.381;0.572	T	0.10154	-1.0642	10	0.66056	D	0.02	.	9.2138	0.37335	0.0:0.6233:0.0:0.3767	.	531;531	F8WEM3;P35228	.;NOS2_HUMAN	N	531;492;531	ENSP00000327251:K531N	ENSP00000305638:K531N	K	-	3	2	NOS2	23123572	0.043000	0.20138	0.283000	0.24790	0.735000	0.41995	0.358000	0.20216	0.328000	0.23435	0.655000	0.94253	AAG	.		0.577	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
NPAS4	266743	ucsc.edu;bcgsc.ca	37	11	66190697	66190697	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:66190697C>A	ENST00000311034.2	+	5	978	c.802C>A	c.(802-804)Cgc>Agc	p.R268S		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	268	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						TCAACACTACCGCCTGTGTGA	0.537																																					p.R268S		.											.	NPAS4	90	0			c.C802A						.						64.0	48.0	53.0					11																	66190697		2200	4295	6495	SO:0001583	missense	266743	exon5			CACTACCGCCTGT	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.802C>A	11.37:g.66190697C>A	ENSP00000311196:p.Arg268Ser	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	ENST00000311034.2	37	CCDS8138.1	.	.	.	.	.	.	.	.	.	.	C	9.361	1.067982	0.20067	.	.	ENSG00000174576	ENST00000311034	T	0.17370	2.28	5.65	5.65	0.86999	PAS fold-3 (1);PAS (2);	0.000000	0.56097	D	0.000037	T	0.09113	0.0225	N	0.10707	0.03	0.48632	D	0.999689	B	0.25007	0.116	B	0.30855	0.121	T	0.23154	-1.0196	10	0.08179	T	0.78	-11.5539	12.2125	0.54388	0.1702:0.8298:0.0:0.0	.	268	Q8IUM7	NPAS4_HUMAN	S	268	ENSP00000311196:R268S	ENSP00000311196:R268S	R	+	1	0	NPAS4	65947273	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.873000	0.48475	2.661000	0.90470	0.650000	0.86243	CGC	.		0.537	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
NPAS4	266743	ucsc.edu;bcgsc.ca	37	11	66191182	66191182	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:66191182C>A	ENST00000311034.2	+	6	1118	c.942C>A	c.(940-942)atC>atA	p.I314I		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	314	PAC.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						ACTACCCAATCAGGTAAGCCA	0.542																																					p.I314I		.											.	NPAS4	90	0			c.C942A						.						68.0	68.0	68.0					11																	66191182		2200	4295	6495	SO:0001819	synonymous_variant	266743	exon6			CCCAATCAGGTAA	AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.942C>A	11.37:g.66191182C>A		Somatic	39.0	1.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_178864	B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	ENST00000311034.2	37	CCDS8138.1																																																																																			.		0.542	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392634.1	NM_178864	
NPHP1	4867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	110959033	110959033	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:110959033A>G	ENST00000393272.3	-	2	205	c.108T>C	c.(106-108)gcT>gcC	p.A36A	NPHP1_ENST00000316534.4_Silent_p.A36A|NPHP1_ENST00000355301.4_Silent_p.A36A|NPHP1_ENST00000418527.1_Silent_p.A36A|NPHP1_ENST00000417665.1_Silent_p.A36A|NPHP1_ENST00000445609.2_Silent_p.A36A	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	36					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						TGGGTTCTAGAGCTTCTTTCA	0.313																																					p.A36A		.											.	NPHP1	92	0			c.T108C						.						123.0	114.0	117.0					2																	110959033		2203	4300	6503	SO:0001819	synonymous_variant	4867	exon2			TTCTAGAGCTTCT	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.108T>C	2.37:g.110959033A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	42.0	NM_207181	O14837	Silent	SNP	ENST00000393272.3	37	CCDS46385.1																																																																																			.		0.313	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272	
NR3C2	4306	ucsc.edu;bcgsc.ca	37	4	149181131	149181131	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:149181131T>C	ENST00000358102.3	-	3	2258	c.1896A>G	c.(1894-1896)gaA>gaG	p.E632E	NR3C2_ENST00000512865.1_Splice_Site_p.E632E|NR3C2_ENST00000511528.1_Silent_p.E632E|NR3C2_ENST00000355292.3_Silent_p.E632E|NR3C2_ENST00000344721.4_Splice_Site_p.E632E	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	632					gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	AACATTTACCTTCCACTGCTC	0.393																																					p.E632E	Melanoma(27;428 957 40335 51025 51111)	.											.	NR3C2	154	0			c.A1896G						.						126.0	120.0	122.0					4																	149181131		2203	4300	6503	SO:0001630	splice_region_variant	4306	exon3			TTTACCTTCCACT	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1897+1A>G	4.37:g.149181131T>C		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	57.0	5.0	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	ENST00000358102.3	37	CCDS3772.1																																																																																			.		0.393	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		Silent
NUP133	55746	ucsc.edu;bcgsc.ca	37	1	229580661	229580661	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:229580661C>A	ENST00000261396.3	-	25	3425	c.3334G>T	c.(3334-3336)Ggc>Tgc	p.G1112C	NUP133_ENST00000537506.1_Splice_Site_p.G1096C	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	1112					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				AACCACTTACCATCTTTTAAA	0.368																																					p.G1112C		.											.	NUP133	271	0			c.G3334T						.						132.0	142.0	139.0					1																	229580661		2203	4300	6503	SO:0001630	splice_region_variant	55746	exon25			ACTTACCATCTTT		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.3334+1G>T	1.37:g.229580661C>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	37	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159185	0.78226	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.32023	1.52;1.47;1.53	5.79	5.79	0.91817	.	0.048909	0.85682	D	0.000000	T	0.58892	0.2154	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.57700	-0.7766	9	.	.	.	-11.666	18.204	0.89848	0.0:1.0:0.0:0.0	.	1112	Q8WUM0	NU133_HUMAN	C	1041;1112;1041;1096	ENSP00000261396:G1112C;ENSP00000355640:G1041C;ENSP00000443496:G1096C	.	G	-	1	0	NUP133	227647284	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.041000	0.57339	2.727000	0.93392	0.563000	0.77884	GGC	.		0.368	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	Missense_Mutation
NYAP1	222950	ucsc.edu;bcgsc.ca	37	7	100085902	100085902	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:100085902T>C	ENST00000300179.2	+	4	717	c.558T>C	c.(556-558)ccT>ccC	p.P186P	NYAP1_ENST00000423930.1_Silent_p.P186P|NYAP1_ENST00000454988.1_Silent_p.P129P	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	186	Involved in CYFIP1- and NCKAP1-binding. {ECO:0000250}.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GCCCCTCTCCTCGAGGGGGGA	0.637																																					p.P186P		.											.	.	.	0			c.T558C						.						50.0	60.0	57.0					7																	100085902		2203	4300	6503	SO:0001819	synonymous_variant	222950	exon4			CTCTCCTCGAGGG	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.558T>C	7.37:g.100085902T>C		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_173564	Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	37	CCDS5696.1																																																																																			.		0.637	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
OCIAD1	54940	broad.mit.edu;bcgsc.ca	37	4	48862751	48862751	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:48862751A>G	ENST00000381473.3	+	9	1128	c.710A>G	c.(709-711)aAc>aGc	p.N237S	OCIAD1_ENST00000444354.2_Missense_Mutation_p.N186S|OCIAD1_ENST00000508293.1_Missense_Mutation_p.N237S|OCIAD1_ENST00000425583.2_Missense_Mutation_p.N186S|OCIAD1_ENST00000513391.2_Missense_Mutation_p.N237S|OCIAD1_ENST00000264312.7_Missense_Mutation_p.N237S|OCIAD1_ENST00000396448.2_3'UTR|OCIAD1_ENST00000509122.1_Missense_Mutation_p.N210S|OCIAD1-AS1_ENST00000513576.1_RNA|OCIAD1_ENST00000506801.1_Missense_Mutation_p.N132S	NM_001079839.2	NP_001073308.1	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1	237						endosome (GO:0005768)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(2)|large_intestine(2)|lung(2)|prostate(1)|skin(2)	9						GTCAAAGTAAACAAGTATGGA	0.323																																					p.N242S		.											.	OCIAD1	68	0			c.A725G						.						96.0	100.0	99.0					4																	48862751		2203	4300	6503	SO:0001583	missense	54940	exon9			AAGTAAACAAGTA	AF324350	CCDS3484.1, CCDS43228.1, CCDS47052.1	4p11	2010-03-19			ENSG00000109180	ENSG00000109180			16074	protein-coding gene	gene with protein product						11162530, 18328549	Standard	NM_017830		Approved	FLJ20455, TPA018, OCIA, Asrij	uc010igk.3	Q9NX40	OTTHUMG00000102095	ENST00000381473.3:c.710A>G	4.37:g.48862751A>G	ENSP00000370882:p.Asn237Ser	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	5.0	NM_001168254	C9K030|G8JLN7|Q9BZE8	Missense_Mutation	SNP	ENST00000381473.3	37	CCDS3484.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.985316	0.53934	.	.	ENSG00000109180	ENST00000509122;ENST00000264312;ENST00000381473;ENST00000444354;ENST00000506801;ENST00000425583;ENST00000508293;ENST00000513391	T;T;T;T;T;T	0.61392	0.11;0.11;0.47;0.47;0.11;0.11	5.35	5.35	0.76521	.	0.045374	0.85682	D	0.000000	T	0.59702	0.2213	M	0.82517	2.595	0.80722	D	1	P;P	0.41393	0.748;0.748	B;B	0.37346	0.138;0.247	T	0.65187	-0.6229	9	.	.	.	-10.1678	12.8547	0.57878	1.0:0.0:0.0:0.0	.	210;237	D6RBN5;Q9NX40	.;OCAD1_HUMAN	S	210;237;237;186;132;186;237;237	ENSP00000264312:N237S;ENSP00000370882:N237S;ENSP00000399656:N186S;ENSP00000416943:N186S;ENSP00000423002:N237S;ENSP00000423909:N237S	.	N	+	2	0	OCIAD1	48557508	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.392000	0.66272	2.023000	0.59567	0.455000	0.32223	AAC	.		0.323	OCIAD1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361812.3	NM_017830	
OVCH1	341350	broad.mit.edu;bcgsc.ca	37	12	29628067	29628067	+	Silent	SNP	C	C	A	rs573263903		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:29628067C>A	ENST00000318184.5	-	14	1526	c.1527G>T	c.(1525-1527)acG>acT	p.T509T	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	509	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.T509T(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					AGTATATCACCGTCATGTTAC	0.308																																					p.T509T		.											.	OVCH1	210	1	Substitution - coding silent(1)	lung(1)	c.G1527T						.						48.0	43.0	45.0					12																	29628067		1821	4085	5906	SO:0001819	synonymous_variant	341350	exon14			TATCACCGTCATG	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1527G>T	12.37:g.29628067C>A		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	8.0	NM_183378		Silent	SNP	ENST00000318184.5	37																																																																																				.		0.308	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
PARD3B	117583	ucsc.edu;bcgsc.ca	37	2	205989190	205989190	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:205989190G>T	ENST00000406610.2	+	9	1512	c.1305G>T	c.(1303-1305)gaG>gaT	p.E435D	PARD3B_ENST00000462231.1_Splice_Site_p.E435D|PARD3B_ENST00000351153.1_Splice_Site_p.E435D|PARD3B_ENST00000358768.2_Splice_Site_p.E435D|PARD3B_ENST00000349953.3_Splice_Site_p.E435D	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	435	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GAATTTTGGAGGTAAGAATTG	0.308																																					p.E435D		.											.	PARD3B	140	0			c.G1305T						.						55.0	52.0	53.0					2																	205989190		1804	4070	5874	SO:0001630	splice_region_variant	117583	exon9			TTTGGAGGTAAGA	AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1305+1G>T	2.37:g.205989190G>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_205863	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	ENST00000406610.2	37		.	.	.	.	.	.	.	.	.	.	G	32	5.122674	0.94429	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.94	5.94	0.96194	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.60805	0.2297	M	0.77313	2.365	0.80722	D	1	D;D;D;D;D	0.76494	0.993;0.994;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.992;0.99;0.999;0.998;0.998	T	0.61618	-0.7026	10	0.72032	D	0.01	.	20.3552	0.98837	0.0:0.0:1.0:0.0	.	435;435;435;435;435	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	D	435	ENSP00000385848:E435D;ENSP00000351618:E435D;ENSP00000317261:E435D;ENSP00000340280:E435D	ENSP00000340280:E435D	E	+	3	2	PARD3B	205697435	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.431000	0.97494	2.812000	0.96745	0.557000	0.71058	GAG	.		0.308	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000335992.1	NM_057177	Missense_Mutation
PASK	23178	ucsc.edu;bcgsc.ca	37	2	242066022	242066022	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:242066022G>A	ENST00000405260.1	-	10	3006	c.2308C>T	c.(2308-2310)Ccc>Tcc	p.P770S	PASK_ENST00000403638.3_Missense_Mutation_p.P770S|PASK_ENST00000358649.4_Missense_Mutation_p.P770S|PASK_ENST00000539818.1_Missense_Mutation_p.P554S|PASK_ENST00000234040.4_Missense_Mutation_p.P770S|PASK_ENST00000544142.1_Missense_Mutation_p.P584S	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	770					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		AAGGAAGAGGGTGTCTCTCTG	0.517																																					p.P770S		.											.	PASK	536	0			c.C2308T						.						108.0	100.0	103.0					2																	242066022		2203	4300	6503	SO:0001583	missense	23178	exon10			AAGAGGGTGTCTC	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.2308C>T	2.37:g.242066022G>A	ENSP00000384016:p.Pro770Ser	Somatic	88.0	0.0		WXS	Illumina HiSeq	.	61.0	5.0	NM_015148	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308562	0.23821	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.18;-0.22;0.74	3.92	0.655	0.17839	.	0.616340	0.14446	N	0.319064	T	0.54175	0.1842	L	0.32530	0.975	0.09310	N	1	P;B;B;P;B	0.45531	0.483;0.112;0.112;0.86;0.264	B;B;B;P;B	0.44561	0.084;0.029;0.029;0.453;0.044	T	0.47129	-0.9141	10	0.62326	D	0.03	.	6.4357	0.21821	0.0:0.1629:0.3692:0.468	.	735;584;770;770;770	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	S	770;584;770;770;554;770	ENSP00000234040:P770S;ENSP00000441374:P584S;ENSP00000384016:P770S;ENSP00000351475:P770S;ENSP00000443083:P554S;ENSP00000384438:P770S	ENSP00000234040:P770S	P	-	1	0	PASK	241714695	0.002000	0.14202	0.003000	0.11579	0.021000	0.10359	0.042000	0.13949	0.363000	0.24346	0.491000	0.48974	CCC	.		0.517	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
PCBP4	57060	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	51993962	51993962	+	Silent	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:51993962C>T	ENST00000461554.1	-	8	796	c.465G>A	c.(463-465)gtG>gtA	p.V155V	PCBP4_ENST00000355852.2_Silent_p.V155V|PCBP4_ENST00000322099.7_Silent_p.V155V|PCBP4_ENST00000395014.2_Silent_p.V176V|PCBP4_ENST00000428823.2_Intron|PCBP4_ENST00000471622.1_Silent_p.V155V|PCBP4_ENST00000484633.1_Intron|RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000395013.3_Intron	NM_001174100.1	NP_001167571.1	P57723	PCBP4_HUMAN	poly(rC) binding protein 4	155						cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|large_intestine(2)|lung(2)|prostate(1)|stomach(1)	8				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TGGCATCAGGCACCCCAGATA	0.632																																					p.V155V		.											.	PCBP4	226	0			c.G465A						.						113.0	110.0	111.0					3																	51993962		2203	4300	6503	SO:0001819	synonymous_variant	57060	exon7			ATCAGGCACCCCA	AF176330	CCDS2839.1, CCDS2840.1, CCDS2840.2	3p21	2013-07-16	2001-11-28		ENSG00000090097	ENSG00000090097			8652	protein-coding gene	gene with protein product	"""RNA binding protein MCG10"", ""LYST-interacting protein"", ""alphaCP-4 protein"""	608503	"""poly(rC)-binding protein 4"""			10936052	Standard	NM_033008		Approved	MCG10, LIP4	uc003dch.2	P57723	OTTHUMG00000157366	ENST00000461554.1:c.465G>A	3.37:g.51993962C>T		Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	4.0	NM_033008	Q96AH7	Silent	SNP	ENST00000461554.1	37	CCDS2839.1																																																																																			.		0.632	PCBP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348597.1	NM_020418	
PCDHGA12	26025	ucsc.edu;bcgsc.ca	37	5	140810434	140810434	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:140810434G>T	ENST00000252085.3	+	1	250	c.108G>T	c.(106-108)ccG>ccT	p.P36P	PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	36	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTCAGTTCCGGAAGAGCTGG	0.642																																					p.P36P		.											.	PCDHGA12	27	0			c.G108T						.						81.0	93.0	89.0					5																	140810434		2203	4300	6503	SO:0001819	synonymous_variant	26025	exon1			AGTTCCGGAAGAG	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.108G>T	5.37:g.140810434G>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	.	52.0	4.0	NM_032094	O15100|Q6UW70|Q9Y5D7	Silent	SNP	ENST00000252085.3	37	CCDS4260.1																																																																																			.		0.642	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
PDDC1	347862	ucsc.edu;bcgsc.ca	37	11	773565	773565	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:773565A>G	ENST00000319863.8	-	4	333	c.312T>C	c.(310-312)agT>agC	p.S104S	PDDC1_ENST00000526325.1_Silent_p.S104S|PDDC1_ENST00000529966.1_5'UTR|PDDC1_ENST00000397472.2_Silent_p.S104S|PDDC1_ENST00000442059.2_Silent_p.S54S|PDDC1_ENST00000524550.1_Intron	NM_182612.2	NP_872418.1	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1	104						extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(3)|urinary_tract(1)	5		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCAGGGAGCCACTGCTGGCCA	0.637																																					p.S104S		.											.	PDDC1	90	0			c.T312C						.						29.0	29.0	29.0					11																	773565		2202	4296	6498	SO:0001819	synonymous_variant	347862	exon4			GGAGCCACTGCTG	AK128653	CCDS7713.1	11p15.5	2005-10-26			ENSG00000177225	ENSG00000177225			26616	protein-coding gene	gene with protein product							Standard	XM_005252898		Approved	FLJ34283	uc001lrc.3	Q8NB37	OTTHUMG00000133315	ENST00000319863.8:c.312T>C	11.37:g.773565A>G		Somatic	75.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_182612	B7ZKW5|Q2NL76|Q6ZQY0|Q8NAE0	Silent	SNP	ENST00000319863.8	37	CCDS7713.1																																																																																			.		0.637	PDDC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258051.2	NM_182612	
PEX5	5830	ucsc.edu;bcgsc.ca	37	12	7343827	7343827	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:7343827G>T	ENST00000455147.2	+	5	769	c.189G>T	c.(187-189)gtG>gtT	p.V63V	PEX5_ENST00000266563.5_Silent_p.V63V|PEX5_ENST00000420616.2_Silent_p.V63V|PEX5_ENST00000412720.2_Silent_p.V84V|RP11-273B20.3_ENST00000543061.1_RNA|PEX5_ENST00000266564.3_Silent_p.V63V|PEX5_ENST00000545220.1_3'UTR|RP11-273B20.3_ENST00000545794.1_RNA|PEX5_ENST00000434354.2_Silent_p.V78V	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	63					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						GGCAGTTGGTGGCTGAATTCC	0.547																																					p.V78V		.											.	PEX5	91	0			c.G234T						.						129.0	130.0	130.0					12																	7343827		2203	4300	6503	SO:0001819	synonymous_variant	5830	exon4			GTTGGTGGCTGAA	U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.189G>T	12.37:g.7343827G>T		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_001131023	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Silent	SNP	ENST00000455147.2	37	CCDS44823.1																																																																																			.		0.547	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398611.1	NM_000319	
PFDN2	5202	ucsc.edu;bcgsc.ca	37	1	161071839	161071839	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:161071839T>C	ENST00000368010.3	-	3	371	c.287A>G	c.(286-288)cAg>cGg	p.Q96R	PFDN2_ENST00000468311.1_Intron	NM_012394.3	NP_036526.2	Q9UHV9	PFD2_HUMAN	prefoldin subunit 2	96					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	unfolded protein binding (GO:0051082)			lung(1)|skin(1)	2	all_cancers(52;1.84e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CTTGCTCACCTGCTCCTTGTT	0.532																																					p.Q96R		.											.	PFDN2	90	0			c.A287G						.						109.0	98.0	102.0					1																	161071839		2203	4300	6503	SO:0001630	splice_region_variant	5202	exon3			CTCACCTGCTCCT	AF165883	CCDS1217.1	1q23.3	2008-02-05	2006-02-24		ENSG00000143256	ENSG00000143256			8867	protein-coding gene	gene with protein product		613466	"""prefoldin 2"""			10051400	Standard	NM_012394		Approved		uc001fxu.3	Q9UHV9	OTTHUMG00000031481	ENST00000368010.3:c.288+1A>G	1.37:g.161071839T>C		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_012394	Q9P0P7|Q9UN05	Missense_Mutation	SNP	ENST00000368010.3	37	CCDS1217.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.921083	0.73213	.	.	ENSG00000143256	ENST00000368010	T	0.42131	0.98	5.15	5.15	0.70609	Prefoldin beta-like (1);Prefoldin (1);	0.105434	0.64402	D	0.000003	T	0.43743	0.1261	M	0.70595	2.14	0.58432	D	0.999993	D	0.56287	0.975	P	0.59056	0.851	T	0.40534	-0.9558	10	0.14252	T	0.57	-19.4494	12.9755	0.58534	0.0:0.0:0.0:1.0	.	96	Q9UHV9	PFD2_HUMAN	R	96	ENSP00000356989:Q96R	ENSP00000356989:Q96R	Q	-	2	0	PFDN2	159338463	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	6.639000	0.74314	2.163000	0.67991	0.459000	0.35465	CAG	.		0.532	PFDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077100.1	NM_012394	Missense_Mutation
PHEX	5251	ucsc.edu;bcgsc.ca	37	X	22196426	22196426	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:22196426C>A	ENST00000379374.4	+	14	2084	c.1519C>A	c.(1519-1521)Cta>Ata	p.L507I	PHEX_ENST00000418858.3_Missense_Mutation_p.L210I|PHEX_ENST00000535894.1_Missense_Mutation_p.L410I|PHEX_ENST00000537599.1_Missense_Mutation_p.L507I	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	507					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						TGGCAACGTCCTACAAACTCG	0.328																																					p.L507I		.											.	PHEX	132	0			c.C1519A						.						96.0	86.0	90.0					X																	22196426		2203	4299	6502	SO:0001583	missense	5251	exon14			AACGTCCTACAAA	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1519C>A	X.37:g.22196426C>A	ENSP00000368682:p.Leu507Ile	Somatic	67.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_000444	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	ENST00000379374.4	37	CCDS14204.1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000406	0.35320	.	.	ENSG00000102174	ENST00000379374;ENST00000537599;ENST00000535894;ENST00000418858	D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81	5.97	5.97	0.96955	.	0.051558	0.85682	D	0.000000	T	0.80560	0.4646	L	0.41492	1.28	0.43050	D	0.994654	B;B	0.29988	0.264;0.172	B;B	0.24701	0.055;0.025	T	0.77064	-0.2726	10	0.33141	T	0.24	.	18.0036	0.89203	0.0:1.0:0.0:0.0	.	507;507	F5GXU4;P78562	.;PHEX_HUMAN	I	507;507;410;210	ENSP00000368682:L507I;ENSP00000440362:L507I;ENSP00000439418:L410I;ENSP00000443531:L210I	ENSP00000368682:L507I	L	+	1	2	PHEX	22106347	0.956000	0.32656	1.000000	0.80357	0.689000	0.40095	1.659000	0.37387	2.527000	0.85204	0.600000	0.82982	CTA	.		0.328	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
PI16	221476	ucsc.edu;bcgsc.ca	37	6	36926948	36926948	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:36926948G>T	ENST00000373674.3	+	2	527	c.199G>T	c.(199-201)Gcc>Tcc	p.A67S		NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	67	SCP.				negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGCCGCCTTCGCCAAGGCCTA	0.652																																					p.A67S		.											.	PI16	90	0			c.G199T						.						22.0	19.0	20.0					6																	36926948		2199	4300	6499	SO:0001583	missense	221476	exon3			GCCTTCGCCAAGG		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.199G>T	6.37:g.36926948G>T	ENSP00000362778:p.Ala67Ser	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001199159	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	37	CCDS34440.1	.	.	.	.	.	.	.	.	.	.	G	33	5.268971	0.95429	.	.	ENSG00000164530	ENST00000536757;ENST00000373674	T	0.30981	1.51	5.29	5.29	0.74685	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.54759	0.1878	M	0.85542	2.76	0.49389	D	0.999785	D;D	0.71674	0.991;0.998	D;D	0.71656	0.974;0.949	T	0.63220	-0.6686	10	0.87932	D	0	.	18.5179	0.90942	0.0:0.0:1.0:0.0	.	67;67	Q6UXB8;Q6UXB8-2	PI16_HUMAN;.	S	67	ENSP00000362778:A67S	ENSP00000362778:A67S	A	+	1	0	PI16	37034926	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.936000	0.75892	2.462000	0.83206	0.511000	0.50034	GCC	.		0.652	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040380.1	NM_153370	
PIGQ	9091	ucsc.edu;bcgsc.ca	37	16	628482	628482	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:628482T>C	ENST00000026218.5	+	5	1134	c.1046T>C	c.(1045-1047)cTc>cCc	p.L349P	PIGQ_ENST00000409527.2_Missense_Mutation_p.L349P|PIGQ_ENST00000321878.5_Missense_Mutation_p.L349P|PIGQ_ENST00000544860.1_3'UTR	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	349	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				CGCTTCTTCCTCTACCACATC	0.667																																					p.L349P		.											.	PIGQ	226	0			c.T1046C						.						52.0	47.0	49.0					16																	628482		2200	4299	6499	SO:0001583	missense	9091	exon5			TCTTCCTCTACCA	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1046T>C	16.37:g.628482T>C	ENSP00000026218:p.Leu349Pro	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_148920	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.588544	0.46110	.	.	ENSG00000007541	ENST00000409527;ENST00000321878;ENST00000026218	T;T;T	0.57273	0.41;0.41;1.75	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.74207	0.3686	M	0.90369	3.11	0.80722	D	1	D;D;P	0.57571	0.98;0.957;0.686	P;P;B	0.59761	0.863;0.705;0.305	T	0.80870	-0.1189	10	0.87932	D	0	-8.8486	14.3336	0.66574	0.0:0.0:0.0:1.0	.	363;349;349	E7ERP4;Q9BRB3;Q9BRB3-2	.;PIGQ_HUMAN;.	P	349	ENSP00000386760:L349P;ENSP00000326674:L349P;ENSP00000026218:L349P	ENSP00000026218:L349P	L	+	2	0	PIGQ	568483	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.002000	0.88514	2.002000	0.58637	0.482000	0.46254	CTC	.		0.667	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	NM_004204	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	178916692	178916692	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:178916692C>A	ENST00000263967.3	+	2	236	c.79C>A	c.(79-81)Cca>Aca	p.P27T		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	27	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ATGTTTACTACCAAATGGAAT	0.413		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.P27T	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	PIK3CA	27752	0			c.C79A						.						67.0	66.0	66.0					3																	178916692		1853	4089	5942	SO:0001583	missense	5290	exon2			TTACTACCAAATG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.79C>A	3.37:g.178916692C>A	ENSP00000263967:p.Pro27Thr	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	38.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364380	0.82463	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	D;D	0.91740	-1.97;-2.9	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.96516	0.8863	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96326	0.9240	9	.	.	.	-18.5061	19.267	0.93990	0.0:1.0:0.0:0.0	.	27	P42336	PK3CA_HUMAN	T	27	ENSP00000263967:P27T;ENSP00000417479:P27T	.	P	+	1	0	PIK3CA	180399386	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.394000	0.79862	2.616000	0.88540	0.650000	0.86243	CCA	.		0.413	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIN1	5300	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9949168	9949168	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:9949168G>T	ENST00000247970.4	+	2	137	c.115G>T	c.(115-117)Ggc>Tgc	p.G39C	PIN1_ENST00000588695.1_Missense_Mutation_p.G39C|PIN1_ENST00000380889.6_3'UTR|PIN1_ENST00000587625.1_Missense_Mutation_p.G39C	NM_006221.3	NP_006212.1	Q13526	PIN1_HUMAN	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	39	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cell cycle (GO:0007049)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|negative regulation of cell motility (GO:2000146)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase activating protein binding (GO:0032794)|mitogen-activated protein kinase kinase binding (GO:0031434)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)	p.G39C(1)		skin(3)	3						GCGGCCCAGCGGCAACAGCAG	0.652																																					p.G39C		.											.	PIN1	227	1	Substitution - Missense(1)	lung(1)	c.G115T						.						17.0	19.0	18.0					19																	9949168		2201	4298	6499	SO:0001583	missense	5300	exon2			CCCAGCGGCAACA		CCDS12220.1	19p13	2014-09-17	2008-03-25		ENSG00000127445	ENSG00000127445			8988	protein-coding gene	gene with protein product		601052	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1"""			8606777	Standard	NM_006221		Approved	dod	uc002mml.2	Q13526		ENST00000247970.4:c.115G>T	19.37:g.9949168G>T	ENSP00000247970:p.Gly39Cys	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	17.0	NM_006221	A8K4V9|Q53X75	Missense_Mutation	SNP	ENST00000247970.4	37	CCDS12220.1	.	.	.	.	.	.	.	.	.	.	G	19.07	3.755544	0.69648	.	.	ENSG00000127445	ENST00000247970;ENST00000424497	T	0.76839	-1.05	3.63	2.59	0.31030	WW/Rsp5/WWP (3);	0.327520	0.27851	N	0.017596	T	0.80969	0.4726	M	0.69185	2.1	0.42263	D	0.992026	D;P;D	0.65815	0.995;0.894;0.983	P;P;P	0.58721	0.769;0.649;0.844	T	0.79351	-0.1839	9	.	.	.	-36.7392	6.9465	0.24522	0.1238:0.0:0.8762:0.0	.	39;39;39	B3KUM4;Q13526;E7EQR5	.;PIN1_HUMAN;.	C	39	ENSP00000247970:G39C	.	G	+	1	0	PIN1	9810168	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	5.971000	0.70440	1.125000	0.41998	0.555000	0.69702	GGC	.		0.652	PIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451107.1		
PLEKHH2	130271	broad.mit.edu;bcgsc.ca	37	2	43919652	43919652	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:43919652G>T	ENST00000282406.4	+	4	296		c.e4-1			NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2						negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTTGAATTTAGGTACAAGTTA	0.289																																					.		.											.	PLEKHH2	92	0			c.187-1G>T						.						42.0	48.0	46.0					2																	43919652		2189	4294	6483	SO:0001630	splice_region_variant	130271	exon4			AATTTAGGTACAA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.187-1G>T	2.37:g.43919652G>T		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	8.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Splice_Site	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963303	0.74016	.	.	ENSG00000152527	ENST00000282406	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2481	0.93912	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLEKHH2	43773156	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.231000	0.78106	2.538000	0.85594	0.563000	0.77884	.	.		0.289	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	Intron
PPEF2	5470	ucsc.edu;bcgsc.ca	37	4	76809470	76809470	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:76809470A>G	ENST00000286719.7	-	6	785	c.429T>C	c.(427-429)gcT>gcC	p.A143A		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	143	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AGACGTAGCGAGCATGGAGCT	0.468																																					p.A143A	NSCLC(105;1359 1603 15961 44567 47947)	.											.	PPEF2	228	0			c.T429C						.						102.0	90.0	94.0					4																	76809470		2203	4300	6503	SO:0001819	synonymous_variant	5470	exon6			GTAGCGAGCATGG	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.429T>C	4.37:g.76809470A>G		Somatic	45.0	1.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_006239	O14831	Silent	SNP	ENST00000286719.7	37	CCDS34013.1																																																																																			.		0.468	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239	
PPP2CA	5515	ucsc.edu;bcgsc.ca	37	5	133536762	133536762	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:133536762A>G	ENST00000481195.1	-	4	770	c.490T>C	c.(490-492)Ttc>Ctc	p.F164L	PPP2CA_ENST00000231504.5_5'Flank|CTD-2410N18.5_ENST00000519718.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	164					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	TGTAGACAGAAGATCTGAAAA	0.428																																					p.F164L		.											.	PPP2CA	1085	0			c.T490C						.						95.0	94.0	95.0					5																	133536762		2203	4300	6503	SO:0001583	missense	5515	exon4			GACAGAAGATCTG		CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.490T>C	5.37:g.133536762A>G	ENSP00000418447:p.Phe164Leu	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_002715	P05323|P13197	Missense_Mutation	SNP	ENST00000481195.1	37	CCDS4173.1	.	.	.	.	.	.	.	.	.	.	A	33	5.275294	0.95459	.	.	ENSG00000113575	ENST00000481195;ENST00000522385	T;T	0.80033	-1.33;-1.33	5.24	5.24	0.73138	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	N	0.20986	0.625	0.80722	D	1	P	0.36162	0.54	B	0.33799	0.17	T	0.74321	-0.3703	10	0.62326	D	0.03	-11.1608	15.4352	0.75140	1.0:0.0:0.0:0.0	.	164	P67775	PP2AA_HUMAN	L	164;99	ENSP00000418447:F164L;ENSP00000430869:F99L	ENSP00000418447:F164L	F	-	1	0	PPP2CA	133564661	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.276000	0.95745	2.106000	0.64143	0.477000	0.44152	TTC	.		0.428	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	NM_002715	
PPP2CB	5516	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	30643819	30643819	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr8:30643819G>A	ENST00000221138.4	-	7	1312	c.862C>T	c.(862-864)Caa>Taa	p.Q288*	PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme	288					apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	GGGTCAAATTGAAGGCTGTAA	0.438																																					p.Q288X		.											.	PPP2CB	658	0			c.C862T						.						44.0	43.0	43.0					8																	30643819		2199	4297	6496	SO:0001587	stop_gained	5516	exon7			CAAATTGAAGGCT		CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.862C>T	8.37:g.30643819G>A	ENSP00000221138:p.Gln288*	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	12.0	NM_001009552	D3DSV4|P11082|Q6FHK5	Nonsense_Mutation	SNP	ENST00000221138.4	37	CCDS6079.1	.	.	.	.	.	.	.	.	.	.	G	39	7.904227	0.98554	.	.	ENSG00000104695	ENST00000221138;ENST00000406655	.	.	.	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-8.8029	17.9622	0.89089	0.0:0.0:1.0:0.0	.	.	.	.	X	288	.	ENSP00000221138:Q288X	Q	-	1	0	PPP2CB	30763361	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	9.476000	0.97823	2.400000	0.81607	0.563000	0.77884	CAA	.		0.438	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376527.2	NM_001009552	
PPP2R5C	5527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102391540	102391540	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr14:102391540C>A	ENST00000334743.5	+	14	1554	c.1506C>A	c.(1504-1506)gaC>gaA	p.D502E	PPP2R5C_ENST00000350249.3_Missense_Mutation_p.D463E|PPP2R5C_ENST00000422945.2_Missense_Mutation_p.D533E|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.D518E	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	502					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						TGCCTCAGGACCCCCACACCA	0.632																																					p.D533E		.											.	PPP2R5C	659	0			c.C1599A						.						93.0	102.0	99.0					14																	102391540		2203	4300	6503	SO:0001583	missense	5527	exon16			TCAGGACCCCCAC	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.1506C>A	14.37:g.102391540C>A	ENSP00000333905:p.Asp502Glu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	36.0	NM_001161725	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	ENST00000334743.5	37	CCDS9964.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586613	0.86851	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334743	T;T;T;T;T	0.61510	0.1;0.53;0.1;0.51;0.1	6.17	0.338	0.15974	.	0.000000	0.85682	D	0.000000	T	0.70465	0.3227	M	0.85630	2.765	0.50171	D	0.999854	D;D;D;D	0.71674	0.994;0.966;0.998;0.994	D;D;D;D	0.66847	0.947;0.921;0.931;0.938	T	0.68176	-0.5478	10	0.59425	D	0.04	-9.0671	5.6504	0.17612	0.0:0.5105:0.1548:0.3347	.	533;463;502;518	F5GWP3;Q13362-3;Q13362;Q6ZN33	.;.;2A5G_HUMAN;.	E	533;518;531;463;502	ENSP00000412324:D533E;ENSP00000329009:D518E;ENSP00000450931:D531E;ENSP00000262239:D463E;ENSP00000333905:D502E	ENSP00000329009:D518E	D	+	3	2	PPP2R5C	101461293	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	1.080000	0.30779	0.284000	0.22305	-0.290000	0.09829	GAC	.		0.632	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414373.2	NM_002719	
PROKR1	10887	ucsc.edu;bcgsc.ca	37	2	68882573	68882573	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:68882573C>A	ENST00000303786.3	+	3	1467	c.1047C>A	c.(1045-1047)acC>acA	p.T349T	PROKR1_ENST00000394342.2_Silent_p.T349T			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	349					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						AGAACGACACCGTCAAGTACT	0.502																																					p.T349T		.											.	PROKR1	523	0			c.C1047A						.						160.0	121.0	134.0					2																	68882573		2203	4300	6503	SO:0001819	synonymous_variant	10887	exon2			CGACACCGTCAAG	AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.1047C>A	2.37:g.68882573C>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	.	48.0	5.0	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Silent	SNP	ENST00000303786.3	37	CCDS1889.1																																																																																			.		0.502	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
PTCH2	8643	ucsc.edu;bcgsc.ca	37	1	45296615	45296615	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:45296615T>C	ENST00000372192.3	-	6	848	c.718A>G	c.(718-720)Aag>Gag	p.K240E	PTCH2_ENST00000447098.2_Missense_Mutation_p.K240E	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	240					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					ACCTGTGCCTTGTCTAGCAGC	0.662									Basal Cell Nevus syndrome																												p.K240E		.											PTCH2,NS,malignant_melanoma,+2	PTCH2	851	0			c.A718G						.						38.0	38.0	38.0					1																	45296615		2203	4300	6503	SO:0001583	missense	8643	exon6	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	GTGCCTTGTCTAG	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.718A>G	1.37:g.45296615T>C	ENSP00000361266:p.Lys240Glu	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001166292	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	CCDS516.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337434	0.81911	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.93189	-3.17;-3.18	4.83	4.83	0.62350	.	0.000000	0.52532	D	0.000061	D	0.95490	0.8535	M	0.69185	2.1	0.46521	D	0.999084	D	0.89917	1.0	D	0.87578	0.998	D	0.94078	0.7341	10	0.25106	T	0.35	-25.6107	13.5192	0.61557	0.0:0.0:0.0:1.0	.	240	Q9Y6C5	PTC2_HUMAN	E	240	ENSP00000389703:K240E;ENSP00000361266:K240E	ENSP00000361266:K240E	K	-	1	0	PTCH2	45069202	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.376000	0.79658	2.026000	0.59711	0.533000	0.62120	AAG	.		0.662	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
PTPN2	5771	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	12802149	12802149	+	Splice_Site	SNP	T	T	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr18:12802149T>G	ENST00000309660.5	-	8	953	c.860A>C	c.(859-861)aAa>aCa	p.K287T	PTPN2_ENST00000327283.3_Splice_Site_p.K287T|PTPN2_ENST00000591497.1_Splice_Site_p.K258T|PTPN2_ENST00000353319.4_Splice_Site_p.K287T|PTPN2_ENST00000591115.1_Splice_Site_p.K310T	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	287					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				TTTCCATCGTTTCTAGGTAGG	0.279																																					p.K310T		.											.	PTPN2	652	0			c.A929C						.						61.0	52.0	55.0					18																	12802149		2203	4299	6502	SO:0001630	splice_region_variant	5771	exon9			CATCGTTTCTAGG	M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.859-1A>C	18.37:g.12802149T>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	51.0	NM_001207013	A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	ENST00000309660.5	37	CCDS11865.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.860965	0.51482	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	T;T;T	0.04275	3.67;3.68;3.66	5.52	5.52	0.82312	.	0.000000	0.56097	D	0.000022	T	0.09555	0.0235	M	0.69823	2.125	0.80722	D	1	B;B;B;B;B	0.33135	0.399;0.066;0.107;0.085;0.04	B;B;B;B;B	0.35607	0.206;0.124;0.065;0.032;0.058	T	0.03306	-1.1050	10	0.44086	T	0.13	.	13.6713	0.62427	0.0:0.0:0.0:1.0	.	287;287;264;287;287	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	T	287;287;264;287	ENSP00000320298:K287T;ENSP00000320546:K287T;ENSP00000311857:K287T	ENSP00000311857:K287T	K	-	2	0	PTPN2	12792149	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.869000	0.63028	2.222000	0.72286	0.455000	0.32223	AAA	.		0.279	PTPN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254613.3	NM_002828, NM_080422, NM_080423	Missense_Mutation
PTPRG	5793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	61975392	61975392	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:61975392T>C	ENST00000474889.1	+	3	661	c.284T>C	c.(283-285)gTt>gCt	p.V95A	PTPRG_ENST00000295874.10_Missense_Mutation_p.V95A	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	95	Alpha-carbonic anhydrase.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TATGCGCGTGTTGGGGAAGAA	0.493																																					p.V95A		.											.	PTPRG	419	0			c.T284C						.						119.0	109.0	112.0					3																	61975392		2203	4300	6503	SO:0001583	missense	5793	exon3			CGCGTGTTGGGGA	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.284T>C	3.37:g.61975392T>C	ENSP00000418112:p.Val95Ala	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	37.0	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707702	0.68615	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.67171	-0.25;-0.25	5.92	5.92	0.95590	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.359047	0.29300	N	0.012560	T	0.66934	0.2840	L	0.52011	1.625	0.52501	D	0.999954	P;P	0.44429	0.835;0.517	B;B	0.43889	0.435;0.226	T	0.71237	-0.4652	10	0.87932	D	0	.	16.3413	0.83082	0.0:0.0:0.0:1.0	.	95;95	P23470-2;P23470	.;PTPRG_HUMAN	A	95	ENSP00000418112:V95A;ENSP00000295874:V95A	ENSP00000295874:V95A	V	+	2	0	PTPRG	61950432	1.000000	0.71417	0.107000	0.21349	0.943000	0.58893	7.642000	0.83385	2.257000	0.74773	0.533000	0.62120	GTT	.		0.493	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
QSOX1	5768	ucsc.edu;bcgsc.ca	37	1	180158782	180158782	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:180158782T>A	ENST00000367602.3	+	9	1187	c.1113T>A	c.(1111-1113)ttT>ttA	p.F371L	QSOX1_ENST00000367600.5_Missense_Mutation_p.F371L			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	371					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						ACAGTTTCTTTAAAACTGCCC	0.468																																					p.F371L		.											.	QSOX1	91	0			c.T1113A						.						70.0	74.0	72.0					1																	180158782		2203	4300	6503	SO:0001583	missense	5768	exon9			TTTCTTTAAAACT	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1113T>A	1.37:g.180158782T>A	ENSP00000356574:p.Phe371Leu	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_002826	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	37	CCDS1337.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.497989	0.26861	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.16597	3.69;2.33	5.2	-2.53	0.06326	.	0.340566	0.34531	N	0.003896	T	0.08133	0.0203	L	0.35644	1.08	0.29726	N	0.838289	B;B;B	0.20368	0.026;0.013;0.044	B;B;B	0.15484	0.006;0.012;0.013	T	0.21518	-1.0243	10	0.17832	T	0.49	-4.3155	1.9082	0.03281	0.1116:0.2921:0.1769:0.4194	.	371;371;371	A8K477;O00391;O00391-2	.;QSOX1_HUMAN;.	L	371	ENSP00000356574:F371L;ENSP00000356572:F371L	ENSP00000356572:F371L	F	+	3	2	QSOX1	178425405	0.045000	0.20229	0.082000	0.20525	0.742000	0.42306	-0.665000	0.05286	-0.148000	0.11234	0.533000	0.62120	TTT	.		0.468	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826	
RAB3GAP2	25782	ucsc.edu;bcgsc.ca	37	1	220364460	220364460	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:220364460G>A	ENST00000358951.2	-	14	1553	c.1437C>T	c.(1435-1437)agC>agT	p.S479S		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	479					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CCTGCTGTGTGCTCCACACTT	0.463																																					p.S479S		.											.	RAB3GAP2	90	0			c.C1437T						.						135.0	133.0	134.0					1																	220364460		2203	4300	6503	SO:0001819	synonymous_variant	25782	exon14			CTGTGTGCTCCAC	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.1437C>T	1.37:g.220364460G>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	ENST00000358951.2	37	CCDS31028.1																																																																																			.		0.463	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
RASGRP3	25780	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	33752434	33752434	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:33752434C>A	ENST00000403687.3	+	10	1778	c.1038C>A	c.(1036-1038)gcC>gcA	p.A346A	RASGRP3_ENST00000402538.3_Silent_p.A346A|RASGRP3_ENST00000407811.1_Silent_p.A346A	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	346	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					TGCAGAATGCCTCTCACCACT	0.468																																					p.A346A		.											.	RASGRP3	661	0			c.C1038A						.						91.0	88.0	89.0					2																	33752434		1983	4167	6150	SO:0001819	synonymous_variant	25780	exon11			GAATGCCTCTCAC	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1038C>A	2.37:g.33752434C>A		Somatic	19.0	0.0		WXS	Illumina HiSeq	.	26.0	5.0	NM_170672	D6W583|O94931|Q53SD7	Silent	SNP	ENST00000403687.3	37	CCDS46256.1																																																																																			.		0.468	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	48947605	48947606	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr13:48947605_48947606insA	ENST00000267163.4	+	12	1330_1331	c.1192_1193insA	c.(1192-1194)gaafs	p.E398fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	398	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.E398L(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCAACCTTCAGAAAATCTGATT	0.287		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.E398fs		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	3784	25	Whole gene deletion(15)|Unknown(8)|Substitution - Missense(2)	bone(11)|breast(5)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.1192_1193insA						.																																			SO:0001589	frameshift_variant	5925	exon12	Familial Cancer Database		CCTTCAGAAAATC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1196dupA	13.37:g.48947609_48947609dupA	ENSP00000267163:p.Glu398fs	Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	311.0	276.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Ins	INS	ENST00000267163.4	37	CCDS31973.1																																																																																			.		0.287	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
RELT	84957	ucsc.edu;bcgsc.ca	37	11	73106527	73106527	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:73106527G>T	ENST00000064780.2	+	11	1545	c.1284G>T	c.(1282-1284)ctG>ctT	p.L428L	RELT_ENST00000393580.2_Silent_p.L428L|RP11-809N8.2_ENST00000544674.1_RNA	NM_152222.1	NP_689408.1	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor	428						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	12						agagcaacctggtcatctgag	0.627																																					p.L428L		.											.	RELT	228	0			c.G1284T						.						108.0	98.0	102.0					11																	73106527		2200	4293	6493	SO:0001819	synonymous_variant	84957	exon11			CAACCTGGTCATC	AF319553	CCDS8222.1	11q13.2	2013-05-22	2007-06-14	2007-06-14		ENSG00000054967		"""Tumor necrosis factor receptor superfamily"""	13764	protein-coding gene	gene with protein product		611211	"""tumor necrosis factor receptor superfamily, member 19-like"""	TNFRSF19L		11313261, 16547002, 16950202, 16389068	Standard	NM_032871		Approved	FLJ14993	uc001otv.3	Q969Z4		ENST00000064780.2:c.1284G>T	11.37:g.73106527G>T		Somatic	43.0	1.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_152222	Q86V34|Q96JU1|Q9BUX7	Silent	SNP	ENST00000064780.2	37	CCDS8222.1																																																																																			.		0.627	RELT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397380.2	NM_032871	
RFPL4A	342931	broad.mit.edu;mdanderson.org	37	19	56274197	56274197	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:56274197C>T	ENST00000434937.2	+	3	691	c.520C>T	c.(520-522)Cga>Tga	p.R174*		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	174	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						ATCTGTGAACCGACAGGGGAA	0.572																																					p.R174X		.											.	RFPL4A	68	0			c.C520T						.						57.0	55.0	55.0					19																	56274197		679	1492	2171	SO:0001587	stop_gained	342931	exon3			GTGAACCGACAGG		CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.520C>T	19.37:g.56274197C>T	ENSP00000392936:p.Arg174*	Somatic	233.0	0.0		WXS	Illumina HiSeq	Phase_I	268.0	46.0	NM_001145014		Nonsense_Mutation	SNP	ENST00000434937.2	37	CCDS46201.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.397992	0.42512	.	.	ENSG00000223638	ENST00000434937	.	.	.	2.36	-2.54	0.06307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.539	2.5983	0.04859	0.3596:0.2672:0.0:0.3732	.	.	.	.	X	174	.	ENSP00000392936:R174X	R	+	1	2	RFPL4A	60966009	0.073000	0.21202	0.000000	0.03702	0.000000	0.00434	1.090000	0.30902	-0.538000	0.06281	-0.905000	0.02835	CGA	.		0.572	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384184.1	XM_292796	
RNF122	79845	ucsc.edu;bcgsc.ca	37	8	33416214	33416214	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr8:33416214G>T	ENST00000256257.1	-	2	502	c.101C>A	c.(100-102)cCg>cAg	p.P34Q		NM_024787.2	NP_079063.2	Q9H9V4	RN122_HUMAN	ring finger protein 122	34						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(67;0.0966)|Kidney(114;0.116)		GATGTTGAGCGGAAGGTCCTG	0.498																																					p.P34Q		.											.	RNF122	226	0			c.C101A						.						119.0	107.0	111.0					8																	33416214		2203	4300	6503	SO:0001583	missense	79845	exon2			TTGAGCGGAAGGT	AK022588	CCDS6091.1	8p12	2013-01-09			ENSG00000133874	ENSG00000133874		"""RING-type (C3HC4) zinc fingers"""	21147	protein-coding gene	gene with protein product							Standard	NM_024787		Approved	FLJ12526	uc003xjo.1	Q9H9V4	OTTHUMG00000163960	ENST00000256257.1:c.101C>A	8.37:g.33416214G>T	ENSP00000256257:p.Pro34Gln	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_024787	Q52LK3	Missense_Mutation	SNP	ENST00000256257.1	37	CCDS6091.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821452	0.90873	.	.	ENSG00000133874	ENST00000256257	T	0.33216	1.42	5.48	5.48	0.80851	.	0.219310	0.48767	D	0.000177	T	0.56761	0.2007	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.58896	-0.7555	10	0.87932	D	0	-15.0732	18.9295	0.92560	0.0:0.0:1.0:0.0	.	34	Q9H9V4	RN122_HUMAN	Q	34	ENSP00000256257:P34Q	ENSP00000256257:P34Q	P	-	2	0	RNF122	33535756	1.000000	0.71417	0.987000	0.45799	0.965000	0.64279	7.444000	0.80532	2.555000	0.86185	0.655000	0.94253	CCG	.		0.498	RNF122-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376562.1	NM_024787	
RSF1	51773	ucsc.edu;bcgsc.ca	37	11	77412597	77412597	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:77412597G>T	ENST00000308488.6	-	6	1979	c.1677C>A	c.(1675-1677)acC>acA	p.T559T	RSF1_ENST00000360355.2_Silent_p.T528T|RSF1_ENST00000480887.1_Silent_p.T307T			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	559					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TACACGACTCGGTGGAAGATA	0.413																																					p.T559T		.											.	RSF1	93	0			c.C1677A						.						187.0	191.0	190.0					11																	77412597		2200	4292	6492	SO:0001819	synonymous_variant	51773	exon6			CGACTCGGTGGAA	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.1677C>A	11.37:g.77412597G>T		Somatic	90.0	0.0		WXS	Illumina HiSeq	.	49.0	5.0	NM_016578	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Silent	SNP	ENST00000308488.6	37	CCDS8253.1																																																																																			.		0.413	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
RTEL1	51750	ucsc.edu;bcgsc.ca	37	20	62311205	62311205	+	Silent	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr20:62311205C>T	ENST00000360203.5	+	13	1366	c.1041C>T	c.(1039-1041)taC>taT	p.Y347Y	RTEL1_ENST00000318100.4_Silent_p.Y347Y|RTEL1_ENST00000370018.3_Silent_p.Y347Y|RTEL1_ENST00000508582.2_Silent_p.Y371Y|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.Y347Y					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			TCGGCAGCTACATCTTTGAGC	0.607																																					p.Y371Y		.											.	RTEL1	44	0			c.C1113T						.						67.0	59.0	62.0					20																	62311205		2203	4300	6503	SO:0001819	synonymous_variant	51750	exon13			CAGCTACATCTTT	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1041C>T	20.37:g.62311205C>T		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_032957		Silent	SNP	ENST00000360203.5	37																																																																																				.		0.607	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
SARDH	1757	ucsc.edu;bcgsc.ca	37	9	136561448	136561448	+	Silent	SNP	G	G	A	rs35013479	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr9:136561448G>A	ENST00000371872.4	-	14	1961	c.1704C>T	c.(1702-1704)gcC>gcT	p.A568A	SARDH_ENST00000422262.2_Silent_p.A400A|SARDH_ENST00000371868.1_5'UTR|SARDH_ENST00000439388.1_Silent_p.A568A	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	568					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CAAACACAGCGGCGGCCCCTC	0.592													G|||	87	0.0173722	0.0651	0.0014	5008	,	,		16162	0.0		0.0	False		,,,				2504	0.0				p.A568A		.											.	SARDH	90	0			c.C1704T						.	G	,	157,4249	107.3+/-145.7	6,145,2052	78.0	74.0	76.0		1704,1704	-10.5	0.0	9	dbSNP_126	76	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	SARDH	NM_001134707.1,NM_007101.3	,	6,145,6352	AA,AG,GG		0.0,3.5633,1.2071	,	568/919,568/919	136561448	157,12849	2203	4300	6503	SO:0001819	synonymous_variant	1757	exon14			CACAGCGGCGGCC		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1704C>T	9.37:g.136561448G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	37	CCDS6978.1																																																																																			G|0.985;A|0.015		0.592	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
SATB1	6304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	18456693	18456693	+	Silent	SNP	T	T	C	rs61733671		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:18456693T>C	ENST00000338745.6	-	5	2283	c.549A>G	c.(547-549)caA>caG	p.Q183Q	TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Silent_p.Q183Q|SATB1_ENST00000417717.2_Silent_p.Q183Q|SATB1_ENST00000475083.1_5'UTR	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	183	PDZ-like dimerization domain.				activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						TGTGCGACCATTGTTCGGGAG	0.448																																					p.Q183Q		.											.	SATB1	228	0			c.A549G						.						114.0	103.0	107.0					3																	18456693		2203	4300	6503	SO:0001819	synonymous_variant	6304	exon5			CGACCATTGTTCG		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.549A>G	3.37:g.18456693T>C		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	41.0	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Silent	SNP	ENST00000338745.6	37	CCDS2631.1																																																																																			T|0.987;C|0.013		0.448	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
SCGB2A2	4250	broad.mit.edu;ucsc.edu	37	11	62040428	62040428	+	Splice_Site	SNP	G	G	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:62040428G>C	ENST00000227918.2	+	3	305		c.e3-1			NM_002411.2	NP_002402.1	Q13296	SG2A2_HUMAN	secretoglobin, family 2A, member 2											large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7						TTGCTTTCTAGCAATTAATAT	0.363																																					.		.											.	SCGB2A2	91	0			c.244-1G>C						.						143.0	136.0	138.0					11																	62040428		2201	4299	6500	SO:0001630	splice_region_variant	4250	exon3			TTTCTAGCAATTA	AF015224	CCDS8018.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000110484	ENSG00000110484		"""Secretoglobins"""	7050	protein-coding gene	gene with protein product	"""mammaglobin A"""	605562	"""mammaglobin 1"""	MGB1		9488047, 8631025, 22155607	Standard	XM_005274005		Approved	UGB2, MGC71974	uc001ntc.3	Q13296	OTTHUMG00000167509	ENST00000227918.2:c.244-1G>C	11.37:g.62040428G>C		Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	16.0	NM_002411	A1A522|Q86WH8	Splice_Site	SNP	ENST00000227918.2	37	CCDS8018.1	.	.	.	.	.	.	.	.	.	.	G	6.639	0.486411	0.12641	.	.	ENSG00000110484	ENST00000227918	.	.	.	3.19	3.19	0.36642	.	.	.	.	.	.	.	.	.	.	.	0.36762	D	0.883352	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1958	0.43054	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCGB2A2	61797004	0.404000	0.25328	0.030000	0.17652	0.010000	0.07245	2.607000	0.46300	2.129000	0.65627	0.555000	0.69702	.	.		0.363	SCGB2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394860.1	NM_002411	Intron
SDCCAG8	10806	ucsc.edu;bcgsc.ca	37	1	243471320	243471320	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:243471320G>T	ENST00000366541.3	+	8	888	c.770G>T	c.(769-771)tGt>tTt	p.C257F	SDCCAG8_ENST00000391846.1_Missense_Mutation_p.C257F|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.C214F|SDCCAG8_ENST00000343783.6_Missense_Mutation_p.C112F	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	257	Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CAGAGAACTTGTGAAGATCTT	0.343																																					p.C257F		.											.	SDCCAG8	90	0			c.G770T						.						133.0	125.0	128.0					1																	243471320		2203	4300	6503	SO:0001583	missense	10806	exon8			GAACTTGTGAAGA	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.770G>T	1.37:g.243471320G>T	ENSP00000355499:p.Cys257Phe	Somatic	70.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_006642	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	37	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.380886	0.24944	.	.	ENSG00000054282	ENST00000355875;ENST00000391846;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	5.6	3.72	0.42706	.	0.138612	0.64402	D	0.000002	T	0.32763	0.0840	M	0.70275	2.135	0.42082	D	0.991255	B;P	0.42961	0.328;0.795	B;B	0.43783	0.151;0.431	T	0.15578	-1.0432	10	0.10111	T	0.7	-0.008	10.9169	0.47142	0.1495:0.0:0.8505:0.0	.	214;257	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	F	214;257;257;112;37	ENSP00000348137:C214F;ENSP00000375721:C257F;ENSP00000355499:C257F;ENSP00000341260:C112F;ENSP00000410200:C37F	ENSP00000341260:C112F	C	+	2	0	SDCCAG8	241537943	1.000000	0.71417	0.981000	0.43875	0.980000	0.70556	3.733000	0.55029	0.830000	0.34757	-0.145000	0.13849	TGT	.		0.343	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642	
SDHA	6389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	240575	240575	+	Missense_Mutation	SNP	G	G	T	rs192818312		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:240575G>T	ENST00000264932.6	+	11	1650	c.1535G>T	c.(1534-1536)cGa>cTa	p.R512L	SDHA_ENST00000504309.1_Missense_Mutation_p.R512L|SDHA_ENST00000510361.1_Missense_Mutation_p.R464L	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	512					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TCGGAACTGCGACTCAGCATG	0.458									Familial Paragangliomas																												p.R512L		.											.	SDHA	226	0			c.G1535T						.						46.0	51.0	50.0					5																	240575		2202	4299	6501	SO:0001583	missense	6389	exon11	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	AACTGCGACTCAG	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1535G>T	5.37:g.240575G>T	ENSP00000264932:p.Arg512Leu	Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	67.0	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	18.62|18.62	3.662639|3.662639	0.67700|0.67700	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000515815|ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	.|D;T;D	.|0.83250	.|-1.7;-0.15;-1.7	4.95|4.95	4.95|4.95	0.65309|0.65309	.|Fumarate reductase/succinate dehydrogenase flavoprotein-like, C-terminal (2);Fumarate reductase/succinate dehydrogenase flavoprotein, C-terminal (1);	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.93903|0.93903	0.8049|0.8049	H|H	0.96048|0.96048	3.76|3.76	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;0.998;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|0.998;0.97;1.0;0.985;0.991	D|D	0.95671|0.95671	0.8723|0.8723	5|10	.|0.87932	.|D	.|0	.|.	16.0271|16.0271	0.80551|0.80551	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|464;512;106;512;512	.|E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040	.|.;.;.;.;DHSA_HUMAN	Y|L	64|512;367;512;464	.|ENSP00000264932:R512L;ENSP00000426514:R512L;ENSP00000427703:R464L	.|ENSP00000264932:R512L	D|R	+|+	1|2	0|0	SDHA|SDHA	293575|293575	1.000000|1.000000	0.71417|0.71417	0.446000|0.446000	0.26920|0.26920	0.521000|0.521000	0.34408|0.34408	9.240000|9.240000	0.95396|0.95396	2.442000|2.442000	0.82660|0.82660	0.650000|0.650000	0.86243|0.86243	GAC|CGA	G|0.999;A|0.001		0.458	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
SDHAF2	54949	broad.mit.edu;bcgsc.ca	37	11	61205239	61205239	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:61205239A>G	ENST00000543265.1	+	2	182	c.179A>G	c.(178-180)gAt>gGt	p.D60G	SDHAF2_ENST00000534878.1_Missense_Mutation_p.D60G|RP11-286N22.8_ENST00000543044.1_Missense_Mutation_p.D48G|SDHAF2_ENST00000301761.2_Missense_Mutation_p.D60G|SDHAF2_ENST00000542074.1_Intron|RP11-286N22.8_ENST00000544880.1_3'UTR|SDHAF2_ENST00000537782.1_Missense_Mutation_p.D60G					succinate dehydrogenase complex assembly factor 2											large_intestine(3)|lung(4)|ovary(2)	9						GAGAGAACTGATGAATCCATA	0.463																																					p.D60G		.											.	SDHAF2	92	0			c.A179G						.						114.0	121.0	119.0					11																	61205239		2202	4299	6501	SO:0001583	missense	54949	exon2			GAACTGATGAATC	AK000494	CCDS8007.1	11q12.2	2014-09-17	2009-08-10	2009-08-10	ENSG00000167985	ENSG00000167985		"""Mitochondrial respiratory chain complex assembly factors"""	26034	protein-coding gene	gene with protein product		613019	"""paraganglioma or familial glomus tumors 2"", ""chromosome 11 open reading frame 79"""	PGL2, C11orf79		19628817	Standard	NM_017841		Approved	FLJ20487, SDH5	uc001nrt.3	Q9NX18	OTTHUMG00000168279	ENST00000543265.1:c.179A>G	11.37:g.61205239A>G	ENSP00000443660:p.Asp60Gly	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	6.0	NM_017841		Missense_Mutation	SNP	ENST00000543265.1	37		.	.	.	.	.	.	.	.	.	.	A	12.19	1.862798	0.32884	.	.	ENSG00000256591;ENSG00000167985;ENSG00000167985	ENST00000541135;ENST00000301761;ENST00000543265	T;T;T	0.78595	-1.05;-0.99;-1.19	5.61	5.61	0.85477	.	0.230480	0.52532	D	0.000078	T	0.67496	0.2899	L	0.42581	1.335	0.46701	D	0.99916	B	0.13145	0.007	B	0.06405	0.002	T	0.62191	-0.6906	10	0.02654	T	1	-14.8721	15.0834	0.72133	1.0:0.0:0.0:0.0	.	60	Q9NX18	SDHF2_HUMAN	G	60	ENSP00000443130:D60G;ENSP00000301761:D60G;ENSP00000443660:D60G	ENSP00000440939:D60G	D	+	2	0	SDHAF2;RP11-286N22.8	60961815	0.726000	0.28059	0.999000	0.59377	0.995000	0.86356	1.823000	0.39062	2.254000	0.74563	0.533000	0.62120	GAT	.		0.463	SDHAF2-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000398484.1	NM_017841	
SEMA3F	6405	ucsc.edu;bcgsc.ca	37	3	50211496	50211496	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:50211496A>G	ENST00000002829.3	+	4	769	c.285A>G	c.(283-285)gcA>gcG	p.A95A	MIR566_ENST00000385187.1_RNA|SEMA3F_ENST00000434342.1_Silent_p.A95A|SEMA3F_ENST00000413852.1_Silent_p.A27A	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	95	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		TACACTGGGCAGCCTCCCCAC	0.632																																					p.A95A		.											.	SEMA3F	279	0			c.A285G						.						81.0	80.0	80.0					3																	50211496		2203	4300	6503	SO:0001819	synonymous_variant	6405	exon4			CTGGGCAGCCTCC	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.285A>G	3.37:g.50211496A>G		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	37	CCDS2811.1																																																																																			.		0.632	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
SGSM2	9905	ucsc.edu;bcgsc.ca	37	17	2276333	2276333	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:2276333T>C	ENST00000426855.2	+	15	1915	c.1740T>C	c.(1738-1740)ctT>ctC	p.L580L	SGSM2_ENST00000268989.3_Silent_p.L625L|SGSM2_ENST00000574563.1_Silent_p.L580L|RP1-59D14.5_ENST00000574290.1_RNA	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	580	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CCTTTCTGCTTGGCCACTACA	0.602																																					p.L625L		.											.	SGSM2	68	0			c.T1875C						.						66.0	51.0	56.0					17																	2276333		2201	4299	6500	SO:0001819	synonymous_variant	9905	exon16			TCTGCTTGGCCAC	BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1740T>C	17.37:g.2276333T>C		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_014853	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	ENST00000426855.2	37	CCDS45570.1																																																																																			.		0.602	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438186.1	NM_014853	
SHISA6	388336	ucsc.edu;bcgsc.ca	37	17	11455212	11455212	+	Intron	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:11455212G>T	ENST00000409168.3	+	3	799				SHISA6_ENST00000432116.3_Intron|SHISA6_ENST00000441885.3_Splice_Site	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6							alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						ATGATTTTCAGGTGATCATCA	0.403																																					.		.											.	SHISA6	67	0			c.896-1G>T						.						228.0	187.0	199.0					17																	11455212		692	1591	2283	SO:0001627	intron_variant	388336	exon4			TTTTCAGGTGATC	AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.800-3845G>T	17.37:g.11455212G>T		Somatic	47.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_207386	B3KXV5|Q4PL63	Splice_Site	SNP	ENST00000409168.3	37	CCDS54090.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.296591	0.60086	.	.	ENSG00000188803	ENST00000441885	.	.	.	3.82	3.82	0.43975	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5005	0.50435	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SHISA6	11395937	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.617000	0.54181	2.431000	0.82371	0.467000	0.42956	.	.		0.403	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000333970.2	NM_207386	
SHROOM3	57619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77357245	77357245	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:77357245A>G	ENST00000296043.6	+	1	993	c.40A>G	c.(40-42)Aca>Gca	p.T14A		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	14					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			GCCTAGTGCCACATTAAACTC	0.483																																					p.T14A		.											.	SHROOM3	93	0			c.A40G						.						174.0	167.0	170.0					4																	77357245		2203	4300	6503	SO:0001583	missense	57619	exon1			AGTGCCACATTAA	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.40A>G	4.37:g.77357245A>G	ENSP00000296043:p.Thr14Ala	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	42.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	.	.	.	.	.	.	.	.	.	.	A	15.25	2.778445	0.49786	.	.	ENSG00000138771	ENST00000296043	T	0.19532	2.14	5.12	-1.69	0.08186	.	1.822020	0.02688	N	0.110299	T	0.11239	0.0274	N	0.16478	0.41	0.09310	N	1	B	0.21452	0.056	B	0.12156	0.007	T	0.21449	-1.0245	10	0.41790	T	0.15	-1.3602	0.3518	0.00350	0.307:0.1287:0.2417:0.3227	.	14	Q8TF72	SHRM3_HUMAN	A	14	ENSP00000296043:T14A	ENSP00000296043:T14A	T	+	1	0	SHROOM3	77576269	0.009000	0.17119	0.182000	0.23118	0.004000	0.04260	-0.211000	0.09332	-0.122000	0.11766	-0.334000	0.08254	ACA	.		0.483	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
SLC10A7	84068	ucsc.edu;bcgsc.ca	37	4	147204345	147204345	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:147204345C>A	ENST00000507030.1	-	10	845	c.846G>T	c.(844-846)ttG>ttT	p.L282F	SLC10A7_ENST00000432059.2_Splice_Site_p.L269F|SLC10A7_ENST00000264986.3_3'UTR|SLC10A7_ENST00000335472.7_Splice_Site_p.L282F|SLC10A7_ENST00000394062.3_Splice_Site_p.L282F			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7	282					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					ATCACTTACCCAATGTAAGGG	0.358																																					p.L282F		.											.	SLC10A7	22	0			c.G846T						.						84.0	83.0	83.0					4																	147204345		2203	4300	6503	SO:0001630	splice_region_variant	84068	exon10			CTTACCCAATGTA	AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.847+1G>T	4.37:g.147204345C>A		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	49.0	5.0	NM_001029998	A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Missense_Mutation	SNP	ENST00000507030.1	37	CCDS34073.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843092	0.71488	.	.	ENSG00000120519	ENST00000432059;ENST00000335472;ENST00000507030;ENST00000394062	.	.	.	5.69	3.95	0.45737	.	0.000000	0.85682	D	0.000000	T	0.69015	0.3064	L	0.60067	1.865	0.80722	D	1	P;D;D	0.89917	0.923;0.999;1.0	P;D;D	0.87578	0.47;0.983;0.998	T	0.70468	-0.4863	9	0.62326	D	0.03	-8.7247	9.3795	0.38304	0.0:0.7862:0.0:0.2138	.	269;282;282	Q0GE19-3;Q0GE19;Q0GE19-2	.;NTCP7_HUMAN;.	F	269;282;282;282	.	ENSP00000334594:L282F	L	-	3	2	SLC10A7	147423795	0.998000	0.40836	0.994000	0.49952	0.988000	0.76386	0.509000	0.22707	1.548000	0.49413	0.655000	0.94253	TTG	.		0.358	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366932.1	NM_032128	Missense_Mutation
SLC22A24	283238	ucsc.edu;bcgsc.ca	37	11	62848565	62848565	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:62848565G>T	ENST00000417740.1	-	9	1866	c.1425C>A	c.(1423-1425)tcC>tcA	p.S475S		NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	0					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						CAGTCCTACCGGACACTGCAT	0.448																																					p.S475S		.											.	.	.	0			c.C1425A						.						93.0	92.0	92.0					11																	62848565		692	1591	2283	SO:0001819	synonymous_variant	283238	exon9			CCTACCGGACACT		CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.1425C>A	11.37:g.62848565G>T		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_001136506		Silent	SNP	ENST00000417740.1	37																																																																																				.		0.448	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000383747.1	NM_173586	
SLC25A16	8034	ucsc.edu;bcgsc.ca	37	10	70253301	70253301	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:70253301G>A	ENST00000609923.1	-	5	546	c.448C>T	c.(448-450)Cct>Tct	p.P150S	SLC25A16_ENST00000265870.3_Intron|SLC25A16_ENST00000539557.1_Missense_Mutation_p.P52S	NM_152707.3	NP_689920.1	P16260	GDC_HUMAN	solute carrier family 25 (mitochondrial carrier), member 16	150				YPL -> DPV (in Ref. 1; AAA36329). {ECO:0000305}.	coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	antiporter activity (GO:0015297)			endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	7						ATGTCAAGAGGGTAAGTACAG	0.348																																					p.P150S		.											.	SLC25A16	90	0			c.C448T						.						88.0	80.0	83.0					10																	70253301		2203	4300	6503	SO:0001583	missense	8034	exon5			CAAGAGGGTAAGT	M31659	CCDS7280.1	10q21.3-q22.1	2014-06-17	2014-06-17		ENSG00000122912	ENSG00000122912		"""Solute carriers"""	10986	protein-coding gene	gene with protein product	"""Graves disease autoantigen"""	139080				8444471, 2575220	Standard	NM_152707		Approved	GDA, D10S105E, HGT.1, ML7	uc001joi.3	P16260	OTTHUMG00000018354	ENST00000609923.1:c.448C>T	10.37:g.70253301G>A	ENSP00000476815:p.Pro150Ser	Somatic	82.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_152707	Q8N2U1	Missense_Mutation	SNP	ENST00000609923.1	37	CCDS7280.1	.	.	.	.	.	.	.	.	.	.	G	33	5.266130	0.95399	.	.	ENSG00000122912	ENST00000265870;ENST00000539557	D;D	0.96885	-4.16;-4.16	5.49	5.49	0.81192	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.98807	0.9598	H	0.95780	3.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99541	1.0963	10	0.87932	D	0	-24.36	19.3628	0.94448	0.0:0.0:1.0:0.0	.	150	P16260	GDC_HUMAN	S	150;52	ENSP00000265870:P150S;ENSP00000443914:P52S	ENSP00000265870:P150S	P	-	1	0	SLC25A16	69923307	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.627000	0.98412	2.564000	0.86499	0.563000	0.77884	CCT	.		0.348	SLC25A16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048347.2		
SLC34A1	6569	ucsc.edu;bcgsc.ca	37	5	176821189	176821189	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:176821189C>A	ENST00000324417.5	+	10	1258	c.1167C>A	c.(1165-1167)atC>atA	p.I389I	SLC34A1_ENST00000513614.1_Intron	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	389					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGAAGGTCATCAATACgggtg	0.567																																					p.I389I		.											.	SLC34A1	91	0			c.C1167A						.						120.0	112.0	115.0					5																	176821189		2203	4300	6503	SO:0001819	synonymous_variant	6569	exon10			GGTCATCAATACG	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1167C>A	5.37:g.176821189C>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_003052	B4DPE3	Silent	SNP	ENST00000324417.5	37	CCDS4418.1																																																																																			.		0.567	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253431.1	NM_003052	
SLC44A3	126969	ucsc.edu;bcgsc.ca	37	1	95332918	95332918	+	Missense_Mutation	SNP	G	G	T	rs142020864	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:95332918G>T	ENST00000271227.6	+	12	1529	c.1427G>T	c.(1426-1428)cGa>cTa	p.R476L	SLC44A3_ENST00000530397.1_3'UTR|SLC44A3_ENST00000529450.1_Missense_Mutation_p.R443L|SLC44A3_ENST00000467909.1_Missense_Mutation_p.R428L|SLC44A3_ENST00000446120.2_Missense_Mutation_p.R440L|SLC44A3_ENST00000527077.1_Missense_Mutation_p.R408L|SLC44A3_ENST00000532427.1_Missense_Mutation_p.R396L	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	476					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TACCTGTTCCGATGCTGCTAC	0.478																																					p.R476L		.											.	SLC44A3	91	0			c.G1427T						.						214.0	163.0	180.0					1																	95332918		2203	4300	6503	SO:0001583	missense	126969	exon12			TGTTCCGATGCTG	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.1427G>T	1.37:g.95332918G>T	ENSP00000271227:p.Arg476Leu	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	55.0	6.0	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	37	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246708	0.22796	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000532427;ENST00000532670	T;T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0;2.0	5.95	1.47	0.22746	.	0.555420	0.17739	N	0.163612	T	0.06325	0.0163	L	0.38175	1.15	0.37667	D	0.922998	P;B;P;P;B	0.41597	0.549;0.013;0.549;0.756;0.002	B;B;B;B;B	0.36092	0.217;0.015;0.217;0.217;0.005	T	0.20207	-1.0282	10	0.51188	T	0.08	-2.8927	8.3727	0.32425	0.4855:0.0:0.5145:0.0	.	396;440;408;443;476	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	L	440;476;408;443;428;396;11	ENSP00000389143:R440L;ENSP00000271227:R476L;ENSP00000433641:R408L;ENSP00000431836:R443L;ENSP00000432789:R428L;ENSP00000436661:R396L;ENSP00000432880:R11L	ENSP00000271227:R476L	R	+	2	0	SLC44A3	95105506	1.000000	0.71417	0.924000	0.36721	0.023000	0.10783	2.693000	0.47027	0.417000	0.25871	-0.251000	0.11542	CGA	G|0.999;A|0.001		0.478	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
SLC8A1	6546	ucsc.edu;bcgsc.ca	37	2	40657282	40657282	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:40657282C>A	ENST00000403092.1	-	2	172	c.139G>T	c.(139-141)Ggt>Tgt	p.G47C	SLC8A1_ENST00000402441.1_Missense_Mutation_p.G47C|SLC8A1_ENST00000332839.4_Missense_Mutation_p.G47C|SLC8A1_ENST00000406391.2_Missense_Mutation_p.G47C|SLC8A1_ENST00000542756.1_Missense_Mutation_p.G47C|SLC8A1_ENST00000542024.1_Missense_Mutation_p.G47C|SLC8A1_ENST00000405269.1_Missense_Mutation_p.G47C|SLC8A1_ENST00000406785.2_Missense_Mutation_p.G47C|SLC8A1_ENST00000408028.2_Missense_Mutation_p.G47C|SLC8A1_ENST00000405901.3_Missense_Mutation_p.G47C			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	47					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GTACATTCACCAGTTTCATTT	0.408																																					p.G47C		.											.	SLC8A1	93	0			c.G139T						.						138.0	136.0	137.0					2																	40657282		2203	4300	6503	SO:0001583	missense	6546	exon1			ATTCACCAGTTTC		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.139G>T	2.37:g.40657282C>A	ENSP00000384763:p.Gly47Cys	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	81.0	8.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	37	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	9.770	1.172367	0.21704	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000542640;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024;ENST00000455476;ENST00000448531;ENST00000417271	T;T;T;T;T;T;T;T;T;T	0.28255	1.62;1.67;1.67;1.67;1.62;1.62;1.67;1.63;1.62;1.63	6.04	1.74	0.24563	.	1.068930	0.06997	N	0.822636	T	0.23806	0.0576	L	0.38175	1.15	0.09310	N	1	B;B;P;B;B	0.37276	0.071;0.284;0.589;0.0;0.221	B;B;B;B;B	0.33196	0.105;0.148;0.148;0.001;0.159	T	0.22487	-1.0215	10	0.52906	T	0.07	.	8.0782	0.30729	0.0:0.5918:0.0:0.4082	.	47;47;47;47;47	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	C	47	ENSP00000383886:G47C;ENSP00000440727:G47C;ENSP00000384763:G47C;ENSP00000385678:G47C;ENSP00000385188:G47C;ENSP00000385535:G47C;ENSP00000332931:G47C;ENSP00000384908:G47C;ENSP00000385811:G47C;ENSP00000443515:G47C	ENSP00000332931:G47C	G	-	1	0	SLC8A1	40510786	0.011000	0.17503	0.006000	0.13384	0.990000	0.78478	1.091000	0.30915	0.436000	0.26393	0.563000	0.77884	GGT	.		0.408	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
SLIT2	9353	ucsc.edu;bcgsc.ca	37	4	20570613	20570613	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr4:20570613C>A	ENST00000504154.1	+	29	3326	c.3074C>A	c.(3073-3075)cCa>cAa	p.P1025Q	SLIT2_ENST00000503823.1_Missense_Mutation_p.P1017Q|SLIT2_ENST00000273739.5_Missense_Mutation_p.P1029Q|SLIT2_ENST00000503837.1_Missense_Mutation_p.P1021Q	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1025	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TGCCTTTGCCCACCTGAGTAT	0.328																																					p.P1025Q		.											.	SLIT2	521	0			c.C3074A						.						122.0	113.0	116.0					4																	20570613		2203	4300	6503	SO:0001583	missense	9353	exon29			TTTGCCCACCTGA	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3074C>A	4.37:g.20570613C>A	ENSP00000422591:p.Pro1025Gln	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	37	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128738	0.77549	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.96232	-3.92;-3.92;-3.95;-3.92	5.61	5.61	0.85477	EGF (1);EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.051191	0.85682	D	0.000000	D	0.97632	0.9224	M	0.74258	2.255	0.80722	D	1	P;P	0.52577	0.954;0.867	P;P	0.60609	0.877;0.877	D	0.96347	0.9255	10	0.27785	T	0.31	.	20.0018	0.97417	0.0:1.0:0.0:0.0	.	1017;1025	O94813-3;O94813	.;SLIT2_HUMAN	Q	1017;1025;1029;1021;1021	ENSP00000427548:P1017Q;ENSP00000422591:P1025Q;ENSP00000273739:P1029Q;ENSP00000422261:P1021Q	ENSP00000273739:P1029Q	P	+	2	0	SLIT2	20179711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.793000	0.96121	0.655000	0.94253	CCA	.		0.328	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SNTB2	6645	ucsc.edu;bcgsc.ca	37	16	69279693	69279693	+	Missense_Mutation	SNP	C	C	A	rs200536488		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:69279693C>A	ENST00000336278.4	+	2	807	c.769C>A	c.(769-771)Cta>Ata	p.L257I	SNTB2_ENST00000528525.1_3'UTR	NM_006750.3	NP_006741.1	Q13425	SNTB2_HUMAN	syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)	257	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|microtubule (GO:0005874)|protein complex (GO:0043234)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)		TGCTAGAAACCTAAGCATGCC	0.443																																					p.L257I	NSCLC(58;1458 1722 3262 39967)|Melanoma(111;1698 2173 25379 28738)	.											.	SNTB2	90	0			c.C769A						.						190.0	180.0	183.0					16																	69279693		2198	4300	6498	SO:0001583	missense	6645	exon2			AGAAACCTAAGCA	U40572	CCDS10873.1	16q22.1	2008-05-14	2002-08-29		ENSG00000168807	ENSG00000168807			11169	protein-coding gene	gene with protein product		600027	"""syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2)"""	SNT2B2, SNTL, D16S2531E		8576247, 8183929	Standard	NM_006750		Approved	EST25263, SNT3	uc002ewu.3	Q13425	OTTHUMG00000137567	ENST00000336278.4:c.769C>A	16.37:g.69279693C>A	ENSP00000338191:p.Leu257Ile	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_006750	Q9BY09	Missense_Mutation	SNP	ENST00000336278.4	37	CCDS10873.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.325724|4.325724	0.81580|0.81580	.|.	.|.	ENSG00000168807|ENSG00000168807	ENST00000336278|ENST00000360496	T|.	0.56776|.	0.44|.	5.76|5.76	3.83|3.83	0.44106|0.44106	Pleckstrin homology domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60130|0.60130	0.2245|0.2245	L|L	0.50333|0.50333	1.59|1.59	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.47302|.	0.893|.	P|.	0.47673|.	0.554|.	T|T	0.55835|0.55835	-0.8078|-0.8078	10|5	0.23302|.	T|.	0.38|.	-23.8625|-23.8625	12.1728|12.1728	0.54167|0.54167	0.0:0.8608:0.0:0.1392|0.0:0.8608:0.0:0.1392	.|.	257|.	Q13425|.	SNTB2_HUMAN|.	I|H	257|113	ENSP00000338191:L257I|.	ENSP00000338191:L257I|.	L|P	+|+	1|2	2|0	SNTB2|SNTB2	67837194|67837194	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.953000|1.953000	0.40352|0.40352	0.797000|0.797000	0.33971|0.33971	0.561000|0.561000	0.74099|0.74099	CTA|CCT	C|0.999;T|0.001		0.443	SNTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268945.1		
SNX6	58533	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	35072633	35072633	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr14:35072633A>C	ENST00000362031.4	-	6	503	c.473T>G	c.(472-474)gTg>gGg	p.V158G	SNX6_ENST00000355110.5_Missense_Mutation_p.V34G|SNX6_ENST00000396526.3_Missense_Mutation_p.V30G|SNX6_ENST00000396534.3_Missense_Mutation_p.V30G	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	146	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		ACACAGGAACACTTCATGCAT	0.338																																					p.V158G		.											.	SNX6	226	0			c.T473G						.						80.0	77.0	78.0					14																	35072633		2203	4300	6503	SO:0001583	missense	58533	exon6			AGGAACACTTCAT	AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.473T>G	14.37:g.35072633A>C	ENSP00000355217:p.Val158Gly	Somatic	176.0	2.0		WXS	Illumina HiSeq	Phase_I	168.0	75.0	NM_152233	C0H5W9|Q9Y449	Missense_Mutation	SNP	ENST00000362031.4	37	CCDS41942.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.941819	0.53079	.	.	ENSG00000129515	ENST00000396526;ENST00000396534;ENST00000362031;ENST00000355110;ENST00000557265	T;T;T;T;T	0.41400	1.74;1.74;1.0;1.78;1.0	5.66	5.66	0.87406	Phox homologous domain (4);	0.123536	0.53938	D	0.000059	T	0.51415	0.1673	M	0.90483	3.12	0.80722	D	1	B;B	0.34313	0.079;0.448	B;B	0.32762	0.023;0.152	T	0.61004	-0.7150	10	0.87932	D	0	-9.5206	12.4656	0.55757	0.8749:0.0:0.0:0.1251	.	34;146	B4DJS7;Q9UNH7	.;SNX6_HUMAN	G	30;30;158;34;121	ENSP00000379779:V30G;ENSP00000379785:V30G;ENSP00000355217:V158G;ENSP00000347230:V34G;ENSP00000452577:V121G	ENSP00000347230:V34G	V	-	2	0	SNX6	34142384	1.000000	0.71417	0.999000	0.59377	0.084000	0.17831	9.249000	0.95470	2.291000	0.77112	0.533000	0.62120	GTG	.		0.338	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276642.3		
SOWAHA	134548	ucsc.edu;bcgsc.ca	37	5	132150924	132150924	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:132150924T>C	ENST00000378693.2	+	1	1892	c.1611T>C	c.(1609-1611)ccT>ccC	p.P537P	AC004775.5_ENST00000607389.1_lincRNA	NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	537																	CTCCGGGGCCTTTAGCTGGTC	0.572																																					p.P537P		.											.	.	.	0			c.T1611C						.						24.0	28.0	26.0					5																	132150924		2159	4273	6432	SO:0001819	synonymous_variant	134548	exon1			GGGGCCTTTAGCT	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.1611T>C	5.37:g.132150924T>C		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_175873	Q8NAE7	Silent	SNP	ENST00000378693.2	37	CCDS43361.1																																																																																			.		0.572	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
SPAG17	200162	ucsc.edu;bcgsc.ca	37	1	118727771	118727771	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:118727771T>C	ENST00000336338.5	-	1	75	c.10A>G	c.(10-12)Aag>Gag	p.K4E		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	4						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTCTCCTTCTTGGGTGCCATG	0.552																																					p.K4E		.											.	SPAG17	158	0			c.A10G						.						154.0	141.0	145.0					1																	118727771		2203	4300	6503	SO:0001583	missense	200162	exon1			CCTTCTTGGGTGC		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.10A>G	1.37:g.118727771T>C	ENSP00000337804:p.Lys4Glu	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543357	0.65198	.	.	ENSG00000155761	ENST00000336338	T	0.30182	1.54	4.88	4.88	0.63580	.	0.061993	0.64402	N	0.000011	T	0.33644	0.0870	L	0.42245	1.32	0.30426	N	0.777668	D	0.76494	0.999	D	0.83275	0.996	T	0.15838	-1.0423	10	0.87932	D	0	.	11.0513	0.47893	0.0:0.0:0.0:1.0	.	4	Q6Q759	SPG17_HUMAN	E	4	ENSP00000337804:K4E	ENSP00000337804:K4E	K	-	1	0	SPAG17	118529294	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.003000	0.40844	2.180000	0.69256	0.454000	0.30748	AAG	.		0.552	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
SPTA1	6708	broad.mit.edu;bcgsc.ca	37	1	158619678	158619678	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:158619678C>A	ENST00000368147.4	-	25	3717	c.3537G>T	c.(3535-3537)ctG>ctT	p.L1179L		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1179					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GGGCACTGCCCAGCAGCTGCC	0.428																																					p.L1179L		.											.	SPTA1	142	0			c.G3537T						.						29.0	30.0	29.0					1																	158619678		1835	4088	5923	SO:0001819	synonymous_variant	6708	exon25			ACTGCCCAGCAGC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3537G>T	1.37:g.158619678C>A		Somatic	89.0	1.0		WXS	Illumina HiSeq	Phase_I	178.0	14.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	ENST00000368147.4	37	CCDS41423.1																																																																																			.		0.428	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SREBF1	6720	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	17716721	17716721	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:17716721G>A	ENST00000261646.5	-	18	3359	c.3175C>T	c.(3175-3177)Cgc>Tgc	p.R1059C	SREBF1_ENST00000395757.1_Missense_Mutation_p.R805C|SREBF1_ENST00000355815.4_Missense_Mutation_p.R1089C|SREBF1_ENST00000338854.5_Intron|MIR33B_ENST00000385104.1_RNA	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	1059					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CTCAGACTGCGGTCGAGGAGC	0.697																																					p.R1089C		.											.	SREBF1	91	0			c.C3265T						.						16.0	19.0	18.0					17																	17716721		2188	4291	6479	SO:0001583	missense	6720	exon19			GACTGCGGTCGAG	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.3175C>T	17.37:g.17716721G>A	ENSP00000261646:p.Arg1059Cys	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	10.0	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	37	CCDS11189.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.231735|4.231735	0.79688|0.79688	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000395751|ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161	.|T;T;T	.|0.13657	.|2.57;2.57;2.57	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.44726|0.44726	0.1307|0.1307	M|M	0.85542|0.85542	2.76|2.76	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.999;0.997	T|T	0.50575|0.50575	-0.8812|-0.8812	5|10	.|0.87932	.|D	.|0	-20.4027|-20.4027	18.6002|18.6002	0.91246|0.91246	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1059;1089;678	.|P36956;P36956-4;A8MTU8	.|SRBP1_HUMAN;.;.	L|C	1066|1089;1059;805;678;896;985	.|ENSP00000348069:R1089C;ENSP00000261646:R1059C;ENSP00000379106:R805C	.|ENSP00000261646:R1059C	P|R	-|-	2|1	0|0	SREBF1|SREBF1	17657446|17657446	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.461000|0.461000	0.32589|0.32589	7.667000|7.667000	0.83888|0.83888	2.483000|2.483000	0.83821|0.83821	0.561000|0.561000	0.74099|0.74099	CCG|CGC	.		0.697	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
ST6GALNAC2	10610	ucsc.edu;bcgsc.ca	37	17	74562309	74562309	+	Silent	SNP	G	G	T	rs376921403		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:74562309G>T	ENST00000225276.5	-	9	1321	c.1002C>A	c.(1000-1002)tcC>tcA	p.S334S		NM_006456.2	NP_006447.2	Q9UJ37	SIA7B_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2	334					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	sialyltransferase activity (GO:0008373)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	11						AATAGTGGTCGGAAAATTTCC	0.473																																					p.S334S		.											.	ST6GALNAC2	90	0			c.C1002A						.						167.0	151.0	156.0					17																	74562309		2203	4300	6503	SO:0001819	synonymous_variant	10610	exon9			GTGGTCGGAAAAT	U14550	CCDS11747.1	17q25.1	2013-03-01	2003-12-05	2005-02-07	ENSG00000070731	ENSG00000070731	2.4.99.7	"""Sialyltransferases"""	10867	protein-coding gene	gene with protein product		610137	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"", ""sialyltransferase-like 1"""	SIAT7, SIAT7B, SIATL1		11984005	Standard	NM_006456		Approved	ST6GalNAII, STHM	uc002jsg.4	Q9UJ37	OTTHUMG00000180301	ENST00000225276.5:c.1002C>A	17.37:g.74562309G>T		Somatic	46.0	0.0		WXS	Illumina HiSeq	.	65.0	6.0	NM_006456	Q12971	Silent	SNP	ENST00000225276.5	37	CCDS11747.1																																																																																			.		0.473	ST6GALNAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450650.1	NM_006456	
STARD3NL	83930	broad.mit.edu;bcgsc.ca	37	7	38253999	38253999	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:38253999G>A	ENST00000009041.7	+	3	524	c.267G>A	c.(265-267)atG>atA	p.M89I	STARD3NL_ENST00000396013.1_Missense_Mutation_p.M89I|STARD3NL_ENST00000544203.1_Missense_Mutation_p.M82I|STARD3NL_ENST00000434197.1_Missense_Mutation_p.M89I	NM_032016.3	NP_114405.1	O95772	MENTO_HUMAN	STARD3 N-terminal like	89	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.					endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10						AGGAGGTGATGCAGTATGACT	0.338																																					p.M89I		.											.	STARD3NL	91	0			c.G267A						.						211.0	216.0	214.0					7																	38253999		2203	4300	6503	SO:0001583	missense	83930	exon3			GGTGATGCAGTAT	AJ492267	CCDS5455.1	7p14-p13	2003-02-06			ENSG00000010270	ENSG00000010270			19169	protein-coding gene	gene with protein product		611759				12393907	Standard	NM_032016		Approved	MENTHO, MGC3251	uc003tfr.3	O95772	OTTHUMG00000023659	ENST00000009041.7:c.267G>A	7.37:g.38253999G>A	ENSP00000009041:p.Met89Ile	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	6.0	NM_032016	A4D1X0	Missense_Mutation	SNP	ENST00000009041.7	37	CCDS5455.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.323328	0.01309	.	.	ENSG00000010270	ENST00000009041;ENST00000544203;ENST00000434197;ENST00000396013;ENST00000440144;ENST00000453225;ENST00000429075	T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12;1.12	5.52	0.229	0.15368	MENTAL domain (2);	0.316623	0.34110	N	0.004249	T	0.09949	0.0244	N	0.01438	-0.865	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16630	-1.0396	10	0.07175	T	0.84	-3.6359	0.29	0.00257	0.3246:0.1328:0.2548:0.2877	.	89;89	C9JKL2;O95772	.;MENTO_HUMAN	I	89;82;89;89;89;89;89	ENSP00000009041:M89I;ENSP00000439436:M82I;ENSP00000394000:M89I;ENSP00000379334:M89I;ENSP00000411933:M89I;ENSP00000395455:M89I;ENSP00000402028:M89I	ENSP00000009041:M89I	M	+	3	0	STARD3NL	38220524	0.994000	0.37717	0.374000	0.26016	0.579000	0.36224	0.435000	0.21510	-0.024000	0.13941	-0.148000	0.13756	ATG	.		0.338	STARD3NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226929.2		
STARD5	80765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81615246	81615246	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr15:81615246C>A	ENST00000302824.6	-	2	168	c.143G>T	c.(142-144)gGg>gTg	p.G48V	RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA|STARD5_ENST00000559913.1_5'UTR	NM_181900.2	NP_871629.1	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer (START) domain containing 5	48	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				C21-steroid hormone biosynthetic process (GO:0006700)|lipid transport (GO:0006869)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)	lipid binding (GO:0008289)			large_intestine(3)|ovary(1)|skin(1)|stomach(1)	6						TTACAGGTTCCCTGGAAACTC	0.483																																					p.G48V		.											.	STARD5	91	0			c.G143T						.						76.0	76.0	76.0					15																	81615246		2203	4300	6503	SO:0001583	missense	80765	exon2			AGGTTCCCTGGAA	AF480304	CCDS10318.1	15q26	2011-09-12	2007-08-16		ENSG00000172345	ENSG00000172345		"""StAR-related lipid transfer (START) domain containing"""	18065	protein-coding gene	gene with protein product		607050	"""START domain containing 5"""			12011452	Standard	NM_181900		Approved	MGC10327	uc002bgm.3	Q9NSY2	OTTHUMG00000147342	ENST00000302824.6:c.143G>T	15.37:g.81615246C>A	ENSP00000304032:p.Gly48Val	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	43.0	NM_181900	P59094	Missense_Mutation	SNP	ENST00000302824.6	37	CCDS10318.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.868363	0.91587	.	.	ENSG00000172345	ENST00000302824	T	0.79247	-1.25	5.4	5.4	0.78164	Lipid-binding START (3);START-like domain (1);	0.000000	0.85682	D	0.000000	D	0.88987	0.6587	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86928	0.2071	10	0.25106	T	0.35	-11.9245	18.7698	0.91887	0.0:1.0:0.0:0.0	.	48	Q9NSY2	STAR5_HUMAN	V	48	ENSP00000304032:G48V	ENSP00000304032:G48V	G	-	2	0	STARD5	79402301	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.520000	0.73773	2.542000	0.85734	0.655000	0.94253	GGG	.		0.483	STARD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303950.2		
SUSD5	26032	ucsc.edu;bcgsc.ca	37	3	33195198	33195198	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:33195198T>C	ENST00000309558.3	-	5	1343	c.926A>G	c.(925-927)gAg>gGg	p.E309G		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	309					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						ATCATCCACCTCCTTTTCCAA	0.522																																					p.E309G		.											.	SUSD5	24	0			c.A926G						.						45.0	45.0	45.0					3																	33195198		1924	4138	6062	SO:0001583	missense	26032	exon5			TCCACCTCCTTTT	AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.926A>G	3.37:g.33195198T>C	ENSP00000308727:p.Glu309Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_015551		Missense_Mutation	SNP	ENST00000309558.3	37	CCDS46787.1	.	.	.	.	.	.	.	.	.	.	T	9.841	1.190977	0.21954	.	.	ENSG00000173705	ENST00000309558	T	0.08008	3.14	5.91	1.98	0.26296	.	0.579453	0.18031	N	0.153907	T	0.07052	0.0179	L	0.43152	1.355	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.31613	-0.9937	10	0.33940	T	0.23	-9.9659	6.5243	0.22293	0.0:0.1395:0.3567:0.5038	.	309	O60279	SUSD5_HUMAN	G	309	ENSP00000308727:E309G	ENSP00000308727:E309G	E	-	2	0	SUSD5	33170202	0.012000	0.17670	0.145000	0.22337	0.877000	0.50540	0.867000	0.27968	0.475000	0.27415	0.533000	0.62120	GAG	.		0.522	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341902.1	XM_171054	
SUCNR1	56670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	151598552	151598552	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:151598552G>T	ENST00000362032.5	+	3	326	c.221G>T	c.(220-222)tGc>tTc	p.C74F	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	74						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	GCTTTTCTGTGCACCCTCCCC	0.423																																					p.C74F		.											.	SUCNR1	711	0			c.G221T						.						152.0	149.0	150.0					3																	151598552		2203	4300	6503	SO:0001583	missense	56670	exon3			TTCTGTGCACCCT	AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.221G>T	3.37:g.151598552G>T	ENSP00000355156:p.Cys74Phe	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	59.0	NM_033050	A8K305|Q8TDQ8	Missense_Mutation	SNP	ENST00000362032.5	37	CCDS3162.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603049	0.28534	.	.	ENSG00000198829	ENST00000362032	T	0.35789	1.29	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50548	0.1622	L	0.33624	1.015	0.47441	D	0.999423	D	0.76494	0.999	D	0.79784	0.993	T	0.39603	-0.9606	10	0.34782	T	0.22	.	19.2413	0.93886	0.0:0.0:1.0:0.0	.	74	Q9BXA5	SUCR1_HUMAN	F	74	ENSP00000355156:C74F	ENSP00000355156:C74F	C	+	2	0	SUCNR1	153081242	1.000000	0.71417	0.999000	0.59377	0.058000	0.15608	4.301000	0.59086	2.625000	0.88918	0.655000	0.94253	TGC	.		0.423	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357897.2	NM_033050	
TAF1	6872	broad.mit.edu;bcgsc.ca	37	X	70597452	70597452	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:70597452G>T	ENST00000373790.4	+	6	762		c.e6-1		TAF1_ENST00000276072.3_Splice_Site|TAF1_ENST00000449580.1_Splice_Site|TAF1_ENST00000423759.1_Splice_Site	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CTGTGTTCTAGGTGTTACGTT	0.458																																					.		.											.	TAF1	900	0			c.775-1G>T						.						117.0	89.0	98.0					X																	70597452		2203	4300	6503	SO:0001630	splice_region_variant	6872	exon6			GTTCTAGGTGTTA		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.712-1G>T	X.37:g.70597452G>T		Somatic	224.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	12.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Splice_Site	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.847994	0.71603	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7666	0.91876	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TAF1	70514177	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	9.476000	0.97823	2.377000	0.81083	0.468000	0.43344	.	.		0.458	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	Intron
TBC1D10B	26000	ucsc.edu;bcgsc.ca	37	16	30380803	30380803	+	Silent	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:30380803G>T	ENST00000409939.3	-	1	782	c.702C>A	c.(700-702)acC>acA	p.T234T		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	234					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			CCGGAGCTGGGGTCACGGTCA	0.657																																					p.T234T		.											.	.	.	0			c.C702A						.						29.0	32.0	31.0					16																	30380803		692	1591	2283	SO:0001819	synonymous_variant	26000	exon1			AGCTGGGGTCACG	BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.702C>A	16.37:g.30380803G>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	.	22.0	5.0	NM_015527	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Silent	SNP	ENST00000409939.3	37	CCDS10676.2																																																																																			.		0.657	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3	NM_015527	
TEX11	56159	hgsc.bcm.edu;bcgsc.ca	37	X	70053381	70053383	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	CAA	CAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:70053381_70053383delCAA	ENST00000395889.2	-	9	786_788	c.631_633delTTG	c.(631-633)ttgdel	p.L211del	TEX11_ENST00000344304.3_In_Frame_Del_p.L211del|TEX11_ENST00000374333.2_In_Frame_Del_p.L196del	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	211					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					GGAGCCTCATCAACATATCTTTA	0.379																																					p.211_211del		.											.	TEX11	178	0			c.631_633del						.																																			SO:0001651	inframe_deletion	56159	exon9			CCTCATCAACATA	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.631_633delTTG	X.37:g.70053381_70053383delCAA	ENSP00000379226:p.Leu211del	Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	63.0	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	In_Frame_Del	DEL	ENST00000395889.2	37	CCDS35323.1																																																																																			.		0.379	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
TFCP2L1	29842	ucsc.edu;bcgsc.ca	37	2	121995248	121995248	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:121995248A>G	ENST00000263707.5	-	10	1051	c.954T>C	c.(952-954)ctT>ctC	p.L318L		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	318					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					TGTTGCGGTGAAGCCACTGCT	0.577																																					p.L318L		.											.	TFCP2L1	93	0			c.T954C						.						92.0	94.0	93.0					2																	121995248		2203	4300	6503	SO:0001819	synonymous_variant	29842	exon10			GCGGTGAAGCCAC	AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.954T>C	2.37:g.121995248A>G		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_014553	Q4ZG43	Silent	SNP	ENST00000263707.5	37	CCDS2134.1																																																																																			.		0.577	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338539.1	NM_014553	
TFDP2	7029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	141678612	141678613	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:141678612_141678613CC>AA	ENST00000489671.1	-	11	1384_1385	c.954_955GG>TT	c.(952-957)atGGga>atTTga	p.318_319MG>I*	TFDP2_ENST00000479040.1_Nonsense_Mutation_p.257_258MG>I*|TFDP2_ENST00000495310.1_Nonsense_Mutation_p.221_222MG>I*|TFDP2_ENST00000467072.1_Nonsense_Mutation_p.258_259MG>I*|TFDP2_ENST00000310282.6_Nonsense_Mutation_p.258_259MG>I*|TFDP2_ENST00000486111.1_Nonsense_Mutation_p.258_259MG>I*|TFDP2_ENST00000477292.1_Nonsense_Mutation_p.182_183MG>I*|TFDP2_ENST00000317104.7_Nonsense_Mutation_p.242_243MG>I*|TFDP2_ENST00000499676.2_Nonsense_Mutation_p.258_259MG>I*|TFDP2_ENST00000397991.4_Nonsense_Mutation_p.290_291MG>I*			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)	318	DCB2.				gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			kidney(1)|upper_aerodigestive_tract(2)	3						AACGACATTCCCATCCGCTTTA	0.421																																					p.G319X|p.M318I		.											.	TFDP2	226	0			c.G955T|c.G954T						.																																			SO:0001587	stop_gained	7029	exon11			ACATTCCCATCCG|CATTCCCATCCGC	U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.954_955delinsAA	3.37:g.141678612_141678613delinsAA	ENSP00000420616:p.M318_G319delinsI*	Somatic	68.0|71.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	26.0|28.0	NM_001178139	B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000489671.1	37	CCDS54650.1																																																																																			.		0.421	TFDP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353294.4	NM_006286	
THSD7A	221981	broad.mit.edu;bcgsc.ca	37	7	11675947	11675947	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:11675947C>A	ENST00000423059.4	-	2	1083	c.832G>T	c.(832-834)Ggg>Tgg	p.G278W	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	278					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TTATTCTTCCCGCGTCTCCTT	0.537										HNSCC(18;0.044)																											p.G278W		.											.	THSD7A	71	0			c.G832T						.						138.0	129.0	132.0					7																	11675947		1927	4133	6060	SO:0001583	missense	221981	exon2			TCTTCCCGCGTCT		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.832G>T	7.37:g.11675947C>A	ENSP00000406482:p.Gly278Trp	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	7.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768015	0.31320	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59224	0.28	5.62	3.8	0.43715	.	0.374020	0.33980	N	0.004379	T	0.59418	0.2192	L	0.47716	1.5	0.21220	N	0.999752	D	0.60575	0.988	P	0.52758	0.708	T	0.53472	-0.8434	10	0.48119	T	0.1	.	11.8626	0.52476	0.0:0.8587:0.0:0.1413	.	278	Q9UPZ6	THS7A_HUMAN	W	278	ENSP00000406482:G278W	ENSP00000262042:G278W	G	-	1	0	THSD7A	11642472	0.040000	0.19996	0.827000	0.32855	0.459000	0.32528	1.992000	0.40737	1.513000	0.48852	0.585000	0.79938	GGG	.		0.537	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
TKT	7086	ucsc.edu;bcgsc.ca	37	3	53259913	53259913	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr3:53259913C>A	ENST00000462138.1	-	14	1819	c.1731G>T	c.(1729-1731)gtG>gtT	p.V577V	TKT_ENST00000296289.6_Silent_p.V530V|TKT_ENST00000461139.1_5'UTR|TKT_ENST00000423525.2_Silent_p.V577V|TKT_ENST00000423516.1_Silent_p.V585V			P29401	TKT_HUMAN	transketolase	577					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		CAGGCTCGCCCACTACTGCAC	0.587																																					p.V585V	Colon(133;1506 2347 35238 42177)	.											.	TKT	92	0			c.G1755T						.						74.0	60.0	65.0					3																	53259913		2203	4300	6503	SO:0001819	synonymous_variant	7086	exon15			CTCGCCCACTACT		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.1731G>T	3.37:g.53259913C>A		Somatic	42.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001258028	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Silent	SNP	ENST00000462138.1	37	CCDS2871.1																																																																																			.		0.587	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1		
TMED4	222068	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44621075	44621075	+	Silent	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:44621075C>T	ENST00000457408.2	-	3	412	c.360G>A	c.(358-360)agG>agA	p.R120R	TMED4_ENST00000289577.5_Silent_p.R120R|TMED4_ENST00000444131.2_5'UTR|TMED4_ENST00000481238.1_Silent_p.R120R	NM_182547.2	NP_872353.2	Q7Z7H5	TMED4_HUMAN	transmembrane emp24 protein transport domain containing 4	120	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6						AGAGAGCCATCCTGGTAGAAT	0.502																																					p.R120R		.											.	TMED4	90	0			c.G360A						.						108.0	107.0	108.0					7																	44621075		2203	4300	6503	SO:0001819	synonymous_variant	222068	exon3			AGCCATCCTGGTA	BC035467	CCDS5493.1	7p13	2004-12-21			ENSG00000158604	ENSG00000158604			22301	protein-coding gene	gene with protein product		612038				12761501	Standard	NM_182547		Approved	HNLF	uc003tli.3	Q7Z7H5	OTTHUMG00000129210	ENST00000457408.2:c.360G>A	7.37:g.44621075C>T		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	10.0	NM_182547	A4D2K8|B4DFJ4|Q56VW3|Q7Z432|Q8N2P6	Silent	SNP	ENST00000457408.2	37	CCDS5493.1																																																																																			.		0.502	TMED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251290.1	NM_182547	
TMEM218	219854	hgsc.bcm.edu;ucsc.edu	37	11	124972140	124972140	+	5'UTR	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:124972140C>T	ENST00000279968.4	-	0	321				TMEM218_ENST00000526175.1_5'UTR|TMEM218_ENST00000529609.1_5'UTR|TMEM218_ENST00000532156.1_5'UTR|TMEM218_ENST00000528724.1_5'UTR|TMEM218_ENST00000531909.1_5'UTR|TMEM218_ENST00000531262.1_Intron|TMEM218_ENST00000527271.1_5'UTR|TMEM218_ENST00000532407.1_5'UTR|TMEM218_ENST00000527766.1_5'UTR|TMEM218_ENST00000529583.1_5'UTR|TMEM218_ENST00000455225.1_5'UTR			A2RU14	TM218_HUMAN	transmembrane protein 218							integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						CCAGCCATCCCGCGGGGAGGC	0.652																																					p.G35R		.											.	TMEM218	68	0			c.G103A						.						30.0	32.0	31.0					11																	124972140		2197	4292	6489	SO:0001623	5_prime_UTR_variant	219854	exon4			CCATCCCGCGGGG		CCDS31715.1	11q24.2	2008-08-08			ENSG00000150433	ENSG00000150433			27344	protein-coding gene	gene with protein product							Standard	NM_001258238		Approved		uc031qeu.1	A2RU14		ENST00000279968.4:c.-3G>A	11.37:g.124972140C>T		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	11.0	NM_001258243	B7ZM48	Missense_Mutation	SNP	ENST00000279968.4	37	CCDS31715.1																																																																																			.		0.652	TMEM218-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386849.1	NM_001080546	
TNMD	64102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	99854571	99854571	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:99854571C>A	ENST00000373031.4	+	7	1028	c.811C>A	c.(811-813)Cga>Aga	p.R271R		NM_022144.2	NP_071427.2	Q9H2S6	TNMD_HUMAN	tenomodulin	271					cellular response to BMP stimulus (GO:0071773)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|tendon cell differentiation (GO:0035990)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(7)|skin(1)	16						TTACTGCCGTCGAGGCAACCG	0.478																																					p.R271R		.											.	TNMD	130	0			c.C811A						.						86.0	56.0	66.0					X																	99854571		2203	4300	6503	SO:0001819	synonymous_variant	64102	exon7			TGCCGTCGAGGCA	AF191770	CCDS14469.1	Xq21.33-q23	2012-10-10			ENSG00000000005	ENSG00000000005		"""BRICHOS domain containing"""	17757	protein-coding gene	gene with protein product	"""BRICHOS domain containing 4"""	300459					Standard	NM_022144		Approved	myodulin, ChM1L, tendin, TEM, BRICD4	uc004efy.4	Q9H2S6	OTTHUMG00000022001	ENST00000373031.4:c.811C>A	X.37:g.99854571C>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	18.0	NM_022144	Q9HBX0|Q9UJG0	Silent	SNP	ENST00000373031.4	37	CCDS14469.1																																																																																			.		0.478	TNMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057481.1	NM_022144	
TNPO1	3842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	72189531	72189532	+	Splice_Site	INS	-	-	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr5:72189531_72189532insT	ENST00000337273.5	+	18	2569		c.e18+1		TNPO1_ENST00000506351.2_Splice_Site|TNPO1_ENST00000523768.1_Splice_Site|TNPO1_ENST00000454282.1_Splice_Site	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CCTTGTATAGGTATGAATATTT	0.327																																					.		.											.	TNPO1	228	0			c.2143+1->T						.																																			SO:0001630	splice_region_variant	3842	exon18			GTATAGGTATGAA	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.2143+1->T	5.37:g.72189532_72189532dupT		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	35.0	NM_002270	B4DVC6|Q92957|Q92975	Splice_Site	INS	ENST00000337273.5	37	CCDS43329.1																																																																																			.		0.327	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	Intron
TNRC6B	23112	ucsc.edu;bcgsc.ca	37	22	40660919	40660919	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr22:40660919A>G	ENST00000454349.2	+	5	896	c.685A>G	c.(685-687)Agc>Ggc	p.S229G	TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.S229G|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	229	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						CTCTGAGAAGAGCACTCTGCC	0.493																																					p.S229G		.											.	TNRC6B	22	0			c.A685G						.						102.0	101.0	101.0					22																	40660919		1949	4146	6095	SO:0001583	missense	23112	exon5			GAGAAGAGCACTC	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.685A>G	22.37:g.40660919A>G	ENSP00000401946:p.Ser229Gly	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	A	7.378	0.628235	0.14257	.	.	ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727	T;T	0.52057	0.68;0.68	5.3	5.3	0.74995	.	0.267835	0.43416	D	0.000562	T	0.31827	0.0809	L	0.27053	0.805	0.26573	N	0.973526	B;B;B	0.24483	0.104;0.0;0.0	B;B;B	0.19148	0.024;0.0;0.001	T	0.14755	-1.0461	10	0.29301	T	0.29	-6.2406	9.0302	0.36254	0.918:0.0:0.082:0.0	.	229;229;229	Q9UPQ9;A8MYY3;Q9UPQ9-1	TNR6B_HUMAN;.;.	G	229	ENSP00000401946:S229G;ENSP00000338371:S229G	ENSP00000338371:S229G	S	+	1	0	TNRC6B	38990865	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.714000	0.61902	2.001000	0.58596	0.528000	0.53228	AGC	.		0.493	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000420246.2_Missense_Mutation_p.R249S|TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,mouth,carcinoma,0	TP53	70225	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	17.37:g.7577534C>A	ENSP00000269305:p.Arg249Ser	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	39.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	C|1.000;|0.000		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRAM2	9697	ucsc.edu;bcgsc.ca	37	6	52373071	52373071	+	Silent	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:52373071C>A	ENST00000182527.3	-	6	515	c.516G>T	c.(514-516)ctG>ctT	p.L172L	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	172	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					GAAGTGCGTGCAGCCAGTAGG	0.537																																					p.L172L		.											.	TRAM2	90	0			c.G516T						.						72.0	58.0	63.0					6																	52373071		2203	4300	6503	SO:0001819	synonymous_variant	9697	exon6			TGCGTGCAGCCAG	D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.516G>T	6.37:g.52373071C>A		Somatic	23.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_012288	A8K6T6	Silent	SNP	ENST00000182527.3	37	CCDS34477.1																																																																																			.		0.537	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040910.1	NM_012288	
TRIM22	10346	ucsc.edu;bcgsc.ca	37	11	5718574	5718574	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:5718574G>A	ENST00000379965.3	+	3	796		c.e3+1		TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22						defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		CGCCTGGAAGGCAGGAGGAGA	0.517																																					.	GBM(104;491 2336 5222)	.											.	TRIM22	90	0			c.519+1G>A						.						38.0	43.0	41.0					11																	5718574		1899	4155	6054	SO:0001630	splice_region_variant	10346	exon3			TGGAAGGCAGGAG	X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.519+1G>A	11.37:g.5718574G>A		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_001199573	Q05CQ0|Q15521	Splice_Site	SNP	ENST00000379965.3	37	CCDS41612.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917334	0.33815	.	.	ENSG00000132274	ENST00000379965;ENST00000425490;ENST00000414641	.	.	.	4.07	3.15	0.36227	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2101	0.31478	0.117:0.0:0.883:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIM22	5675150	1.000000	0.71417	0.739000	0.30968	0.213000	0.24496	4.481000	0.60250	1.035000	0.39972	0.313000	0.20887	.	.		0.517	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143387.2	NM_006074	Intron
TRPC6	7225	ucsc.edu;bcgsc.ca	37	11	101342954	101342954	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:101342954G>T	ENST00000344327.3	-	8	2543	c.2119C>A	c.(2119-2121)Ctt>Att	p.L707I	TRPC6_ENST00000348423.4_Missense_Mutation_p.L591I|TRPC6_ENST00000532133.1_Missense_Mutation_p.L629I|TRPC6_ENST00000360497.4_Missense_Mutation_p.L652I	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	707					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		ACTCCATAAAGAACGTAACCA	0.333																																					p.L707I	Colon(166;1315 1927 11094 12848 34731)	.											.	TRPC6	93	0			c.C2119A						.						89.0	90.0	90.0					11																	101342954		2203	4298	6501	SO:0001583	missense	7225	exon8			CATAAAGAACGTA	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2119C>A	11.37:g.101342954G>T	ENSP00000340913:p.Leu707Ile	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.575058	0.86542	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01	5.81	5.81	0.92471	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98704	0.9565	M	0.67517	2.055	0.80722	D	1	D;D;D	0.63880	0.991;0.991;0.993	D;D;D	0.71184	0.967;0.935;0.972	D	0.98686	1.0694	10	0.37606	T	0.19	-3.0827	20.0784	0.97758	0.0:0.0:1.0:0.0	.	652;591;707	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	I	707;629;591;652	ENSP00000340913:L707I;ENSP00000435574:L629I;ENSP00000343672:L591I;ENSP00000353687:L652I	ENSP00000340913:L707I	L	-	1	0	TRPC6	100848164	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.034000	0.88864	2.736000	0.93811	0.655000	0.94253	CTT	.		0.333	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
TRPM2	7226	ucsc.edu;bcgsc.ca	37	21	45837840	45837840	+	Silent	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr21:45837840G>A	ENST00000397928.1	+	21	3622	c.3177G>A	c.(3175-3177)acG>acA	p.T1059T	TRPM2_ENST00000300481.9_Silent_p.T1039T|TRPM2_ENST00000397932.2_Silent_p.T1059T|TRPM2_ENST00000498430.1_3'UTR|AP001065.2_ENST00000423310.1_RNA|AP001065.2_ENST00000456880.1_RNA|TRPM2_ENST00000300482.5_Silent_p.T1059T	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	1059					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						AGGAGCACACGGACCAGATTT	0.627																																					p.T1059T		.											.	TRPM2	92	0			c.G3177A						.						63.0	55.0	58.0					21																	45837840		2203	4299	6502	SO:0001819	synonymous_variant	7226	exon21			GCACACGGACCAG	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.3177G>A	21.37:g.45837840G>A		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	19.0	4.0	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	ENST00000397928.1	37	CCDS13710.1																																																																																			.		0.627	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
TULP3	7289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	3048495	3048495	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:3048495A>T	ENST00000448120.2	+	11	1265	c.1214A>T	c.(1213-1215)cAg>cTg	p.Q405L	TULP3_ENST00000397132.2_Missense_Mutation_p.Q405L	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	405					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			ATAGTCATGCAGTTTGGACGT	0.393																																					p.Q405L		.											.	TULP3	226	0			c.A1214T						.						301.0	255.0	270.0					12																	3048495		2203	4300	6503	SO:0001583	missense	7289	exon11			TCATGCAGTTTGG	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.1214A>T	12.37:g.3048495A>T	ENSP00000410051:p.Gln405Leu	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	51.0	NM_003324	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	ENST00000448120.2	37	CCDS8519.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.099136	0.76983	.	.	ENSG00000078246	ENST00000228245;ENST00000544943;ENST00000542730;ENST00000448120;ENST00000397132	D;D;D	0.97870	-4.58;-4.58;-4.58	5.64	5.64	0.86602	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.98833	0.9606	M	0.88450	2.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.99793	1.1032	10	0.87932	D	0	-10.6884	15.0316	0.71710	1.0:0.0:0.0:0.0	.	229;405;405	B7Z1E7;O75386;F8WBZ9	.;TULP3_HUMAN;.	L	405;132;229;405;405	ENSP00000442631:Q132L;ENSP00000410051:Q405L;ENSP00000380321:Q405L	ENSP00000228245:Q405L	Q	+	2	0	TULP3	2918756	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	9.339000	0.96797	2.150000	0.67090	0.402000	0.26972	CAG	.		0.393	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398468.1	NM_003324	
TULP4	56995	bcgsc.ca;mdanderson.org	37	6	158923495	158923495	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr6:158923495G>T	ENST00000367097.3	+	13	4157	c.2800G>T	c.(2800-2802)Gtc>Ttc	p.V934F	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	934					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		TGAGAAGAAGGTCCCTCAGCC	0.672																																					p.V934F		.											.	TULP4	91	0			c.G2800T						.						64.0	67.0	66.0					6																	158923495		2203	4300	6503	SO:0001583	missense	56995	exon13			AAGAAGGTCCCTC		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2800G>T	6.37:g.158923495G>T	ENSP00000356064:p.Val934Phe	Somatic	43.0	2.0		WXS	Illumina HiSeq	Phase_1	36.0	17.0	NM_020245	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	ENST00000367097.3	37	CCDS34561.1	.	.	.	.	.	.	.	.	.	.	G	9.325	1.058937	0.19987	.	.	ENSG00000130338	ENST00000367097	T	0.65178	-0.14	4.49	1.11	0.20524	.	0.493816	0.22485	N	0.059452	T	0.28995	0.0720	L	0.34521	1.04	0.80722	D	1	B	0.24823	0.112	B	0.23419	0.046	T	0.19976	-1.0289	10	0.87932	D	0	-16.4861	5.7046	0.17901	0.6215:0.0:0.3785:0.0	.	934	Q9NRJ4	TULP4_HUMAN	F	934	ENSP00000356064:V934F	ENSP00000356064:V934F	V	+	1	0	TULP4	158843483	1.000000	0.71417	0.967000	0.41034	0.592000	0.36648	2.044000	0.41241	0.443000	0.26582	-0.291000	0.09656	GTC	.		0.672	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042869.1	NM_020245	
UBN1	29855	ucsc.edu;bcgsc.ca	37	16	4925031	4925031	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:4925031A>G	ENST00000396658.4	+	14	3323	c.2620A>G	c.(2620-2622)Aag>Gag	p.K874E	UBN1_ENST00000262376.6_Missense_Mutation_p.K874E|UBN1_ENST00000590769.1_Missense_Mutation_p.K874E|UBN1_ENST00000545171.1_Missense_Mutation_p.K874E	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	874	Ser-rich.				chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						CAGCTCTCACAAGACCCCAGC	0.582																																					p.K874E		.											.	UBN1	92	0			c.A2620G						.						57.0	58.0	57.0					16																	4925031		2197	4300	6497	SO:0001583	missense	29855	exon15			TCTCACAAGACCC	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.2620A>G	16.37:g.4925031A>G	ENSP00000379894:p.Lys874Glu	Somatic	17.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_001079514	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	A	17.54	3.415070	0.62511	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.51817	1.34;0.69;1.34	5.2	5.2	0.72013	.	0.070349	0.64402	D	0.000018	T	0.36880	0.0983	L	0.32530	0.975	0.31566	N	0.656908	B;P	0.35745	0.419;0.518	B;B	0.34652	0.187;0.129	T	0.45396	-0.9264	10	0.28530	T	0.3	-11.5364	13.79	0.63133	1.0:0.0:0.0:0.0	.	874;874	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	E	874	ENSP00000262376:K874E;ENSP00000442379:K874E;ENSP00000379894:K874E	ENSP00000262376:K874E	K	+	1	0	UBN1	4865032	1.000000	0.71417	0.991000	0.47740	0.971000	0.66376	6.212000	0.72188	2.187000	0.69744	0.460000	0.39030	AAG	.		0.582	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
USH2A	7399	ucsc.edu;bcgsc.ca	37	1	216462747	216462747	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:216462747T>C	ENST00000307340.3	-	11	2232	c.1846A>G	c.(1846-1848)Aac>Gac	p.N616D	USH2A_ENST00000366943.2_Missense_Mutation_p.N616D|USH2A_ENST00000366942.3_Missense_Mutation_p.N616D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	616	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGCTCACAGTTCCTTCCTGCA	0.403										HNSCC(13;0.011)																											p.N616D		.											.	USH2A	115	0			c.A1846G						.						146.0	130.0	136.0					1																	216462747		2203	4300	6503	SO:0001583	missense	7399	exon11			CACAGTTCCTTCC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1846A>G	1.37:g.216462747T>C	ENSP00000305941:p.Asn616Asp	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	18.56	3.649581	0.67358	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.61274	0.12;0.12;0.12	5.43	3.01	0.34805	EGF-like, laminin (4);	0.140383	0.31772	N	0.007087	T	0.58133	0.2101	L	0.52266	1.64	0.43652	D	0.996066	B;P	0.40578	0.409;0.722	B;P	0.45998	0.438;0.5	T	0.59516	-0.7440	10	0.72032	D	0.01	.	12.7032	0.57045	0.0:0.0:0.394:0.606	.	616;616	O75445-2;O75445	.;USH2A_HUMAN	D	616	ENSP00000305941:N616D;ENSP00000355910:N616D;ENSP00000355909:N616D	ENSP00000305941:N616D	N	-	1	0	USH2A	214529370	1.000000	0.71417	0.968000	0.41197	0.998000	0.95712	3.405000	0.52630	0.389000	0.25086	0.455000	0.32223	AAC	.		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
VPS51	738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64878964	64878964	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:64878964C>G	ENST00000279281.3	+	10	2346	c.2254C>G	c.(2254-2256)Ctg>Gtg	p.L752V	TM7SF2_ENST00000345348.5_5'Flank|TM7SF2_ENST00000279263.7_5'Flank|TM7SF2_ENST00000540748.1_5'Flank|AP003068.9_ENST00000528887.1_RNA|VPS51_ENST00000527646.1_3'UTR	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	752					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CGTGCACTTGCTGCTGGACGA	0.632																																					p.L752V		.											.	.	.	0			c.C2254G						.						115.0	85.0	95.0					11																	64878964		2201	4297	6498	SO:0001583	missense	738	exon10			CACTTGCTGCTGG	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.2254C>G	11.37:g.64878964C>G	ENSP00000279281:p.Leu752Val	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	28.0	NM_013265	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	ENST00000279281.3	37	CCDS8093.1	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393038	0.62066	.	.	ENSG00000149823	ENST00000279281	.	.	.	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000001	T	0.80423	0.4620	M	0.83692	2.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81959	-0.0694	9	0.52906	T	0.07	-13.1403	16.005	0.80357	0.0:1.0:0.0:0.0	.	752	Q9UID3	FFR_HUMAN	V	752	.	ENSP00000279281:L752V	L	+	1	2	C11orf2	64635540	1.000000	0.71417	1.000000	0.80357	0.524000	0.34500	2.909000	0.48758	2.647000	0.89833	0.555000	0.69702	CTG	.		0.632	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385217.1	NM_013265	
VWA3A	146177	ucsc.edu;bcgsc.ca	37	16	22132937	22132937	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:22132937A>G	ENST00000389398.5	+	14	1451	c.1355A>G	c.(1354-1356)gAg>gGg	p.E452G	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	452						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		ACCATCCATGAGGTAATTCAG	0.433																																					p.E452G		.											.	VWA3A	1	0			c.A1355G						.						140.0	137.0	138.0					16																	22132937		1861	4094	5955	SO:0001630	splice_region_variant	146177	exon14			TCCATGAGGTAAT	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.1356+1A>G	16.37:g.22132937A>G		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	ENST00000389398.5	37	CCDS45441.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.029301	0.35797	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.14640	2.49	5.77	5.77	0.91146	.	0.060690	0.64402	D	0.000005	T	0.20170	0.0485	M	0.64997	1.995	0.80722	D	1	B;P	0.34562	0.09;0.457	B;B	0.37239	0.1;0.244	T	0.01162	-1.1432	10	0.72032	D	0.01	.	14.9755	0.71267	1.0:0.0:0.0:0.0	.	452;76	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	G	452;75	ENSP00000374049:E452G	ENSP00000299840:E75G	E	+	2	0	VWA3A	22040438	1.000000	0.71417	1.000000	0.80357	0.425000	0.31504	6.672000	0.74477	2.215000	0.71742	0.524000	0.50904	GAG	.		0.433	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		Missense_Mutation
VWA5A	4013	ucsc.edu;bcgsc.ca	37	11	124013226	124013226	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr11:124013226G>T	ENST00000456829.2	+	17	2352	c.2101G>T	c.(2101-2103)Gcc>Tcc	p.A701S	VWA5A_ENST00000360334.4_3'UTR|VWA5A_ENST00000392748.1_Missense_Mutation_p.A701S	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	701										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						TGAAGATCTAGCCAAGATCCT	0.418																																					p.A701S		.											.	VWA5A	92	0			c.G2101T						.						115.0	106.0	109.0					11																	124013226		2201	4299	6500	SO:0001583	missense	4013	exon16			GATCTAGCCAAGA	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.2101G>T	11.37:g.124013226G>T	ENSP00000407726:p.Ala701Ser	Somatic	68.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_014622	Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	ENST00000456829.2	37	CCDS8444.1	.	.	.	.	.	.	.	.	.	.	G	14.81	2.646281	0.47258	.	.	ENSG00000110002	ENST00000456829;ENST00000392748	T;T	0.04862	3.54;3.54	5.59	3.67	0.42095	.	0.176815	0.52532	D	0.000076	T	0.09247	0.0228	M	0.64170	1.965	0.80722	D	1	P	0.42337	0.776	P	0.46585	0.521	T	0.31503	-0.9941	10	0.11485	T	0.65	-9.3899	6.8732	0.24133	0.0893:0.0:0.7377:0.1731	.	701	O00534	VMA5A_HUMAN	S	701	ENSP00000407726:A701S;ENSP00000376504:A701S	ENSP00000376504:A701S	A	+	1	0	VWA5A	123518436	1.000000	0.71417	0.009000	0.14445	0.646000	0.38490	2.711000	0.47177	0.686000	0.31488	0.561000	0.74099	GCC	.		0.418	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622	
VWF	7450	broad.mit.edu;bcgsc.ca	37	12	6161738	6161738	+	Silent	SNP	T	T	C	rs62643628		TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr12:6161738T>C	ENST00000261405.5	-	16	2411	c.2157A>G	c.(2155-2157)gaA>gaG	p.E719E		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	719					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AGAAGATGTCTTCTGGCTGGA	0.582																																					p.E719E		.											.	VWF	163	0			c.A2157G	GRCh37	CD034180	VWF	D		.						167.0	152.0	157.0					12																	6161738		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon16			GATGTCTTCTGGC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2157A>G	12.37:g.6161738T>C		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	5.0	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	37	CCDS8539.1																																																																																			.		0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
WDR78	79819	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	67292730	67292730	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:67292730C>T	ENST00000371026.3	-	15	2168		c.e15-1		WDR78_ENST00000431318.1_Splice_Site|RP11-342H21.2_ENST00000456389.1_RNA	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78						hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						ACACTGGACCCTAGAAATAAA	0.294																																					.		.											.	WDR78	92	0			c.2113-1G>A						.						66.0	68.0	68.0					1																	67292730		2203	4300	6503	SO:0001630	splice_region_variant	79819	exon16			TGGACCCTAGAAA	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.2113-1G>A	1.37:g.67292730C>T		Somatic	159.0	1.0		WXS	Illumina HiSeq	Phase_I	183.0	83.0	NM_024763	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Splice_Site	SNP	ENST00000371026.3	37	CCDS635.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294450	0.60086	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352	.	.	.	5.66	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5852	0.68320	0.0:0.9297:0.0:0.0703	.	.	.	.	.	-1	.	.	.	-	.	.	WDR78	67065318	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	6.584000	0.74057	1.386000	0.46466	0.650000	0.86243	.	.		0.294	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025404.1	NM_024763	Intron
WDR90	197335	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	712780	712780	+	Missense_Mutation	SNP	C	C	T	rs576866547	byFrequency	TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr16:712780C>T	ENST00000293879.4	+	34	4247	c.4247C>T	c.(4246-4248)aCg>aTg	p.T1416M	WDR90_ENST00000549091.1_Missense_Mutation_p.T1418M|WDR90_ENST00000315764.4_5'Flank|WDR90_ENST00000547944.1_5'Flank			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1416										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				ACGGCGGGCACGCTGTGGTTT	0.652													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17268	0.0		0.0	False		,,,				2504	0.0				p.T1416M		.											.	WDR90	92	0			c.C4247T						.						35.0	37.0	36.0					16																	712780		2134	4231	6365	SO:0001583	missense	197335	exon34			CGGGCACGCTGTG	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.4247C>T	16.37:g.712780C>T	ENSP00000293879:p.Thr1416Met	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	11.0	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720665	0.48728	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.32272	1.46;1.46	5.0	4.05	0.47172	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	U	0.000001	T	0.51702	0.1690	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.53436	-0.8439	10	0.62326	D	0.03	.	12.0694	0.53607	0.0:0.9166:0.0:0.0834	.	1418;1416	F8VUX9;Q96KV7	.;WDR90_HUMAN	M	1418;1416	ENSP00000448122:T1418M;ENSP00000293879:T1416M	ENSP00000293879:T1416M	T	+	2	0	WDR90	652781	1.000000	0.71417	0.222000	0.23844	0.009000	0.06853	5.581000	0.67471	1.105000	0.41606	0.491000	0.48974	ACG	.		0.652	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
XPNPEP2	7512	ucsc.edu;bcgsc.ca	37	X	128896688	128896688	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chrX:128896688A>T	ENST00000371106.3	+	19	1874	c.1682A>T	c.(1681-1683)gAt>gTt	p.D561V		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	561						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TACTATAAGGATGGAGAATTT	0.542																																					p.D561V		.											.	XPNPEP2	130	0			c.A1682T						.						107.0	94.0	98.0					X																	128896688		2203	4300	6503	SO:0001583	missense	7512	exon19			ATAAGGATGGAGA	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1682A>T	X.37:g.128896688A>T	ENSP00000360147:p.Asp561Val	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_003399	A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.017568	0.75161	.	.	ENSG00000122121	ENST00000371106	T	0.77750	-1.12	5.7	5.7	0.88788	Peptidase M24, structural domain (3);	0.140570	0.64402	D	0.000005	D	0.86372	0.5917	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.87778	0.2610	10	0.87932	D	0	-13.0716	13.8195	0.63311	1.0:0.0:0.0:0.0	.	561	O43895	XPP2_HUMAN	V	561	ENSP00000360147:D561V	ENSP00000360147:D561V	D	+	2	0	XPNPEP2	128724369	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	6.738000	0.74822	1.908000	0.55244	0.481000	0.45027	GAT	.		0.542	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	
ZBTB40	9923	ucsc.edu;bcgsc.ca	37	1	22839460	22839460	+	Silent	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr1:22839460T>C	ENST00000375647.4	+	12	2712	c.2505T>C	c.(2503-2505)ccT>ccC	p.P835P	ZBTB40_ENST00000374651.4_Silent_p.P723P|ZBTB40_ENST00000404138.1_Silent_p.P835P	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	835					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		ATGAGAAGCCTTTCTCCTGTG	0.532																																					p.P835P		.											.	ZBTB40	91	0			c.T2505C						.						128.0	94.0	106.0					1																	22839460		2203	4300	6503	SO:0001819	synonymous_variant	9923	exon13			GAAGCCTTTCTCC	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.2505T>C	1.37:g.22839460T>C		Somatic	24.0	0.0		WXS	Illumina HiSeq	.	40.0	5.0	NM_001083621	O75066|Q5TFU5|Q8N1R1	Silent	SNP	ENST00000375647.4	37	CCDS224.1																																																																																			.		0.532	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
ZDHHC16	84287	broad.mit.edu;bcgsc.ca	37	10	99213323	99213323	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:99213323G>T	ENST00000370854.3	+	6	782	c.593G>T	c.(592-594)cGg>cTg	p.R198L	ZDHHC16_ENST00000370846.4_Intron|ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.R133L|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.R198L|ZDHHC16_ENST00000352634.4_Missense_Mutation_p.R198L|ZDHHC16_ENST00000393760.1_Missense_Mutation_p.R198L|ZDHHC16_ENST00000353979.3_Intron	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	198					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		TATAACCATCGGTACTTCTTC	0.488																																					p.R198L		.											.	ZDHHC16	91	0			c.G593T						.						291.0	248.0	263.0					10																	99213323		2203	4300	6503	SO:0001583	missense	84287	exon6			ACCATCGGTACTT	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.593G>T	10.37:g.99213323G>T	ENSP00000359891:p.Arg198Leu	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	8.0	NM_198043	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	ENST00000370854.3	37	CCDS7460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.9|29.9	5.043968|5.043968	0.93685|0.93685	.|.	.|.	ENSG00000171307|ENSG00000171307	ENST00000420089;ENST00000417044|ENST00000370854;ENST00000393760;ENST00000414567;ENST00000352634;ENST00000370842;ENST00000345745;ENST00000433086	.|T;T;T;T;T;T;T	.|0.27256	.|1.68;1.68;1.68;1.68;1.68;1.68;1.68	5.95|5.95	5.95|5.95	0.96441|0.96441	.|Zinc finger, DHHC-type, palmitoyltransferase (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61324|0.61324	0.2338|0.2338	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|1.0;0.998;0.997;0.999;1.0;0.999	T|T	0.66064|0.66064	-0.6016|-0.6016	5|10	.|0.72032	.|D	.|0.01	-18.7209|-18.7209	20.3645|20.3645	0.98876|0.98876	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|198;133;173;133;198;198	.|B4DNL2;E9PCL9;B1AMU1;Q969W1-4;Q969W1-2;Q969W1	.|.;.;.;.;.;ZDH16_HUMAN	C|L	174;140|198;198;198;198;198;133;133	.|ENSP00000359891:R198L;ENSP00000377357:R198L;ENSP00000400719:R198L;ENSP00000345383:R198L;ENSP00000359879:R198L;ENSP00000304487:R133L;ENSP00000398532:R133L	.|ENSP00000304487:R133L	G|R	+|+	1|2	0|0	ZDHHC16|ZDHHC16	99203313|99203313	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	9.869000|9.869000	0.99810|0.99810	2.821000|2.821000	0.97095|0.97095	0.561000|0.561000	0.74099|0.74099	GGT|CGG	.		0.488	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049658.2	NM_032327	
ZFP36	7538	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	39899108	39899108	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:39899108C>A	ENST00000248673.3	+	2	808	c.750C>A	c.(748-750)tgC>tgA	p.C250*	MIR4530_ENST00000581459.1_RNA|ZFP36_ENST00000597629.1_Nonsense_Mutation_p.C256*	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	250					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CAGTCTGTTGCCCCTCCTGCC	0.662																																					p.C256X	NSCLC(67;1164 1324 12056 21056 30097)	.											.	ZFP36	227	0			c.C768A						.						25.0	31.0	29.0					19																	39899108		2201	4299	6500	SO:0001587	stop_gained	7538	exon2			CTGTTGCCCCTCC	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.750C>A	19.37:g.39899108C>A	ENSP00000248673:p.Cys250*	Somatic	71.0	1.0		WXS	Illumina HiSeq	Phase_I	67.0	24.0	NM_003407	B2RA54	Nonsense_Mutation	SNP	ENST00000248673.3	37		.	.	.	.	.	.	.	.	.	.	C	16.75	3.210551	0.58343	.	.	ENSG00000128016	ENST00000248673	.	.	.	4.35	-0.614	0.11590	.	0.399679	0.24748	U	0.035940	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.1477	4.2333	0.10613	0.1508:0.4839:0.0:0.3653	.	.	.	.	X	250	.	ENSP00000248673:C250X	C	+	3	2	ZFP36	44590948	0.001000	0.12720	0.999000	0.59377	0.580000	0.36256	-0.295000	0.08298	0.117000	0.18138	0.442000	0.29010	TGC	.		0.662	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ZFYVE1	53349	ucsc.edu;bcgsc.ca	37	14	73460001	73460001	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr14:73460001A>G	ENST00000556143.1	-	4	1773	c.1053T>C	c.(1051-1053)ccT>ccC	p.P351P	ZFYVE1_ENST00000553891.1_Silent_p.P351P|ZFYVE1_ENST00000318876.5_Silent_p.P351P	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	351					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		TAAAGGCTTCAGGGAAACGGC	0.527																																					p.P351P		.											.	ZFYVE1	91	0			c.T1053C						.						80.0	81.0	81.0					14																	73460001		2203	4300	6503	SO:0001819	synonymous_variant	53349	exon4			GGCTTCAGGGAAA	AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.1053T>C	14.37:g.73460001A>G		Somatic	55.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_021260	J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Silent	SNP	ENST00000556143.1	37	CCDS9811.1																																																																																			.		0.527	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413172.1	NM_021260	
ZNF518A	9849	broad.mit.edu;ucsc.edu	37	10	97918109	97918109	+	RNA	SNP	C	C	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr10:97918109C>A	ENST00000534948.1	+	0	2887							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		GTCCAACAACCAATTAGTGAA	0.353																																					.		.											.	ZNF518A	23	0			.						.						86.0	84.0	85.0					10																	97918109		1836	4093	5929			9849	.			AACAACCAATTAG	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97918109C>A		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	7.0	.	A0PJI5|O15044|Q32MP4	RNA	SNP	ENST00000534948.1	37																																																																																				.		0.353	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
ZNF546	339327	ucsc.edu;bcgsc.ca	37	19	40520384	40520384	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr19:40520384C>T	ENST00000347077.4	+	7	1423	c.1207C>T	c.(1207-1209)Cat>Tat	p.H403Y	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.H377Y	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CCTTGTTCAACATCAGAAAAT	0.368																																					p.H403Y		.											.	ZNF546	155	0			c.C1207T						.						44.0	43.0	44.0					19																	40520384		2203	4300	6503	SO:0001583	missense	339327	exon7			GTTCAACATCAGA	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1207C>T	19.37:g.40520384C>T	ENSP00000339823:p.His403Tyr	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_178544	A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	c	17.72	3.459367	0.63401	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	D	0.86769	-2.17	2.76	2.76	0.32466	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94994	0.8380	H	0.96333	3.805	0.34192	D	0.672169	D;D	0.89917	1.0;1.0	P;D	0.91635	0.884;0.999	D	0.96880	0.9645	9	0.87932	D	0	.	11.6945	0.51536	0.0:1.0:0.0:0.0	.	377;403	B3KVL3;Q86UE3	.;ZN546_HUMAN	Y	403;40	ENSP00000339823:H403Y	ENSP00000339823:H403Y	H	+	1	0	ZNF546	45212224	1.000000	0.71417	0.977000	0.42913	0.998000	0.95712	6.534000	0.73833	1.825000	0.53177	0.655000	0.94253	CAT	.		0.368	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544	
ZNF638	27332	ucsc.edu;bcgsc.ca	37	2	71577282	71577282	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:71577282G>A	ENST00000409544.1	+	2	1828	c.1198G>A	c.(1198-1200)Gat>Aat	p.D400N	ZNF638_ENST00000355812.3_Missense_Mutation_p.D400N|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000377802.2_Missense_Mutation_p.D400N|ZNF638_ENST00000264447.4_Missense_Mutation_p.D400N	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	400					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTCACATGCTGATGCCCAGAA	0.408																																					p.D400N		.											.	ZNF638	94	0			c.G1198A						.						142.0	140.0	141.0					2																	71577282		2203	4300	6503	SO:0001583	missense	27332	exon2			CATGCTGATGCCC	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1198G>A	2.37:g.71577282G>A	ENSP00000386433:p.Asp400Asn	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.266494	0.40095	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.74842	-0.29;-0.88;0.3;-0.27;1.32;1.32	5.85	4.98	0.66077	.	0.377447	0.29335	N	0.012444	T	0.60379	0.2264	N	0.14661	0.345	0.28440	N	0.916847	D;P;P;P;P	0.56521	0.976;0.873;0.873;0.799;0.787	P;B;P;B;B	0.46452	0.517;0.42;0.517;0.272;0.42	T	0.54576	-0.8273	10	0.15499	T	0.54	-10.4049	12.5196	0.56052	0.08:0.0:0.92:0.0	.	506;400;400;400;400	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	N	400;506;400;400;400;400	ENSP00000386669:D400N;ENSP00000438189:D506N;ENSP00000348066:D400N;ENSP00000367033:D400N;ENSP00000264447:D400N;ENSP00000386433:D400N	ENSP00000264447:D400N	D	+	1	0	ZNF638	71430790	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.860000	0.48372	1.493000	0.48517	0.655000	0.94253	GAT	.		0.408	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	88963115	88963115	+	Silent	SNP	A	A	G			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr7:88963115A>G	ENST00000333190.4	+	4	1428	c.819A>G	c.(817-819)acA>acG	p.T273T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	273							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATAAAGATACACACCTTACCA	0.358										HNSCC(36;0.09)																											p.T273T		.											.	ZNF804B	101	0			c.A819G						.						73.0	69.0	70.0					7																	88963115		2202	4300	6502	SO:0001819	synonymous_variant	219578	exon4			AGATACACACCTT	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.819A>G	7.37:g.88963115A>G		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	54.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	CCDS5613.1																																																																																			.		0.358	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ZRANB3	84083	ucsc.edu;bcgsc.ca	37	2	136029433	136029433	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25U-01A-11D-A16V-10	TCGA-G3-A25U-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	656f2a16-cd8a-4255-b6ff-703f560a74a7	c178796c-e0ab-403c-9ab1-95aa12c72f0e	g.chr2:136029433T>C	ENST00000264159.6	-	10	1227	c.1111A>G	c.(1111-1113)Agt>Ggt	p.S371G	ZRANB3_ENST00000536680.1_Missense_Mutation_p.S371G|ZRANB3_ENST00000401392.1_Missense_Mutation_p.S371G	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	371	DNA annealing helicase activity.|Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GATGAAACACTTCCATCTATC	0.408																																					p.S371G		.											.	ZRANB3	658	0			c.A1111G						.						77.0	75.0	76.0					2																	136029433		1873	4112	5985	SO:0001583	missense	84083	exon10			AAACACTTCCATC	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.1111A>G	2.37:g.136029433T>C	ENSP00000264159:p.Ser371Gly	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_032143	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	37	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738437	0.49045	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680;ENST00000397448	D;D;D	0.92446	-3.04;-3.04;-3.04	5.94	4.78	0.61160	Helicase, C-terminal (3);	0.037714	0.85682	N	0.000000	D	0.87819	0.6273	L	0.28608	0.87	0.45161	D	0.998173	B;B;B	0.15473	0.013;0.011;0.001	B;B;B	0.19391	0.025;0.009;0.002	T	0.80627	-0.1298	10	0.62326	D	0.03	-2.2024	14.3933	0.66994	0.0:0.063:0.0:0.937	.	311;371;371	E9PBP0;Q5FWF4;Q5FWF4-3	.;ZRAB3_HUMAN;.	G	371;371;371;311	ENSP00000383979:S371G;ENSP00000264159:S371G;ENSP00000441320:S371G	ENSP00000264159:S371G	S	-	1	0	ZRANB3	135745903	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.943000	0.70211	0.487000	0.27698	-1.431000	0.01090	AGT	.		0.408	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
