#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A2ML1	144568	ucsc.edu;bcgsc.ca	37	12	8982345	8982345	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:8982345G>T	ENST00000299698.7	+	4	612	c.432G>T	c.(430-432)atG>atT	p.M144I	A2ML1-AS1_ENST00000537288.1_RNA	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TTGTCACCATGGATAGCAACT	0.438																																					p.M144I		.											.	A2ML1	93	0			c.G432T						.						135.0	133.0	134.0					12																	8982345		1984	4176	6160	SO:0001583	missense	144568	exon4			CACCATGGATAGC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.432G>T	12.37:g.8982345G>T	ENSP00000299698:p.Met144Ile	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	39.0	5.0	NM_144670		Missense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953198	0.34471	.	.	ENSG00000166535	ENST00000299698;ENST00000539161	T	0.73047	-0.71	4.13	1.28	0.21552	Alpha-2-macroglobulin, N-terminal (1);	0.705336	0.11729	N	0.535113	T	0.48750	0.1517	N	0.12443	0.215	0.09310	N	0.999998	B	0.15473	0.013	B	0.16722	0.016	T	0.41734	-0.9492	10	0.72032	D	0.01	.	4.4441	0.11588	0.2075:0.202:0.5905:0.0	.	144	A8K2U0	A2ML1_HUMAN	I	144	ENSP00000299698:M144I	ENSP00000299698:M144I	M	+	3	0	A2ML1	8873612	0.454000	0.25728	0.016000	0.15963	0.874000	0.50279	2.130000	0.42064	0.284000	0.22305	0.637000	0.83480	ATG	.		0.438	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
ABCC12	94160	broad.mit.edu;bcgsc.ca	37	16	48149506	48149506	+	Silent	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr16:48149506G>A	ENST00000311303.3	-	13	2154	c.1809C>T	c.(1807-1809)ctC>ctT	p.L603L	ABCC12_ENST00000416054.1_Missense_Mutation_p.S579F|ABCC12_ENST00000448542.1_Silent_p.L603L	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	603	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GCCCCCCAGAGAGGTTGAGGC	0.632																																					p.L603L		.											.	ABCC12	93	0			c.C1809T						.						40.0	37.0	38.0					16																	48149506		2201	4300	6501	SO:0001819	synonymous_variant	94160	exon13			CCCAGAGAGGTTG	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1809C>T	16.37:g.48149506G>A		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	4.0	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	ENST00000311303.3	37	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789797	0.31685	.	.	ENSG00000140798	ENST00000416054	D	0.92965	-3.14	5.09	1.93	0.25924	.	.	.	.	.	D	0.91737	0.7387	.	.	.	0.27545	N	0.950676	.	.	.	.	.	.	D	0.85242	0.1039	6	0.87932	D	0	.	9.9412	0.41580	0.0758:0.4269:0.4973:0.0	.	.	.	.	F	579	ENSP00000413046:S579F	ENSP00000413046:S579F	S	-	2	0	ABCC12	46707007	0.995000	0.38212	0.965000	0.40720	0.101000	0.19017	0.327000	0.19663	0.223000	0.20920	-0.251000	0.11542	TCT	.		0.632	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
ABCC3	8714	ucsc.edu;bcgsc.ca	37	17	48761110	48761110	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:48761110G>T	ENST00000285238.8	+	27	4027	c.3947G>T	c.(3946-3948)gGc>gTc	p.G1316V		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1316	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GTGCACGGTGGCGAGAAGGTA	0.622																																					p.G1316V		.											.	ABCC3	93	0			c.G3947T						.						125.0	117.0	120.0					17																	48761110		2203	4300	6503	SO:0001583	missense	8714	exon27			ACGGTGGCGAGAA	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3947G>T	17.37:g.48761110G>T	ENSP00000285238:p.Gly1316Val	Somatic	23.0	0.0		WXS	Illumina HiSeq	.	19.0	4.0	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	37	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	g	35	5.453643	0.96223	.	.	ENSG00000108846	ENST00000285238	D	0.96334	-3.98	5.94	4.98	0.66077	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.98953	0.9644	H	0.98936	4.375	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.99075	1.0835	10	0.72032	D	0.01	-21.1255	15.1075	0.72332	0.0676:0.0:0.9324:0.0	.	1316	O15438	MRP3_HUMAN	V	1316	ENSP00000285238:G1316V	ENSP00000285238:G1316V	G	+	2	0	ABCC3	46116109	1.000000	0.71417	0.467000	0.27180	0.690000	0.40134	6.611000	0.74183	1.531000	0.49152	0.651000	0.88453	GGC	.		0.622	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
ABT1	29777	ucsc.edu;bcgsc.ca	37	6	26598733	26598733	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:26598733C>T	ENST00000274849.1	+	3	710	c.679C>T	c.(679-681)Cgg>Tgg	p.R227W		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	227					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						TAAAGCAGCACGGCCAGGGGG	0.657																																					p.R227W		.											.	ABT1	91	0			c.C679T						.						34.0	37.0	36.0					6																	26598733		2203	4300	6503	SO:0001583	missense	29777	exon3			GCAGCACGGCCAG	AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.679C>T	6.37:g.26598733C>T	ENSP00000274849:p.Arg227Trp	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_013375		Missense_Mutation	SNP	ENST00000274849.1	37	CCDS4616.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880188	0.51801	.	.	ENSG00000146109	ENST00000274849	.	.	.	5.09	2.07	0.26955	.	0.670270	0.15417	N	0.263426	T	0.40171	0.1106	M	0.62723	1.935	0.24392	N	0.994742	D	0.89917	1.0	D	0.67382	0.951	T	0.10965	-1.0607	9	0.72032	D	0.01	-13.803	6.0855	0.19964	0.4401:0.4706:0.0:0.0892	.	227	Q9ULW3	ABT1_HUMAN	W	227	.	ENSP00000274849:R227W	R	+	1	2	ABT1	26706712	0.780000	0.28664	0.115000	0.21578	0.616000	0.37450	0.761000	0.26489	0.781000	0.33589	0.655000	0.94253	CGG	.		0.657	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043698.1		
ACSM1	116285	ucsc.edu;bcgsc.ca	37	16	20682931	20682931	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr16:20682931A>G	ENST00000307493.4	-	4	741	c.674T>C	c.(673-675)tTc>tCc	p.F225S	ACSM1_ENST00000520010.1_Missense_Mutation_p.F225S|ACSM1_ENST00000219151.4_5'UTR	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	225					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						CCCACTGGTGAAGAAGATGAC	0.502																																					p.F225S		.											.	ACSM1	91	0			c.T674C						.						131.0	108.0	116.0					16																	20682931		2201	4300	6501	SO:0001583	missense	116285	exon4			CTGGTGAAGAAGA	AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.674T>C	16.37:g.20682931A>G	ENSP00000301956:p.Phe225Ser	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_052956	Q08AH2|Q96A20	Missense_Mutation	SNP	ENST00000307493.4	37	CCDS10587.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.030577	0.75504	.	.	ENSG00000166743	ENST00000307493;ENST00000520010	T;T	0.55930	0.49;0.49	4.95	4.95	0.65309	AMP-dependent synthetase/ligase (1);AMP-binding, conserved site (1);	0.126822	0.36703	N	0.002460	T	0.73218	0.3559	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77807	-0.2450	10	0.87932	D	0	.	12.6264	0.56632	1.0:0.0:0.0:0.0	.	225	Q08AH1	ACSM1_HUMAN	S	225	ENSP00000301956:F225S;ENSP00000428047:F225S	ENSP00000301956:F225S	F	-	2	0	ACSM1	20590432	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.616000	0.61197	2.076000	0.62316	0.491000	0.48974	TTC	.		0.502	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254412.1	NM_052956	
ACTC1	70	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	35083385	35083385	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr15:35083385A>G	ENST00000290378.4	-	6	1575	c.920T>C	c.(919-921)aTg>aCg	p.M307T	ACTC1_ENST00000557860.1_5'UTR|RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	307			M -> L (in CMH11). {ECO:0000269|PubMed:14729850}.		actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ACCAGGGTACATAGTGGTGCC	0.448																																					p.M307T		.											.	ACTC1	92	0			c.T920C						.						330.0	290.0	303.0					15																	35083385		2201	4298	6499	SO:0001583	missense	70	exon6			GGGTACATAGTGG	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.920T>C	15.37:g.35083385A>G	ENSP00000290378:p.Met307Thr	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	10.0	NM_005159	P04270	Missense_Mutation	SNP	ENST00000290378.4	37	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	A	17.34	3.364324	0.61513	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.94723	-3.5	5.49	5.49	0.81192	.	0.000000	0.64402	U	0.000005	D	0.97736	0.9257	H	0.94462	3.54	0.58432	D	0.999998	B	0.13594	0.008	P	0.46299	0.511	D	0.97424	1.0011	10	0.87932	D	0	.	15.8884	0.79273	1.0:0.0:0.0:0.0	.	307	P68032	ACTC_HUMAN	T	307;272	ENSP00000290378:M307T	ENSP00000290378:M307T	M	-	2	0	ACTC1	32870677	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.209000	0.71365	0.533000	0.62120	ATG	.		0.448	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
ALG13	79868	ucsc.edu;bcgsc.ca	37	X	110951316	110951316	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chrX:110951316T>C	ENST00000394780.3	+	4	457	c.445T>C	c.(445-447)Tct>Cct	p.S149P	ALG13_ENST00000251943.4_Missense_Mutation_p.S45P|ALG13-AS1_ENST00000430794.1_RNA	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	149	Deubiquitinase activity.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						GTGCCAAGATTCTGCAGCGCT	0.517																																					p.S149P		.											.	ALG13	130	0			c.T445C						.						71.0	58.0	62.0					X																	110951316		1568	3582	5150	SO:0001583	missense	79868	exon4			CAAGATTCTGCAG	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.445T>C	X.37:g.110951316T>C	ENSP00000378260:p.Ser149Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001099922	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Missense_Mutation	SNP	ENST00000394780.3	37	CCDS55477.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.325008	0.41197	.	.	ENSG00000101901	ENST00000251943;ENST00000486353;ENST00000394780;ENST00000495283	T;T;T;T	0.78364	1.44;-1.17;0.46;1.42	5.25	0.0702	0.14377	.	.	.	.	.	T	0.52565	0.1742	N	0.08118	0	0.09310	N	1	B;B;B	0.11235	0.004;0.002;0.002	B;B;B	0.10450	0.005;0.001;0.005	T	0.39210	-0.9625	9	0.45353	T	0.12	.	1.6987	0.02867	0.1657:0.0993:0.3658:0.3692	.	71;149;45	Q9NP73-3;Q9NP73;Q9NP73-4	.;ALG13_HUMAN;.	P	45;149;149;45	ENSP00000251943:S45P;ENSP00000426892:S149P;ENSP00000378260:S149P;ENSP00000427093:S45P	ENSP00000251943:S45P	S	+	1	0	ALG13	110837972	0.978000	0.34361	0.256000	0.24389	0.978000	0.69477	0.149000	0.16243	0.013000	0.14918	-0.405000	0.06341	TCT	.		0.517	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	NM_018466	
ALOXE3	59344	broad.mit.edu;ucsc.edu	37	17	8012628	8012628	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:8012628G>A	ENST00000448843.2	-	12	1766	c.1426C>T	c.(1426-1428)Ctc>Ttc	p.L476F	ALOXE3_ENST00000318227.3_Missense_Mutation_p.L608F|ALOXE3_ENST00000380149.1_Missense_Mutation_p.L632F	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	476	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						GTGCTCATGAGGTAGATGAGG	0.647																																					p.L608F		.											.	ALOXE3	229	0			c.C1822T						.						58.0	51.0	54.0					17																	8012628		2203	4300	6503	SO:0001583	missense	59344	exon12			TCATGAGGTAGAT	AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.1426C>T	17.37:g.8012628G>A	ENSP00000400581:p.Leu476Phe	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	5.0	NM_001165960	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	ENST00000448843.2	37	CCDS11130.1	.	.	.	.	.	.	.	.	.	.	g	16.68	3.191612	0.58017	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	D;D;D	0.81739	-1.53;-1.53;-1.53	5.0	5.0	0.66597	Lipoxygenase, C-terminal (3);	0.184234	0.48286	D	0.000185	D	0.85414	0.5691	M	0.78223	2.4	0.41406	D	0.987701	D;B;B	0.56968	0.978;0.072;0.072	P;B;B	0.58780	0.845;0.176;0.176	D	0.85512	0.1198	10	0.49607	T	0.09	-29.3907	7.417	0.27050	0.1761:0.0:0.8239:0.0	.	608;476;476	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	F	632;608;476	ENSP00000369494:L632F;ENSP00000314879:L608F;ENSP00000400581:L476F	ENSP00000314879:L608F	L	-	1	0	ALOXE3	7953353	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.018000	0.40991	2.625000	0.88918	0.556000	0.70494	CTC	.		0.647	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1		
AMOTL1	154810	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	94602492	94602492	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:94602492A>G	ENST00000433060.2	+	12	2759	c.2618A>G	c.(2617-2619)aAg>aGg	p.K873R	AMOTL1_ENST00000317829.8_Missense_Mutation_p.K823R|AMOTL1_ENST00000317837.9_Missense_Mutation_p.K460R	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	873					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				ACAGGCAGCAAGGACAGCAGC	0.662																																					p.K873R		.											.	AMOTL1	91	0			c.A2618G						.						35.0	45.0	41.0					11																	94602492		2178	4284	6462	SO:0001583	missense	154810	exon12			GCAGCAAGGACAG	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.2618A>G	11.37:g.94602492A>G	ENSP00000387739:p.Lys873Arg	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	5.0	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	A	19.21	3.783312	0.70222	.	.	ENSG00000166025	ENST00000317829;ENST00000317837;ENST00000433060	T;T;T	0.17370	2.3;2.54;2.28	5.48	3.2	0.36748	.	0.137346	0.49916	N	0.000138	T	0.07863	0.0197	N	0.15975	0.35	0.20196	N	0.999922	B;B	0.19200	0.014;0.034	B;B	0.20384	0.027;0.029	T	0.39251	-0.9623	10	0.05351	T	0.99	-38.0096	9.1088	0.36714	0.8528:0.0:0.1472:0.0	.	823;873	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	R	823;460;873	ENSP00000320968:K823R;ENSP00000323474:K460R;ENSP00000387739:K873R	ENSP00000320968:K823R	K	+	2	0	AMOTL1	94242140	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.650000	0.46665	0.934000	0.37316	0.459000	0.35465	AAG	.		0.662	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
AMT	275	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49458964	49458964	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:49458964A>G	ENST00000273588.3	-	3	602	c.300T>C	c.(298-300)agT>agC	p.S100S	NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000538581.1_Silent_p.S44S|AMT_ENST00000395338.2_Silent_p.S100S|AMT_ENST00000476226.1_5'UTR|AMT_ENST00000546031.1_Silent_p.S3S|AMT_ENST00000458307.2_Silent_p.S100S	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase	100					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	CAACCACTAGACTCTCCATCA	0.478																																					p.S100S		.											.	AMT	91	0			c.T300C						.						162.0	153.0	156.0					3																	49458964		2203	4300	6503	SO:0001819	synonymous_variant	275	exon3			CACTAGACTCTCC	D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.300T>C	3.37:g.49458964A>G		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	9.0	NM_001164712	A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Silent	SNP	ENST00000273588.3	37	CCDS2797.1	.	.	.	.	.	.	.	.	.	.	A	11.19	1.564935	0.27915	.	.	ENSG00000145020	ENST00000427987	T	0.75477	-0.94	5.41	4.1	0.47936	.	0.089279	0.85682	D	0.000000	T	0.74199	0.3685	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75199	-0.3402	7	0.56958	D	0.05	-17.2642	4.7299	0.12959	0.7689:0.0:0.2311:0.0	.	.	.	.	P	98	ENSP00000403821:S98P	ENSP00000403821:S98P	S	-	1	0	AMT	49433968	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.017000	0.40981	2.168000	0.68352	0.533000	0.62120	TCT	.		0.478	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346216.2	NM_000481	
AP1G2	8906	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24032935	24032935	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:24032935C>G	ENST00000308724.5	-	11	1977	c.1222G>C	c.(1222-1224)Gct>Cct	p.A408P	AP1G2_ENST00000397120.3_Missense_Mutation_p.A408P|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_5'Flank|RP11-66N24.4_ENST00000553985.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	408					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CTCTCTGCAGCCAGCAGGATG	0.572																																					p.A408P		.											.	AP1G2	45	0			c.G1222C						.						84.0	76.0	78.0					14																	24032935		2203	4300	6503	SO:0001583	missense	8906	exon12			CTGCAGCCAGCAG	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1222G>C	14.37:g.24032935C>G	ENSP00000312442:p.Ala408Pro	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	4.0	NM_003917	D3DS51|O75504	Missense_Mutation	SNP	ENST00000308724.5	37	CCDS9602.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614684	0.87359	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852	T;T	0.26660	1.72;1.72	4.5	4.5	0.54988	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59676	0.2211	M	0.92833	3.35	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.69480	-0.5134	10	0.54805	T	0.06	-9.4278	14.7542	0.69552	0.0:1.0:0.0:0.0	.	408;263	O75843;Q86V28	AP1G2_HUMAN;.	P	408;408;177;263	ENSP00000312442:A408P;ENSP00000380309:A408P	ENSP00000312442:A408P	A	-	1	0	AP1G2	23102775	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	5.188000	0.65093	2.314000	0.78098	0.557000	0.71058	GCT	.		0.572	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071812.4	NM_003917	
APOM	55937	ucsc.edu;bcgsc.ca	37	6	31625487	31625487	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:31625487T>C	ENST00000375916.3	+	5	1024	c.528T>C	c.(526-528)acT>acC	p.T176T	APOM_ENST00000375920.4_Silent_p.T104T|C6orf47-AS1_ENST00000422049.1_RNA|APOM_ENST00000375918.2_Silent_p.T104T	NM_019101.2	NP_061974.2	O95445	APOM_HUMAN	apolipoprotein M	176				LTPRNQEACELSNN -> VDS (in Ref. 2; CAB51604). {ECO:0000305}.	cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein metabolic process (GO:0042157)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|response to glucose (GO:0009749)|reverse cholesterol transport (GO:0043691)	discoidal high-density lipoprotein particle (GO:0034365)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|lipid transporter activity (GO:0005319)|phospholipid binding (GO:0005543)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(1)	7						TCTTATTGACTCCTAGGAATC	0.483																																					p.T176T	Colon(39;129 858 13764 41453 42617)	.											.	APOM	90	0			c.T528C						.						127.0	132.0	130.0					6																	31625487		1511	2708	4219	SO:0001819	synonymous_variant	55937	exon5			ATTGACTCCTAGG	AJ245434	CCDS4710.1, CCDS59004.1	6p21	2014-01-22			ENSG00000204444	ENSG00000204444		"""Apolipoproteins"", ""Lipocalins"""	13916	protein-coding gene	gene with protein product		606907				10531326, 11418126	Standard	NM_019101		Approved	ApoM, G3a, NG20	uc003nvl.3	O95445	OTTHUMG00000031250	ENST00000375916.3:c.528T>C	6.37:g.31625487T>C		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_019101	B0UX98|Q5SRP4|Q9P046|Q9UMP6	Silent	SNP	ENST00000375916.3	37	CCDS4710.1																																																																																			.		0.483	APOM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076527.3	NM_019101	
APTX	54840	ucsc.edu;bcgsc.ca	37	9	33001565	33001565	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:33001565C>A	ENST00000379819.1	-	1	37	c.38G>T	c.(37-39)aGa>aTa	p.R13I	APTX_ENST00000379825.2_Splice_Site_p.R13I|APTX_ENST00000463596.1_5'Flank|APTX_ENST00000309615.3_Splice_Site_p.R13I|APTX_ENST00000379813.3_5'UTR|APTX_ENST00000397172.3_Splice_Site_p.R13I|APTX_ENST00000476858.1_Splice_Site_p.R13I			Q7Z2E3	APTX_HUMAN	aprataxin	13	Interactions with ADPRT and NCL.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|dephosphorylation (GO:0016311)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA ligation (GO:0006266)|double-strand break repair (GO:0006302)|polynucleotide 3' dephosphorylation (GO:0098506)|regulation of protein stability (GO:0031647)|response to hydrogen peroxide (GO:0042542)|single strand break repair (GO:0000012)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA 5'-adenosine monophosphate hydrolase activity (GO:0033699)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|phosphoglycolate phosphatase activity (GO:0008967)|phosphoprotein binding (GO:0051219)|polynucleotide 3'-phosphatase activity (GO:0046403)|protein N-terminus binding (GO:0047485)			endometrium(1)|lung(1)|ovary(2)|prostate(2)	6			LUSC - Lung squamous cell carcinoma(29;0.0302)	GBM - Glioblastoma multiforme(74;0.105)		ACCGCCTTACCTCCAGAAGTC	0.607								Editing and processing nucleases																													p.R13I		.											.	APTX	91	0			c.G38T						.						104.0	80.0	88.0					9																	33001565		2203	4300	6503	SO:0001630	splice_region_variant	54840	exon1			CCTTACCTCCAGA	AK000164	CCDS47956.1, CCDS56568.1, CCDS75827.1	9p13.3	2014-01-28	2003-04-03		ENSG00000137074	ENSG00000137074			15984	protein-coding gene	gene with protein product		606350	"""ataxia 1, early onset with hypoalbuminemia"""	AXA1		11586299, 11586300	Standard	NM_175069		Approved	FLJ20157, AOA, AOA1, EAOH, EOAHA	uc003zry.3	Q7Z2E3	OTTHUMG00000019759	ENST00000379819.1:c.38+1G>T	9.37:g.33001565C>A		Somatic	23.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_001195252	A8MTN4|D3DRK9|D3DRL0|Q0P662|Q5T781|Q5T782|Q5T784|Q6JV81|Q6JV82|Q6JV85|Q7Z2F3|Q7Z336|Q7Z5R5|Q7Z6V7|Q7Z6V8|Q9NXM5	Missense_Mutation	SNP	ENST00000379819.1	37		.	.	.	.	.	.	.	.	.	.	C	16.71	3.198550	0.58126	.	.	ENSG00000137074	ENST00000379825;ENST00000309615;ENST00000397172;ENST00000379819;ENST00000476858;ENST00000344355;ENST00000379812;ENST00000473221	D;D;D;D;D;T;D	0.91996	-1.9;-1.9;-1.93;-1.9;-2.95;-1.45;-2.46	4.11	4.11	0.48088	.	0.507103	0.19634	N	0.109609	D	0.92756	0.7697	M	0.65975	2.015	0.80722	D	1	D	0.61697	0.99	P	0.51806	0.68	D	0.93042	0.6458	10	0.87932	D	0	-2.1894	12.1476	0.54031	0.0:1.0:0.0:0.0	.	13	Q5T782	.	I	13	ENSP00000369153:R13I;ENSP00000311547:R13I;ENSP00000380357:R13I;ENSP00000369147:R13I;ENSP00000419042:R13I;ENSP00000369140:R13I;ENSP00000419020:R13I	ENSP00000311547:R13I	R	-	2	0	APTX	32991565	0.995000	0.38212	0.986000	0.45419	0.075000	0.17131	2.906000	0.48735	2.577000	0.86979	0.655000	0.94253	AGA	.		0.607	APTX-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000052028.2	NM_017692	Missense_Mutation
ASB12	142689	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	63445128	63445128	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chrX:63445128T>C	ENST00000396130.2	-	1	375	c.376A>G	c.(376-378)Agc>Ggc	p.S126G	ASB12_ENST00000362002.2_Missense_Mutation_p.S135G|MTMR8_ENST00000453546.1_Missense_Mutation_p.S510G			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	126					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						TTGTAGATGCTACCACCAGGA	0.547																																					p.S135G		.											.	ASB12	228	2	Whole gene deletion(2)	ovary(1)|large_intestine(1)	c.A403G						.						104.0	65.0	78.0					X																	63445128		2203	4300	6503	SO:0001583	missense	142689	exon2			AGATGCTACCACC	AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.376A>G	X.37:g.63445128T>C	ENSP00000379435:p.Ser126Gly	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	15.0	NM_130388	J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	ENST00000396130.2	37		.	.	.	.	.	.	.	.	.	.	T	19.39	3.817934	0.71028	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.64618	-0.11;-0.11;-0.11	4.0	4.0	0.46444	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.63070	0.2480	L	0.28192	0.835	0.27853	N	0.940689	D;D	0.69078	0.997;0.997	D;D	0.80764	0.994;0.992	T	0.54390	-0.8301	10	0.14656	T	0.56	-24.6711	11.2485	0.49010	0.0:0.0:0.0:1.0	.	510;126	B4DQL0;Q8WXK4	.;ASB12_HUMAN	G	135;126;135;510	ENSP00000355195:S135G;ENSP00000379435:S126G;ENSP00000394003:S510G	ENSP00000354626:S135G	S	-	1	0	ASB12;MTMR8	63361853	1.000000	0.71417	0.998000	0.56505	0.910000	0.53928	7.194000	0.77789	1.595000	0.50050	0.381000	0.24937	AGC	.		0.547	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ATN1	1822	ucsc.edu;bcgsc.ca	37	12	7047718	7047718	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:7047718A>G	ENST00000356654.4	+	7	2829	c.2592A>G	c.(2590-2592)gaA>gaG	p.E864E	ATN1_ENST00000396684.2_Silent_p.E864E	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	864					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CTCCATTTGAACCGGGCAGTG	0.612											OREG0021641	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E864E		.											.	ATN1	139	0			c.A2592G						.						47.0	49.0	48.0					12																	7047718		2203	4300	6503	SO:0001819	synonymous_variant	1822	exon7			ATTTGAACCGGGC	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.2592A>G	12.37:g.7047718A>G		Somatic	40.0	1.0	638	WXS	Illumina HiSeq	.	35.0	4.0	NM_001007026	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			.		0.612	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
ATP6V0A2	23545	broad.mit.edu;bcgsc.ca	37	12	124221770	124221770	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:124221770T>C	ENST00000330342.3	+	9	1238	c.990T>C	c.(988-990)tgT>tgC	p.C330C		NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	330					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		AGGTCTGGTGTCCCGAGGCGG	0.567																																					p.C330C		.											.	ATP6V0A2	92	0			c.T990C						.						100.0	79.0	86.0					12																	124221770		2203	4300	6503	SO:0001819	synonymous_variant	23545	exon9			CTGGTGTCCCGAG	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.990T>C	12.37:g.124221770T>C		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	5.0	NM_012463	A8K026|Q6NUM0	Silent	SNP	ENST00000330342.3	37	CCDS9254.1																																																																																			.		0.567	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
ATP6V1H	51606	ucsc.edu;bcgsc.ca	37	8	54742070	54742070	+	Silent	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr8:54742070C>A	ENST00000359530.2	-	4	503	c.240G>T	c.(238-240)ctG>ctT	p.L80L	ATP6V1H_ENST00000355221.3_Silent_p.L80L|ATP6V1H_ENST00000520188.1_Silent_p.L40L|ATP6V1H_ENST00000396774.2_Silent_p.L80L	NM_015941.3	NP_057025.2	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H	80					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|endocytosis (GO:0006897)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|regulation of catalytic activity (GO:0050790)|regulation of defense response to virus by virus (GO:0050690)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V1 domain (GO:0000221)	enzyme regulator activity (GO:0030234)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	18		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			TATGAGTCATCAGATTTATAA	0.303																																					p.L80L		.											.	ATP6V1H	90	0			c.G240T						.						109.0	105.0	106.0					8																	54742070		2203	4299	6502	SO:0001819	synonymous_variant	51606	exon4			AGTCATCAGATTT	AF132945	CCDS6153.1, CCDS6154.1	8q11.2	2011-05-24	2002-08-29		ENSG00000047249	ENSG00000047249		"""ATPases / V-type"""	18303	protein-coding gene	gene with protein product	"""vacuolar ATP synthase subunit H"""	608861	"""ATPase, H+ transporting, lysosomal 50/57kD, V1 subunit H"""			9620685, 10810093	Standard	NM_015941		Approved	CGI-11, SFD, VMA13, SFDalpha, SFDbeta	uc003xrm.4	Q9UI12	OTTHUMG00000164231	ENST00000359530.2:c.240G>T	8.37:g.54742070C>A		Somatic	25.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_015941	B3KMR0|Q6PK44|Q9H3E3|Q9Y300	Silent	SNP	ENST00000359530.2	37	CCDS6153.1																																																																																			.		0.303	ATP6V1H-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377865.1	NM_015941	
ATP8A2	51761	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	26411378	26411378	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr13:26411378C>T	ENST00000381655.2	+	29	2974	c.2832C>T	c.(2830-2832)ccC>ccT	p.P944P	ATP8A2_ENST00000255283.8_Silent_p.P879P|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	904					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TCAGGTTTCCCCAGCTCTACA	0.493																																					p.P944P		.											ATP8A2,NS,carcinoma,+2	ATP8A2	138	0			c.C2832T						.						119.0	113.0	115.0					13																	26411378		1929	4128	6057	SO:0001819	synonymous_variant	51761	exon29			GTTTCCCCAGCTC	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2832C>T	13.37:g.26411378C>T		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	13.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	ENST00000381655.2	37	CCDS41873.1																																																																																			.		0.493	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
AXL	558	ucsc.edu;bcgsc.ca	37	19	41762488	41762488	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:41762488A>G	ENST00000301178.4	+	18	2358	c.2168A>G	c.(2167-2169)gAc>gGc	p.D723G	AXL_ENST00000359092.3_Missense_Mutation_p.D714G|AXL_ENST00000593513.1_Missense_Mutation_p.D455G	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	723	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						AGTCTAGCTGACCGTGTCTAC	0.562																																					p.D723G		.											.	AXL	1403	0			c.A2168G						.						210.0	149.0	169.0					19																	41762488		2203	4300	6503	SO:0001583	missense	558	exon18			TAGCTGACCGTGT	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.2168A>G	19.37:g.41762488A>G	ENSP00000301178:p.Asp723Gly	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_021913	Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	37	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.429716	0.83776	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.59638	0.25;0.25	4.49	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	L	0.33093	0.98	0.58432	D	0.999997	D;D	0.69078	0.997;0.994	D;D	0.66847	0.936;0.947	T	0.68209	-0.5469	10	0.87932	D	0	-25.7	13.1778	0.59637	1.0:0.0:0.0:0.0	.	714;723	P30530-2;P30530	.;UFO_HUMAN	G	723;714	ENSP00000301178:D723G;ENSP00000351995:D714G	ENSP00000301178:D723G	D	+	2	0	AXL	46454328	1.000000	0.71417	0.822000	0.32727	0.901000	0.52897	8.989000	0.93506	2.004000	0.58718	0.482000	0.46254	GAC	.		0.562	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2		
BIRC6	57448	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32626685	32626685	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:32626685G>A	ENST00000421745.2	+	8	1546	c.1412G>A	c.(1411-1413)gGa>gAa	p.G471E		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	471					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AAATTGGAAGGAGATAGGTAT	0.358																																					p.G471E	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.G1412A						.						82.0	84.0	83.0					2																	32626685		2203	4300	6503	SO:0001583	missense	57448	exon8			TGGAAGGAGATAG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1412G>A	2.37:g.32626685G>A	ENSP00000393596:p.Gly471Glu	Somatic	86.0	1.0		WXS	Illumina HiSeq	Phase_I	97.0	10.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	31	5.085758	0.94100	.	.	ENSG00000115760	ENST00000421745	D	0.81908	-1.55	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.86628	0.5978	L	0.36672	1.1	0.80722	D	1	D	0.64830	0.994	P	0.59115	0.852	D	0.87062	0.2154	10	0.72032	D	0.01	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	471	Q9NR09	BIRC6_HUMAN	E	471	ENSP00000393596:G471E	ENSP00000393596:G471E	G	+	2	0	BIRC6	32480189	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.414000	0.97362	2.813000	0.96785	0.561000	0.74099	GGA	.		0.358	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BTN3A1	11119	ucsc.edu;bcgsc.ca	37	6	26413718	26413718	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:26413718C>T	ENST00000289361.6	+	10	1708	c.1340C>T	c.(1339-1341)cCc>cTc	p.P447L	BTN3A1_ENST00000414912.2_Missense_Mutation_p.P395L	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	447	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						CTAACTGAGCCCAGAACCAAC	0.473																																					p.P447L		.											.	BTN3A1	92	0			c.C1340T						.						135.0	135.0	135.0					6																	26413718		2203	4300	6503	SO:0001583	missense	11119	exon10			CTGAGCCCAGAAC	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1340C>T	6.37:g.26413718C>T	ENSP00000289361:p.Pro447Leu	Somatic	70.0	0.0		WXS	Illumina HiSeq	.	59.0	5.0	NM_007048	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	ENST00000289361.6	37	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	1.369	-0.586620	0.03827	.	.	ENSG00000026950	ENST00000289361;ENST00000414912	T;T	0.69306	-0.39;-0.39	2.31	1.43	0.22495	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.58864	0.2152	M	0.68317	2.08	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.985	T	0.51733	-0.8668	9	0.08599	T	0.76	.	7.4295	0.27120	0.0:0.8553:0.0:0.1446	.	395;447	E9PGB4;O00481	.;BT3A1_HUMAN	L	447;395	ENSP00000289361:P447L;ENSP00000406667:P395L	ENSP00000289361:P447L	P	+	2	0	BTN3A1	26521697	0.000000	0.05858	0.023000	0.16930	0.006000	0.05464	-2.674000	0.00842	0.516000	0.28340	-0.177000	0.13119	CCC	.		0.473	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
C14orf182	283551	ucsc.edu;bcgsc.ca	37	14	50459531	50459531	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:50459531T>C	ENST00000399206.1	-	2	1987	c.267A>G	c.(265-267)agA>agG	p.R89R	C14orf182_ENST00000529902.1_5'UTR	NM_001012706.1	NP_001012724.1	A1A4T8	CN182_HUMAN	chromosome 14 open reading frame 182	0										large_intestine(2)|urinary_tract(1)	3						TGTCTGCTGCTCTCCTGACGC	0.443																																					p.R89R		.											.	C14orf182	90	0			c.A267G						.						79.0	78.0	78.0					14																	50459531		1889	4109	5998	SO:0001819	synonymous_variant	283551	exon2			TGCTGCTCTCCTG	AK090420	CCDS41949.1	14q22.1	2009-02-24			ENSG00000214900	ENSG00000214900			27503	protein-coding gene	gene with protein product							Standard	NM_001012706		Approved		uc001wxi.1	A1A4T8		ENST00000399206.1:c.267A>G	14.37:g.50459531T>C		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	47.0	5.0	NM_001012706	A8MYX4	Silent	SNP	ENST00000399206.1	37	CCDS41949.1																																																																																			.		0.443	C14orf182-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395717.1	NM_001012706	
ZNF436	80818	ucsc.edu;bcgsc.ca	37	1	23696028	23696028	+	5'Flank	SNP	T	T	C	rs147377149		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:23696028T>C	ENST00000314011.4	-	0	0				C1orf213_ENST00000437367.2_Intron|Y_RNA_ENST00000364535.1_RNA|ZNF436_ENST00000374608.3_5'Flank|C1orf213_ENST00000335648.3_Silent_p.L80L|C1orf213_ENST00000518821.1_Intron|C1orf213_ENST00000454117.1_Intron|C1orf213_ENST00000458053.1_Intron	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ATTCGTAGACTTGCAGGCGAA	0.567																																					.		.											.	C1orf213	68	0			.						.	T		0,4406		0,0,2203	68.0	70.0	69.0			-0.2	0.0	1	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	utr-5	ZNF436	NM_001077195.1		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077			23696028	1,13005	2203	4300	6503	SO:0001631	upstream_gene_variant	148898	.			GTAGACTTGCAGG	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232		1.37:g.23696028T>C	Exception_encountered	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	.	Q658I9	RNA	SNP	ENST00000314011.4	37	CCDS233.1																																																																																			T|1.000;C|0.000		0.567	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008908.1	NM_030634	
C21orf54	728409	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34540848	34540848	+	Missense_Mutation	SNP	C	C	T	rs551756589		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr21:34540848C>T	ENST00000451980.2	-	3	272	c.206G>A	c.(205-207)cGc>cAc	p.R69H						chromosome 21 open reading frame 54																		AGGGtgtccgcgcttgagctc	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		17711	0.001		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.																																			SO:0001583	missense	728409	.			TGTCCGCGCTTGA			21q22.11	2013-01-15			ENSG00000229086	ENSG00000229086			1296	other	unknown							Standard	NR_024102		Approved		uc002yra.4	A6NM66	OTTHUMG00000065061	ENST00000451980.2:c.206G>A	21.37:g.34540848C>T	ENSP00000407868:p.Arg69His	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	9.0	.		RNA	SNP	ENST00000451980.2	37		.	.	.	.	.	.	.	.	.	.	C	0.008	-1.874758	0.00542	.	.	ENSG00000229086	ENST00000440586;ENST00000451980	.	.	.	0.848	-1.7	0.08159	.	.	.	.	.	T	0.27349	0.0671	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29150	-1.0021	5	0.87932	D	0	.	0.3728	0.00382	0.2476:0.2189:0.3172:0.2163	.	.	.	.	H	69	.	ENSP00000406117:R69H	R	-	2	0	C21orf54	33462718	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.712000	0.01885	-2.544000	0.00483	-2.059000	0.00401	CGC	.		0.562	C21orf54-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000139727.3	NR_024102	
C9orf152	401546	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	112963511	112963511	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:112963511C>T	ENST00000400613.4	-	2	1046	c.437G>A	c.(436-438)gGa>gAa	p.G146E	C9orf152_ENST00000473442.1_Intron	NM_001012993.2	NP_001013011.2	Q5JTZ5	CI152_HUMAN	chromosome 9 open reading frame 152	146										NS(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						TTGATCAGATCCCACAAGCTT	0.532																																					p.G146E		.											.	C9orf152	90	0			c.G437A						.						206.0	187.0	193.0					9																	112963511		2203	4300	6503	SO:0001583	missense	401546	exon2			TCAGATCCCACAA	BX648620	CCDS35102.2	9q31.3	2012-04-03			ENSG00000188959	ENSG00000188959			31455	protein-coding gene	gene with protein product							Standard	NM_001012993		Approved	bA470J20.2	uc011lwk.2	Q5JTZ5	OTTHUMG00000020478	ENST00000400613.4:c.437G>A	9.37:g.112963511C>T	ENSP00000383456:p.Gly146Glu	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	18.0	NM_001012993	A8MWT6	Missense_Mutation	SNP	ENST00000400613.4	37	CCDS35102.2	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.594336	0.00857	.	.	ENSG00000188959	ENST00000400613	.	.	.	4.38	-3.56	0.04626	.	0.637853	0.14603	N	0.309514	T	0.12732	0.0309	N	0.12746	0.255	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.20009	-1.0288	9	0.16420	T	0.52	-2.9295	1.55	0.02573	0.1234:0.2292:0.2425:0.4049	.	146	Q5JTZ5	CI152_HUMAN	E	146	.	ENSP00000383456:G146E	G	-	2	0	C9orf152	112003332	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.214000	0.09292	-0.726000	0.04895	-1.845000	0.00574	GGA	.		0.532	C9orf152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053602.2	NM_001012993	
CACNA1D	776	ucsc.edu;bcgsc.ca	37	3	53835346	53835346	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:53835346C>T	ENST00000350061.5	+	42	5813	c.5302C>T	c.(5302-5304)Cat>Tat	p.H1768Y	CACNA1D_ENST00000422281.2_Missense_Mutation_p.H1753Y|CACNA1D_ENST00000544977.1_Missense_Mutation_p.H147Y|CACNA1D_ENST00000288139.4_Missense_Mutation_p.H1788Y	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1768					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CAAAGCTGCCCATGGAAAGCG	0.473																																					p.H1788Y		.											.	CACNA1D	100	0			c.C5362T						.						79.0	73.0	75.0					3																	53835346		2203	4300	6503	SO:0001583	missense	776	exon43			GCTGCCCATGGAA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5302C>T	3.37:g.53835346C>T	ENSP00000288133:p.His1768Tyr	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	37	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675447	0.29783	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000544977	D;D;D;D	0.95853	-3.8;-3.83;-3.82;-3.82	4.15	3.17	0.36434	.	1.385230	0.04888	N	0.448923	D	0.90758	0.7099	N	0.22421	0.69	0.31419	N	0.674502	B;B;B;B	0.25772	0.113;0.01;0.01;0.134	B;B;B;B	0.29862	0.049;0.023;0.007;0.108	T	0.78575	-0.2151	10	0.02654	T	1	.	11.547	0.50698	0.3417:0.6583:0.0:0.0	.	1753;1461;1768;1788	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	Y	1768;1788;1753;1461;147	ENSP00000288133:H1768Y;ENSP00000288139:H1788Y;ENSP00000409174:H1753Y;ENSP00000418014:H1461Y	ENSP00000288139:H1788Y	H	+	1	0	CACNA1D	53810386	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.069000	0.41481	2.256000	0.74724	0.462000	0.41574	CAT	.		0.473	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CALHM1	255022	ucsc.edu;bcgsc.ca	37	10	105218131	105218131	+	Silent	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr10:105218131G>T	ENST00000329905.5	-	1	514	c.378C>A	c.(376-378)ctC>ctA	p.L126L	RP11-225H22.4_ENST00000411906.1_RNA	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	126					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)			large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						AGAAGGCACAGAGGAAGCATT	0.697																																					p.L126L		.											.	CALHM1	91	0			c.C378A						.						30.0	28.0	29.0					10																	105218131		2203	4297	6500	SO:0001819	synonymous_variant	255022	exon1			GGCACAGAGGAAG	BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.378C>A	10.37:g.105218131G>T		Somatic	57.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001001412	Q5W091	Silent	SNP	ENST00000329905.5	37	CCDS7550.1																																																																																			.		0.697	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050165.1	NM_001001412	
CAMTA2	23125	ucsc.edu;bcgsc.ca	37	17	4883887	4883887	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:4883887T>C	ENST00000348066.3	-	9	853	c.730A>G	c.(730-732)Agc>Ggc	p.S244G	CAMTA2_ENST00000358183.4_Missense_Mutation_p.S244G|CAMTA2_ENST00000381311.5_Missense_Mutation_p.S246G|CAMTA2_ENST00000572543.1_Missense_Mutation_p.S249G|CAMTA2_ENST00000414043.3_Missense_Mutation_p.S267G|CAMTA2_ENST00000361571.5_Missense_Mutation_p.S243G|CAMTA2_ENST00000571831.1_5'Flank	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	244					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TGTTTCGTGCTGCTGCATTTG	0.572											OREG0024111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S267G		.											.	CAMTA2	91	0			c.A799G						.						92.0	102.0	99.0					17																	4883887		2085	4220	6305	SO:0001583	missense	23125	exon9			TCGTGCTGCTGCA	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.730A>G	17.37:g.4883887T>C	ENSP00000321813:p.Ser244Gly	Somatic	62.0	0.0	622	WXS	Illumina HiSeq	.	43.0	4.0	NM_001171167	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	ENST00000348066.3	37	CCDS11063.1	.	.	.	.	.	.	.	.	.	.	T	16.37	3.103055	0.56183	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.38240	2.42;1.44;1.15;1.44;1.21	4.61	4.61	0.57282	.	0.183938	0.47455	D	0.000237	T	0.42471	0.1204	N	0.19112	0.55	0.37705	D	0.924356	B;B;B;D	0.57257	0.382;0.363;0.278;0.979	B;B;B;D	0.75484	0.265;0.358;0.079;0.986	T	0.45702	-0.9243	10	0.39692	T	0.17	-13.2117	12.0099	0.53280	0.0:0.0:0.0:1.0	.	267;246;244;243	E7EWU5;O94983-3;O94983;O94983-4	.;.;CMTA2_HUMAN;.	G	267;246;243;244;244	ENSP00000412886:S267G;ENSP00000370712:S246G;ENSP00000354828:S243G;ENSP00000350910:S244G;ENSP00000321813:S244G	ENSP00000321813:S244G	S	-	1	0	CAMTA2	4824611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.526000	0.81920	1.935000	0.56089	0.528000	0.53228	AGC	.		0.572	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216876.1	NM_015099	
CAPS2	84698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	75692559	75692559	+	Splice_Site	SNP	T	T	C	rs372993486		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:75692559T>C	ENST00000409445.3	-	12	1205	c.1009A>G	c.(1009-1011)Aca>Gca	p.T337A	RP11-560G2.1_ENST00000534648.2_RNA|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000409799.1_Splice_Site_p.T255A|CAPS2_ENST00000442339.2_Intron|CAPS2_ENST00000393284.3_Splice_Site_p.T105A	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	337							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						AGCACATTTGTTCTAGAAAGT	0.323																																					p.T337A		.											.	CAPS2	92	0			c.A1009G						.						99.0	97.0	98.0					12																	75692559		2203	4299	6502	SO:0001630	splice_region_variant	84698	exon12			CATTTGTTCTAGA	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1008-1A>G	12.37:g.75692559T>C		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	12.0	NM_032606	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	ENST00000409445.3	37	CCDS9008.2	.	.	.	.	.	.	.	.	.	.	T	12.75	2.031379	0.35797	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284	D;T;T	0.82619	-1.63;1.87;1.91	5.45	5.45	0.79879	.	0.143817	0.49305	D	0.000152	T	0.79399	0.4439	M	0.65320	2	0.80722	D	1	B;B;B;B	0.34290	0.447;0.019;0.058;0.011	B;B;B;B	0.26202	0.067;0.019;0.013;0.014	T	0.78360	-0.2234	10	0.34782	T	0.22	-14.7626	15.5603	0.76240	0.0:0.0:0.0:1.0	.	105;73;337;255	Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;CAYP2_HUMAN;.	A	255;337;73;105	ENSP00000386977:T255A;ENSP00000386959:T337A;ENSP00000376963:T105A	ENSP00000367975:T73A	T	-	1	0	CAPS2	73978826	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	1.392000	0.34486	2.091000	0.63221	0.439000	0.28862	ACA	.		0.323	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327880.2		Missense_Mutation
CCDC60	160777	ucsc.edu;bcgsc.ca	37	12	119916935	119916935	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:119916935T>C	ENST00000327554.2	+	4	843	c.378T>C	c.(376-378)gcT>gcC	p.A126A	RP11-768F21.1_ENST00000509470.2_lincRNA|CCDC60_ENST00000546345.1_3'UTR	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	126										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CACTGGGAGCTAGAGTCACAC	0.483																																					p.A126A		.											.	CCDC60	93	0			c.T378C						.						215.0	163.0	181.0					12																	119916935		2203	4300	6503	SO:0001819	synonymous_variant	160777	exon4			GGGAGCTAGAGTC	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.378T>C	12.37:g.119916935T>C		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_178499		Silent	SNP	ENST00000327554.2	37	CCDS9190.1																																																																																			.		0.483	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
CDK7	1022	ucsc.edu;bcgsc.ca	37	5	68555712	68555712	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr5:68555712C>A	ENST00000256443.3	+	7	579	c.476C>A	c.(475-477)gCc>gAc	p.A159D	CDK7_ENST00000502604.1_Missense_Mutation_p.A66D|CDK7_ENST00000514676.1_Missense_Mutation_p.A122D|CDK7_ENST00000513629.1_Intron	NM_001799.3	NP_001790.1	P50613	CDK7_HUMAN	cyclin-dependent kinase 7	159	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				7-methylguanosine mRNA capping (GO:0006370)|androgen receptor signaling pathway (GO:0030521)|ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA-dependent ATPase activity (GO:0008094)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription coactivator activity (GO:0003713)			endometrium(1)|lung(2)	3		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)		TTTGGCCTGGCCAAATCTTTT	0.388								Nucleotide excision repair (NER)																													p.A159D		.											.	CDK7	964	0			c.C476A						.						68.0	71.0	70.0					5																	68555712		2203	4300	6503	SO:0001583	missense	1022	exon7			GCCTGGCCAAATC		CCDS3999.1	5q12.1	2012-11-05	2007-11-21		ENSG00000134058	ENSG00000134058		"""Cyclin-dependent kinases"", ""General transcription factor IIH complex subunits"""	1778	protein-coding gene	gene with protein product		601955	"""cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase)"", ""cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk-activating kinase)"""			8069918	Standard	NM_001799		Approved	CAK1, CDKN7, MO15, STK1, CAK	uc003jvs.4	P50613	OTTHUMG00000099358	ENST00000256443.3:c.476C>A	5.37:g.68555712C>A	ENSP00000256443:p.Ala159Asp	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001799	Q9BS60|Q9UE19	Missense_Mutation	SNP	ENST00000256443.3	37	CCDS3999.1	.	.	.	.	.	.	.	.	.	.	C	33	5.269917	0.95429	.	.	ENSG00000134058	ENST00000506563;ENST00000256443;ENST00000514676;ENST00000502604	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87962	0.6310	H	0.98525	4.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92228	0.5790	10	0.87932	D	0	.	18.5748	0.91150	0.0:1.0:0.0:0.0	.	122;159	D6RAD4;P50613	.;CDK7_HUMAN	D	66;159;122;66	ENSP00000425043:A66D;ENSP00000256443:A159D;ENSP00000422737:A122D;ENSP00000422121:A66D	ENSP00000256443:A159D	A	+	2	0	CDK7	68591468	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.517000	0.81783	2.764000	0.94973	0.491000	0.48974	GCC	.		0.388	CDK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216802.3	NM_001799	
CHD9	80205	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	53340280	53340280	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr16:53340280delT	ENST00000398510.3	+	31	6838	c.6751delT	c.(6751-6753)tatfs	p.Y2251fs	CHD9_ENST00000447540.1_Frame_Shift_Del_p.Y2252fs|CHD9_ENST00000564845.1_Frame_Shift_Del_p.Y2251fs|CHD9_ENST00000566029.1_Frame_Shift_Del_p.Y2251fs			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2251					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				ACAAGGTGGATATATGCTGGC	0.393																																					p.Y2251fs		.											.	CHD9	272	0			c.6751delT						.						79.0	78.0	79.0					16																	53340280		1880	4108	5988	SO:0001589	frameshift_variant	80205	exon32			GGTGGATATATGC	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6751delT	16.37:g.53340280delT	ENSP00000381522:p.Tyr2251fs	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	15.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Frame_Shift_Del	DEL	ENST00000398510.3	37																																																																																				.		0.393	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
CHST2	9435	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	142841015	142841015	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:142841015C>T	ENST00000309575.3	+	2	2741	c.1357C>T	c.(1357-1359)Cag>Tag	p.Q453*		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	453					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CGAAATGGAGCAGTTTGCCCT	0.607																																					p.Q453X		.											.	CHST2	93	0			c.C1357T						.						69.0	62.0	64.0					3																	142841015		2203	4300	6503	SO:0001587	stop_gained	9435	exon2			ATGGAGCAGTTTG	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.1357C>T	3.37:g.142841015C>T	ENSP00000307911:p.Gln453*	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	11.0	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Nonsense_Mutation	SNP	ENST00000309575.3	37	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	C	48	14.489120	0.99798	.	.	ENSG00000175040	ENST00000309575	.	.	.	4.46	4.46	0.54185	.	0.346449	0.27787	N	0.017844	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-12.394	10.4733	0.44650	0.3403:0.6597:0.0:0.0	.	.	.	.	X	453	.	ENSP00000307911:Q453X	Q	+	1	0	CHST2	144323705	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.901000	0.39838	2.303000	0.77524	0.514000	0.50259	CAG	.		0.607	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
CIR1	9541	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	175244954	175244954	+	Silent	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:175244954G>A	ENST00000342016.3	-	6	434	c.342C>T	c.(340-342)atC>atT	p.I114I	CIR1_ENST00000362053.5_Silent_p.I114I	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	114	Interaction with RBPJ.				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						GCTGATCTCTGATGTTCATGT	0.259																																					p.I114I		.											.	CIR1	153	0			c.C342T						.						28.0	30.0	30.0					2																	175244954		2199	4292	6491	SO:0001819	synonymous_variant	9541	exon6			ATCTCTGATGTTC	AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.342C>T	2.37:g.175244954G>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	17.0	NM_004882	A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Silent	SNP	ENST00000342016.3	37	CCDS2256.1	.	.	.	.	.	.	.	.	.	.	G	9.459	1.092711	0.20471	.	.	ENSG00000138433	ENST00000377973	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0659	0.93110	0.0:0.0:1.0:0.0	.	.	.	.	X	19	.	.	Q	-	1	0	CIR1	174953200	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.255000	0.51484	2.510000	0.84645	0.585000	0.79938	CAG	.		0.259	CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255460.1	NM_004882	
CNPPD1	27013	ucsc.edu;bcgsc.ca	37	2	220037312	220037312	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:220037312C>T	ENST00000409789.1	-	9	1656	c.1229G>A	c.(1228-1230)gGc>gAc	p.G410D	SLC23A3_ENST00000409878.3_5'Flank|SLC23A3_ENST00000455516.2_5'Flank|CNPPD1_ENST00000360507.5_Missense_Mutation_p.G410D|SLC23A3_ENST00000295738.7_5'Flank|SLC23A3_ENST00000396775.3_5'Flank			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	410					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						CCCTACCTAGCCTGGGAAAAC	0.537																																					p.G410D		.											.	CNPPD1	90	0			c.G1229A						.						111.0	113.0	113.0					2																	220037312		2203	4299	6502	SO:0001583	missense	27013	exon8			ACCTAGCCTGGGA	AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.1229G>A	2.37:g.220037312C>T	ENSP00000386277:p.Gly410Asp	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_015680	B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	ENST00000409789.1	37	CCDS2433.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916192	0.73098	.	.	ENSG00000115649	ENST00000360507;ENST00000409789	T;T	0.22743	1.94;1.94	4.87	4.87	0.63330	.	0.252227	0.37761	N	0.001947	T	0.30293	0.0760	N	0.24115	0.695	0.43564	D	0.99588	D	0.64830	0.994	P	0.61328	0.887	T	0.07009	-1.0795	10	0.87932	D	0	-7.1277	15.964	0.79952	0.0:1.0:0.0:0.0	.	410	Q9BV87	CNPD1_HUMAN	D	410	ENSP00000353698:G410D;ENSP00000386277:G410D	ENSP00000353698:G410D	G	-	2	0	CNPPD1	219745556	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.488000	0.60300	2.526000	0.85167	0.655000	0.94253	GGC	.		0.537	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336220.1	NM_015680	
COL11A1	1301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	103343720	103343720	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:103343720G>T	ENST00000370096.3	-	67	5588	c.5276C>A	c.(5275-5277)tCc>tAc	p.S1759Y	COL11A1_ENST00000353414.4_Splice_Site_p.S1720Y|COL11A1_ENST00000358392.2_Splice_Site_p.S1771Y|COL11A1_ENST00000512756.1_Splice_Site_p.S1643Y	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1759	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCCTTTTCTGGACTGTAAAAT	0.308																																					p.S1771Y		.											.	COL11A1	586	0			c.C5312A						.						66.0	61.0	62.0					1																	103343720		2203	4300	6503	SO:0001630	splice_region_variant	1301	exon67			TTTCTGGACTGTA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.5275-1C>A	1.37:g.103343720G>T		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	14.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	6.270	0.418019	0.11870	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	5.36	5.36	0.76844	Fibrillar collagen, C-terminal (4);	0.335856	0.32918	N	0.005489	T	0.54415	0.1857	L	0.34521	1.04	0.39274	D	0.964436	P;P;P;P;P	0.48503	0.794;0.846;0.911;0.873;0.755	P;B;B;P;B	0.45998	0.5;0.367;0.367;0.5;0.367	T	0.53005	-0.8499	10	0.16420	T	0.52	.	12.575	0.56359	0.0752:0.0:0.9248:0.0	.	1643;1720;1771;1759;979	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	Y	1759;1771;1720;979;1643	ENSP00000359114:S1759Y;ENSP00000351163:S1771Y;ENSP00000302551:S1720Y;ENSP00000426533:S1643Y	ENSP00000302551:S1720Y	S	-	2	0	COL11A1	103116308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.779000	0.62375	2.774000	0.95407	0.655000	0.94253	TCC	.		0.308	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Missense_Mutation
COL11A1	1301	broad.mit.edu;bcgsc.ca	37	1	103481238	103481238	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:103481238T>C	ENST00000370096.3	-	12	1786	c.1474A>G	c.(1474-1476)Atg>Gtg	p.M492V	COL11A1_ENST00000353414.4_Missense_Mutation_p.M453V|COL11A1_ENST00000358392.2_Missense_Mutation_p.M504V|COL11A1_ENST00000512756.1_Missense_Mutation_p.M376V	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	492	Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AACATCAACATAGTACCAGGA	0.373																																					p.M504V		.											.	COL11A1	586	0			c.A1510G						.						37.0	36.0	36.0					1																	103481238		2203	4297	6500	SO:0001583	missense	1301	exon12			TCAACATAGTACC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1474A>G	1.37:g.103481238T>C	ENSP00000359114:p.Met492Val	Somatic	223.0	1.0		WXS	Illumina HiSeq	Phase_I	260.0	13.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	7.024	0.559290	0.13436	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.87103	-2.21;-2.21;-2.18;-2.21;-1.94	5.35	5.35	0.76521	.	0.042205	0.85682	D	0.000000	T	0.54791	0.1880	N	0.02674	-0.535	0.58432	D	0.999999	B;P;P;P	0.36753	0.203;0.512;0.512;0.568	B;B;B;B	0.39503	0.112;0.199;0.199;0.301	T	0.69540	-0.5118	10	0.02654	T	1	.	15.0096	0.71539	0.0:0.0:0.0:1.0	.	376;453;504;492	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	V	492;504;453;376;504	ENSP00000359114:M492V;ENSP00000351163:M504V;ENSP00000302551:M453V;ENSP00000426533:M376V;ENSP00000408640:M504V	ENSP00000302551:M453V	M	-	1	0	COL11A1	103253826	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.045000	0.49838	2.031000	0.59945	0.477000	0.44152	ATG	.		0.373	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
COL15A1	1306	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	101829192	101829192	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:101829192T>C	ENST00000375001.3	+	40	4103	c.3680T>C	c.(3679-3681)tTt>tCt	p.F1227S		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1227	Nonhelical region 10 (NC10).			F -> V (in Ref. 2; AAC78500). {ECO:0000305}.	angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				AACATGCCATTTTCTGGGGAC	0.473																																					p.F1227S		.											.	COL15A1	96	0			c.T3680C						.						126.0	116.0	119.0					9																	101829192		2203	4300	6503	SO:0001583	missense	1306	exon40			TGCCATTTTCTGG	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3680T>C	9.37:g.101829192T>C	ENSP00000364140:p.Phe1227Ser	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	8.0	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.467180	0.43839	.	.	ENSG00000204291	ENST00000375001	T	0.42131	0.98	5.85	5.85	0.93711	Collagenase NC10/endostatin (1);C-type lectin fold (1);C-type lectin-like (1);	0.424146	0.26331	N	0.024982	T	0.40839	0.1133	L	0.40543	1.245	0.40715	D	0.982609	P	0.47191	0.891	P	0.45829	0.494	T	0.18999	-1.0319	10	0.27082	T	0.32	-0.466	15.2242	0.73336	0.0:0.0:0.0:1.0	.	1227	P39059	COFA1_HUMAN	S	1227	ENSP00000364140:F1227S	ENSP00000364140:F1227S	F	+	2	0	COL15A1	100869013	0.031000	0.19500	0.816000	0.32577	0.991000	0.79684	1.577000	0.36515	2.229000	0.72834	0.533000	0.62120	TTT	.		0.473	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	
CPOX	1371	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	98304402	98304402	+	Missense_Mutation	SNP	C	C	A	rs376372510		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:98304402C>A	ENST00000264193.2	-	5	1273	c.1055G>T	c.(1054-1056)cGc>cTc	p.R352L		NM_000097.5	NP_000088.3	P36551	HEM6_HUMAN	coproporphyrinogen oxidase	352			R -> C (in dbSNP:rs11921054).		heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to arsenic-containing substance (GO:0046685)|response to insecticide (GO:0017085)|response to iron ion (GO:0010039)|response to lead ion (GO:0010288)|response to methylmercury (GO:0051597)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	coproporphyrinogen oxidase activity (GO:0004109)|protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)	16						CTGTACAAAGCGAAACACCTC	0.493																																					p.R352L	Esophageal Squamous(75;7 1223 22300 43648 48951)	.											.	CPOX	90	0			c.G1055T						.						146.0	154.0	151.0					3																	98304402		2203	4300	6503	SO:0001583	missense	1371	exon5			ACAAAGCGAAACA	BC017210	CCDS2932.1	3q12	2012-10-02		2004-01-30		ENSG00000080819	1.3.3.3		2321	protein-coding gene	gene with protein product	"""coproporphyria"""	612732	"""coproporphyrinogen oxidase (coproporphyria, harderoporphyria)"""	CPO		7757079, 8407975	Standard	NM_000097		Approved	CPX, HCP	uc003dsx.3	P36551		ENST00000264193.2:c.1055G>T	3.37:g.98304402C>A	ENSP00000264193:p.Arg352Leu	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	6.0	NM_000097	A8K275|B4DSD5|Q14060|Q53F08|Q8IZ45|Q96AF3	Missense_Mutation	SNP	ENST00000264193.2	37	CCDS2932.1	.	.	.	.	.	.	.	.	.	.	C	11.81	1.748911	0.30955	.	.	ENSG00000080819	ENST00000264193	D	0.93076	-3.16	6.02	-0.235	0.13071	.	0.653267	0.17123	N	0.186157	D	0.85283	0.5661	L	0.35644	1.08	0.09310	N	1	B	0.21688	0.059	B	0.25614	0.062	T	0.70673	-0.4807	9	.	.	.	-0.1805	1.7751	0.03020	0.1303:0.3614:0.127:0.3813	.	352	P36551	HEM6_HUMAN	L	352	ENSP00000264193:R352L	.	R	-	2	0	CPOX	99787092	0.939000	0.31865	0.698000	0.30274	0.737000	0.42083	0.500000	0.22562	0.095000	0.17434	-0.136000	0.14681	CGC	.		0.493	CPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358900.1	NM_000097	
CRCP	27297	ucsc.edu;bcgsc.ca	37	7	65617296	65617296	+	Silent	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:65617296G>A	ENST00000395326.3	+	6	757	c.399G>A	c.(397-399)aaG>aaA	p.K133K	CRCP_ENST00000431089.2_Silent_p.K126K|CRCP_ENST00000492264.1_3'UTR|CRCP_ENST00000338592.5_Silent_p.K100K|CRCP_ENST00000398684.2_Silent_p.K56K|CRCP_ENST00000415001.2_Silent_p.K100K|RP5-1132H15.1_ENST00000435524.2_RNA	NM_014478.4	NP_055293.1	O75575	RPC9_HUMAN	CGRP receptor component	133					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|neuropeptide signaling pathway (GO:0007218)|transcription from RNA polymerase III promoter (GO:0006383)	acrosomal vesicle (GO:0001669)|DNA polymerase III complex (GO:0009360)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcitonin gene-related polypeptide receptor activity (GO:0001635)|DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)			cervix(1)|kidney(1)|lung(4)	6						CTGAGCAGAAGAAGAATACAA	0.552																																					p.K133K		.											.	CRCP	90	0			c.G399A						.						80.0	68.0	72.0					7																	65617296		2203	4300	6503	SO:0001819	synonymous_variant	27297	exon6			GCAGAAGAAGAAT	AF073792	CCDS5532.1, CCDS47599.1, CCDS47600.1, CCDS55116.1	7q11.1	2009-01-14			ENSG00000241258	ENSG00000241258			17888	protein-coding gene	gene with protein product	"""calcitonin gene-related peptide-receptor component protein"""	606121				8622957, 10067875, 12482973	Standard	NM_014478		Approved	CGRP-RCP, RCP, RCP9	uc011kdw.2	O75575	OTTHUMG00000129519	ENST00000395326.3:c.399G>A	7.37:g.65617296G>A		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_014478	A8MUZ4|A8MW23|B2R4H4|B4E198|Q3KRA3|Q5HYF1|Q8IXL4	Silent	SNP	ENST00000395326.3	37	CCDS5532.1																																																																																			.		0.552	CRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251697.2	NM_014478	
CSNK1A1L	122011	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	37678905	37678906	+	Frame_Shift_Ins	INS	-	-	T	rs568346753		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr13:37678905_37678906insT	ENST00000379800.3	-	1	897_898	c.488_489insA	c.(487-489)aagfs	p.K163fs		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	163	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TGTCTCTGTACTTTTTGGCCAA	0.421																																					p.K163fs		.											.	CSNK1A1L	396	0			c.489_490insA						.																																			SO:0001589	frameshift_variant	122011	exon1			TCTGTACTTTTTG	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.489dupA	13.37:g.37678910_37678910dupT	ENSP00000369126:p.Lys163fs	Somatic	323.0	0.0		WXS	Illumina HiSeq	Phase_I	286.0	43.0	NM_145203	Q5T2N2	Frame_Shift_Ins	INS	ENST00000379800.3	37	CCDS9363.1																																																																																			.		0.421	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
CUX1	1523	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	101671397	101671397	+	Missense_Mutation	SNP	C	C	T	rs143267032	byFrequency	TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:101671397C>T	ENST00000292535.7	+	3	199	c.161C>T	c.(160-162)gCg>gTg	p.A54V	CUX1_ENST00000393824.3_Missense_Mutation_p.A28V|CUX1_ENST00000556210.1_Missense_Mutation_p.A54V|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000292538.4_Missense_Mutation_p.A65V|CUX1_ENST00000360264.3_Missense_Mutation_p.A65V|CUX1_ENST00000437600.4_Missense_Mutation_p.A65V|CUX1_ENST00000546411.2_Missense_Mutation_p.A54V|CUX1_ENST00000425244.2_Missense_Mutation_p.A65V|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.A54V|CUX1_ENST00000549414.2_Missense_Mutation_p.A54V	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	54					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AAGCAGGTAGCGCCGCTGCTG	0.468																																					p.A65V		.											.	CUX1	160	0			c.C194T						.						76.0	73.0	74.0					7																	101671397		2203	4300	6503	SO:0001583	missense	1523	exon3			AGGTAGCGCCGCT	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.161C>T	7.37:g.101671397C>T	ENSP00000292535:p.Ala54Val	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	9.0	NM_181500	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.813938	0.70912	.	.	ENSG00000257923	ENST00000292538;ENST00000360264;ENST00000393824;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91;1.91;1.91;1.91	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.47135	0.1429	L	0.47016	1.485	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	0.996;0.999;0.998;1.0;0.982;0.999	P;D;P;D;P;D	0.78314	0.642;0.98;0.833;0.946;0.46;0.991	T	0.21965	-1.0230	10	0.49607	T	0.09	-16.3043	19.924	0.97098	0.0:1.0:0.0:0.0	.	28;54;65;65;65;65	B4DZZ2;P39880;B3KV79;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;CASP_HUMAN;.	V	65;65;65;65;65;54;54;54;54;54	ENSP00000292538:A65V;ENSP00000353401:A65V;ENSP00000409745:A65V;ENSP00000414091:A65V;ENSP00000292535:A54V;ENSP00000446630:A54V;ENSP00000447373:A54V;ENSP00000450125:A54V;ENSP00000451558:A54V	ENSP00000292535:A54V	A	+	2	0	CUX1	101458117	0.998000	0.40836	0.970000	0.41538	0.982000	0.71751	5.022000	0.64078	2.790000	0.95986	0.591000	0.81541	GCG	C|1.000;G|0.000		0.468	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
CYB5R1	51706	ucsc.edu;bcgsc.ca	37	1	202935660	202935660	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:202935660A>G	ENST00000367249.4	-	3	308	c.234T>C	c.(232-234)ccT>ccC	p.P78P	CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	78	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	CCTTACCCACAGGCAGCCCCA	0.572																																					p.P78P		.											.	CYB5R1	91	0			c.T234C						.						89.0	75.0	80.0					1																	202935660		2203	4300	6503	SO:0001819	synonymous_variant	51706	exon3			ACCCACAGGCAGC	AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.234T>C	1.37:g.202935660A>G		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_016243	A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Silent	SNP	ENST00000367249.4	37	CCDS1431.1	.	.	.	.	.	.	.	.	.	.	A	13.67	2.307168	0.40795	.	.	ENSG00000159348	ENST00000446185	.	.	.	5.95	-1.99	0.07457	.	.	.	.	.	T	0.42177	0.1191	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31668	-0.9935	4	.	.	.	-3.7653	3.3971	0.07310	0.3468:0.0:0.2549:0.3983	.	.	.	.	P	10	.	.	L	-	2	0	CYB5R1	201202283	0.926000	0.31397	0.997000	0.53966	0.999000	0.98932	0.157000	0.16402	-0.118000	0.11851	0.533000	0.62120	CTG	.		0.572	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099155.1	NM_016243	
CYP2A13	1553	ucsc.edu;bcgsc.ca	37	19	41595994	41595994	+	Missense_Mutation	SNP	G	G	A	rs138225940	byFrequency	TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:41595994G>A	ENST00000330436.3	+	3	386	c.386G>A	c.(385-387)cGc>cAc	p.R129H		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	129					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CAGCTCCGGCGCTTCTCCATC	0.706																																					p.R129H		.											.	CYP2A13	93	0			c.G386A						.						19.0	20.0	20.0					19																	41595994		2201	4297	6498	SO:0001583	missense	1553	exon3			TCCGGCGCTTCTC	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.386G>A	19.37:g.41595994G>A	ENSP00000332679:p.Arg129His	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	10.12	1.262651	0.23051	.	.	ENSG00000197838	ENST00000330436	T	0.01560	4.77	3.43	1.22	0.21188	.	0.000000	0.85682	U	0.000000	T	0.03739	0.0106	M	0.84082	2.675	0.31188	N	0.701244	B	0.31054	0.306	B	0.33042	0.157	T	0.02004	-1.1231	10	0.59425	D	0.04	.	9.2439	0.37513	0.1717:0.0:0.8283:0.0	.	129	Q16696	CP2AD_HUMAN	H	129	ENSP00000332679:R129H	ENSP00000332679:R129H	R	+	2	0	CYP2A13	46287834	0.260000	0.24053	0.899000	0.35326	0.002000	0.02628	2.802000	0.47916	0.275000	0.22094	-2.332000	0.00249	CGC	G|0.999;C|0.001		0.706	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
DDB2	1643	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	47256456	47256456	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:47256456C>A	ENST00000256996.4	+	6	1046	c.851C>A	c.(850-852)tCg>tAg	p.S284*	DDB2_ENST00000378601.3_Intron|DDB2_ENST00000378603.3_Nonsense_Mutation_p.S220*|DDB2_ENST00000378600.3_Intron	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	284					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						TTCCTCTACTCGCTGCCGCAC	0.557			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.S284X		.	yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	.	DDB2	971	0			c.C851A						.						44.0	44.0	44.0					11																	47256456		2201	4298	6499	SO:0001587	stop_gained	1643	exon6	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	TCTACTCGCTGCC		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.851C>A	11.37:g.47256456C>A	ENSP00000256996:p.Ser284*	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	11.0	NM_000107	B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Nonsense_Mutation	SNP	ENST00000256996.4	37	CCDS7927.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723870	0.89298	.	.	ENSG00000134574	ENST00000256996;ENST00000378603	.	.	.	5.57	3.62	0.41486	.	0.557698	0.19839	N	0.104896	.	.	.	.	.	.	0.20403	N	0.999906	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-24.607	3.9271	0.09269	0.1527:0.5671:0.1689:0.1113	.	.	.	.	X	284;220	.	ENSP00000256996:S284X	S	+	2	0	DDB2	47213032	0.721000	0.28007	0.872000	0.34217	0.997000	0.91878	1.900000	0.39828	2.618000	0.88619	0.563000	0.77884	TCG	.		0.557	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000107	
DHX16	8449	ucsc.edu;bcgsc.ca	37	6	30633483	30633483	+	Silent	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:30633483G>T	ENST00000376442.3	-	5	889	c.694C>A	c.(694-696)Cga>Aga	p.R232R		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	232					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						AGGTACTCTCGGCGAGATTTC	0.572																																					p.R232R		.											.	DHX16	228	0			c.C694A						.						75.0	77.0	76.0					6																	30633483		1510	2709	4219	SO:0001819	synonymous_variant	8449	exon5			ACTCTCGGCGAGA	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.694C>A	6.37:g.30633483G>T		Somatic	21.0	0.0		WXS	Illumina HiSeq	.	16.0	4.0	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	CCDS4685.1																																																																																			.		0.572	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
DNAH10	196385	ucsc.edu;bcgsc.ca	37	12	124341692	124341692	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:124341692T>C	ENST00000409039.3	+	36	6199	c.6174T>C	c.(6172-6174)gaT>gaC	p.D2058D		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2058					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGATTTCGGATCTGTTTCCTG	0.542																																					p.D2058D		.											.	DNAH10	95	0			c.T6174C						.						171.0	176.0	174.0					12																	124341692		2054	4198	6252	SO:0001819	synonymous_variant	196385	exon36			TTCGGATCTGTTT	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6174T>C	12.37:g.124341692T>C		Somatic	46.0	0.0		WXS	Illumina HiSeq	.	46.0	5.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																			.		0.542	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
CDCA7L	55536	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	21940749	21940749	+	3'UTR	SNP	C	C	T	rs530934832		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:21940749C>T	ENST00000406877.3	-	0	2835				CDCA7L_ENST00000356195.5_3'UTR|DNAH11_ENST00000409508.3_Silent_p.Y4476Y|DNAH11_ENST00000328843.6_Silent_p.Y4483Y	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like						positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						AACAGACCTACGAGTGCCCTG	0.532																																					.		.											.	DNAH11	146	0			.						.						80.0	84.0	83.0					7																	21940749		1896	4112	6008	SO:0001624	3_prime_UTR_variant	8701	.			GACCTACGAGTGC		CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.*1191G>A	7.37:g.21940749C>T		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	8.0	.	A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Silent	SNP	ENST00000406877.3	37	CCDS5374.1																																																																																			.		0.532	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250218.4	NM_018719	
DNAH1	25981	ucsc.edu;bcgsc.ca	37	3	52388935	52388935	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:52388935T>C	ENST00000420323.2	+	21	3818	c.3557T>C	c.(3556-3558)aTc>aCc	p.I1186T		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1186	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GACACCTACATCCTGAAGAGC	0.562																																					p.I1186T		.											.	DNAH1	67	0			c.T3557C						.						95.0	101.0	99.0					3																	52388935		2101	4212	6313	SO:0001583	missense	25981	exon21			CCTACATCCTGAA	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.3557T>C	3.37:g.52388935T>C	ENSP00000401514:p.Ile1186Thr	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.001813	0.74932	.	.	ENSG00000114841	ENST00000420323	T	0.63580	-0.05	5.29	5.29	0.74685	.	0.131543	0.34025	N	0.004326	D	0.83876	0.5349	M	0.93854	3.465	0.51767	D	0.999934	D	0.89917	1.0	D	0.79784	0.993	D	0.88178	0.2869	10	0.66056	D	0.02	.	15.2048	0.73169	0.0:0.0:0.0:1.0	.	1186	C9JXH6	.	T	1186	ENSP00000401514:I1186T	ENSP00000401514:I1186T	I	+	2	0	DNAH1	52363975	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.195000	0.72088	2.006000	0.58801	0.379000	0.24179	ATC	.		0.562	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
DNAH5	1767	broad.mit.edu;bcgsc.ca	37	5	13716732	13716732	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr5:13716732T>C	ENST00000265104.4	-	74	12877	c.12773A>G	c.(12772-12774)gAc>gGc	p.D4258G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4258					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTTATCATAGTCGTCAGTGAC	0.373									Kartagener syndrome																												p.D4258G		.											.	DNAH5	182	0			c.A12773G						.						120.0	105.0	110.0					5																	13716732		2203	4300	6503	SO:0001583	missense	1767	exon74	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TCATAGTCGTCAG	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12773A>G	5.37:g.13716732T>C	ENSP00000265104:p.Asp4258Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	8.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	19.75	3.886174	0.72410	.	.	ENSG00000039139	ENST00000265104	T	0.10382	2.88	5.53	5.53	0.82687	Dynein heavy chain (1);	0.049060	0.85682	D	0.000000	T	0.38374	0.1038	M	0.91561	3.22	0.80722	D	1	P	0.41624	0.757	P	0.55615	0.78	T	0.37865	-0.9687	10	0.56958	D	0.05	.	15.682	0.77376	0.0:0.0:0.0:1.0	.	4258	Q8TE73	DYH5_HUMAN	G	4258	ENSP00000265104:D4258G	ENSP00000265104:D4258G	D	-	2	0	DNAH5	13769732	1.000000	0.71417	0.998000	0.56505	0.402000	0.30811	8.020000	0.88740	2.112000	0.64535	0.528000	0.53228	GAC	.		0.373	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DNAH8	1769	broad.mit.edu;bcgsc.ca	37	6	38899596	38899596	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:38899596G>T	ENST00000359357.3	+	74	10887	c.10633G>T	c.(10633-10635)Ggt>Tgt	p.G3545C	DNAH8_ENST00000441566.1_Missense_Mutation_p.G3509C|RP1-207H1.3_ENST00000418399.1_RNA|RP1-207H1.3_ENST00000453417.1_RNA|RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000449981.2_Missense_Mutation_p.G3762C			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3545	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GGTGAAAGTCGGTGATAAGGA	0.348																																					p.G3762C		.											.	DNAH8	615	0			c.G11284T						.						140.0	147.0	144.0					6																	38899596		2203	4299	6502	SO:0001583	missense	1769	exon76			AAAGTCGGTGATA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.10633G>T	6.37:g.38899596G>T	ENSP00000352312:p.Gly3545Cys	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	8.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	25.0	4.595029	0.86953	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.38240	1.15;1.15;1.15	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.77928	0.4204	H	0.99770	4.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87457	0.2405	10	0.87932	D	0	.	20.2786	0.98501	0.0:0.0:1.0:0.0	.	3545	Q96JB1	DYH8_HUMAN	C	3750;3750;3545;3509	ENSP00000333363:G3750C;ENSP00000352312:G3545C;ENSP00000402294:G3509C	ENSP00000333363:G3750C	G	+	1	0	DNAH8	39007574	1.000000	0.71417	0.981000	0.43875	0.894000	0.52154	9.406000	0.97321	2.868000	0.98415	0.557000	0.71058	GGT	.		0.348	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DNAJC24	120526	broad.mit.edu;bcgsc.ca	37	11	31436406	31436406	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:31436406G>A	ENST00000465995.1	+	3	266	c.160G>A	c.(160-162)Gaa>Aaa	p.E54K	DNAJC24_ENST00000536040.1_Missense_Mutation_p.E53K	NM_181706.4	NP_859057.4	Q6P3W2	DJC24_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 24	53	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone-mediated protein folding (GO:0061077)|oxidation-reduction process (GO:0055114)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|positive regulation of ATPase activity (GO:0032781)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATPase activator activity (GO:0001671)|ferrous iron binding (GO:0008198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|skin(1)|upper_aerodigestive_tract(2)	11						AACAGTGGAGGAATGTGTACA	0.448																																					p.E54K		.											.	DNAJC24	153	0			c.G160A						.						102.0	100.0	101.0					11																	31436406		1944	4157	6101	SO:0001583	missense	120526	exon3			GTGGAGGAATGTG	AL833128	CCDS7873.2	11p14.1	2011-09-02	2008-07-03	2008-07-03	ENSG00000170946	ENSG00000170946		"""Heat shock proteins / DNAJ (HSP40)"""	26979	protein-coding gene	gene with protein product		611072	"""zinc finger, CSL-type containing 3"", ""DPH4 homolog (JJJ3, S. cerevisiae)"", ""DPH4, JJJ3 homolog (S. cerevisiae)"""	ZCSL3, DPH4		15485916	Standard	NM_181706		Approved	JJJ3	uc001msx.3	Q6P3W2	OTTHUMG00000133712	ENST00000465995.1:c.160G>A	11.37:g.31436406G>A	ENSP00000417548:p.Glu54Lys	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	10.0	NM_181706	A8K0V0|B1ALC1|I6L9B4	Missense_Mutation	SNP	ENST00000465995.1	37	CCDS7873.2	.	.	.	.	.	.	.	.	.	.	G	13.19	2.163082	0.38217	.	.	ENSG00000170946	ENST00000465995;ENST00000536040	T;T	0.32515	1.45;1.45	6.17	4.22	0.49857	Heat shock protein DnaJ, N-terminal (5);	0.240776	0.43579	N	0.000548	T	0.28863	0.0716	L	0.28504	0.86	0.45464	D	0.998436	P;P	0.44309	0.517;0.832	B;P	0.46510	0.229;0.519	T	0.02539	-1.1144	10	0.52906	T	0.07	.	11.4471	0.50129	0.0704:0.1239:0.8057:0.0	.	53;54	Q6P3W2;D3DQZ6	DJC24_HUMAN;.	K	54;53	ENSP00000417548:E54K;ENSP00000444967:E53K	ENSP00000417548:E54K	E	+	1	0	DNAJC24	31392982	1.000000	0.71417	0.924000	0.36721	0.000000	0.00434	3.769000	0.55303	0.850000	0.35239	-1.058000	0.02302	GAA	.		0.448	DNAJC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258011.3	NM_181706	
DOK7	285489	ucsc.edu;bcgsc.ca	37	4	3491480	3491480	+	Silent	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr4:3491480G>A	ENST00000340083.5	+	6	794	c.729G>A	c.(727-729)aaG>aaA	p.K243K	DOK7_ENST00000507039.1_Missense_Mutation_p.A240T|DOK7_ENST00000389653.2_Silent_p.K243K	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	243					neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		AGCTGGAGAAGCGGCTGAGCC	0.672																																					p.A240T		.											.	DOK7	91	0			c.G718A						.						26.0	25.0	25.0					4																	3491480		2168	4285	6453	SO:0001819	synonymous_variant	285489	exon6			GGAGAAGCGGCTG	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.729G>A	4.37:g.3491480G>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_001164673	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681723	0.29872	.	.	ENSG00000175920	ENST00000507039	D	0.92495	-3.05	3.45	2.6	0.31112	.	.	.	.	.	D	0.93207	0.7836	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.92087	0.5677	6	0.87932	D	0	-19.1733	9.365	0.38219	0.1075:0.0:0.8925:0.0	.	.	.	.	T	240	ENSP00000423614:A240T	ENSP00000423614:A240T	A	+	1	0	DOK7	3461278	1.000000	0.71417	0.999000	0.59377	0.690000	0.40134	1.523000	0.35932	0.645000	0.30675	0.457000	0.33378	GCG	.		0.672	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
DPAGT1	1798	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118967763	118967763	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:118967763C>T	ENST00000409993.2	-	11	2723	c.1172G>A	c.(1171-1173)aGt>aAt	p.S391N	DPAGT1_ENST00000432443.2_Missense_Mutation_p.S310N|H2AFX_ENST00000530167.1_5'Flank|DPAGT1_ENST00000354202.4_Missense_Mutation_p.S391N			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	391					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		GGTGATGGCACTGCCCAGGAT	0.493																																					p.S391N		.											.	DPAGT1	221	0			c.G1172A						.						145.0	132.0	137.0					11																	118967763		2200	4295	6495	SO:0001583	missense	1798	exon9			ATGGCACTGCCCA	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.1172G>A	11.37:g.118967763C>T	ENSP00000386597:p.Ser391Asn	Somatic	117.0	1.0		WXS	Illumina HiSeq	Phase_I	110.0	12.0	NM_001382	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	37	CCDS8411.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350533	0.82132	.	.	ENSG00000172269	ENST00000409993;ENST00000354202;ENST00000432443	D;D;D	0.94828	-3.04;-3.04;-3.53	5.38	5.38	0.77491	.	0.038880	0.85682	D	0.000000	D	0.96914	0.8992	M	0.83953	2.67	0.80722	D	1	D;P	0.58970	0.984;0.758	P;B	0.61477	0.889;0.318	D	0.96834	0.9613	10	0.56958	D	0.05	-7.4418	16.4525	0.83996	0.0:1.0:0.0:0.0	.	310;391	E7EW40;Q9H3H5	.;GPT_HUMAN	N	391;391;310	ENSP00000386597:S391N;ENSP00000346142:S391N;ENSP00000404036:S310N	ENSP00000346142:S391N	S	-	2	0	DPAGT1	118472973	1.000000	0.71417	0.993000	0.49108	0.820000	0.46376	7.339000	0.79282	2.793000	0.96121	0.655000	0.94253	AGT	.		0.493	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382	
DPP6	1804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	154645528	154645528	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:154645528G>T	ENST00000377770.3	+	17	1846	c.1705G>T	c.(1705-1707)Gat>Tat	p.D569Y	DPP6_ENST00000427557.1_Missense_Mutation_p.D462Y|RP11-476H24.1_ENST00000448767.1_RNA|DPP6_ENST00000332007.3_Missense_Mutation_p.D507Y|DPP6_ENST00000404039.1_Missense_Mutation_p.D505Y			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	569					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CAACACAACAGATAAGAAAAG	0.428																																					p.D569Y	NSCLC(125;1384 1783 2490 7422 34254)	.											.	DPP6	652	0			c.G1705T						.						170.0	152.0	158.0					7																	154645528		1876	4110	5986	SO:0001583	missense	1804	exon17			ACAACAGATAAGA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1705G>T	7.37:g.154645528G>T	ENSP00000367001:p.Asp569Tyr	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	41.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	37		.	.	.	.	.	.	.	.	.	.	G	8.809	0.934762	0.18206	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.47	4.47	0.54385	.	0.540503	0.21329	N	0.076326	T	0.32436	0.0829	L	0.59436	1.845	0.48830	D	0.999715	B;B;B;B	0.18013	0.025;0.005;0.002;0.003	B;B;B;B	0.21151	0.033;0.006;0.004;0.003	T	0.12708	-1.0537	10	0.45353	T	0.12	-7.4579	14.1935	0.65654	0.0:0.0:1.0:0.0	.	462;507;569;505	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	Y	505;569;507;462	ENSP00000385578:D505Y;ENSP00000367001:D569Y;ENSP00000328226:D507Y;ENSP00000397303:D462Y	ENSP00000328226:D507Y	D	+	1	0	DPP6	154276461	0.971000	0.33674	0.830000	0.32933	0.141000	0.21300	4.143000	0.58051	2.158000	0.67659	0.655000	0.94253	GAT	.		0.428	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
DSC2	1824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	28648117	28648117	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr18:28648117T>C	ENST00000280904.6	-	16	3013	c.2570A>G	c.(2569-2571)tAt>tGt	p.Y857C	DSC2_ENST00000251081.6_3'UTR	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	857					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TTCATAGTTATATGTCAGGAC	0.393																																					p.Y857C		.											.	DSC2	517	0			c.A2570G						.						96.0	85.0	89.0					18																	28648117		2203	4300	6503	SO:0001583	missense	1824	exon16			TAGTTATATGTCA	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2570A>G	18.37:g.28648117T>C	ENSP00000280904:p.Tyr857Cys	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	30.0	NM_024422		Missense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.525070	0.44969	.	.	ENSG00000134755	ENST00000280904;ENST00000438199;ENST00000399347	D	0.87809	-2.3	5.87	5.87	0.94306	Cadherin, cytoplasmic domain (1);	0.000000	0.29838	N	0.011069	D	0.95127	0.8421	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96037	0.9021	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	857	Q02487	DSC2_HUMAN	C	857;623;870	ENSP00000280904:Y857C	ENSP00000280904:Y857C	Y	-	2	0	DSC2	26902115	1.000000	0.71417	0.061000	0.19648	0.028000	0.11728	3.815000	0.55651	2.371000	0.80710	0.533000	0.62120	TAT	.		0.393	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
EEF1A1	1915	broad.mit.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	74227627	74227628	+	Missense_Mutation	DNP	GT	GT	AA			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G|T	G|T	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:74227627_74227628GT>AA	ENST00000316292.9	-	7	2285_2286	c.1294_1295AC>TT	c.(1294-1296)ACa>TTa	p.T432L	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Missense_Mutation_p.T432L|EEF1A1_ENST00000309268.6_Missense_Mutation_p.T432L	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	432					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						CACCGCAACTGTCTGTCTCATA	0.401											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T432I|p.T432S		.											.	EEF1A1	226	0			c.C1295T|c.A1294T						.																																			SO:0001583	missense	1915	exon8			GCAACTGTCTGTC|CAACTGTCTGTCT	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1294_1295delinsAA	6.37:g.74227627_74227628delinsAA	ENSP00000339063:p.Thr432Leu	Somatic	84.0	0.0	1151	WXS	Illumina HiSeq	Phase_I	113.0	16.0|18.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	37	CCDS4980.1																																																																																			.		0.401	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
EFHB	151651	ucsc.edu;bcgsc.ca	37	3	19962061	19962061	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:19962061T>C	ENST00000295824.9	-	2	951		c.e2-2		EFHB_ENST00000498089.1_Splice_Site|EFHB_ENST00000344838.4_Splice_Site	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B								calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						TTTTCCTGCCTTTGGGGGAAA	0.388																																					.		.											.	EFHB	22	0			c.790-2A>G						.						72.0	73.0	72.0					3																	19962061		2203	4300	6503	SO:0001630	splice_region_variant	151651	exon3			CCTGCCTTTGGGG	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.790-2A>G	3.37:g.19962061T>C		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	39.0	5.0	NM_144715	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Splice_Site	SNP	ENST00000295824.9	37	CCDS33715.2	.	.	.	.	.	.	.	.	.	.	T	17.35	3.367966	0.61513	.	.	ENSG00000163576	ENST00000295824;ENST00000344838;ENST00000389256	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.594	0.61978	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EFHB	19937065	1.000000	0.71417	0.984000	0.44739	0.752000	0.42762	4.959000	0.63666	2.194000	0.70268	0.533000	0.62120	.	.		0.388	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715	Intron
EIF1AD	84285	ucsc.edu;bcgsc.ca	37	11	65766855	65766855	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:65766855A>G	ENST00000312234.2	-	5	653	c.319T>C	c.(319-321)Tct>Cct	p.S107P	EIF1AD_ENST00000526451.1_Missense_Mutation_p.S107P|EIF1AD_ENST00000533544.1_Missense_Mutation_p.S107P|EIF1AD_ENST00000527249.1_Missense_Mutation_p.S107P|BANF1_ENST00000445560.2_5'Flank|BANF1_ENST00000312175.2_5'Flank|EIF1AD_ENST00000529964.1_Missense_Mutation_p.S107P|EIF1AD_ENST00000525767.1_Missense_Mutation_p.S55P	NM_001242481.1|NM_001242482.1|NM_001242483.1|NM_032325.3	NP_001229410.1|NP_001229411.1|NP_001229412.1|NP_115701.2	Q8N9N8	EIF1A_HUMAN	eukaryotic translation initiation factor 1A domain containing	107						intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	translation initiation factor activity (GO:0003743)			lung(5)	5						GCCACTTCAGAGAAGGCCTCA	0.498																																					p.S107P		.											.	EIF1AD	68	0			c.T319C						.						312.0	303.0	306.0					11																	65766855		2201	4296	6497	SO:0001583	missense	84285	exon5			CTTCAGAGAAGGC	AK094129	CCDS8124.1	11q13.1	2009-05-27				ENSG00000175376			28147	protein-coding gene	gene with protein product						12477932	Standard	NM_001242482		Approved	MGC11102, haponin	uc001ogn.2	Q8N9N8		ENST00000312234.2:c.319T>C	11.37:g.65766855A>G	ENSP00000309175:p.Ser107Pro	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001242483	B2R4N5|Q9BSC1	Missense_Mutation	SNP	ENST00000312234.2	37	CCDS8124.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.638840	0.47153	.	.	ENSG00000175376	ENST00000526451;ENST00000312234;ENST00000525767;ENST00000529964;ENST00000533544;ENST00000527249;ENST00000530462;ENST00000532707	T;T;T;T;T;T;T;T	0.44881	1.51;1.51;0.91;0.91;1.51;1.51;0.96;0.96	4.66	4.66	0.58398	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.291563	0.33457	N	0.004887	T	0.33644	0.0870	L	0.60455	1.87	0.36029	D	0.839242	P	0.45768	0.866	B	0.33521	0.165	T	0.51212	-0.8734	10	0.46703	T	0.11	.	10.5038	0.44821	1.0:0.0:0.0:0.0	.	107	Q8N9N8	EIF1A_HUMAN	P	107;107;55;107;107;107;107;107	ENSP00000436644:S107P;ENSP00000309175:S107P;ENSP00000434796:S55P;ENSP00000435942:S107P;ENSP00000434056:S107P;ENSP00000435439:S107P;ENSP00000435891:S107P;ENSP00000433320:S107P	ENSP00000309175:S107P	S	-	1	0	EIF1AD	65523431	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.213000	0.58520	1.731000	0.51592	0.379000	0.24179	TCT	.		0.498	EIF1AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391072.1	NM_032325	
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	79356902	79356902	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:79356902C>T	ENST00000370742.3	-	15	2074		c.e15-1			NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CTTCTTGAATCTAAAAATTAA	0.259																																					.		.											.	ELTD1	24	0			c.2011-1G>A						.						58.0	53.0	54.0					1																	79356902		1783	4039	5822	SO:0001630	splice_region_variant	64123	exon16			TTGAATCTAAAAA	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.2011-1G>A	1.37:g.79356902C>T		Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	286.0	40.0	NM_022159	B1AR71|Q5KU34	Splice_Site	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.155873	0.38021	.	.	ENSG00000162618	ENST00000370742;ENST00000401034	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2948	0.87168	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ELTD1	79129490	1.000000	0.71417	0.997000	0.53966	0.336000	0.28762	6.835000	0.75344	2.516000	0.84829	0.655000	0.94253	.	.		0.259	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	Intron
ELK4	2005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	205588972	205588972	+	Intron	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:205588972C>T	ENST00000357992.4	-	3	1420				ELK4_ENST00000289703.4_Missense_Mutation_p.C401Y|ELK4_ENST00000468523.1_5'Flank	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)						cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GACAGTCACACATAACCTTTC	0.318			T	SLC45A3	prostate																																p.C401Y		.		Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	.	ELK4	658	0			c.G1202A						.						55.0	55.0	55.0					1																	205588972		2203	4300	6503	SO:0001627	intron_variant	2005	exon3			GTCACACATAACC	M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.1080+121G>A	1.37:g.205588972C>T		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	17.0	NM_021795	P28323|Q6GSJ2	Missense_Mutation	SNP	ENST00000357992.4	37	CCDS1456.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.670708	0.29693	.	.	ENSG00000158711	ENST00000289703	T	0.32515	1.45	5.42	-9.81	0.00487	.	.	.	.	.	T	0.15478	0.0373	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35500	-0.9786	8	0.87932	D	0	.	3.6076	0.08049	0.3214:0.4379:0.1162:0.1245	.	401	P28324-2	.	Y	401	ENSP00000289703:C401Y	ENSP00000289703:C401Y	C	-	2	0	ELK4	203855595	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.490000	0.06482	-1.803000	0.01242	-1.261000	0.01458	TGT	.		0.318	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	NM_021795	
FAM124B	79843	ucsc.edu;bcgsc.ca	37	2	225265789	225265789	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:225265789T>C	ENST00000409685.3	-	1	962	c.697A>G	c.(697-699)Act>Gct	p.T233A	FAM124B_ENST00000243806.2_Missense_Mutation_p.T233A|FAM124B_ENST00000389874.3_Missense_Mutation_p.T233A	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	233										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		TAGTCCTGAGTCTGCCACCTG	0.478																																					p.T233A		.											.	FAM124B	92	0			c.A697G						.						71.0	65.0	67.0					2																	225265789		2203	4300	6503	SO:0001583	missense	79843	exon1			CCTGAGTCTGCCA	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.697A>G	2.37:g.225265789T>C	ENSP00000386895:p.Thr233Ala	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_024785	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	ENST00000409685.3	37	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.945106	0.92593	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	T;T;T	0.53857	0.6;0.6;0.6	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.75917	0.3915	M	0.84433	2.695	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.80460	-0.1373	10	0.87932	D	0	-13.5927	15.9472	0.79803	0.0:0.0:0.0:1.0	.	233;233	Q9H5Z6;Q9H5Z6-2	F124B_HUMAN;.	A	233	ENSP00000374524:T233A;ENSP00000386895:T233A;ENSP00000243806:T233A	ENSP00000243806:T233A	T	-	1	0	FAM124B	224974033	1.000000	0.71417	0.988000	0.46212	0.997000	0.91878	7.698000	0.84413	2.161000	0.67846	0.533000	0.62120	ACT	.		0.478	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
ESPNL	339768	ucsc.edu;bcgsc.ca	37	2	239010582	239010582	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:239010582G>T	ENST00000343063.3	+	2	558	c.295G>T	c.(295-297)Gac>Tac	p.D99Y	ESPNL_ENST00000409169.1_Splice_Site_p.D99Y	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	99										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GGCTTGGTAGGACCAAGATGC	0.692																																					p.D99Y		.											.	ESPNL	69	0			c.G295T						.						16.0	18.0	17.0					2																	239010582		2197	4295	6492	SO:0001630	splice_region_variant	339768	exon2			TGGTAGGACCAAG	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.295-1G>T	2.37:g.239010582G>T		Somatic	47.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_194312	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669035	0.67814	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.62788	-0.0;0.67	4.45	4.45	0.53987	Ankyrin repeat-containing domain (3);	0.418766	0.19511	U	0.112508	T	0.78162	0.4240	M	0.79475	2.455	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.79669	-0.1707	9	.	.	.	-40.8339	14.0307	0.64613	0.0:0.0:1.0:0.0	.	99	Q6ZVH7	ESPNL_HUMAN	Y	99	ENSP00000339115:D99Y;ENSP00000386577:D99Y	.	D	+	1	0	ESPNL	238675321	1.000000	0.71417	0.998000	0.56505	0.718000	0.41266	6.958000	0.76025	2.039000	0.60335	0.484000	0.47621	GAC	.		0.692	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	Missense_Mutation
FAM169B	283777	ucsc.edu;bcgsc.ca	37	15	98995196	98995196	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr15:98995196A>G	ENST00000558256.1	-	5	477	c.228T>C	c.(226-228)ccT>ccC	p.P76P	FAM169B_ENST00000332908.4_Silent_p.P76P	NM_182562.2	NP_872368.2	Q8N8A8	F169B_HUMAN	family with sequence similarity 169, member B	76										large_intestine(3)|lung(3)|urinary_tract(1)	7						TGTCAAAGACAGGCAGCAGGT	0.592																																					p.P76P		.											.	.	.	0			c.T228C						.						72.0	78.0	76.0					15																	98995196		2099	4224	6323	SO:0001819	synonymous_variant	283777	exon5			AAAGACAGGCAGC		CCDS45360.1	15q26.3	2008-08-08			ENSG00000185087	ENSG00000185087			26835	protein-coding gene	gene with protein product							Standard	NM_182562		Approved	FLJ39743, KIAA0888L	uc002buk.1	Q8N8A8		ENST00000558256.1:c.228T>C	15.37:g.98995196A>G		Somatic	50.0	0.0		WXS	Illumina HiSeq	.	38.0	5.0	NM_182562	B5MDL8	Silent	SNP	ENST00000558256.1	37	CCDS45360.1																																																																																			.		0.592	FAM169B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415488.1	NM_182562	
FCGR3A	2214	broad.mit.edu;bcgsc.ca	37	1	161600871	161600871	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:161600871A>C	ENST00000540048.1	-	1	46	c.14T>G	c.(13-15)cTc>cGc	p.L5R	FCGR2B_ENST00000428605.2_Intron|FCGR3B_ENST00000294800.3_Missense_Mutation_p.L5R|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR2B_ENST00000367962.4_Intron|FCGR3B_ENST00000531221.1_Missense_Mutation_p.L41R|FCGR3B_ENST00000367964.2_Missense_Mutation_p.L5R			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	5					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGTTGGGAGGAGCAGCTGCCA	0.527																																					p.L41R		.											.	FCGR3B	22	0			c.T122G						.						73.0	71.0	72.0					1																	161600871		2191	4297	6488	SO:0001583	missense	2215	exon1			GGGAGGAGCAGCT	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.14T>G	1.37:g.161600871A>C	ENSP00000444971:p.Leu5Arg	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	8.0	NM_001271035	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	ENST00000540048.1	37		.	.	.	.	.	.	.	.	.	.	A	14.41	2.526528	0.44969	.	.	ENSG00000203747;ENSG00000162747;ENSG00000162747;ENSG00000162747	ENST00000540048;ENST00000367964;ENST00000294800;ENST00000531221	T;T;T;T	0.01647	4.75;4.71;4.71;4.87	2.66	2.66	0.31614	.	2.119430	0.01869	N	0.037097	T	0.05227	0.0139	M	0.85197	2.74	0.09310	N	0.999995	D	0.76494	0.999	D	0.69307	0.963	T	0.33523	-0.9865	10	0.87932	D	0	.	7.1077	0.25372	1.0:0.0:0.0:0.0	.	5	O75015	FCG3B_HUMAN	R	5;5;5;41	ENSP00000444971:L5R;ENSP00000356941:L5R;ENSP00000294800:L5R;ENSP00000433642:L41R	ENSP00000444971:L5R	L	-	2	0	FCGR3A;FCGR3B	159867495	0.008000	0.16893	0.118000	0.21660	0.162000	0.22319	1.318000	0.33643	1.223000	0.43536	0.324000	0.21423	CTC	.		0.527	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000569	
FREM1	158326	ucsc.edu;bcgsc.ca	37	9	14851597	14851597	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:14851597A>G	ENST00000380880.3	-	6	1620	c.837T>C	c.(835-837)agT>agC	p.S279S	RNU6-1260P_ENST00000362944.1_RNA|FREM1_ENST00000380881.4_Silent_p.S280S|FREM1_ENST00000422223.2_Silent_p.S279S			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	279					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GCAGCCACGCACTCTCTGACT	0.398																																					p.S279S		.											.	FREM1	138	0			c.T837C						.						89.0	88.0	88.0					9																	14851597		1906	4129	6035	SO:0001819	synonymous_variant	158326	exon7			CCACGCACTCTCT	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.837T>C	9.37:g.14851597A>G		Somatic	27.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																			.		0.398	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
GAGE10	643832	ucsc.edu;bcgsc.ca	37	X	49173765	49173765	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chrX:49173765A>G	ENST00000407599.3	+	4	419	c.326A>G	c.(325-327)gAa>gGa	p.E109G		NM_001098413.2	NP_001091883.2	A6NGK3	GAG10_HUMAN	G antigen 10	109										breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	Ovarian(276;0.236)					AGGCCTGAAGAAGGTAGGGAA	0.473																																					p.E109G		.											.	GAGE10	22	0			c.A326G						.						164.0	166.0	166.0					X																	49173765		2203	4300	6503	SO:0001583	missense	643832	exon4			CTGAAGAAGGTAG			Xp11.23	2010-06-03			ENSG00000215274	ENSG00000215274			30968	protein-coding gene	gene with protein product							Standard	XM_006710256		Approved	OTTHUMG00000024136	uc010nir.1	A6NGK3	OTTHUMG00000024136	ENST00000407599.3:c.326A>G	X.37:g.49173765A>G	ENSP00000385415:p.Glu109Gly	Somatic	74.0	0.0		WXS	Illumina HiSeq	.	55.0	5.0	NM_001098413		Missense_Mutation	SNP	ENST00000407599.3	37	CCDS43938.1	.	.	.	.	.	.	.	.	.	.	.	0.693	-0.793634	0.02862	.	.	ENSG00000215274	ENST00000407599	T	0.10668	2.85	1.62	0.687	0.18020	.	.	.	.	.	T	0.06416	0.0165	L	0.31845	0.965	0.09310	N	0.999999	P	0.43578	0.811	B	0.37550	0.253	T	0.34054	-0.9844	9	0.20519	T	0.43	.	4.7121	0.12877	0.3766:0.6234:0.0:0.0	.	109	A6NGK3	GAG10_HUMAN	G	109	ENSP00000385415:E109G	ENSP00000385415:E109G	E	+	2	0	GAGE10	49060709	0.169000	0.23002	0.003000	0.11579	0.005000	0.04900	-0.314000	0.08092	0.155000	0.19261	-0.734000	0.03567	GAA	.		0.473	GAGE10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060816.1	NM_001098413	
GAK	2580	ucsc.edu;bcgsc.ca	37	4	887731	887731	+	Silent	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr4:887731G>T	ENST00000314167.4	-	8	918	c.808C>A	c.(808-810)Cga>Aga	p.R270R	GAK_ENST00000511163.1_Silent_p.R191R	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R270*(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		TTGACTATTCGAAGTTTCGCT	0.607																																					p.R270R		.											.	GAK	568	1	Substitution - Nonsense(1)	lung(1)	c.C808A						.						108.0	73.0	85.0					4																	887731		2201	4299	6500	SO:0001819	synonymous_variant	2580	exon8			CTATTCGAAGTTT	D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.808C>A	4.37:g.887731G>T		Somatic	95.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_005255	Q5U4P5|Q9BVY6	Silent	SNP	ENST00000314167.4	37	CCDS3340.1																																																																																			.		0.607	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239188.1	NM_005255	
GAS2L2	246176	ucsc.edu;bcgsc.ca	37	17	34079489	34079489	+	Silent	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:34079489G>T	ENST00000254466.6	-	1	408	c.381C>A	c.(379-381)atC>atA	p.I127I	GAS2L2_ENST00000587565.1_Silent_p.I127I	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	127	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGTTACCTTGGATGCCCATCT	0.587																																					p.I127I		.											.	GAS2L2	227	0			c.C381A						.						160.0	161.0	160.0					17																	34079489		2203	4300	6503	SO:0001819	synonymous_variant	246176	exon1			ACCTTGGATGCCC	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.381C>A	17.37:g.34079489G>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_139285	Q8NHY4	Silent	SNP	ENST00000254466.6	37	CCDS11298.1																																																																																			.		0.587	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
GCNT2	2651	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	10586875	10586875	+	Intron	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:10586875G>T	ENST00000379597.3	+	2	1481				GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000265012.4_Missense_Mutation_p.G218V|GCNT2_ENST00000316170.3_Intron|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000410107.1_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		ATCACCCCAGGGGTGCTGCCT	0.413																																					p.G218V		.											.	GCNT2	92	0			c.G653T						.						72.0	76.0	75.0					6																	10586875		2203	4300	6503	SO:0001627	intron_variant	2651	exon1			CCCCAGGGGTGCT	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.926-34709G>T	6.37:g.10586875G>T		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	16.0	NM_145655		Missense_Mutation	SNP	ENST00000379597.3	37	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164504	0.78339	.	.	ENSG00000111846	ENST00000265012	T	0.10960	2.82	5.47	5.47	0.80525	.	.	.	.	.	T	0.23133	0.0559	M	0.83774	2.66	0.80722	D	1	P	0.42649	0.786	P	0.51297	0.665	T	0.01212	-1.1417	9	0.87932	D	0	.	19.3314	0.94291	0.0:0.0:1.0:0.0	.	218	Q8NFS9	GNT2C_HUMAN	V	218	ENSP00000265012:G218V	ENSP00000265012:G218V	G	+	2	0	GCNT2	10694861	1.000000	0.71417	0.994000	0.49952	0.956000	0.61745	6.525000	0.73795	2.552000	0.86080	0.655000	0.94253	GGG	.		0.413	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
GDF9	2661	ucsc.edu;bcgsc.ca	37	5	132197841	132197841	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr5:132197841C>T	ENST00000378673.2	-	3	1671	c.805G>A	c.(805-807)Gac>Aac	p.D269N	GDF9_ENST00000296875.2_Missense_Mutation_p.D269N|GDF9_ENST00000464378.1_5'Flank			O60383	GDF9_HUMAN	growth differentiation factor 9	269					female gamete generation (GO:0007292)|negative regulation of cell growth (GO:0030308)|oocyte growth (GO:0001555)|positive regulation of cell proliferation (GO:0008284)|regulation of progesterone secretion (GO:2000870)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.D269N(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	22		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCACTTGTGTCATTCAAATAT	0.458																																					p.D269N		.											.	GDF9	227	1	Substitution - Missense(1)	kidney(1)	c.G805A						.						72.0	71.0	71.0					5																	132197841		2203	4300	6503	SO:0001583	missense	2661	exon2			TTGTGTCATTCAA		CCDS4162.1, CCDS75299.1	5q31.1	2014-01-30			ENSG00000164404	ENSG00000164404		"""Endogenous ligands"""	4224	protein-coding gene	gene with protein product		601918				7760846	Standard	NM_005260		Approved		uc003kxz.1	O60383	OTTHUMG00000059842	ENST00000378673.2:c.805G>A	5.37:g.132197841C>T	ENSP00000367942:p.Asp269Asn	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_005260	Q4VAW5	Missense_Mutation	SNP	ENST00000378673.2	37	CCDS4162.1	.	.	.	.	.	.	.	.	.	.	C	32	5.189302	0.94923	.	.	ENSG00000164404	ENST00000378673;ENST00000296875	D;D	0.87103	-2.21;-2.21	5.51	4.63	0.57726	.	0.000000	0.85682	D	0.000000	D	0.93828	0.8026	M	0.87827	2.91	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94201	0.7450	10	0.87932	D	0	.	14.6627	0.68885	0.0:0.9283:0.0:0.0717	.	269	O60383	GDF9_HUMAN	N	269	ENSP00000367942:D269N;ENSP00000296875:D269N	ENSP00000296875:D269N	D	-	1	0	GDF9	132225740	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.688000	0.68227	2.890000	0.99128	0.650000	0.86243	GAC	.		0.458	GDF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133060.2	NM_005260	
GIPC3	126326	ucsc.edu;bcgsc.ca	37	19	3586569	3586569	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:3586569T>C	ENST00000322315.5	+	2	347	c.302T>C	c.(301-303)tTc>tCc	p.F101S		NM_133261.2	NP_573568.1	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	101										breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGAGGACTTCATCTTTGCC	0.587											OREG0025154	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F101S		.											.	GIPC3	135	0			c.T302C						.						105.0	100.0	102.0					19																	3586569		2203	4300	6503	SO:0001583	missense	126326	exon2			AGGACTTCATCTT	AB073738	CCDS32871.1	19p13.3	2011-11-29				ENSG00000179855			18183	protein-coding gene	gene with protein product		608792	"""chromosome 19 open reading frame 64"", ""deafness, autosomal recessive 72"", ""deafness, autosomal recessive 15"""	C19orf64, DFNB72, DFNB15		11836571, 21326233	Standard	NM_133261		Approved	DFNB95	uc002lyd.4	Q8TF64		ENST00000322315.5:c.302T>C	19.37:g.3586569T>C	ENSP00000319254:p.Phe101Ser	Somatic	56.0	0.0	612	WXS	Illumina HiSeq	.	33.0	4.0	NM_133261	O75227	Missense_Mutation	SNP	ENST00000322315.5	37	CCDS32871.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740138	0.69304	.	.	ENSG00000179855	ENST00000322315	T	0.37752	1.18	3.49	3.49	0.39957	PDZ/DHR/GLGF (1);	0.052916	0.85682	D	0.000000	T	0.55481	0.1923	M	0.72894	2.215	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.58880	-0.7558	10	0.62326	D	0.03	-20.9964	11.0049	0.47629	0.0:0.0:0.0:1.0	.	101	Q8TF64	GIPC3_HUMAN	S	101	ENSP00000319254:F101S	ENSP00000319254:F101S	F	+	2	0	GIPC3	3537569	1.000000	0.71417	0.999000	0.59377	0.729000	0.41735	7.256000	0.78350	1.463000	0.47967	0.459000	0.35465	TTC	.		0.587	GIPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394577.1	NM_133261	
GNAS	2778	ucsc.edu;bcgsc.ca	37	20	57415853	57415853	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr20:57415853C>A	ENST00000313949.7	+	1	1081	c.692C>A	c.(691-693)cCg>cAg	p.P231Q	GNAS-AS1_ENST00000598163.1_RNA|GNAS_ENST00000371075.3_Missense_Mutation_p.P231Q|GNAS_ENST00000371098.2_Missense_Mutation_p.P231Q|GNAS-AS1_ENST00000424094.2_RNA|GNAS-AS1_ENST00000443966.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	326			R -> H (in AHO; impairs the ability to mediate hormonal stimulation). {ECO:0000269|PubMed:11450852}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GACGCGTCCCCGGAGTCCCCT	0.592			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.P231Q	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	GNAS	4767	0			c.C692A						.						22.0	20.0	20.0					20																	57415853		2184	4272	6456	SO:0001583	missense	2778	exon1			CGTCCCCGGAGTC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.692C>A	20.37:g.57415853C>A	ENSP00000323571:p.Pro231Gln	Somatic	26.0	0.0		WXS	Illumina HiSeq	.	22.0	4.0	NM_016592	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000313949.7	37	CCDS13471.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001548	0.54254	.	.	ENSG00000087460	ENST00000313949;ENST00000371098;ENST00000371075;ENST00000453292	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	T	0.62804	0.2458	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66720	-0.5852	8	0.72032	D	0.01	.	13.3277	0.60469	0.0:1.0:0.0:0.0	.	231	O95467	GNAS3_HUMAN	Q	231;231;231;152	.	ENSP00000323571:P231Q	P	+	2	0	GNAS	56849248	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	3.328000	0.52052	2.404000	0.81709	0.585000	0.79938	CCG	.		0.592	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080418.7	NM_000516	
GPR116	221395	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	46847716	46847716	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:46847716delA	ENST00000283296.7	-	9	1163	c.875delT	c.(874-876)gtgfs	p.V292fs	GPR116_ENST00000362015.4_Frame_Shift_Del_p.V292fs|GPR116_ENST00000456426.2_Intron|GPR116_ENST00000265417.7_Frame_Shift_Del_p.V292fs	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	292	Ig-like 1.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			CTTTTCACACACCAGACTGAC	0.418																																					p.V292fs	NSCLC(59;410 1274 8751 36715 50546)	.											.	GPR116	91	0			c.875delT						.						149.0	128.0	135.0					6																	46847716		2203	4300	6503	SO:0001589	frameshift_variant	221395	exon9			TCACACACCAGAC	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.875delT	6.37:g.46847716delA	ENSP00000283296:p.Val292fs	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	15.0	NM_015234	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Frame_Shift_Del	DEL	ENST00000283296.7	37	CCDS4919.1																																																																																			.		0.418	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
GRIA4	2893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	105623945	105623945	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:105623945G>T	ENST00000530497.1	+	3	486	c.486G>T	c.(484-486)agG>agT	p.R162S	GRIA4_ENST00000393125.2_Splice_Site_p.R162S|GRIA4_ENST00000428631.2_Splice_Site_p.R162S|GRIA4_ENST00000393127.2_Splice_Site_p.R162S|GRIA4_ENST00000525187.1_Splice_Site_p.R162S|GRIA4_ENST00000282499.5_Splice_Site_p.R162S			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	162					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACACAGACAGGGGTAAGTCCA	0.393																																					p.R162S		.											.	GRIA4	230	0			c.G486T						.						117.0	106.0	110.0					11																	105623945		2202	4299	6501	SO:0001630	splice_region_variant	2893	exon4			AGACAGGGGTAAG	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.487+1G>T	11.37:g.105623945G>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	10.0	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141628	0.57044	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	T;T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	5.75	2.9	0.33743	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.82972	0.5153	L	0.41824	1.3	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;0.98	D;D;D;P	0.91635	0.944;0.999;0.999;0.609	T	0.78974	-0.1992	10	0.36615	T	0.2	.	10.0649	0.42297	0.29:0.0:0.71:0.0	.	162;162;192;162	P48058;G3V164;Q59GL7;Q86XE8	GRIA4_HUMAN;.;.;.	S	162	ENSP00000376833:R162S;ENSP00000282499:R162S;ENSP00000376835:R162S;ENSP00000415551:R162S;ENSP00000432443:R162S;ENSP00000435775:R162S;ENSP00000432180:R162S	ENSP00000282499:R162S	R	+	3	2	GRIA4	105129155	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	1.879000	0.39618	0.370000	0.24538	-0.150000	0.13652	AGG	.		0.393	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		Missense_Mutation
GRTP1	79774	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	113980034	113980034	+	Missense_Mutation	SNP	T	T	C	rs375273020		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr13:113980034T>C	ENST00000375431.4	-	7	937	c.863A>G	c.(862-864)gAt>gGt	p.D288G	GRTP1_ENST00000375430.4_Missense_Mutation_p.D288G|GRTP1_ENST00000326039.3_Missense_Mutation_p.D210G	NM_024719.2	NP_078995.2	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	288							Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	14	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			CTTAAACTTATCGCAAATGTC	0.517																																					p.D288G		.											.	GRTP1	90	0			c.A863G						.	T	GLY/ASP	0,4406		0,0,2203	117.0	114.0	115.0		863	5.0	0.1	13		115	1,8599	1.2+/-3.3	0,1,4299	no	missense	GRTP1	NM_024719.2	94	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	288/337	113980034	1,13005	2203	4300	6503	SO:0001583	missense	79774	exon7			AACTTATCGCAAA	AK026127	CCDS9534.2, CCDS66591.1, CCDS73606.1	13q34	2011-11-30			ENSG00000139835	ENSG00000139835			20310	protein-coding gene	gene with protein product						11564724	Standard	NM_001286732		Approved	FLJ22474, TBC1D6	uc001vtn.3	Q5TC63	OTTHUMG00000017381	ENST00000375431.4:c.863A>G	13.37:g.113980034T>C	ENSP00000364580:p.Asp288Gly	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	9.0	NM_024719	B9A6K2|Q2M232|Q5TC64|Q66K26|Q6P659|Q8N528|Q9H695	Missense_Mutation	SNP	ENST00000375431.4	37	CCDS9534.2	.	.	.	.	.	.	.	.	.	.	T	10.33	1.321160	0.23994	0.0	1.16E-4	ENSG00000139835	ENST00000375431;ENST00000326039;ENST00000375430	T;T;T	0.22336	1.96;1.96;1.96	4.97	4.97	0.65823	Rab-GAP/TBC domain (1);	0.374904	0.28730	N	0.014329	T	0.19967	0.0480	L	0.50333	1.59	0.44417	D	0.99733	B;P	0.34800	0.004;0.469	B;B	0.30029	0.005;0.11	T	0.02925	-1.1093	10	0.31617	T	0.26	.	14.6885	0.69068	0.0:0.0:0.0:1.0	.	288;288	B9A6K2;Q5TC63	.;GRTP1_HUMAN	G	288;210;288	ENSP00000364580:D288G;ENSP00000321850:D210G;ENSP00000364579:D288G	ENSP00000321850:D210G	D	-	2	0	GRTP1	113028035	1.000000	0.71417	0.058000	0.19502	0.031000	0.12232	7.215000	0.77966	1.867000	0.54127	0.379000	0.24179	GAT	.		0.517	GRTP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045882.5	NM_024719	
GTDC1	79712	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	144903283	144903283	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:144903283A>T	ENST00000392869.2	-	4	355	c.203T>A	c.(202-204)cTt>cAt	p.L68H	GTDC1_ENST00000409298.1_Missense_Mutation_p.L68H|GTDC1_ENST00000241391.5_Missense_Mutation_p.L68H|GTDC1_ENST00000542155.1_Missense_Mutation_p.L68H|GTDC1_ENST00000392867.3_Missense_Mutation_p.L68H|GTDC1_ENST00000409214.1_Missense_Mutation_p.L68H|GTDC1_ENST00000344850.4_Missense_Mutation_p.L68H|GTDC1_ENST00000463875.2_5'UTR	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	68					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		GGTCAGGTTAAGCACTGAACT	0.438																																					p.L68H		.											.	GTDC1	91	0			c.T203A						.						100.0	96.0	97.0					2																	144903283		2203	4300	6503	SO:0001583	missense	79712	exon5			AGGTTAAGCACTG	AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.203T>A	2.37:g.144903283A>T	ENSP00000376608:p.Leu68His	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	7.0	NM_001006636	A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Missense_Mutation	SNP	ENST00000392869.2	37	CCDS33300.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.565296	0.86439	.	.	ENSG00000121964	ENST00000392869;ENST00000409214;ENST00000392867;ENST00000409298;ENST00000542155;ENST00000241391;ENST00000344850;ENST00000437114;ENST00000417450	T;T;T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.73	5.73	0.89815	Glycosyltransferase family 1, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.76793	0.4037	M	0.87682	2.9	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.997;0.999;1.0;0.994	T	0.81291	-0.0999	10	0.87932	D	0	-0.6801	16.3265	0.82983	1.0:0.0:0.0:0.0	.	68;68;68;68;68	G1UFN1;Q4AE62-2;B8ZZ45;Q4AE62;Q4AE62-3	.;.;.;GTDC1_HUMAN;.	H	68	ENSP00000376608:L68H;ENSP00000386581:L68H;ENSP00000376606:L68H;ENSP00000386691:L68H;ENSP00000438323:L68H;ENSP00000241391:L68H;ENSP00000339750:L68H;ENSP00000403869:L68H;ENSP00000400661:L68H	ENSP00000241391:L68H	L	-	2	0	GTDC1	144619753	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.142000	0.94618	2.313000	0.78055	0.455000	0.32223	CTT	.		0.438	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254779.2	NM_024659	
HIC2	23119	ucsc.edu;bcgsc.ca	37	22	21800865	21800865	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr22:21800865T>C	ENST00000443632.2	+	2	2053	c.1681T>C	c.(1681-1683)Ttc>Ctc	p.F561L	HIC2_ENST00000407598.2_Missense_Mutation_p.F561L|HIC2_ENST00000407464.2_Missense_Mutation_p.F561L			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	561					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				CCTGAAGCCCTTCGCCTGCGA	0.627																																					p.F561L	NSCLC(23;437 858 2282 27947 40366)	.											.	HIC2	703	0			c.T1681C						.						75.0	61.0	66.0					22																	21800865		2203	4300	6503	SO:0001583	missense	23119	exon3			AAGCCCTTCGCCT	AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.1681T>C	22.37:g.21800865T>C	ENSP00000387757:p.Phe561Leu	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_015094	Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Missense_Mutation	SNP	ENST00000443632.2	37	CCDS13789.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111525	0.77210	.	.	ENSG00000169635	ENST00000407464;ENST00000407598;ENST00000443632	T;T;T	0.17691	2.26;2.26;2.26	4.55	4.55	0.56014	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.34803	0.0910	L	0.58510	1.815	0.53005	D	0.999966	D	0.65815	0.995	D	0.67103	0.949	T	0.06481	-1.0824	10	0.62326	D	0.03	.	11.939	0.52890	0.0:0.0:0.0:1.0	.	561	Q96JB3	HIC2_HUMAN	L	561	ENSP00000385319:F561L;ENSP00000384889:F561L;ENSP00000387757:F561L	ENSP00000385319:F561L	F	+	1	0	HIC2	20130865	1.000000	0.71417	0.997000	0.53966	0.850000	0.48378	7.774000	0.85478	1.931000	0.55961	0.456000	0.33151	TTC	.		0.627	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320061.2		
HIPK1	204851	ucsc.edu;bcgsc.ca	37	1	114515662	114515662	+	Missense_Mutation	SNP	C	C	A	rs17853522	byFrequency	TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:114515662C>A	ENST00000369558.1	+	16	3393	c.3161C>A	c.(3160-3162)gCg>gAg	p.A1054E	HIPK1_ENST00000406344.1_Missense_Mutation_p.A660E|HIPK1_ENST00000369561.4_Missense_Mutation_p.A1020E|HIPK1_ENST00000369555.2_Missense_Mutation_p.A1009E|HIPK1_ENST00000369554.2_Missense_Mutation_p.A1009E|HIPK1_ENST00000340480.4_Missense_Mutation_p.A680E|HIPK1_ENST00000426820.2_Missense_Mutation_p.A1054E|HIPK1_ENST00000369553.1_Missense_Mutation_p.A660E			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	1054	Interaction with TP53.			A -> V (in Ref. 4; AAH36057). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGTCATCGGCGGCTCCAACC	0.592																																					p.A1054E		.											.	HIPK1	361	0			c.C3161A						.						112.0	123.0	119.0					1																	114515662		2203	4300	6503	SO:0001583	missense	204851	exon16			CATCGGCGGCTCC	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.3161C>A	1.37:g.114515662C>A	ENSP00000358571:p.Ala1054Glu	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	C	9.192	1.026219	0.19512	.	.	ENSG00000163349	ENST00000426820;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.78;0.75;0.75;0.78;0.74;3.8;2.89;2.89	5.82	5.82	0.92795	.	0.733148	0.11888	N	0.519832	T	0.23133	0.0559	L	0.29908	0.895	0.24723	N	0.993137	B;B;B	0.21452	0.001;0.056;0.02	B;B;B	0.25291	0.005;0.059;0.012	T	0.10590	-1.0623	10	0.41790	T	0.15	.	13.3128	0.60390	0.0:0.9281:0.0:0.0719	.	346;660;1054	E9PCF6;Q86Z02-4;Q86Z02	.;.;HIPK1_HUMAN	E	1125;1054;1009;1009;1054;1020;680;660;660	ENSP00000407442:A1125E;ENSP00000409673:A1054E;ENSP00000358567:A1009E;ENSP00000358568:A1009E;ENSP00000358571:A1054E;ENSP00000358574:A1020E;ENSP00000340956:A680E;ENSP00000358566:A660E;ENSP00000384960:A660E	ENSP00000340956:A680E	A	+	2	0	HIPK1	114317185	0.957000	0.32711	0.988000	0.46212	0.939000	0.58152	3.279000	0.51670	2.752000	0.94435	0.655000	0.94253	GCG	C|0.999;T|0.001		0.592	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
QRICH1	54870	ucsc.edu;bcgsc.ca	37	3	49066740	49066740	+	IGR	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:49066740T>C	ENST00000395443.2	-	0	3549				IMPDH2_ENST00000326739.4_Missense_Mutation_p.D15G|RP13-131K19.6_ENST00000607245.1_RNA	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		GAGTCCGTCGTCTGGCACGTA	0.662																																					p.D15G		.											.	IMPDH2	227	0			c.A44G						.						47.0	38.0	41.0					3																	49066740		2202	4300	6502	SO:0001628	intergenic_variant	3615	exon1			CCGTCGTCTGGCA		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		3.37:g.49066740T>C		Somatic	25.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_000884	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	37	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.493262	0.64186	.	.	ENSG00000178035	ENST00000537036;ENST00000326739;ENST00000442157	T;T	0.46451	2.24;0.87	4.45	4.45	0.53987	.	0.046663	0.85682	D	0.000000	T	0.30135	0.0755	N	0.21545	0.675	0.80722	D	1	B	0.10296	0.003	B	0.13407	0.009	T	0.06862	-1.0803	10	0.33940	T	0.23	-20.905	13.88	0.63676	0.0:0.0:0.0:1.0	.	15	P12268	IMDH2_HUMAN	G	15	ENSP00000321584:D15G;ENSP00000403502:D15G	ENSP00000321584:D15G	D	-	2	0	IMPDH2	49041744	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	7.357000	0.79456	1.865000	0.54081	0.533000	0.62120	GAC	.		0.662	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
IMPG1	3617	ucsc.edu;bcgsc.ca	37	6	76660465	76660465	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:76660465G>T	ENST00000369950.3	-	13	1827	c.1638C>A	c.(1636-1638)ttC>ttA	p.F546L	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TATCCTCCAAGAAATGATCTG	0.483																																					p.F546L	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1	93	0			c.C1638A						.						93.0	79.0	84.0					6																	76660465		2203	4300	6503	SO:0001583	missense	3617	exon13			CTCCAAGAAATGA	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1638C>A	6.37:g.76660465G>T	ENSP00000358966:p.Phe546Leu	Somatic	26.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	9.432	1.085708	0.20390	.	.	ENSG00000112706	ENST00000369950	T	0.19532	2.14	5.67	0.817	0.18773	.	0.942898	0.08930	N	0.873167	T	0.08223	0.0205	M	0.73598	2.24	0.09310	N	1	B	0.26258	0.145	B	0.20955	0.032	T	0.42292	-0.9460	10	0.15066	T	0.55	.	8.972	0.35912	0.39:0.0:0.61:0.0	.	546	Q17R60	IMPG1_HUMAN	L	546	ENSP00000358966:F546L	ENSP00000358966:F546L	F	-	3	2	IMPG1	76717185	0.000000	0.05858	0.026000	0.17262	0.005000	0.04900	-0.651000	0.05372	0.055000	0.16094	-0.142000	0.14014	TTC	.		0.483	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
INSR	3643	ucsc.edu;bcgsc.ca	37	19	7117231	7117231	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:7117231G>T	ENST00000302850.5	-	22	4127	c.3985C>A	c.(3985-3987)Ctg>Atg	p.L1329M	INSR_ENST00000341500.5_Missense_Mutation_p.L1317M	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1329					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GAACGGTCCAGGGGCACATTC	0.607																																					p.L1329M		.											.	INSR	1381	0			c.C3985A						.						91.0	80.0	84.0					19																	7117231		2203	4300	6503	SO:0001583	missense	3643	exon22			GGTCCAGGGGCAC	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3985C>A	19.37:g.7117231G>T	ENSP00000303830:p.Leu1329Met	Somatic	49.0	1.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979041	0.53827	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.77489	-1.1;-1.1	4.99	2.69	0.31865	.	0.000000	0.36555	U	0.002528	D	0.87293	0.6141	M	0.87547	2.89	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.99	D	0.86376	0.1726	10	0.62326	D	0.03	.	9.317	0.37941	0.1394:0.0:0.8606:0.0	.	1317;1329	P06213-2;P06213	.;INSR_HUMAN	M	1329;1317	ENSP00000303830:L1329M;ENSP00000342838:L1317M	ENSP00000303830:L1329M	L	-	1	2	INSR	7068231	1.000000	0.71417	0.959000	0.39883	0.394000	0.30568	3.954000	0.56708	0.522000	0.28464	0.563000	0.77884	CTG	.		0.607	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
ITGA8	8516	ucsc.edu;bcgsc.ca	37	10	15760772	15760772	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr10:15760772G>T	ENST00000378076.3	-	2	689	c.336C>A	c.(334-336)gaC>gaA	p.D112E		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	112					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TACTGGTGGTGTCAAACGGTA	0.587																																					p.D112E		.											.	ITGA8	230	0			c.C336A						.						136.0	121.0	126.0					10																	15760772		2203	4300	6503	SO:0001583	missense	8516	exon2			GGTGGTGTCAAAC	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.336C>A	10.37:g.15760772G>T	ENSP00000367316:p.Asp112Glu	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_003638	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798562	0.70567	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.36157	1.27	4.79	3.89	0.44902	.	0.000000	0.85682	D	0.000000	T	0.59266	0.2181	M	0.85859	2.78	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.61647	-0.7020	10	0.56958	D	0.05	.	7.7945	0.29140	0.3044:0.0:0.6956:0.0	.	112;112	F5H818;P53708	.;ITA8_HUMAN	E	112	ENSP00000367316:D112E	ENSP00000367316:D112E	D	-	3	2	ITGA8	15800778	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.740000	0.47418	1.246000	0.43901	0.561000	0.74099	GAC	.		0.587	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
ITIH3	3699	ucsc.edu;bcgsc.ca	37	3	52828855	52828855	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:52828855T>C	ENST00000449956.2	+	1	42	c.36T>C	c.(34-36)gcT>gcC	p.A12A	ITIH3_ENST00000416872.2_Silent_p.A12A	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	12					hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TCATCTTGGCTCTGCTCTCCA	0.577																																					p.A12A		.											.	ITIH3	93	0			c.T36C						.						135.0	146.0	142.0					3																	52828855		2077	4214	6291	SO:0001819	synonymous_variant	3699	exon1			CTTGGCTCTGCTC		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.36T>C	3.37:g.52828855T>C		Somatic	37.0	1.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Silent	SNP	ENST00000449956.2	37	CCDS46845.1	.	.	.	.	.	.	.	.	.	.	T	6.755	0.508118	0.12883	.	.	ENSG00000162267	ENST00000273291	.	.	.	4.89	2.85	0.33270	.	0.538671	0.17092	N	0.187339	T	0.55721	0.1938	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52675	-0.8544	6	0.48119	T	0.1	-4.3835	4.0669	0.09864	0.0:0.5109:0.0:0.4891	.	.	.	.	P	9	.	ENSP00000273291:S9P	S	+	1	0	ITIH3	52803895	0.957000	0.32711	0.974000	0.42286	0.420000	0.31355	0.151000	0.16283	0.607000	0.29982	0.482000	0.46254	TCT	.		0.577	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
KBTBD12	166348	hgsc.bcm.edu;broad.mit.edu	37	3	127642837	127642838	+	In_Frame_Ins	INS	-	-	TCA			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:127642837_127642838insTCA	ENST00000405109.1	+	2	1400_1401	c.933_934insTCA	c.(934-936)tca>TCAtca	p.312_312S>SS	KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000405256.1_In_Frame_Ins_p.312_312S>SS|KBTBD12_ENST00000343941.4_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	312										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CCTATTTCATCTCATCTCCCAA	0.411																																					p.I311delinsIS		.											.	KBTBD12	23	0			c.933_934insTCA						.																																			SO:0001652	inframe_insertion	166348	exon1			TTTCATCTCATCT		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.934_936dupTCA	3.37:g.127642838_127642840dupTCA	ENSP00000385957:p.Ser313dup	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	24.0	NM_207335	B5MCC6|Q6ZRK1	In_Frame_Ins	INS	ENST00000405109.1	37	CCDS33848.2																																																																																			.		0.411	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
KCNJ15	3772	broad.mit.edu;bcgsc.ca	37	21	39671899	39671899	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr21:39671899T>A	ENST00000328656.4	+	4	1019	c.716T>A	c.(715-717)gTg>gAg	p.V239E	KCNJ15_ENST00000398932.1_Missense_Mutation_p.V239E|KCNJ15_ENST00000398934.1_Missense_Mutation_p.V239E|KCNJ15_ENST00000398930.1_Missense_Mutation_p.V239E|KCNJ15_ENST00000398938.2_Missense_Mutation_p.V239E	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	239					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	AAATTCCACGTGGACTCCTCC	0.562																																					p.I239N		.											.	KCNJ15	157	0			c.T716A						.						59.0	63.0	62.0					21																	39671899		2203	4300	6503	SO:0001583	missense	3772	exon4			TCCACGTGGACTC	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.716T>A	21.37:g.39671899T>A	ENSP00000331698:p.Val239Glu	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	3.0	NM_002243	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	37	CCDS13656.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.698733	0.88830	.	.	ENSG00000157551	ENST00000328656;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934	D;D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36;-3.36	5.83	5.83	0.93111	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.052428	0.85682	D	0.000000	D	0.96244	0.8775	M	0.73598	2.24	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.95975	0.8973	9	.	.	.	.	16.2127	0.82178	0.0:0.0:0.0:1.0	.	239	Q99712	IRK15_HUMAN	E	239	ENSP00000331698:V239E;ENSP00000381911:V239E;ENSP00000381905:V239E;ENSP00000414487:V239E;ENSP00000381904:V239E;ENSP00000381907:V239E	.	V	+	2	0	KCNJ15	38593769	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.027000	0.88791	2.236000	0.73375	0.533000	0.62120	GTG	.		0.562	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
KDM5D	8284	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	21897301	21897301	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chrY:21897301C>T	ENST00000317961.4	-	8	1141	c.870G>A	c.(868-870)ttG>ttA	p.L290L	KDM5D_ENST00000382806.2_Silent_p.L233L|KDM5D_ENST00000541639.1_Silent_p.L290L	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	290					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	GCTCTAGGCTCAAGTGCTGCT	0.453																																					p.L290L		.											.	KDM5D	560	0			c.G870A						.						119.0	117.0	118.0					Y																	21897301		624	1956	2580	SO:0001819	synonymous_variant	8284	exon8			TAGGCTCAAGTGC	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.870G>A	Y.37:g.21897301C>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	21.0	NM_001146705	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Silent	SNP	ENST00000317961.4	37	CCDS14794.1																																																																																			.		0.453	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653	
KIF1B	23095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	10381913	10381913	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:10381913A>C	ENST00000377086.1	+	24	2558	c.2356A>C	c.(2356-2358)Aag>Cag	p.K786Q	KIF1B_ENST00000377081.1_Missense_Mutation_p.K786Q|KIF1B_ENST00000263934.6_Missense_Mutation_p.K740Q			O60333	KIF1B_HUMAN	kinesin family member 1B	786					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		ACTGAAAAAGAAGGTATGGAG	0.502																																					p.K740Q		.											.	KIF1B	93	0			c.A2218C						.						54.0	54.0	54.0					1																	10381913		2203	4300	6503	SO:0001583	missense	23095	exon22			AAAAAGAAGGTAT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2356A>C	1.37:g.10381913A>C	ENSP00000366290:p.Lys786Gln	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	19.0	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	A	17.63	3.436481	0.62955	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.75050	-0.9;-0.9;-0.9	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.76097	0.3940	L	0.28192	0.835	0.80722	D	1	P;P;D;P;P;D	0.76494	0.87;0.609;0.999;0.609;0.765;0.989	B;B;D;B;B;D	0.75020	0.299;0.298;0.926;0.186;0.287;0.985	T	0.70898	-0.4747	10	0.11485	T	0.65	.	15.5286	0.75932	1.0:0.0:0.0:0.0	.	772;746;786;760;786;740	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	Q	786;740;786;786	ENSP00000263934:K740Q;ENSP00000366290:K786Q;ENSP00000366284:K786Q	ENSP00000263934:K740Q	K	+	1	0	KIF1B	10304500	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	5.782000	0.68973	2.120000	0.65058	0.459000	0.35465	AAG	.		0.502	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
KIF21B	23046	broad.mit.edu;bcgsc.ca	37	1	200959272	200959272	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:200959272C>T	ENST00000422435.2	-	20	3340	c.3024G>A	c.(3022-3024)gaG>gaA	p.E1008E	KIF21B_ENST00000461742.2_Silent_p.E1008E|KIF21B_ENST00000360529.5_Silent_p.E1008E|KIF21B_ENST00000332129.2_Silent_p.E1008E	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1008					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						ATACCTTGGTCTCCTCCAGCT	0.652																																					p.E1008E		.											.	KIF21B	96	0			c.G3024A						.						80.0	80.0	80.0					1																	200959272		2203	4300	6503	SO:0001819	synonymous_variant	23046	exon20			CTTGGTCTCCTCC	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3024G>A	1.37:g.200959272C>T		Somatic	128.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	10.0	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	37	CCDS58056.1																																																																																			.		0.652	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
KIAA1804	84451	broad.mit.edu;bcgsc.ca	37	1	233512249	233512249	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:233512249G>T	ENST00000366624.3	+	8	2161	c.1900G>T	c.(1900-1902)Gct>Tct	p.A634S	MLK4_ENST00000366622.1_Missense_Mutation_p.A80S	NM_032435.2	NP_115811.2																					CATGCCCTTGGCTTCATTGTT	0.413																																					p.A634S		.											.	KIAA1804	523	0			c.G1900T						.						97.0	98.0	98.0					1																	233512249		2203	4300	6503	SO:0001583	missense	0	exon8			CCCTTGGCTTCAT																												ENST00000366624.3:c.1900G>T	1.37:g.233512249G>T	ENSP00000355583:p.Ala634Ser	Somatic	90.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	10.0	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.998819	0.35226	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	T;T	0.75260	-0.92;3.16	4.91	4.0	0.46444	.	0.141392	0.46758	D	0.000272	T	0.69797	0.3151	L	0.54323	1.7	0.40644	D	0.981974	B;B	0.26258	0.145;0.0	B;B	0.29598	0.104;0.002	T	0.67914	-0.5547	10	0.36615	T	0.2	.	13.1916	0.59715	0.0:0.0:0.8406:0.1594	.	81;634	Q5TCX8-3;Q5TCX8	.;M3KL4_HUMAN	S	634;80	ENSP00000355583:A634S;ENSP00000355581:A80S	ENSP00000355581:A80S	A	+	1	0	RP5-862P8.2	231578872	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	3.320000	0.51991	1.279000	0.44446	-0.152000	0.13540	GCT	.		0.413	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
KLHL18	23276	ucsc.edu;bcgsc.ca	37	3	47376272	47376272	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:47376272T>C	ENST00000232766.5	+	6	881	c.861T>C	c.(859-861)gcT>gcC	p.A287A	KLHL18_ENST00000455924.2_Silent_p.A175A	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	287										endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		CATCCATCGCTGGACTTATCT	0.597																																					p.A287A		.											.	KLHL18	90	0			c.T861C						.						46.0	43.0	44.0					3																	47376272		2203	4300	6503	SO:0001819	synonymous_variant	23276	exon6			CATCGCTGGACTT	AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.861T>C	3.37:g.47376272T>C		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_025010	A8K612|Q7Z3E8|Q8N125	Silent	SNP	ENST00000232766.5	37	CCDS33749.1																																																																																			.		0.597	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344493.1	NM_025010	
LAMA1	284217	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	6958590	6958590	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr18:6958590G>A	ENST00000389658.3	-	55	7943	c.7850C>T	c.(7849-7851)aCg>aTg	p.T2617M	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2617	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CACATTTATCGTCCTGCTTTC	0.428																																					p.T2617M		.											.	LAMA1	149	0			c.C7850T						.						132.0	102.0	112.0					18																	6958590		2203	4300	6503	SO:0001583	missense	284217	exon55			TTTATCGTCCTGC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7850C>T	18.37:g.6958590G>A	ENSP00000374309:p.Thr2617Met	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	11.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189752	0.38707	.	.	ENSG00000101680	ENST00000389658;ENST00000344342	T	0.79845	-1.31	5.48	3.23	0.37069	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.587596	0.17071	N	0.188179	T	0.80757	0.4684	M	0.64404	1.975	0.09310	N	1	D	0.57899	0.981	P	0.49332	0.607	T	0.71938	-0.4441	10	0.54805	T	0.06	.	9.8016	0.40768	0.1055:0.1352:0.7593:0.0	.	2617	P25391	LAMA1_HUMAN	M	2617;70	ENSP00000374309:T2617M	ENSP00000341000:T70M	T	-	2	0	LAMA1	6948590	0.246000	0.23909	0.258000	0.24420	0.377000	0.30045	2.530000	0.45641	1.377000	0.46286	0.655000	0.94253	ACG	.		0.428	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LMTK2	22853	ucsc.edu;bcgsc.ca	37	7	97823273	97823273	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:97823273T>C	ENST00000297293.5	+	11	3789	c.3496T>C	c.(3496-3498)Tct>Cct	p.S1166P		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	1166					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					AAGTTGTCTGTCTGCTTTGCA	0.602																																					p.S1166P		.											.	LMTK2	1381	0			c.T3496C						.						50.0	51.0	51.0					7																	97823273		2203	4300	6503	SO:0001583	missense	22853	exon11			TGTCTGTCTGCTT	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.3496T>C	7.37:g.97823273T>C	ENSP00000297293:p.Ser1166Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_014916	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	ENST00000297293.5	37	CCDS5654.1	.	.	.	.	.	.	.	.	.	.	T	9.047	0.991110	0.18966	.	.	ENSG00000164715	ENST00000297293	T	0.78481	-1.18	5.03	-4.51	0.03483	.	1.070630	0.07051	N	0.831897	T	0.57373	0.2049	N	0.11201	0.11	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.40156	-0.9578	10	0.30854	T	0.27	.	11.6122	0.51066	0.0:0.4025:0.0:0.5975	.	1166	Q8IWU2	LMTK2_HUMAN	P	1166	ENSP00000297293:S1166P	ENSP00000297293:S1166P	S	+	1	0	LMTK2	97661209	0.002000	0.14202	0.000000	0.03702	0.048000	0.14542	0.766000	0.26560	-0.821000	0.04312	-0.297000	0.09499	TCT	.		0.602	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
LRP1	4035	ucsc.edu;bcgsc.ca	37	12	57588784	57588784	+	Missense_Mutation	SNP	G	G	T	rs539458663		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:57588784G>T	ENST00000243077.3	+	51	8674	c.8208G>T	c.(8206-8208)gaG>gaT	p.E2736D	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2736	LDL-receptor class A 16. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCTGCTCAGAGGCCCAGTTTG	0.602																																					p.E2736D		.											.	LRP1	596	0			c.G8208T						.						86.0	81.0	83.0					12																	57588784		2203	4300	6503	SO:0001583	missense	4035	exon51			CTCAGAGGCCCAG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8208G>T	12.37:g.57588784G>T	ENSP00000243077:p.Glu2736Asp	Somatic	55.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342037	0.24339	.	.	ENSG00000123384	ENST00000243077	D	0.95554	-3.74	4.67	4.67	0.58626	.	0.183617	0.35615	N	0.003095	D	0.86431	0.5931	N	0.11845	0.185	0.80722	D	1	B	0.26147	0.143	B	0.21708	0.036	T	0.80441	-0.1381	10	0.12766	T	0.61	.	5.8728	0.18812	0.0957:0.0:0.7124:0.1919	.	2736	Q07954	LRP1_HUMAN	D	2736	ENSP00000243077:E2736D	ENSP00000243077:E2736D	E	+	3	2	LRP1	55875051	0.071000	0.21146	1.000000	0.80357	0.993000	0.82548	0.217000	0.17603	2.401000	0.81631	0.455000	0.32223	GAG	.		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRRC31	79782	ucsc.edu;bcgsc.ca	37	3	169565938	169565938	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:169565938A>G	ENST00000316428.5	-	8	1354	c.1297T>C	c.(1297-1299)Tcc>Ccc	p.S433P	LRRC31_ENST00000523069.1_Missense_Mutation_p.S433P|LRRC31_ENST00000264676.5_Missense_Mutation_p.S377P	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	433										cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			GTCACCAGGGAACAGCTGCTC	0.527																																					p.L433L		.											.	LRRC31	93	0			c.C1297C						.						75.0	79.0	78.0					3																	169565938		2065	4211	6276	SO:0001583	missense	79782	exon8			CCAGGGAACAGCT	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.1297T>C	3.37:g.169565938A>G	ENSP00000325978:p.Ser433Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_024727	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Silent	SNP	ENST00000316428.5	37	CCDS43167.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463996	0.43736	.	.	ENSG00000114248	ENST00000316428;ENST00000264676;ENST00000523069	T;T;T	0.53423	0.62;0.62;0.62	4.61	-1.47	0.08772	.	0.804498	0.11118	N	0.597688	T	0.52008	0.1708	M	0.73962	2.25	0.22629	N	0.998913	D;P	0.57571	0.98;0.93	P;B	0.53649	0.731;0.36	T	0.44697	-0.9311	10	0.32370	T	0.25	-13.9226	5.2512	0.15522	0.265:0.2295:0.0:0.5055	.	377;433	Q6UY01-2;Q6UY01	.;LRC31_HUMAN	P	433;377;433	ENSP00000325978:S433P;ENSP00000264676:S377P;ENSP00000429145:S433P	ENSP00000264676:S377P	S	-	1	0	LRRC31	171048632	1.000000	0.71417	0.974000	0.42286	0.288000	0.27193	1.423000	0.34837	-0.159000	0.11021	0.533000	0.62120	TCC	.		0.527	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727	
MAP2K4	6416	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	11998923	11998923	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:11998923delA	ENST00000353533.5	+	4	488	c.425delA	c.(424-426)caafs	p.Q142fs	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Frame_Shift_Del_p.Q153fs	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	142	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Q -> L (in a lung squamous cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.Q142L(1)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		GAAAAAGAACAAAAACAACTT	0.333			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.Q142fs		.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	MAP2K4,NS,carcinoma,0	MAP2K4	3134	12	Whole gene deletion(10)|Substitution - Missense(1)|Unknown(1)	breast(4)|ovary(4)|biliary_tract(1)|large_intestine(1)|lung(1)|pancreas(1)	c.425delA						.						154.0	146.0	149.0					17																	11998923		2203	4300	6503	SO:0001589	frameshift_variant	6416	exon4			AAGAACAAAAACA	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.425delA	17.37:g.11998923delA	ENSP00000262445:p.Gln142fs	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	13.0	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Frame_Shift_Del	DEL	ENST00000353533.5	37	CCDS11162.1																																																																																			.		0.333	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
MAST2	23139	ucsc.edu;bcgsc.ca	37	1	46472011	46472011	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:46472011A>G	ENST00000361297.2	+	8	1129	c.846A>G	c.(844-846)gtA>gtG	p.V282V	MAST2_ENST00000372009.2_Silent_p.V282V	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CAGAGAGCGTACCAGATGAGG	0.557																																					p.V282V		.											.	MAST2	581	0			c.A846G						.						111.0	115.0	114.0					1																	46472011		2100	4236	6336	SO:0001819	synonymous_variant	23139	exon8			GAGCGTACCAGAT	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.846A>G	1.37:g.46472011A>G		Somatic	45.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_015112		Silent	SNP	ENST00000361297.2	37	CCDS41326.1																																																																																			.		0.557	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
MCF2L2	23101	ucsc.edu;bcgsc.ca	37	3	183145765	183145765	+	Start_Codon_SNP	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:183145765T>C	ENST00000328913.3	-	1	298	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	MCF2L2_ENST00000447025.2_Start_Codon_SNP_p.M1V|MCF2L2_ENST00000414362.2_Start_Codon_SNP_p.M1V|MCF2L2_ENST00000473233.1_Start_Codon_SNP_p.M1V	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	1							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CAAGACAGCATTTCACTGAAA	0.458																																					p.M1V		.											.	MCF2L2	293	0			c.A1G						.						82.0	87.0	85.0					3																	183145765		2203	4300	6503	SO:0001582	initiator_codon_variant	23101	exon1			ACAGCATTTCACT	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1A>G	3.37:g.183145765T>C	ENSP00000328118:p.Met1Val	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	48.0	5.0	NM_015078	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.560523	0.27827	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	T;T;T;T	0.04551	4.69;4.75;3.88;3.6	5.31	1.47	0.22746	.	0.083317	0.41194	D	0.000935	T	0.03095	0.0091	.	.	.	0.09310	N	0.999994	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.001	T	0.42310	-0.9459	9	0.33141	T	0.24	.	3.817	0.08819	0.1558:0.1743:0.0:0.6699	.	1;1	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	V	1	ENSP00000328118:M1V;ENSP00000420070:M1V;ENSP00000388190:M1V;ENSP00000414131:M1V	ENSP00000328118:M1V	M	-	1	0	MCF2L2	184628459	0.997000	0.39634	0.000000	0.03702	0.021000	0.10359	1.883000	0.39658	0.007000	0.14760	-0.274000	0.10170	ATG	.		0.458	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	Missense_Mutation
MERTK	10461	ucsc.edu;bcgsc.ca	37	2	112702624	112702624	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:112702624C>T	ENST00000295408.4	+	3	827	c.570C>T	c.(568-570)taC>taT	p.Y190Y	MERTK_ENST00000421804.2_Silent_p.Y190Y|MERTK_ENST00000409780.1_Silent_p.Y14Y			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	190					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						ATCCCATCTACATCGAAGTAC	0.398																																					p.Y190Y		.											.	MERTK	1463	0			c.C570T						.						115.0	106.0	109.0					2																	112702624		2203	4300	6503	SO:0001819	synonymous_variant	10461	exon3			CATCTACATCGAA	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.570C>T	2.37:g.112702624C>T		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_006343	Q9HBB4	Silent	SNP	ENST00000295408.4	37	CCDS2094.1																																																																																			.		0.398	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
MFSD1	64747	ucsc.edu;bcgsc.ca	37	3	158537505	158537505	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:158537505G>T	ENST00000264266.8	+	8	782	c.720G>T	c.(718-720)gaG>gaT	p.E240D	MFSD1_ENST00000415822.2_Missense_Mutation_p.E289D|MFSD1_ENST00000392813.4_Missense_Mutation_p.E250D			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1	240					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGAGAGCAGAGAGAATCCTTC	0.353																																					p.E289D	Pancreas(62;1186 1654 36636 37908)	.											.	MFSD1	90	0			c.G867T						.						54.0	54.0	54.0					3																	158537505		2203	4300	6503	SO:0001583	missense	64747	exon8			AGCAGAGAGAATC	BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835	ENST00000264266.8:c.720G>T	3.37:g.158537505G>T	ENSP00000264266:p.Glu240Asp	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_022736	B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Missense_Mutation	SNP	ENST00000264266.8	37		.	.	.	.	.	.	.	.	.	.	G	15.67	2.901223	0.52227	.	.	ENSG00000118855	ENST00000415822;ENST00000392813;ENST00000264266;ENST00000361159;ENST00000477743	T;T;T;T	0.57907	0.37;0.37;0.37;1.93	5.6	2.27	0.28462	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.097394	0.64402	D	0.000001	T	0.40145	0.1105	L	0.43757	1.38	0.54753	D	0.999986	B;B	0.31640	0.333;0.055	B;B	0.36464	0.225;0.192	T	0.08452	-1.0721	10	0.08599	T	0.76	-19.0944	8.2601	0.31779	0.5522:0.0:0.4478:0.0	.	250;240	C9JS94;Q9H3U5	.;MFSD1_HUMAN	D	289;250;240;164;74	ENSP00000403117:E289D;ENSP00000376560:E250D;ENSP00000264266:E240D;ENSP00000417163:E74D	ENSP00000264266:E240D	E	+	3	2	MFSD1	160020199	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.185000	0.32065	0.549000	0.28973	0.585000	0.79938	GAG	.		0.353	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470730.1	NM_022736	
MYBPC2	4606	ucsc.edu;bcgsc.ca	37	19	50965201	50965201	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:50965201A>G	ENST00000357701.5	+	26	3187	c.3136A>G	c.(3136-3138)Atg>Gtg	p.M1046V		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	1046					cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		TGACTTCCGGATGGCTCCCAA	0.577											OREG0025636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M1046V		.											.	MYBPC2	67	0			c.A3136G						.						57.0	58.0	58.0					19																	50965201		2040	4181	6221	SO:0001583	missense	4606	exon26			TTCCGGATGGCTC		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.3136A>G	19.37:g.50965201A>G	ENSP00000350332:p.Met1046Val	Somatic	63.0	0.0	973	WXS	Illumina HiSeq	.	45.0	4.0	NM_004533	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	37	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	a	10.53	1.377249	0.24944	.	.	ENSG00000086967	ENST00000357701	T	0.72051	-0.62	4.8	2.38	0.29361	.	1.355760	0.05951	U	0.638878	T	0.52693	0.1750	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.17098	0.017	T	0.34079	-0.9843	10	0.12430	T	0.62	.	8.893	0.35446	0.5748:0.0:0.0:0.4252	.	1046	Q14324	MYPC2_HUMAN	V	1046	ENSP00000350332:M1046V	ENSP00000350332:M1046V	M	+	1	0	MYBPC2	55657013	0.000000	0.05858	0.105000	0.21289	0.989000	0.77384	0.125000	0.15749	0.768000	0.33290	0.449000	0.29647	ATG	.		0.577	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
NLRP5	126206	ucsc.edu;bcgsc.ca	37	19	56515221	56515221	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:56515221T>C	ENST00000390649.3	+	2	202	c.202T>C	c.(202-204)Tgt>Cgt	p.C68R		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	68	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GCTGCAATGGTGTCTCTATGA	0.423																																					p.C68R		.											.	NLRP5	162	0			c.T202C						.						111.0	105.0	107.0					19																	56515221		1874	4115	5989	SO:0001583	missense	126206	exon2			CAATGGTGTCTCT	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.202T>C	19.37:g.56515221T>C	ENSP00000375063:p.Cys68Arg	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	40.0	5.0	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	T	12.46	1.944575	0.34283	.	.	ENSG00000171487	ENST00000390649	T	0.47528	0.84	3.15	3.15	0.36227	Pyrin (1);DEATH-like (2);	.	.	.	.	T	0.51890	0.1701	L	0.51422	1.61	0.22435	N	0.999109	D	0.60575	0.988	P	0.56343	0.796	T	0.31861	-0.9928	9	0.32370	T	0.25	.	8.115	0.30937	0.0:0.0:0.0:1.0	.	68	P59047	NALP5_HUMAN	R	68	ENSP00000375063:C68R	ENSP00000375063:C68R	C	+	1	0	NLRP5	61207033	0.715000	0.27946	0.119000	0.21687	0.013000	0.08279	1.841000	0.39240	1.691000	0.51100	0.456000	0.33151	TGT	.		0.423	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
NOTCH2	4853	ucsc.edu;bcgsc.ca	37	1	120529625	120529625	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:120529625C>A	ENST00000256646.2	-	5	1051	c.832G>T	c.(832-834)Ggg>Tgg	p.G278W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	278	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGTTGACCCCATCCACACAA	0.483			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.G278W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	1441	0			c.G832T						.						134.0	123.0	127.0					1																	120529625		2203	4300	6503	SO:0001583	missense	4853	exon5	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	TGACCCCATCCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.832G>T	1.37:g.120529625C>A	ENSP00000256646:p.Gly278Trp	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001200001	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617856	0.87359	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	D	0.96685	-4.09	6.06	5.15	0.70609	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38548	U	0.001656	D	0.98501	0.9500	H	0.95151	3.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.99201	1.0873	10	0.59425	D	0.04	.	14.4176	0.67160	0.0:0.9299:0.0:0.0701	.	239;278;278	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	W	278;239	ENSP00000256646:G278W	ENSP00000256646:G278W	G	-	1	0	NOTCH2	120331148	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	7.818000	0.86416	1.584000	0.49913	0.655000	0.94253	GGG	.		0.483	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NPTXR	23467	ucsc.edu;bcgsc.ca	37	22	39224465	39224465	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr22:39224465G>A	ENST00000333039.2	-	2	800	c.677C>T	c.(676-678)gCt>gTt	p.A226V		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	226						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					GGTGGGCACAGCAGAGACTGG	0.627																																					p.A226V	Pancreas(139;2521 3281 36965)	.											.	NPTXR	92	0			c.C677T						.						17.0	17.0	17.0					22																	39224465		2203	4300	6503	SO:0001583	missense	23467	exon2			GGCACAGCAGAGA	AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.677C>T	22.37:g.39224465G>A	ENSP00000327545:p.Ala226Val	Somatic	24.0	0.0		WXS	Illumina HiSeq	.	23.0	4.0	NM_014293		Missense_Mutation	SNP	ENST00000333039.2	37	CCDS33647.1	.	.	.	.	.	.	.	.	.	.	G	4.597	0.110963	0.08831	.	.	ENSG00000221890	ENST00000333039	T	0.10288	2.89	4.17	-4.15	0.03881	.	1.156380	0.06375	N	0.714253	T	0.05227	0.0139	N	0.12182	0.205	0.33072	D	0.535513	B	0.06786	0.001	B	0.04013	0.001	T	0.41716	-0.9493	9	0.39692	T	0.17	-9.9608	4.775	0.13175	0.5349:0.0:0.3104:0.1547	.	226	O95502	NPTXR_HUMAN	V	226	ENSP00000327545:A226V	ENSP00000327545:A226V	A	-	2	0	NPTXR	37554411	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.111000	0.10807	-0.834000	0.04239	-0.367000	0.07326	GCT	.		0.627	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318194.2	NM_014293	
NTSR1	4923	ucsc.edu;bcgsc.ca	37	20	61340805	61340805	+	Silent	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr20:61340805G>T	ENST00000370501.3	+	1	617	c.246G>T	c.(244-246)acG>acT	p.T82T		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	82					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			TGGGCAACACGGTGACGGCGT	0.657																																					p.T82T	GBM(37;400 780 6403 19663 35669)	.											.	NTSR1	524	0			c.G246T						.						90.0	63.0	72.0					20																	61340805		2203	4300	6503	SO:0001819	synonymous_variant	4923	exon1			CAACACGGTGACG		CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.246G>T	20.37:g.61340805G>T		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_002531	Q9H4H1|Q9H4T5	Silent	SNP	ENST00000370501.3	37	CCDS13502.1																																																																																			.		0.657	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080061.1		
NUCB1	4924	ucsc.edu;bcgsc.ca	37	19	49425171	49425171	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:49425171A>G	ENST00000405315.4	+	12	1595	c.1261A>G	c.(1261-1263)Aag>Gag	p.K421E	NUCB1_ENST00000263273.5_Missense_Mutation_p.K421E|NUCB1_ENST00000485798.1_3'UTR|NUCB1_ENST00000407032.1_Missense_Mutation_p.K421E	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	421						endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		GGGGCAGCTCAAGTTCCACCC	0.682																																					p.K421E		.											.	NUCB1	90	0			c.A1261G						.						15.0	17.0	16.0					19																	49425171		2197	4293	6490	SO:0001583	missense	4924	exon12			CAGCTCAAGTTCC	BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.1261A>G	19.37:g.49425171A>G	ENSP00000385923:p.Lys421Glu	Somatic	94.0	0.0		WXS	Illumina HiSeq	.	56.0	6.0	NM_006184	B2RD64|Q15838|Q7Z4J7|Q9BUR1	Missense_Mutation	SNP	ENST00000405315.4	37	CCDS12740.1	.	.	.	.	.	.	.	.	.	.	A	9.014	0.983208	0.18889	.	.	ENSG00000104805	ENST00000405315;ENST00000407032;ENST00000263273	T;T;T	0.19105	2.17;2.17;2.17	3.23	0.987	0.19790	.	0.454433	0.21179	N	0.078853	T	0.12178	0.0296	N	0.24115	0.695	0.30204	N	0.798373	B	0.24483	0.104	B	0.21708	0.036	T	0.11348	-1.0591	10	0.42905	T	0.14	.	7.4467	0.27215	0.5243:0.4757:0.0:0.0	.	421	Q02818	NUCB1_HUMAN	E	421	ENSP00000385923:K421E;ENSP00000385211:K421E;ENSP00000263273:K421E	ENSP00000263273:K421E	K	+	1	0	NUCB1	54116983	1.000000	0.71417	0.999000	0.59377	0.426000	0.31534	1.178000	0.31981	0.142000	0.18901	0.260000	0.18958	AAG	.		0.682	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
NUP205	23165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135330244	135330244	+	Silent	SNP	T	T	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:135330244T>G	ENST00000285968.6	+	41	5738	c.5712T>G	c.(5710-5712)ctT>ctG	p.L1904L		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1904					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TATTTATTCTTTGGCGCCATC	0.403											OREG0018343	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1904L		.											.	NUP205	207	0			c.T5712G						.						212.0	214.0	213.0					7																	135330244		2203	4300	6503	SO:0001819	synonymous_variant	23165	exon41			TATTCTTTGGCGC	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.5712T>G	7.37:g.135330244T>G		Somatic	125.0	0.0	1617	WXS	Illumina HiSeq	Phase_I	184.0	23.0	NM_015135	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																			.		0.403	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
NYAP2	57624	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	226378354	226378354	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:226378354C>T	ENST00000272907.6	+	3	902	c.489C>T	c.(487-489)gcC>gcT	p.A163A	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	163					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GCACTGCAGCCAGTAAGAGCG	0.537																																					p.A163A		.											.	.	.	0			c.C489T						.						57.0	71.0	66.0					2																	226378354		2059	4217	6276	SO:0001819	synonymous_variant	57624	exon3			TGCAGCCAGTAAG	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.489C>T	2.37:g.226378354C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	9.0	NM_020864	A2RRN4|Q96NL2	Silent	SNP	ENST00000272907.6	37	CCDS46529.1																																																																																			.		0.537	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
OR4A5	81318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	51411592	51411592	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:51411592C>A	ENST00000319760.6	-	1	856	c.804G>T	c.(802-804)atG>atT	p.M268I		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AAAACACAGTCATGAACTTAT	0.363																																					p.M268I		.											.	OR4A5	92	0			c.G804T						.						50.0	49.0	49.0					11																	51411592		2201	4296	6497	SO:0001583	missense	81318	exon1			CACAGTCATGAAC	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.804G>T	11.37:g.51411592C>A	ENSP00000367664:p.Met268Ile	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	16.0	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.457979	0.00173	.	.	ENSG00000221840	ENST00000319760	T	0.32753	1.44	2.2	-4.39	0.03611	GPCR, rhodopsin-like superfamily (1);	2.164420	0.02455	N	0.085995	T	0.11495	0.0280	N	0.02181	-0.65	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20306	-1.0279	10	0.31617	T	0.26	.	4.7661	0.13132	0.5323:0.1613:0.0:0.3064	.	268	Q8NH83	OR4A5_HUMAN	I	268	ENSP00000367664:M268I	ENSP00000367664:M268I	M	-	3	0	OR4A5	51268168	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-3.282000	0.00528	-2.867000	0.00324	0.162000	0.16502	ATG	.		0.363	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
OR4L1	122742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20528668	20528668	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:20528668C>T	ENST00000315683.1	+	1	465	c.465C>T	c.(463-465)caC>caT	p.H155H		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GTTTTTTACACTCCATAAGCC	0.398																																					p.H155H		.											.	OR4L1	72	0			c.C465T						.						148.0	138.0	141.0					14																	20528668		2203	4300	6503	SO:0001819	synonymous_variant	122742	exon1			TTTACACTCCATA		CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.465C>T	14.37:g.20528668C>T		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	14.0	NM_001004717	Q6IEZ5	Silent	SNP	ENST00000315683.1	37	CCDS32029.1																																																																																			.		0.398	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404381.1		
OR5L2	26338	ucsc.edu;bcgsc.ca	37	11	55595514	55595514	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:55595514G>T	ENST00000378397.1	+	1	820	c.820G>T	c.(820-822)Gcc>Tcc	p.A274S		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TGACAAAGTGGCCACCGTGTT	0.493										HNSCC(27;0.073)																											p.A274S		.											.	OR5L2	69	0			c.G820T						.						87.0	80.0	82.0					11																	55595514		2200	4296	6496	SO:0001583	missense	26338	exon1			AAAGTGGCCACCG	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.820G>T	11.37:g.55595514G>T	ENSP00000367650:p.Ala274Ser	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	50.0	6.0	NM_001004739	Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	37	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	10.09	1.256130	0.22965	.	.	ENSG00000205030	ENST00000378397	T	0.38240	1.15	5.1	1.02	0.19986	GPCR, rhodopsin-like superfamily (1);	0.124077	0.36778	N	0.002418	T	0.29061	0.0722	L	0.58925	1.835	0.09310	N	1	B	0.33919	0.432	B	0.37989	0.262	T	0.14117	-1.0484	10	0.33940	T	0.23	-15.6275	2.1487	0.03794	0.1478:0.1322:0.4477:0.2723	.	274	Q8NGL0	OR5L2_HUMAN	S	274	ENSP00000367650:A274S	ENSP00000367650:A274S	A	+	1	0	OR5L2	55352090	0.444000	0.25649	0.723000	0.30687	0.408000	0.30992	0.082000	0.14847	0.004000	0.14682	0.536000	0.68110	GCC	.		0.493	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739	
OTUD6A	139562	ucsc.edu;bcgsc.ca	37	X	69282482	69282482	+	Silent	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chrX:69282482C>A	ENST00000338352.2	+	1	142	c.108C>A	c.(106-108)acC>acA	p.T36T		NM_207320.1	NP_997203.1	Q7L8S5	OTU6A_HUMAN	OTU deubiquitinase 6A	36					protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)		ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(3)|urinary_tract(1)	23						TCCCCAAGACCGACAAGACGA	0.587																																					p.T36T		.											.	OTUD6A	541	0			c.C108A						.						32.0	29.0	30.0					X																	69282482		2203	4300	6503	SO:0001819	synonymous_variant	139562	exon1			CAAGACCGACAAG	AK098697	CCDS14395.1	Xq13.1	2014-02-24	2014-02-24			ENSG00000189401		"""OTU domain containing"""	32312	protein-coding gene	gene with protein product		300714	"""OTU domain containing 6A"""			23827681	Standard	NM_207320		Approved	FLJ25831, HSHIN6, DUBA2	uc004dxu.1	Q7L8S5		ENST00000338352.2:c.108C>A	X.37:g.69282482C>A		Somatic	61.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_207320	B2RPB7	Silent	SNP	ENST00000338352.2	37	CCDS14395.1																																																																																			.		0.587	OTUD6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358763.1	NM_207320	
P4HA2	8974	ucsc.edu;bcgsc.ca	37	5	131531150	131531150	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr5:131531150A>G	ENST00000401867.1	-	14	1963	c.1395T>C	c.(1393-1395)ggT>ggC	p.G465G	P4HA2_ENST00000166534.4_Silent_p.G465G|P4HA2_ENST00000379100.2_Silent_p.G463G|P4HA2_ENST00000379086.1_Silent_p.G463G|P4HA2-AS1_ENST00000417667.1_RNA|P4HA2_ENST00000360568.3_Silent_p.G463G|P4HA2_ENST00000379104.2_Silent_p.G465G			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	465	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	AGACGGTGGCACCACCAGCTT	0.483																																					p.G465G	Esophageal Squamous(68;117 1135 17362 19256 34242)	.											.	P4HA2	68	0			c.T1395C						.						126.0	113.0	117.0					5																	131531150		2203	4300	6503	SO:0001819	synonymous_variant	8974	exon13			GGTGGCACCACCA	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1395T>C	5.37:g.131531150A>G		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_004199	D3DQ85|D3DQ86|Q8WWN0	Silent	SNP	ENST00000401867.1	37	CCDS4151.1																																																																																			.		0.483	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199	
PABPC1	26986	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	101718907	101718907	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr8:101718907T>C	ENST00000318607.5	-	11	2702	c.1574A>G	c.(1573-1575)aAt>aGt	p.N525S	PABPC1_ENST00000519596.1_5'Flank|PABPC1_ENST00000519004.1_Missense_Mutation_p.N480S|PABPC1_ENST00000522387.1_Missense_Mutation_p.N493S|AP001205.1_ENST00000579868.1_RNA	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	525					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			TGGCTGTGCATTAAGATGTTG	0.463																																					p.N525S		.											.	PABPC1	68	0			c.A1574G						.						94.0	92.0	92.0					8																	101718907		2203	4300	6503	SO:0001583	missense	26986	exon11			TGTGCATTAAGAT	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.1574A>G	8.37:g.101718907T>C	ENSP00000313007:p.Asn525Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	16.0	NM_002568	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.05|14.05	2.419149|2.419149	0.42918|0.42918	.|.	.|.	ENSG00000070756|ENSG00000070756	ENST00000520868;ENST00000517403|ENST00000318607;ENST00000519004;ENST00000522387;ENST00000517990;ENST00000522658	.|T;T;T;T;T	.|0.44083	.|0.93;0.93;0.93;0.93;0.93	5.3|5.3	5.3|5.3	0.74995|0.74995	.|Polyadenylate-binding protein/Hyperplastic disc protein (1);	.|0.077632	.|0.52532	.|N	.|0.000071	T|T	0.29491|0.29491	0.0735|0.0735	L|L	0.29908|0.29908	0.895|0.895	0.40415|0.40415	D|D	0.979785|0.979785	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.01281	.|0.0;0.0;0.0	T|T	0.12708|0.12708	-1.0537|-1.0537	5|10	.|0.06494	.|T	.|0.89	.|.	15.5422|15.5422	0.76062|0.76062	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|493;525;525	.|E7ERJ7;B3KT93;P11940	.|.;.;PABP1_HUMAN	V|S	58;178|525;480;493;34;72	.|ENSP00000313007:N525S;ENSP00000429594:N480S;ENSP00000429395:N493S;ENSP00000428030:N34S;ENSP00000428840:N72S	.|ENSP00000313007:N525S	M|N	-|-	1|2	0|0	PABPC1|PABPC1	101788083|101788083	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.775000|4.775000	0.62346|0.62346	2.148000|2.148000	0.66965|0.66965	0.482000|0.482000	0.46254|0.46254	ATG|AAT	.		0.463	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
PADI4	23569	ucsc.edu;bcgsc.ca	37	1	17682885	17682885	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:17682885T>C	ENST00000375448.4	+	13	1515	c.1489T>C	c.(1489-1491)Tgc>Cgc	p.C497R	PADI4_ENST00000487048.1_3'UTR	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	497					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CCCCAGGTCCTGCTACAAACT	0.607																																					p.C497R		.											.	PADI4	70	0			c.T1489C						.						27.0	29.0	28.0					1																	17682885		2203	4299	6502	SO:0001583	missense	23569	exon13			AGGTCCTGCTACA	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1489T>C	1.37:g.17682885T>C	ENSP00000364597:p.Cys497Arg	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_012387	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	37	CCDS180.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.815719	0.70912	.	.	ENSG00000159339	ENST00000375448	T	0.35236	1.32	5.24	5.24	0.73138	Protein-arginine deiminase, C-terminal (1);	0.164918	0.53938	D	0.000046	T	0.69305	0.3096	M	0.94142	3.5	0.52501	D	0.999956	D	0.76494	0.999	D	0.72338	0.977	T	0.78894	-0.2024	10	0.72032	D	0.01	-30.2441	13.9872	0.64343	0.0:0.0:0.0:1.0	.	497	Q9UM07	PADI4_HUMAN	R	497	ENSP00000364597:C497R	ENSP00000364597:C497R	C	+	1	0	PADI4	17555472	1.000000	0.71417	0.987000	0.45799	0.977000	0.68977	4.972000	0.63756	1.982000	0.57802	0.533000	0.62120	TGC	.		0.607	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
PAX8	7849	ucsc.edu;bcgsc.ca	37	2	114004482	114004482	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:114004482T>C	ENST00000429538.3	-	3	234	c.40A>G	c.(40-42)Aac>Gac	p.N14D	AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000436293.2_RNA|PAX8_ENST00000397647.3_Missense_Mutation_p.N14D|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000263335.7_Missense_Mutation_p.N14D|PAX8_ENST00000263334.5_Missense_Mutation_p.N14D|PAX8_ENST00000348715.5_Missense_Mutation_p.N14D|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000553869.2_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	14	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						CCCAGCTGGTTCAGCCCTCCA	0.592			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.N14D	Ovarian(188;7 2067 9084 29802 29892)	.		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	684	0			c.A40G						.						26.0	30.0	29.0					2																	114004482		2020	4185	6205	SO:0001583	missense	7849	exon3			GCTGGTTCAGCCC	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.40A>G	2.37:g.114004482T>C	ENSP00000395498:p.Asn14Asp	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_013952	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	CCDS46398.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.732025	0.89390	.	.	ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000263334	D;D;D;D;D	0.99557	-6.16;-6.16;-6.16;-6.16;-6.16	5.1	5.1	0.69264	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99764	0.9904	H	0.97315	3.98	0.80722	D	1	P;D;D;D;D	0.89917	0.869;1.0;0.982;1.0;1.0	P;D;D;D;D	0.85130	0.84;0.997;0.971;0.996;0.985	D	0.97145	0.9827	10	0.87932	D	0	.	12.8594	0.57906	0.0:0.0:0.0:1.0	.	14;14;14;14;14	Q06710-2;Q06710-3;Q06710;Q06710-5;Q06710-4	.;.;PAX8_HUMAN;.;.	D	14	ENSP00000263335:N14D;ENSP00000380768:N14D;ENSP00000314750:N14D;ENSP00000395498:N14D;ENSP00000263334:N14D	ENSP00000263334:N14D	N	-	1	0	PAX8	113720952	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.983000	0.88140	1.931000	0.55961	0.533000	0.62120	AAC	.		0.592	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
PCIF1	63935	ucsc.edu;bcgsc.ca	37	20	44574480	44574480	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr20:44574480G>T	ENST00000372409.3	+	12	1663	c.1299G>T	c.(1297-1299)aaG>aaT	p.K433N	PCIF1_ENST00000479348.1_3'UTR	NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	433					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						TCCGGTATAAGGGAGAGATGG	0.582																																					p.K433N		.											.	PCIF1	91	0			c.G1299T						.						101.0	94.0	97.0					20																	44574480		2203	4300	6503	SO:0001583	missense	63935	exon12			GTATAAGGGAGAG	AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.1299G>T	20.37:g.44574480G>T	ENSP00000361486:p.Lys433Asn	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_022104	E1P5P1|Q54AB9|Q9NT85	Missense_Mutation	SNP	ENST00000372409.3	37	CCDS13388.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812176	0.32053	.	.	ENSG00000100982	ENST00000372409;ENST00000443130	.	.	.	5.28	4.34	0.51931	.	0.148085	0.64402	D	0.000015	T	0.46795	0.1411	L	0.43152	1.355	0.43708	D	0.996178	B	0.14805	0.011	B	0.10450	0.005	T	0.40664	-0.9551	9	0.36615	T	0.2	-17.4826	9.1434	0.36917	0.1655:0.0:0.8345:0.0	.	433	Q9H4Z3	PCIF1_HUMAN	N	433	.	ENSP00000361486:K433N	K	+	3	2	PCIF1	44007887	1.000000	0.71417	0.999000	0.59377	0.930000	0.56654	2.737000	0.47393	1.483000	0.48342	-0.259000	0.10710	AAG	.		0.582	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079550.1	NM_022104	
PDSS2	57107	ucsc.edu;bcgsc.ca	37	6	107655522	107655522	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:107655522T>C	ENST00000369037.4	-	2	588	c.311A>G	c.(310-312)gAc>gGc	p.D104G	PDSS2_ENST00000369031.4_Missense_Mutation_p.D104G|PDSS2_ENST00000453874.2_Missense_Mutation_p.D104G	NM_020381.3	NP_065114.3	Q86YH6	DLP1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 2	104					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|regulation of body fluid levels (GO:0050878)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(3)	19	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		ATTCCAGCTGTCATGTACAAG	0.478																																					p.D104G		.											.	PDSS2	92	0			c.A311G						.						79.0	71.0	74.0					6																	107655522		2203	4300	6503	SO:0001583	missense	57107	exon2			CAGCTGTCATGTA	AF254956	CCDS5059.1	6q21	2006-02-14	2006-02-14	2006-02-14	ENSG00000164494	ENSG00000164494			23041	protein-coding gene	gene with protein product		610564	"""chromosome 6 open reading frame 210"""	C6orf210		16262699	Standard	NM_020381		Approved	bA59I9.3	uc003prt.2	Q86YH6	OTTHUMG00000059359	ENST00000369037.4:c.311A>G	6.37:g.107655522T>C	ENSP00000358033:p.Asp104Gly	Somatic	23.0	0.0		WXS	Illumina HiSeq	.	38.0	5.0	NM_020381	Q33DR4|Q4G158|Q5VU38|Q5VU39|Q9NR58	Missense_Mutation	SNP	ENST00000369037.4	37	CCDS5059.1	.	.	.	.	.	.	.	.	.	.	T	11.92	1.782817	0.31502	.	.	ENSG00000164494	ENST00000369037;ENST00000453874;ENST00000369031	T;T;T	0.71934	-0.61;-0.05;0.95	5.56	5.56	0.83823	Terpenoid synthase (2);	0.248404	0.45361	D	0.000362	T	0.55321	0.1913	L	0.47190	1.495	0.50813	D	0.999895	P;B;P;P	0.48589	0.799;0.046;0.912;0.912	B;B;B;B	0.41412	0.272;0.059;0.356;0.356	T	0.63422	-0.6641	10	0.52906	T	0.07	.	14.6085	0.68498	0.0:0.0:0.0:1.0	.	104;104;104;104	B4DKU5;Q86YH6-2;B2RE48;Q86YH6	.;.;.;DLP1_HUMAN	G	104	ENSP00000358033:D104G;ENSP00000399691:D104G;ENSP00000358027:D104G	ENSP00000358027:D104G	D	-	2	0	PDSS2	107762215	1.000000	0.71417	0.874000	0.34290	0.422000	0.31414	6.681000	0.74523	2.254000	0.74563	0.459000	0.35465	GAC	.		0.478	PDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131954.1	NM_020381	
PGBD2	267002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	249211485	249211485	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:249211485C>T	ENST00000329291.5	+	3	849	c.702C>T	c.(700-702)aaC>aaT	p.N234N	PGBD2_ENST00000462488.1_3'UTR|PGBD2_ENST00000539153.1_Silent_p.N231N|PGBD2_ENST00000355360.4_5'UTR	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	234										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CAGATAACAACGAACTTGATG	0.433																																					p.N234N		.											.	PGBD2	91	0			c.C702T						.						109.0	111.0	111.0					1																	249211485		2203	4300	6503	SO:0001819	synonymous_variant	267002	exon3			TAACAACGAACTT	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.702C>T	1.37:g.249211485C>T		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	8.0	NM_170725	B3KVR8|Q6MZF8	Silent	SNP	ENST00000329291.5	37	CCDS31128.1																																																																																			.		0.433	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
PGLS	25796	ucsc.edu;bcgsc.ca	37	19	17627038	17627038	+	Silent	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:17627038C>A	ENST00000252603.2	+	2	389	c.345C>A	c.(343-345)ccC>ccA	p.P115P	CTD-3131K8.3_ENST00000596192.1_RNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	115					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CCATTAACCCCGAGCTGCCTG	0.597																																					p.P115P		.											.	PGLS	90	0			c.C345A						.						90.0	70.0	77.0					19																	17627038		2203	4300	6503	SO:0001819	synonymous_variant	25796	exon2			TAACCCCGAGCTG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.345C>A	19.37:g.17627038C>A		Somatic	73.0	0.0		WXS	Illumina HiSeq	.	61.0	5.0	NM_012088		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			.		0.597	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
PHF20	51230	broad.mit.edu;bcgsc.ca	37	20	34389481	34389481	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr20:34389481T>C	ENST00000374012.3	+	2	166	c.37T>C	c.(37-39)Ttt>Ctt	p.F13L	PHF20_ENST00000439301.1_Missense_Mutation_p.F13L|PHF20_ENST00000481202.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	13	Tudor 1.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					AGGAATCAGCTTTGAAGTGGG	0.398																																					p.F13L		.											.	PHF20	515	0			c.T37C						.						69.0	67.0	67.0					20																	34389481		2203	4300	6503	SO:0001583	missense	51230	exon2			ATCAGCTTTGAAG	AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.37T>C	20.37:g.34389481T>C	ENSP00000363124:p.Phe13Leu	Somatic	40.0	1.0		WXS	Illumina HiSeq	Phase_I	68.0	6.0	NM_016436	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	ENST00000374012.3	37	CCDS13268.1	.	.	.	.	.	.	.	.	.	.	T	19.92	3.915753	0.73098	.	.	ENSG00000025293	ENST00000374012;ENST00000439301;ENST00000339089;ENST00000374000	T;T;T;T	0.60424	0.95;0.21;0.19;0.24	5.73	5.73	0.89815	Tudor domain (1);	0.000000	0.85682	D	0.000000	T	0.68988	0.3061	L	0.51914	1.62	0.58432	D	0.999999	D	0.69078	0.997	D	0.70716	0.97	T	0.65467	-0.6161	10	0.27082	T	0.32	.	15.0035	0.71492	0.0:0.0:0.0:1.0	.	13	Q9BVI0	PHF20_HUMAN	L	13	ENSP00000363124:F13L;ENSP00000410373:F13L;ENSP00000341900:F13L;ENSP00000363112:F13L	ENSP00000341900:F13L	F	+	1	0	PHF20	33852895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.030000	0.64128	2.186000	0.69663	0.459000	0.35465	TTT	.		0.398	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078949.2	NM_016436	
PHRF1	57661	ucsc.edu;bcgsc.ca	37	11	611703	611703	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:611703A>G	ENST00000264555.5	+	18	5004	c.4876A>G	c.(4876-4878)Aag>Gag	p.K1626E	PHRF1_ENST00000416188.2_Missense_Mutation_p.K1625E|PHRF1_ENST00000533464.1_Missense_Mutation_p.K1622E|PHRF1_ENST00000413872.2_Missense_Mutation_p.K1624E	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1626					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GTACGTGGACAAGTACAGGCA	0.622																																					p.K1625E		.											.	PHRF1	22	0			c.A4873G						.						55.0	62.0	59.0					11																	611703		2135	4262	6397	SO:0001583	missense	57661	exon18			GTGGACAAGTACA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.4876A>G	11.37:g.611703A>G	ENSP00000264555:p.Lys1626Glu	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	A	15.28	2.785760	0.49997	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	4.58	3.4	0.38934	.	0.000000	0.37669	N	0.001998	T	0.78641	0.4315	M	0.82193	2.58	0.43824	D	0.996399	D;D;D;D	0.89917	0.982;0.994;1.0;1.0	D;D;D;D	0.83275	0.952;0.992;0.996;0.992	T	0.80547	-0.1334	10	0.87932	D	0	-49.8234	11.5333	0.50622	0.8495:0.1505:0.0:0.0	.	1622;1624;1625;1626	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	E	1626;1624;1625;1622	ENSP00000264555:K1626E;ENSP00000388589:K1624E;ENSP00000410626:K1625E;ENSP00000431870:K1622E	ENSP00000264555:K1626E	K	+	1	0	PHRF1	601703	1.000000	0.71417	0.993000	0.49108	0.190000	0.23558	5.737000	0.68606	0.809000	0.34255	0.459000	0.35465	AAG	.		0.622	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
PKD1L1	168507	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	47937789	47937789	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:47937789T>C	ENST00000289672.2	-	14	2117	c.2067A>G	c.(2065-2067)atA>atG	p.I689M		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	689	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GAGACCTCCATATCTAAGTAT	0.408																																					p.I689M		.											.	PKD1L1	145	0			c.A2067G						.						53.0	49.0	51.0					7																	47937789		2203	4300	6503	SO:0001583	missense	168507	exon14			CCTCCATATCTAA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.2067A>G	7.37:g.47937789T>C	ENSP00000289672:p.Ile689Met	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	4.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.577404	0.45902	.	.	ENSG00000158683	ENST00000289672	T	0.21191	2.02	4.76	-9.51	0.00581	Egg jelly receptor, REJ-like (1);	0.871455	0.09311	N	0.819546	T	0.08758	0.0217	L	0.38175	1.15	0.19300	N	0.999976	P	0.43788	0.817	B	0.36244	0.22	T	0.01195	-1.1422	10	0.28530	T	0.3	-7.4556	1.3252	0.02124	0.1831:0.3124:0.2556:0.2488	.	689	Q8TDX9	PK1L1_HUMAN	M	689	ENSP00000289672:I689M	ENSP00000289672:I689M	I	-	3	3	PKD1L1	47904314	0.005000	0.15991	0.011000	0.14972	0.677000	0.39632	-2.515000	0.00955	-3.143000	0.00233	-0.312000	0.09012	ATA	.		0.408	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PLA2G4D	283748	ucsc.edu;bcgsc.ca	37	15	42364567	42364567	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr15:42364567T>C	ENST00000290472.3	-	14	1435	c.1341A>G	c.(1339-1341)ggA>ggG	p.G447G		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	447	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		CGGCTCTCTGTCCTGACAGCT	0.597																																					p.G447G		.											.	PLA2G4D	136	0			c.A1341G						.						141.0	138.0	139.0					15																	42364567		2203	4299	6502	SO:0001819	synonymous_variant	283748	exon14			TCTCTGTCCTGAC	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.1341A>G	15.37:g.42364567T>C		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_178034	Q8N176	Silent	SNP	ENST00000290472.3	37	CCDS32203.1																																																																																			.		0.597	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034	
C10orf55	414236	ucsc.edu;bcgsc.ca	37	10	75672838	75672838	+	Intron	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr10:75672838G>A	ENST00000409178.1	-	3	268				PLAU_ENST00000494287.1_3'UTR|PLAU_ENST00000372764.3_Missense_Mutation_p.G117E|PLAU_ENST00000446342.1_Missense_Mutation_p.G100E|C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000372762.4_Missense_Mutation_p.G81E	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					CTGGGCCTGGGGAAACATAAT	0.572																																					p.G117E		.											.	PLAU	118	0			c.G350A						.						58.0	56.0	57.0					10																	75672838		2203	4300	6503	SO:0001627	intron_variant	5328	exon5			GCCTGGGGAAACA		CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.73-5C>T	10.37:g.75672838G>A		Somatic	42.0	1.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_002658	Q3KRG4|Q8NAK4	Missense_Mutation	SNP	ENST00000409178.1	37	CCDS53541.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500756	0.85176	.	.	ENSG00000122861	ENST00000446342;ENST00000372764;ENST00000372762;ENST00000372761	T;T;T	0.64085	-0.08;-0.08;-0.08	5.68	5.68	0.88126	Kringle (5);Kringle-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78496	0.4292	M	0.75447	2.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.989	D;D;D;P	0.91635	0.999;0.999;0.999;0.893	T	0.78455	-0.2197	9	.	.	.	.	15.2821	0.73794	0.0:0.0:1.0:0.0	.	100;81;117;117	E7ET40;E7ESM2;B2R7F2;P00749	.;.;.;UROK_HUMAN	E	100;117;81;81	ENSP00000388474:G100E;ENSP00000361850:G117E;ENSP00000361848:G81E	.	G	+	2	0	PLAU	75342844	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.859000	0.69539	2.672000	0.90937	0.650000	0.86243	GGG	.		0.572	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048746.1	NM_001001791	
PLCB3	5331	ucsc.edu;bcgsc.ca	37	11	64031511	64031511	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:64031511T>C	ENST00000540288.1	+	22	2682	c.2579T>C	c.(2578-2580)aTc>aCc	p.I860T	PLCB3_ENST00000325234.5_Missense_Mutation_p.I793T|PLCB3_ENST00000279230.6_Missense_Mutation_p.I860T	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	860					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						GAGGCCCTGATCAACCCCATT	0.662																																					p.I860T		.											.	PLCB3	228	0			c.T2579C						.						54.0	60.0	58.0					11																	64031511		2201	4297	6498	SO:0001583	missense	5331	exon22			CCCTGATCAACCC	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2579T>C	11.37:g.64031511T>C	ENSP00000443631:p.Ile860Thr	Somatic	62.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_000932	A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	t	11.96	1.793593	0.31685	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.20463	2.2;2.2;2.07	5.25	5.25	0.73442	.	0.106937	0.64402	D	0.000007	T	0.11452	0.0279	N	0.12182	0.205	0.41461	D	0.988043	B;B	0.18741	0.03;0.003	B;B	0.20577	0.03;0.011	T	0.18023	-1.0350	10	0.25751	T	0.34	.	8.7921	0.34857	0.0:0.0862:0.0:0.9138	.	793;860	G5E960;Q01970	.;PLCB3_HUMAN	T	860;860;793	ENSP00000279230:I860T;ENSP00000443631:I860T;ENSP00000324660:I793T	ENSP00000279230:I860T	I	+	2	0	PLCB3	63788087	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.814000	0.48010	1.990000	0.58119	0.454000	0.30748	ATC	.		0.662	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
PMS1	5378	hgsc.bcm.edu;broad.mit.edu	37	2	190719433	190719433	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:190719433delG	ENST00000441310.2	+	9	1668	c.1435delG	c.(1435-1437)gggfs	p.G479fs	PMS1_ENST00000409823.3_Frame_Shift_Del_p.G440fs|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000447232.2_Frame_Shift_Del_p.G479fs|PMS1_ENST00000432292.3_Frame_Shift_Del_p.G303fs|PMS1_ENST00000418224.3_Frame_Shift_Del_p.G303fs	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	479					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AGATGAGAGTGGGGAAAATGA	0.388			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																													p.G479fs		.	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	.	PMS1	1396	0			c.1435delG						.						48.0	52.0	51.0					2																	190719433		2196	4298	6494	SO:0001589	frameshift_variant	5378	exon9			GAGAGTGGGGAAA		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.1435delG	2.37:g.190719433delG	ENSP00000406490:p.Gly479fs	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	14.0	NM_001128144	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Frame_Shift_Del	DEL	ENST00000441310.2	37	CCDS2302.1																																																																																			.		0.388	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2		
PROM2	150696	ucsc.edu;bcgsc.ca	37	2	95942074	95942074	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:95942074C>T	ENST00000317620.9	+	4	730	c.597C>T	c.(595-597)ggC>ggT	p.G199G	PROM2_ENST00000403131.2_Silent_p.G199G|PROM2_ENST00000463580.1_Intron|PROM2_ENST00000542147.1_Silent_p.G199G|PROM2_ENST00000317668.4_Silent_p.G199G	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	199					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GCCTCTGGGGCCTGGTCTCTG	0.637																																					p.G199G		.											.	PROM2	91	0			c.C597T						.						97.0	81.0	87.0					2																	95942074		2203	4300	6503	SO:0001819	synonymous_variant	150696	exon4			CTGGGGCCTGGTC	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.597C>T	2.37:g.95942074C>T		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_001165977	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Silent	SNP	ENST00000317620.9	37	CCDS2012.1																																																																																			.		0.637	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
PRR16	51334	ucsc.edu;bcgsc.ca	37	5	120021742	120021742	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr5:120021742A>G	ENST00000407149.2	+	2	462	c.253A>G	c.(253-255)Agt>Ggt	p.S85G	PRR16_ENST00000505123.1_Missense_Mutation_p.S15G|PRR16_ENST00000446965.1_Missense_Mutation_p.S15G|PRR16_ENST00000379551.2_Missense_Mutation_p.S62G			Q569H4	LARGN_HUMAN	proline rich 16	85					positive regulation of cell size (GO:0045793)|positive regulation of translation (GO:0045727)					endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		TAGTAGCTCAAGTGGCACAAC	0.532																																					p.S62G		.											.	PRR16	71	0			c.A184G						.						113.0	103.0	107.0					5																	120021742		2203	4300	6503	SO:0001583	missense	51334	exon3			AGCTCAAGTGGCA	AF242769	CCDS4127.1, CCDS75290.1	5q23.1	2006-08-22			ENSG00000184838	ENSG00000184838			29654	protein-coding gene	gene with protein product		615931				15971941	Standard	XM_005272010		Approved	DSC54	uc003ksp.3	Q569H4	OTTHUMG00000128903	ENST00000407149.2:c.253A>G	5.37:g.120021742A>G	ENSP00000385118:p.Ser85Gly	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_016644	D3DSZ0|Q8IXY1|Q9NYI5	Missense_Mutation	SNP	ENST00000407149.2	37		.	.	.	.	.	.	.	.	.	.	A	18.78	3.697340	0.68386	.	.	ENSG00000184838	ENST00000407149;ENST00000379551;ENST00000509923;ENST00000505123;ENST00000446965	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.74030	0.3663	M	0.71036	2.16	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.76071	0.987;0.987	T	0.75202	-0.3401	9	.	.	.	-11.7358	14.5163	0.67821	1.0:0.0:0.0:0.0	.	85;62	Q569H4;Q569H4-3	PRR16_HUMAN;.	G	85;62;15;15;15	ENSP00000385118:S85G;ENSP00000368869:S62G;ENSP00000421256:S15G;ENSP00000423446:S15G;ENSP00000405491:S15G	.	S	+	1	0	PRR16	120049641	1.000000	0.71417	0.788000	0.31933	0.912000	0.54170	8.885000	0.92439	2.076000	0.62316	0.454000	0.30748	AGT	.		0.532	PRR16-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371059.1	NM_016644	
PTPDC1	138639	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	96870207	96870207	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:96870207G>A	ENST00000375360.3	+	10	2586	c.2246G>A	c.(2245-2247)gGc>gAc	p.G749D	PTPDC1_ENST00000288976.3_Missense_Mutation_p.G801D	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	749					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						ACAAAAGATGGCCCTAAGCCT	0.378																																					p.G803D		.											.	PTPDC1	227	0			c.G2408A						.						26.0	27.0	27.0					9																	96870207		2201	4298	6499	SO:0001583	missense	138639	exon9			AAGATGGCCCTAA	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.2246G>A	9.37:g.96870207G>A	ENSP00000364509:p.Gly749Asp	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	11.0	NM_001253829	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888815	0.33348	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.16073	2.39;2.37	5.71	1.92	0.25849	.	0.604103	0.18814	N	0.130440	T	0.18215	0.0437	L	0.57536	1.79	0.09310	N	1	B;B;B;B	0.31680	0.335;0.328;0.335;0.083	B;B;B;B	0.34242	0.086;0.178;0.086;0.025	T	0.12426	-1.0548	10	0.59425	D	0.04	-0.8526	9.0699	0.36486	0.2712:0.0:0.7288:0.0	.	803;801;803;749	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	D	749;801	ENSP00000364509:G749D;ENSP00000288976:G801D	ENSP00000288976:G801D	G	+	2	0	PTPDC1	95910028	0.007000	0.16637	0.000000	0.03702	0.682000	0.39822	1.565000	0.36386	0.105000	0.17753	0.650000	0.86243	GGC	.		0.378	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
PTPRK	5796	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	128326319	128326319	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:128326319T>C	ENST00000368215.3	-	15	2400	c.2401A>G	c.(2401-2403)Atg>Gtg	p.M801V	PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368207.3_Missense_Mutation_p.M812V|PTPRK_ENST00000368227.3_Missense_Mutation_p.M802V|PTPRK_ENST00000368210.3_Missense_Mutation_p.M802V|PTPRK_ENST00000368226.4_Missense_Mutation_p.M802V|PTPRK_ENST00000532331.1_Missense_Mutation_p.M802V|PTPRK_ENST00000368213.5_Missense_Mutation_p.M802V			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	801					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CTTCGATCCATTGCATTCACC	0.438																																					p.M802V		.											.	PTPRK	231	0			c.A2404G						.						123.0	101.0	108.0					6																	128326319		2202	4299	6501	SO:0001583	missense	5796	exon15			GATCCATTGCATT	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2401A>G	6.37:g.128326319T>C	ENSP00000357198:p.Met801Val	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	7.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	37		.	.	.	.	.	.	.	.	.	.	T	6.661	0.490529	0.12702	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000415055;ENST00000427676	T;T;T;T;T;T;T;T	0.09073	3.2;3.2;3.21;3.2;3.2;3.21;3.2;3.02	5.87	5.87	0.94306	.	0.037662	0.85682	D	0.000000	T	0.02455	0.0075	L	0.33245	0.995	0.58432	D	0.99999	B;B;B;B;B;B	0.33904	0.431;0.001;0.003;0.014;0.012;0.021	B;B;B;B;B;B	0.26969	0.075;0.002;0.006;0.032;0.011;0.025	T	0.31251	-0.9950	10	0.08599	T	0.76	.	16.2654	0.82577	0.0:0.0:0.0:1.0	.	812;802;802;683;801;802	B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.;.;.;.;PTPRK_HUMAN;.	V	802;802;802;802;802;801;812;45;683	ENSP00000357209:M802V;ENSP00000357210:M802V;ENSP00000432973:M802V;ENSP00000357196:M802V;ENSP00000357193:M802V;ENSP00000357198:M801V;ENSP00000357190:M812V;ENSP00000408180:M45V	ENSP00000357190:M812V	M	-	1	0	PTPRK	128368012	1.000000	0.71417	0.960000	0.40013	0.970000	0.65996	6.299000	0.72770	2.243000	0.73865	0.528000	0.53228	ATG	.		0.438	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
PZP	5858	ucsc.edu;bcgsc.ca	37	12	9333676	9333676	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:9333676A>G	ENST00000261336.2	-	15	1770	c.1742T>C	c.(1741-1743)cTg>cCg	p.L581P	PZP_ENST00000381997.2_Missense_Mutation_p.L450P	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	581					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						TGCTACTTGCAGGTGGGCATG	0.557																																					p.L581P	Melanoma(125;1402 1695 4685 34487 38571)	.											.	PZP	157	0			c.T1742C						.						81.0	62.0	68.0					12																	9333676		2203	4300	6503	SO:0001583	missense	5858	exon15			ACTTGCAGGTGGG	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1742T>C	12.37:g.9333676A>G	ENSP00000261336:p.Leu581Pro	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	37.0	5.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	A	9.571	1.120989	0.20877	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.69561	-0.41;-0.41	3.03	3.03	0.35002	Alpha-2-macroglobulin, N-terminal 2 (1);	0.162599	0.27000	U	0.021439	D	0.84669	0.5523	H	0.95816	3.725	0.20307	N	0.999919	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.75566	-0.3273	10	0.87932	D	0	.	9.2295	0.37428	1.0:0.0:0.0:0.0	.	450;581	P20742-2;P20742	.;PZP_HUMAN	P	581;450	ENSP00000261336:L581P;ENSP00000371427:L450P	ENSP00000261336:L581P	L	-	2	0	PZP	9224943	0.862000	0.29867	0.199000	0.23439	0.033000	0.12548	4.619000	0.61218	1.352000	0.45808	0.383000	0.25322	CTG	.		0.557	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
QSER1	79832	ucsc.edu;bcgsc.ca	37	11	32956305	32956305	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:32956305A>G	ENST00000399302.2	+	4	3449	c.3114A>G	c.(3112-3114)ccA>ccG	p.P1038P	QSER1_ENST00000527788.1_Silent_p.P799P	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1038										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					CAATGAACCCAGCTAGGAGTG	0.433																																					p.P1038P		.											.	QSER1	95	0			c.A3114G						.						83.0	80.0	81.0					11																	32956305		1941	4138	6079	SO:0001819	synonymous_variant	79832	exon4			GAACCCAGCTAGG	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.3114A>G	11.37:g.32956305A>G		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001076786	Q6ZU30|Q6ZUR5	Silent	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.041964	0.00402	.	.	ENSG00000060749	ENST00000524678	.	.	.	5.64	-11.3	0.00108	.	.	.	.	.	T	0.13372	0.0324	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.08186	-1.0734	4	.	.	.	.	1.028	0.01532	0.204:0.1845:0.3329:0.2786	.	.	.	.	R	59	.	.	Q	+	2	0	QSER1	32912881	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.273000	0.02823	-3.471000	0.00157	-0.313000	0.08912	CAG	.		0.433	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
RABGGTA	5875	ucsc.edu;bcgsc.ca	37	14	24737766	24737766	+	Silent	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:24737766G>T	ENST00000399409.3	-	9	1443	c.960C>A	c.(958-960)gtC>gtA	p.V320V	RABGGTA_ENST00000216840.6_Silent_p.V320V|RABGGTA_ENST00000559586.1_5'Flank|RABGGTA_ENST00000560777.1_Intron	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	320					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		CTGTCCAAATGACGCGAAATG	0.547																																					p.V320V		.											.	.	.	0			c.C960A						.						99.0	102.0	101.0					14																	24737766		2059	4204	6263	SO:0001819	synonymous_variant	5875	exon9			CCAAATGACGCGA		CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.960C>A	14.37:g.24737766G>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_004581	A8K5N2|D3DS69	Silent	SNP	ENST00000399409.3	37	CCDS45088.1																																																																																			.		0.547	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415308.5	NM_182836	
RAD54L2	23132	ucsc.edu;bcgsc.ca	37	3	51696480	51696480	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:51696480A>G	ENST00000409535.2	+	22	3573	c.3448A>G	c.(3448-3450)Aga>Gga	p.R1150G	RAD54L2_ENST00000296477.3_Missense_Mutation_p.R844G	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1150						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		AAGCAACGGCAGACACAGTGC	0.572																																					p.R1150G		.											.	RAD54L2	93	0			c.A3448G						.						62.0	65.0	64.0					3																	51696480		2203	4300	6503	SO:0001583	missense	23132	exon22			AACGGCAGACACA	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.3448A>G	3.37:g.51696480A>G	ENSP00000386520:p.Arg1150Gly	Somatic	55.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_015106	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	37	CCDS33765.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.83|12.83	2.056302|2.056302	0.36277|0.36277	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000432863|ENST00000409535;ENST00000296477	.|D;D	.|0.93604	.|-3.17;-3.25	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.172662	.|0.51477	.|D	.|0.000090	D|D	0.86669|0.86669	0.5988|0.5988	N|N	0.24115|0.24115	0.695|0.695	0.47778|0.47778	D|D	0.999516|0.999516	.|B;P	.|0.42827	.|0.0;0.791	.|B;B	.|0.31751	.|0.001;0.135	D|D	0.88507|0.88507	0.3086|0.3086	5|10	.|0.62326	.|D	.|0.03	-10.6837|-10.6837	14.9357|14.9357	0.70954|0.70954	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1150;739	.|Q9Y4B4;B3KV54	.|ARIP4_HUMAN;.	R|G	978|1150;844	.|ENSP00000386520:R1150G;ENSP00000296477:R844G	.|ENSP00000296477:R844G	Q|R	+|+	2|1	0|2	RAD54L2|RAD54L2	51671520|51671520	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.159000|4.159000	0.58157|0.58157	2.118000|2.118000	0.64928|0.64928	0.460000|0.460000	0.39030|0.39030	CAG|AGA	.		0.572	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	109347859	109347859	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:109347859G>T	ENST00000283195.6	+	4	460	c.334G>T	c.(334-336)Gga>Tga	p.G112*		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	112					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TGTTACTGATGGAAGAGCAAA	0.338																																					p.G112X		.											.	RANBP2	675	0			c.G334T						.						129.0	144.0	139.0					2																	109347859		2203	4299	6502	SO:0001587	stop_gained	5903	exon4			ACTGATGGAAGAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.334G>T	2.37:g.109347859G>T	ENSP00000283195:p.Gly112*	Somatic	858.0	0.0		WXS	Illumina HiSeq	Phase_I	841.0	110.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Nonsense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	33	5.273520	0.95459	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-25.9233	18.5845	0.91183	0.0:0.0:1.0:0.0	.	.	.	.	X	112	.	ENSP00000283195:G112X	G	+	1	0	RANBP2	108714291	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.531000	0.67148	2.477000	0.83638	0.573000	0.79308	GGA	.		0.338	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RANBP2	5903	ucsc.edu;bcgsc.ca	37	2	109392308	109392308	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:109392308T>C	ENST00000283195.6	+	24	8539	c.8413T>C	c.(8413-8415)Tca>Cca	p.S2805P		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2805					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						ATCCATTAGTTCACCATCTGT	0.363																																					p.S2805P		.											.	RANBP2	675	0			c.T8413C						.						126.0	125.0	125.0					2																	109392308		2203	4300	6503	SO:0001583	missense	5903	exon24			ATTAGTTCACCAT	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.8413T>C	2.37:g.109392308T>C	ENSP00000283195:p.Ser2805Pro	Somatic	34.0	1.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.683391	0.47991	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.28255	1.62	5.8	4.69	0.59074	.	.	.	.	.	T	0.26738	0.0654	L	0.51422	1.61	0.09310	N	1	B	0.31730	0.337	B	0.31614	0.133	T	0.19160	-1.0314	9	0.49607	T	0.09	-0.0787	6.1383	0.20245	0.1267:0.0:0.2677:0.6056	.	2805	P49792	RBP2_HUMAN	P	1829;2805	ENSP00000283195:S2805P	ENSP00000283195:S2805P	S	+	1	0	RANBP2	108758740	0.007000	0.16637	0.003000	0.11579	0.030000	0.12068	0.860000	0.27871	2.219000	0.72066	0.533000	0.62120	TCA	.		0.363	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RBM33	155435	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	155457902	155457902	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:155457902C>G	ENST00000401878.3	+	2	275	c.77C>G	c.(76-78)gCg>gGg	p.A26G	RBM33_ENST00000287912.3_Missense_Mutation_p.A26G|RBM33_ENST00000392759.3_Missense_Mutation_p.A26G	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	26							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		AAGCCTGGCGCGGAACGGTCG	0.458																																					p.A26G		.											.	RBM33	23	0			c.C77G						.						118.0	125.0	123.0					7																	155457902		2030	4185	6215	SO:0001583	missense	155435	exon2			CTGGCGCGGAACG	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.77C>G	7.37:g.155457902C>G	ENSP00000384160:p.Ala26Gly	Somatic	87.0	1.0		WXS	Illumina HiSeq	Phase_I	103.0	20.0	NM_053043	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	ENST00000401878.3	37	CCDS5941.2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158841	0.78226	.	.	ENSG00000184863	ENST00000287912;ENST00000401878;ENST00000392759	T;T;T	0.32515	1.45;1.45;1.45	5.95	5.95	0.96441	.	.	.	.	.	T	0.52964	0.1767	L	0.52573	1.65	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.48151	-0.9060	9	0.66056	D	0.02	.	19.1646	0.93551	0.0:1.0:0.0:0.0	.	26;26	Q96EV2;Q96EV2-2	RBM33_HUMAN;.	G	26	ENSP00000287912:A26G;ENSP00000384160:A26G;ENSP00000376513:A26G	ENSP00000287912:A26G	A	+	2	0	RBM33	155150663	1.000000	0.71417	0.985000	0.45067	0.993000	0.82548	4.931000	0.63469	2.824000	0.97209	0.655000	0.94253	GCG	.		0.458	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
RUNDC1	146923	ucsc.edu;bcgsc.ca	37	17	41143616	41143616	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:41143616G>T	ENST00000361677.1	+	5	1737	c.1725G>T	c.(1723-1725)atG>atT	p.M575I		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	575	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		GGAGCTACATGGCACACACAG	0.567																																					p.M575I		.											.	RUNDC1	90	0			c.G1725T						.						76.0	61.0	66.0					17																	41143616		2203	4300	6503	SO:0001583	missense	146923	exon5			CTACATGGCACAC	AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1725G>T	17.37:g.41143616G>T	ENSP00000354622:p.Met575Ile	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_173079	Q6Y2K8|Q8IXT9|Q8N3W1	Missense_Mutation	SNP	ENST00000361677.1	37	CCDS11448.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677242	0.88445	.	.	ENSG00000198863	ENST00000361677	T	0.11495	2.77	4.91	4.91	0.64330	RUN (3);	0.000000	0.85682	D	0.000000	T	0.24275	0.0588	L	0.51422	1.61	0.80722	D	1	D	0.63880	0.993	P	0.60415	0.874	T	0.00770	-1.1573	10	0.26408	T	0.33	-35.6474	18.2709	0.90068	0.0:0.0:1.0:0.0	.	575	Q96C34	RUND1_HUMAN	I	575	ENSP00000354622:M575I	ENSP00000354622:M575I	M	+	3	0	RUNDC1	38397142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.642000	0.98461	2.538000	0.85594	0.655000	0.94253	ATG	.		0.567	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452464.1	NM_173079	
SAYSD1	55776	ucsc.edu;bcgsc.ca	37	6	39082692	39082692	+	Silent	SNP	G	G	T	rs534026071	byFrequency	TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:39082692G>T	ENST00000229903.4	-	1	273	c.174C>A	c.(172-174)ccC>ccA	p.P58P	SAYSD1_ENST00000481599.1_5'UTR	NM_018322.1	NP_060792.1	Q9NPB0	SMDC1_HUMAN	SAYSVFN motif domain containing 1	58						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)											GGGCACTCGCGGGCCTAGGTT	0.657																																					p.P58P		.											.	.	.	0			c.C174A						.						36.0	44.0	41.0					6																	39082692		2203	4300	6503	SO:0001819	synonymous_variant	55776	exon1			ACTCGCGGGCCTA	BC022007	CCDS4840.1	6p21.1	2011-12-13	2011-12-13	2011-12-13	ENSG00000112167	ENSG00000112167			21025	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 64"""	C6orf64			Standard	XM_005249222		Approved	FLJ11101	uc003ook.1	Q9NPB0	OTTHUMG00000014641	ENST00000229903.4:c.174C>A	6.37:g.39082692G>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_018322	Q9H0D8	Silent	SNP	ENST00000229903.4	37	CCDS4840.1																																																																																			.		0.657	SAYSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040448.1	NM_018322	
SCAPER	49855	ucsc.edu;bcgsc.ca	37	15	77092703	77092703	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr15:77092703G>A	ENST00000563290.1	-	7	592	c.497C>T	c.(496-498)cCa>cTa	p.P166L	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000562890.1_5'Flank|SCAPER_ENST00000324767.7_Missense_Mutation_p.P166L			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	166						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CAATGATGTTGGTCTGCGAAT	0.363																																					p.P166L		.											.	SCAPER	137	0			c.C497T						.						101.0	90.0	94.0					15																	77092703		1830	4091	5921	SO:0001583	missense	49855	exon6			GATGTTGGTCTGC	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.497C>T	15.37:g.77092703G>A	ENSP00000454973:p.Pro166Leu	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	70.0	6.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917409	0.92249	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.51574	0.7	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.71787	0.3381	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.91635	0.999;0.958	T	0.76759	-0.2841	10	0.87932	D	0	.	18.4362	0.90646	0.0:0.0:1.0:0.0	.	166;181	Q6NSF1;Q9BY12-2	.;.	L	166;182	ENSP00000326924:P166L	ENSP00000303560:P182L	P	-	2	0	SCAPER	74879758	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.413000	0.97351	2.332000	0.79248	0.650000	0.86243	CCA	.		0.363	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
SCML1	6322	ucsc.edu;bcgsc.ca	37	X	17769993	17769993	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chrX:17769993C>T	ENST00000380041.3	+	7	1090	c.762C>T	c.(760-762)caC>caT	p.H254H	SCML1_ENST00000380045.3_Silent_p.H133H|SCML1_ENST00000398080.1_Silent_p.H133H|SCML1_ENST00000380043.3_Silent_p.H227H	NM_001037540.1	NP_001032629.1	Q9UN30	SCML1_HUMAN	sex comb on midleg-like 1 (Drosophila)	254					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)	10	Hepatocellular(33;0.183)					TCACTAAGCACCCTTCAACCT	0.433																																					p.H254H		.											.	SCML1	290	0			c.C762T						.						273.0	221.0	239.0					X																	17769993		2203	4300	6503	SO:0001819	synonymous_variant	6322	exon7			TAAGCACCCTTCA		CCDS14182.2, CCDS35210.1, CCDS35211.1	Xp22	2013-01-10	2001-11-28		ENSG00000047634	ENSG00000047634		"""Sterile alpha motif (SAM) domain containing"""	10580	protein-coding gene	gene with protein product		300227	"""sex comb on midleg (Drosophila)-like 1"""			9570953	Standard	XM_005274578		Approved		uc004cyc.3	Q9UN30	OTTHUMG00000021206	ENST00000380041.3:c.762C>T	X.37:g.17769993C>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_001037540	B0FZN6|B2RA08|Q5H968|Q5H969	Silent	SNP	ENST00000380041.3	37	CCDS35210.1																																																																																			.		0.433	SCML1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060495.5	NM_006746	
SCN3B	55800	ucsc.edu;bcgsc.ca	37	11	123516373	123516373	+	Silent	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:123516373G>T	ENST00000392770.2	-	2	943	c.141C>A	c.(139-141)tcC>tcA	p.S47S	SCN3B_ENST00000299333.3_Silent_p.S47S|SCN3B_ENST00000530277.1_Silent_p.S47S	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	47	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTCATGCAGGAGATGCAGC	0.582																																					p.S47S		.											.	SCN3B	156	0			c.C141A						.						126.0	122.0	123.0					11																	123516373		2202	4299	6501	SO:0001819	synonymous_variant	55800	exon2			CATGCAGGAGATG	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.141C>A	11.37:g.123516373G>T		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_018400	A5H1I5|Q17RL3|Q9ULR2	Silent	SNP	ENST00000392770.2	37	CCDS8442.1																																																																																			.		0.582	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	NM_018400	
SCUBE3	222663	ucsc.edu;bcgsc.ca	37	6	35201068	35201068	+	Silent	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:35201068G>A	ENST00000274938.7	+	6	702	c.702G>A	c.(700-702)aaG>aaA	p.K234K	SCUBE3_ENST00000394681.1_Silent_p.K234K	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CCGACGGGAAGACATGCATCG	0.612																																					p.K234K		.											.	SCUBE3	91	0			c.G702A						.						50.0	46.0	47.0					6																	35201068		2203	4300	6503	SO:0001819	synonymous_variant	222663	exon6			CGGGAAGACATGC	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.702G>A	6.37:g.35201068G>A		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	52.0	4.0	NM_152753		Silent	SNP	ENST00000274938.7	37	CCDS4800.1																																																																																			.		0.612	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
SLC1A3	6507	ucsc.edu;bcgsc.ca	37	5	36684024	36684024	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr5:36684024A>G	ENST00000265113.4	+	9	1824	c.1348A>G	c.(1348-1350)Act>Gct	p.T450A	SLC1A3_ENST00000381918.3_Intron|CTD-2353F22.1_ENST00000510740.1_RNA	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	450					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGGCCTGGTCACTATGGTCAT	0.532																																					p.T450A		.											.	SLC1A3	90	0			c.A1348G						.						134.0	113.0	120.0					5																	36684024		2203	4300	6503	SO:0001583	missense	6507	exon9			CTGGTCACTATGG		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1348A>G	5.37:g.36684024A>G	ENSP00000265113:p.Thr450Ala	Somatic	62.0	0.0		WXS	Illumina HiSeq	.	57.0	5.0	NM_004172	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	37	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	A	31	5.075832	0.94000	.	.	ENSG00000079215	ENST00000265113;ENST00000427100	T	0.58506	0.33	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	M	0.72576	2.205	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.78334	-0.2244	10	0.87932	D	0	-29.8904	16.0502	0.80755	1.0:0.0:0.0:0.0	.	450	P43003	EAA1_HUMAN	A	450;398	ENSP00000265113:T450A	ENSP00000265113:T450A	T	+	1	0	SLC1A3	36719781	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	9.332000	0.96446	2.197000	0.70478	0.528000	0.53228	ACT	.		0.532	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
SLC9C1	285335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111996688	111996688	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:111996688G>A	ENST00000305815.5	-	5	590	c.338C>T	c.(337-339)cCc>cTc	p.P113L	SLC9C1_ENST00000467397.1_5'Flank|SLC9C1_ENST00000487372.1_Missense_Mutation_p.P113L	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	113					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										CAAAAAGCCGGGAATTGAAAT	0.303																																					p.P113L		.											.	.	.	0			c.C338T						.						45.0	52.0	50.0					3																	111996688		2191	4297	6488	SO:0001583	missense	285335	exon5			AAGCCGGGAATTG	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.338C>T	3.37:g.111996688G>A	ENSP00000306627:p.Pro113Leu	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	28.0	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	37	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.381080	0.24944	.	.	ENSG00000172139	ENST00000305815;ENST00000487372;ENST00000486574	T;T;T	0.19532	2.14;2.14;2.14	5.13	5.13	0.70059	Cation/H+ exchanger (1);	0.000000	0.50627	D	0.000118	T	0.38585	0.1046	L	0.55481	1.735	0.48040	D	0.999571	D;D	0.89917	0.967;1.0	P;D	0.91635	0.752;0.999	T	0.05419	-1.0886	10	0.17369	T	0.5	.	14.0939	0.65008	0.0:0.0:1.0:0.0	.	113;113	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	L	113;113;40	ENSP00000306627:P113L;ENSP00000420688:P113L;ENSP00000417274:P40L	ENSP00000306627:P113L	P	-	2	0	SLC9A10	113479378	1.000000	0.71417	0.923000	0.36655	0.005000	0.04900	4.760000	0.62235	2.375000	0.81037	0.655000	0.94253	CCC	.		0.303	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
SMYD5	10322	ucsc.edu;bcgsc.ca	37	2	73447311	73447311	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:73447311A>G	ENST00000389501.4	+	3	383	c.338A>G	c.(337-339)cAt>cGt	p.H113R	SMYD5_ENST00000474652.1_3'UTR	NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	113	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						AACTGTCCCCATTGCCAAGTG	0.602																																					p.H113R		.											.	SMYD5	226	0			c.A338G						.						39.0	40.0	40.0					2																	73447311		2002	4180	6182	SO:0001583	missense	10322	exon3			GTCCCCATTGCCA	U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.338A>G	2.37:g.73447311A>G	ENSP00000374152:p.His113Arg	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_006062	D6W5H3|Q13558	Missense_Mutation	SNP	ENST00000389501.4	37	CCDS33221.2	.	.	.	.	.	.	.	.	.	.	A	0.016	-1.512882	0.00975	.	.	ENSG00000135632	ENST00000389501;ENST00000443900	T	0.42131	0.98	5.73	1.78	0.24846	SET domain (2);	0.360223	0.33691	N	0.004650	T	0.11367	0.0277	N	0.01048	-1.04	0.29920	N	0.822854	B	0.02656	0.0	B	0.04013	0.001	T	0.20672	-1.0268	10	0.12103	T	0.63	-10.9641	4.7274	0.12948	0.5426:0.1561:0.3012:0.0	.	113	Q6GMV2	SMYD5_HUMAN	R	113;86	ENSP00000374152:H113R	ENSP00000374152:H113R	H	+	2	0	SMYD5	73300819	0.924000	0.31332	1.000000	0.80357	0.125000	0.20455	2.129000	0.42055	0.515000	0.28320	0.533000	0.62120	CAT	.		0.602	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318301.1	NM_006062	
SPP1	6696	ucsc.edu;bcgsc.ca	37	4	88901220	88901220	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr4:88901220C>A	ENST00000395080.3	+	4	243	c.116C>A	c.(115-117)gCt>gAt	p.A39D	SPP1_ENST00000509659.1_3'UTR|SPP1_ENST00000360804.4_Intron|SPP1_ENST00000237623.7_Missense_Mutation_p.A39D	NM_001040058.1|NM_001251830.1	NP_001035147.1|NP_001238759.1	P10451	OSTP_HUMAN	secreted phosphoprotein 1	39					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|negative regulation of collateral sprouting of intact axon in response to injury (GO:0048685)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell-substrate adhesion (GO:0010811)|response to steroid hormone (GO:0048545)|response to vitamin D (GO:0033280)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix binding (GO:0050840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(1)	13		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)		TACCCAGATGCTGTGGCCACA	0.358																																					p.A52D		.											.	SPP1	555	0			c.C155A						.						99.0	100.0	100.0					4																	88901220		2203	4300	6503	SO:0001583	missense	6696	exon5			CAGATGCTGTGGC		CCDS3626.1, CCDS34027.1, CCDS43250.1	4q22.1	2014-01-30	2008-07-31		ENSG00000118785	ENSG00000118785		"""Endogenous ligands"""	11255	protein-coding gene	gene with protein product	"""early T-lymphocyte activation 1"""	166490	"""osteopontin"", ""bone sialoprotein I"""	BNSP, OPN		1575754	Standard	NM_001251829		Approved	BSPI, ETA-1	uc003hra.3	P10451	OTTHUMG00000130599	ENST00000395080.3:c.116C>A	4.37:g.88901220C>A	ENSP00000378517:p.Ala39Asp	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001251830	B2RDA1|Q15681|Q15682|Q15683|Q4W597|Q567T5|Q8NBK2|Q96IZ1	Missense_Mutation	SNP	ENST00000395080.3	37	CCDS43250.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303346	0.60195	.	.	ENSG00000118785	ENST00000359072;ENST00000237623;ENST00000395080	T;T	0.36157	1.27;1.27	5.62	2.5	0.30297	.	0.852017	0.10277	N	0.694002	T	0.32763	0.0840	L	0.59436	1.845	0.09310	N	0.999998	B;B;B	0.18461	0.025;0.028;0.028	B;B;B	0.25291	0.059;0.026;0.026	T	0.28106	-1.0054	10	0.39692	T	0.17	-7.0643	4.8363	0.13466	0.3857:0.5118:0.0:0.1025	.	52;39;39	B7Z351;B2RDA1;P10451	.;.;OSTP_HUMAN	D	39	ENSP00000237623:A39D;ENSP00000378517:A39D	ENSP00000237623:A39D	A	+	2	0	SPP1	89120244	0.955000	0.32602	0.124000	0.21820	0.985000	0.73830	0.624000	0.24462	1.338000	0.45544	0.643000	0.83706	GCT	.		0.358	SPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253048.3		
SPTBN1	6711	ucsc.edu;bcgsc.ca	37	2	54885138	54885138	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:54885138A>G	ENST00000356805.4	+	30	6479	c.6198A>G	c.(6196-6198)gcA>gcG	p.A2066A	SPTBN1_ENST00000333896.5_Silent_p.A2053A	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	2066	Interaction with ANK2.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AAAAGTCTGCAGCAACCTGGG	0.572											OREG0014619	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A2066A		.											.	SPTBN1	140	0			c.A6198G						.						69.0	67.0	68.0					2																	54885138		2203	4300	6503	SO:0001819	synonymous_variant	6711	exon30			GTCTGCAGCAACC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.6198A>G	2.37:g.54885138A>G		Somatic	36.0	0.0	1003	WXS	Illumina HiSeq	.	42.0	4.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	ENST00000356805.4	37	CCDS33198.1																																																																																			.		0.572	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
ST6GALNAC5	81849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	77528691	77528691	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:77528691T>C	ENST00000477717.1	+	5	1046	c.811T>C	c.(811-813)Tat>Cat	p.Y271H		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	271					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						ACCTTATCATTATTATGAACC	0.403																																					p.Y271H		.											.	ST6GALNAC5	92	0			c.T811C						.						117.0	117.0	117.0					1																	77528691		2203	4300	6503	SO:0001583	missense	81849	exon5			TATCATTATTATG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.811T>C	1.37:g.77528691T>C	ENSP00000417583:p.Tyr271His	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	12.0	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	37	CCDS673.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572262	0.86542	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.71461	-0.57	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.87071	0.6086	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90710	0.4627	10	0.87932	D	0	-24.81	16.3789	0.83431	0.0:0.0:0.0:1.0	.	271	Q9BVH7	SIA7E_HUMAN	H	271;181	ENSP00000417583:Y271H	ENSP00000406658:Y181H	Y	+	1	0	ST6GALNAC5	77301279	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.649000	0.83500	2.267000	0.75376	0.533000	0.62120	TAT	.		0.403	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
STRAP	11171	ucsc.edu;bcgsc.ca	37	12	16053885	16053885	+	Silent	SNP	A	A	G	rs375283378		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:16053885A>G	ENST00000419869.2	+	9	1243	c.930A>G	c.(928-930)gaA>gaG	p.E310E	STRAP_ENST00000025399.6_Silent_p.E323E|STRAP_ENST00000538352.1_Silent_p.E216E	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein	310					maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				TTACAGAAGAAGATAGTGGTG	0.373																																					p.E310E		.											.	STRAP	228	0			c.A930G						.	A		1,4405	2.1+/-5.4	0,1,2202	67.0	65.0	66.0		930	2.5	1.0	12		66	0,8600		0,0,4300	no	coding-synonymous	STRAP	NM_007178.3		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		310/351	16053885	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11171	exon9			AGAAGAAGATAGT	AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.930A>G	12.37:g.16053885A>G		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_007178	B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Silent	SNP	ENST00000419869.2	37	CCDS8676.1																																																																																			.		0.373	STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401114.1	NM_007178	
STRN3	29966	ucsc.edu;bcgsc.ca	37	14	31382855	31382855	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:31382855T>C	ENST00000357479.5	-	10	1445	c.1249A>G	c.(1249-1251)Ata>Gta	p.I417V	STRN3_ENST00000355683.5_Missense_Mutation_p.I333V|STRN3_ENST00000366206.2_Intron	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3	417					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		GGAAACGTTATTGGTTCAGCT	0.378																																					p.I417V		.											.	STRN3	226	0			c.A1249G						.						130.0	134.0	133.0					14																	31382855		2203	4300	6503	SO:0001583	missense	29966	exon10			ACGTTATTGGTTC		CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.1249A>G	14.37:g.31382855T>C	ENSP00000350071:p.Ile417Val	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001083893	A2RTX7|A6NHZ7|Q9NRA5	Missense_Mutation	SNP	ENST00000357479.5	37	CCDS41938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.32|13.32	2.201493|2.201493	0.38905|0.38905	.|.	.|.	ENSG00000196792|ENSG00000196792	ENST00000355683;ENST00000357479;ENST00000554991|ENST00000556577	T;T|.	0.60672|.	0.17;2.28|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.047316|.	0.85682|.	D|.	0.000000|.	T|T	0.54647|0.54647	0.1871|0.1871	N|N	0.25647|0.25647	0.755|0.755	0.50039|0.50039	D|D	0.999849|0.999849	B;B|.	0.18461|.	0.017;0.028|.	B;B|.	0.19391|.	0.025;0.016|.	T|T	0.51172|0.51172	-0.8739|-0.8739	10|5	0.15066|.	T|.	0.55|.	-14.346|-14.346	16.087|16.087	0.81065|0.81065	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	333;417|.	Q13033-2;Q13033|.	.;STRN3_HUMAN|.	V|S	333;417;98|130	ENSP00000347909:I333V;ENSP00000350071:I417V|.	ENSP00000347909:I333V|.	I|N	-|-	1|2	0|0	STRN3|STRN3	30452606|30452606	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.207000|4.207000	0.58480|0.58480	2.202000|2.202000	0.70862|0.70862	0.533000|0.533000	0.62120|0.62120	ATA|AAT	.		0.378	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409713.1	NM_014574	
STYK1	55359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10775259	10775259	+	Silent	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:10775259C>A	ENST00000075503.3	-	9	1465	c.945G>T	c.(943-945)ctG>ctT	p.L315L		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	315	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						TCTCATAGAGCAGGATCCCAA	0.378										HNSCC(73;0.22)																											p.L315L		.											.	STYK1	1379	0			c.G945T						.						153.0	142.0	146.0					12																	10775259		2203	4300	6503	SO:0001819	synonymous_variant	55359	exon9			ATAGAGCAGGATC	AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.945G>T	12.37:g.10775259C>A		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	15.0	NM_018423	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Silent	SNP	ENST00000075503.3	37	CCDS8629.1																																																																																			.		0.378	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423	
TBCCD1	55171	ucsc.edu;bcgsc.ca	37	3	186272531	186272531	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:186272531T>C	ENST00000424280.1	-	6	1535	c.1056A>G	c.(1054-1056)acA>acG	p.T352T	TBCCD1_ENST00000338733.5_Silent_p.T352T|TBCCD1_ENST00000446782.1_Silent_p.T256T|TBCCD1_ENST00000479590.1_5'Flank	NM_001134415.1	NP_001127887.1	Q9NVR7	TBCC1_HUMAN	TBCC domain containing 1	352	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|cytoskeleton organization (GO:0007010)|maintenance of centrosome location (GO:0051661)|maintenance of Golgi location (GO:0051684)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|spindle pole centrosome (GO:0031616)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|skin(1)	17	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.3e-21)	GBM - Glioblastoma multiforme(93;0.0474)		ACTTCTCAATTGTCACAGATC	0.353																																					p.T352T		.											.	TBCCD1	108	0			c.A1056G						.						36.0	36.0	36.0					3																	186272531		2203	4299	6502	SO:0001819	synonymous_variant	55171	exon6			CTCAATTGTCACA	BC025748	CCDS3276.1, CCDS75061.1	3q27.3	2006-03-09			ENSG00000113838	ENSG00000113838			25546	protein-coding gene	gene with protein product						12477932	Standard	NM_001134415		Approved	FLJ10560	uc003fqg.3	Q9NVR7	OTTHUMG00000156613	ENST00000424280.1:c.1056A>G	3.37:g.186272531T>C		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001134415	B3KW69|D3DNU6|G5E9J4	Silent	SNP	ENST00000424280.1	37	CCDS3276.1																																																																																			.		0.353	TBCCD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344774.1	NM_018138	
THBS1	7057	ucsc.edu;bcgsc.ca	37	15	39880779	39880779	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr15:39880779T>C	ENST00000260356.5	+	10	1689	c.1524T>C	c.(1522-1524)tgT>tgC	p.C508C		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	508	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CTGTCACCTGTGGAGGAGGGG	0.493																																					p.C508C		.											.	THBS1	653	0			c.T1524C						.						85.0	82.0	83.0					15																	39880779		2200	4297	6497	SO:0001819	synonymous_variant	7057	exon10			CACCTGTGGAGGA		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.1524T>C	15.37:g.39880779T>C		Somatic	31.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	ENST00000260356.5	37	CCDS32194.1																																																																																			.		0.493	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
TIGIT	201633	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	114018501	114018501	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:114018501T>C	ENST00000486257.1	+	4	706	c.449T>C	c.(448-450)cTg>cCg	p.L150P	TIGIT_ENST00000383671.3_Missense_Mutation_p.L150P|TIGIT_ENST00000481065.1_Missense_Mutation_p.L217P			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	150					negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						GCCGCGACGCTGGTGGTCATC	0.592																																					p.L150P		.											.	TIGIT	90	0			c.T449C						.						88.0	73.0	78.0					3																	114018501		2203	4300	6503	SO:0001583	missense	201633	exon3			CGACGCTGGTGGT	AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.449T>C	3.37:g.114018501T>C	ENSP00000419085:p.Leu150Pro	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	7.0	NM_173799	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	ENST00000486257.1	37	CCDS2980.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.307462	0.23821	.	.	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.66995	0.1;-0.24;-0.19;-0.19;0.11	4.31	1.92	0.25849	.	0.436670	0.17450	N	0.173817	T	0.48466	0.1501	L	0.34521	1.04	0.20403	N	0.999908	B	0.30033	0.266	B	0.23419	0.046	T	0.29912	-0.9996	10	0.36615	T	0.2	-0.8515	6.541	0.22380	0.0:0.16:0.0:0.84	.	150	Q495A1	TIGIT_HUMAN	P	129;217;150;150;129	ENSP00000418917:L129P;ENSP00000420552:L217P;ENSP00000419085:L150P;ENSP00000373167:L150P;ENSP00000419706:L129P	ENSP00000373167:L150P	L	+	2	0	TIGIT	115501191	0.001000	0.12720	0.003000	0.11579	0.191000	0.23601	0.858000	0.27845	0.300000	0.22699	0.459000	0.35465	CTG	.		0.592	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354690.1	NM_173799	
TIMELESS	8914	ucsc.edu;bcgsc.ca	37	12	56814376	56814376	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:56814376C>G	ENST00000553532.1	-	26	3355	c.3205G>C	c.(3205-3207)Gtt>Ctt	p.V1069L	TIMELESS_ENST00000229201.4_Missense_Mutation_p.V1068L|TIMELESS_ENST00000554616.1_Missense_Mutation_p.V566L					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GGGGGCCGAACCCCTAGCTTG	0.522																																					p.V1069L		.											.	TIMELESS	159	0			c.G3205C						.						116.0	98.0	104.0					12																	56814376		2203	4300	6503	SO:0001583	missense	8914	exon26			GCCGAACCCCTAG	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.3205G>C	12.37:g.56814376C>G	ENSP00000450607:p.Val1069Leu	Somatic	100.0	0.0		WXS	Illumina HiSeq	.	83.0	9.0	NM_003920		Missense_Mutation	SNP	ENST00000553532.1	37	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	C	1.566	-0.535474	0.04082	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.09630	2.96;2.96;2.96	5.34	-0.334	0.12666	Timeless C-terminal (1);	0.587860	0.16987	N	0.191480	T	0.03959	0.0111	N	0.12887	0.27	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.44697	-0.9311	10	0.05525	T	0.97	-5.4829	6.1046	0.20067	0.1282:0.3257:0.0:0.5461	.	1069	Q9UNS1	TIM_HUMAN	L	1068;1069;566	ENSP00000229201:V1068L;ENSP00000450607:V1069L;ENSP00000450848:V566L	ENSP00000229201:V1069L	V	-	1	0	TIMELESS	55100643	0.063000	0.20901	0.904000	0.35570	0.581000	0.36288	-0.106000	0.10890	-0.022000	0.13986	-0.291000	0.09656	GTT	.		0.522	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
TLE4	7091	ucsc.edu;bcgsc.ca	37	9	82334962	82334962	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:82334962A>G	ENST00000376552.2	+	16	2610	c.1592A>G	c.(1591-1593)aAc>aGc	p.N531S	TLE4_ENST00000265284.6_Splice_Site_p.N506S|TLE4_ENST00000376544.3_Splice_Site_p.N462S|TLE4_ENST00000376537.4_Splice_Site_p.N563S|TLE4_ENST00000376520.4_Splice_Site_p.N563S|TLE4_ENST00000376534.4_Splice_Site_p.N168S	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	531					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TCTCTACAGAACAGGGATAAC	0.458																																					p.N531S		.											.	TLE4	524	0			c.A1592G						.						73.0	71.0	72.0					9																	82334962		2201	4300	6501	SO:0001630	splice_region_variant	7091	exon16			TACAGAACAGGGA	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1591-1A>G	9.37:g.82334962A>G		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_007005	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	37	CCDS43837.1	.	.	.	.	.	.	.	.	.	.	A	16.98	3.270384	0.59540	.	.	ENSG00000106829	ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000376534;ENST00000265284	T;T;T;T;T;T	0.10668	2.85;2.85;2.85;2.85;2.85;2.85	5.5	5.5	0.81552	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.07007	0.0178	N	0.12569	0.235	0.80722	D	1	B;B;B;P	0.36660	0.367;0.106;0.21;0.564	B;B;B;B	0.31245	0.042;0.007;0.061;0.126	T	0.38329	-0.9666	10	0.44086	T	0.13	-29.7529	15.6101	0.76710	1.0:0.0:0.0:0.0	.	506;462;563;531	F8W6T6;Q04727-2;Q04727-3;Q04727	.;.;.;TLE4_HUMAN	S	531;462;563;563;168;506	ENSP00000365735:N531S;ENSP00000365727:N462S;ENSP00000365703:N563S;ENSP00000365720:N563S;ENSP00000365717:N168S;ENSP00000265284:N506S	ENSP00000265284:N506S	N	+	2	0	TLE4	81524782	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	2.085000	0.62840	0.482000	0.46254	AAC	.		0.458	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	Missense_Mutation
TM4SF5	9032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4686278	4686278	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:4686278C>T	ENST00000270560.3	+	4	556	c.525C>T	c.(523-525)atC>atT	p.I175I		NM_003963.2	NP_003954.2	O14894	T4S5_HUMAN	transmembrane 4 L six family member 5	175						integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(3)|ovary(1)	6						TGTGTGGGATCCAGCTGGTGA	0.597																																					p.I175I		.											.	TM4SF5	91	0			c.C525T						.						123.0	104.0	110.0					17																	4686278		2203	4300	6503	SO:0001819	synonymous_variant	9032	exon4			TGGGATCCAGCTG	AF027204	CCDS11054.1	17p13.3	2007-01-06	2005-03-21		ENSG00000142484	ENSG00000142484			11857	protein-coding gene	gene with protein product		604657	"""transmembrane 4 superfamily member 5"""			9479038	Standard	NM_003963		Approved		uc002fyw.1	O14894	OTTHUMG00000090776	ENST00000270560.3:c.525C>T	17.37:g.4686278C>T		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	20.0	NM_003963	Q17RW9|Q6IB79	Silent	SNP	ENST00000270560.3	37	CCDS11054.1																																																																																			.		0.597	TM4SF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207558.2		
TMEM205	374882	ucsc.edu;bcgsc.ca	37	19	11453629	11453629	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:11453629T>C	ENST00000354882.5	-	3	858	c.432A>G	c.(430-432)cgA>cgG	p.R144R	TMEM205_ENST00000588560.1_Silent_p.R144R|TMEM205_ENST00000586218.1_Silent_p.R83R|TMEM205_ENST00000589555.1_Silent_p.R144R|TMEM205_ENST00000586956.1_Silent_p.R144R|RAB3D_ENST00000589655.1_Intron|TMEM205_ENST00000587948.1_Silent_p.R144R|CCDC159_ENST00000588790.1_5'Flank|TMEM205_ENST00000586590.1_Silent_p.R144R|TMEM205_ENST00000593256.2_Silent_p.R144R|TMEM205_ENST00000447337.1_Silent_p.R144R			Q6UW68	TM205_HUMAN	transmembrane protein 205	144						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						GGTCCTTCTCTCGCAGCTGGC	0.622																																					p.R144R		.											.	TMEM205	22	0			c.A432G						.						101.0	90.0	94.0					19																	11453629		2203	4300	6503	SO:0001819	synonymous_variant	374882	exon4			CTTCTCTCGCAGC	AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68		ENST00000354882.5:c.432A>G	19.37:g.11453629T>C		Somatic	120.0	0.0		WXS	Illumina HiSeq	.	61.0	6.0	NM_033408		Silent	SNP	ENST00000354882.5	37	CCDS32909.1																																																																																			.		0.622	TMEM205-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458743.1	NM_198536	
TMEM243	79161	broad.mit.edu;bcgsc.ca	37	7	86826043	86826043	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:86826043G>A	ENST00000433078.1	-	5	707	c.266C>T	c.(265-267)cCg>cTg	p.P89L	TMEM243_ENST00000257637.3_Missense_Mutation_p.P89L|TMEM243_ENST00000481425.1_5'UTR			Q9BU79	TM243_HUMAN	transmembrane protein 243, mitochondrial	89						integral component of membrane (GO:0016021)											TCTAAATTTCGGTTCTAAGTC	0.299																																					p.P89L		.											.	.	.	0			c.C266T						.						70.0	69.0	69.0					7																	86826043		2203	4300	6503	SO:0001583	missense	79161	exon4			AATTTCGGTTCTA		CCDS5602.1	7q21.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000135185	ENSG00000135185			21707	protein-coding gene	gene with protein product	"""MDR1 and mitochondrial taxol resistance associated gene"""		"""chromosome 7 open reading frame 23"""	C7orf23			Standard	NM_024315		Approved	MGC4175, MM-TRAG	uc003uio.3	Q9BU79	OTTHUMG00000130823	ENST00000433078.1:c.266C>T	7.37:g.86826043G>A	ENSP00000398083:p.Pro89Leu	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	6.0	NM_024315	A4D1C6|B2R9I4|D6W5P1	Missense_Mutation	SNP	ENST00000433078.1	37	CCDS5602.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256694	0.80246	.	.	ENSG00000135185	ENST00000257637;ENST00000433078	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.82820	0.5120	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83359	0.0001	9	0.87932	D	0	.	19.5254	0.95203	0.0:0.0:1.0:0.0	.	89	Q9BU79	CG023_HUMAN	L	89	.	ENSP00000257637:P89L	P	-	2	0	C7orf23	86663979	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.476000	0.97823	2.857000	0.98124	0.650000	0.86243	CCG	.		0.299	TMEM243-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334412.1	NM_024315	
TMPPE	643853	ucsc.edu;bcgsc.ca	37	3	33135113	33135113	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:33135113G>T	ENST00000342462.4	-	2	765	c.575C>A	c.(574-576)aCt>aAt	p.T192N	GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Intron|GLB1_ENST00000399402.3_Intron|GLB1_ENST00000445488.2_Intron|TMPPE_ENST00000416695.2_Missense_Mutation_p.T55N	NM_001039770.2	NP_001034859.2	Q6ZT21	TMPPE_HUMAN	transmembrane protein with metallophosphoesterase domain	192						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|large_intestine(5)|lung(6)|prostate(1)	13						CACCTCCACAGTTTTCACAGC	0.607																																					p.T192N		.											.	TMPPE	90	0			c.C575A						.						70.0	70.0	70.0					3																	33135113		2203	4300	6503	SO:0001583	missense	643853	exon2			TCCACAGTTTTCA	AK126979	CCDS33732.1, CCDS46786.1	3p22.3	2014-02-12	2009-02-24		ENSG00000188167	ENSG00000188167			33865	protein-coding gene	gene with protein product							Standard	NM_001039770		Approved	FLJ45032	uc003cfk.2	Q6ZT21	OTTHUMG00000155779	ENST00000342462.4:c.575C>A	3.37:g.33135113G>T	ENSP00000343398:p.Thr192Asn	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	49.0	5.0	NM_001039770	B2RNG5|Q6ZRG1	Missense_Mutation	SNP	ENST00000342462.4	37	CCDS33732.1	.	.	.	.	.	.	.	.	.	.	G	0.790	-0.759087	0.03019	.	.	ENSG00000188167	ENST00000416695;ENST00000342462	.	.	.	5.87	5.87	0.94306	.	0.278758	0.29493	N	0.011992	T	0.40398	0.1115	L	0.43923	1.385	0.09310	N	1	B	0.19935	0.04	B	0.12837	0.008	T	0.16571	-1.0398	9	0.21540	T	0.41	-23.857	14.7378	0.69430	0.0:0.1443:0.8557:0.0	.	192	Q6ZT21	TMPPE_HUMAN	N	55;192	.	ENSP00000343398:T192N	T	-	2	0	TMPPE	33110117	0.150000	0.22732	0.465000	0.27155	0.245000	0.25701	2.321000	0.43805	2.780000	0.95670	0.655000	0.94253	ACT	.		0.607	TMPPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341566.1	NM_001039770	
TNN	63923	ucsc.edu;bcgsc.ca	37	1	175097282	175097282	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:175097282T>C	ENST00000239462.4	+	14	3273	c.3160T>C	c.(3160-3162)Tcc>Ccc	p.S1054P		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1054	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CAGAAATGTATCCACCACCCT	0.557																																					p.S1054P		.											.	TNN	138	0			c.T3160C						.						81.0	72.0	75.0					1																	175097282		2203	4300	6503	SO:0001583	missense	63923	exon14			AATGTATCCACCA	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3160T>C	1.37:g.175097282T>C	ENSP00000239462:p.Ser1054Pro	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	T	13.06	2.125558	0.37533	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.28255	1.62	5.78	4.61	0.57282	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.299706	0.33401	N	0.004947	T	0.36936	0.0985	M	0.74881	2.28	0.09310	N	1	P	0.43662	0.814	P	0.45610	0.487	T	0.42396	-0.9454	10	0.62326	D	0.03	.	6.6576	0.22996	0.3156:0.0:0.1186:0.5657	.	1054	Q9UQP3	TENN_HUMAN	P	1054;877	ENSP00000239462:S1054P	ENSP00000239462:S1054P	S	+	1	0	TNN	173363905	0.000000	0.05858	0.313000	0.25210	0.579000	0.36224	0.229000	0.17833	2.212000	0.71576	0.260000	0.18958	TCC	.		0.557	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TOPBP1	11073	ucsc.edu;bcgsc.ca	37	3	133331301	133331301	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:133331301C>A	ENST00000260810.5	-	24	4098	c.3967G>T	c.(3967-3969)Gca>Tca	p.A1323S		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1323	BRCT 7. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TTCCCAGCTGCCACTGAGGCT	0.468								Other conserved DNA damage response genes																													p.A1323S	Ovarian(21;193 658 4424 15423 17362)	.											.	TOPBP1	540	0			c.G3967T						.						81.0	85.0	84.0					3																	133331301		1994	4182	6176	SO:0001583	missense	11073	exon24			CAGCTGCCACTGA	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3967G>T	3.37:g.133331301C>A	ENSP00000260810:p.Ala1323Ser	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_007027	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	CCDS46919.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090541	0.94149	.	.	ENSG00000163781	ENST00000260810	T	0.80304	-1.36	5.48	5.48	0.80851	BRCT (4);	0.000000	0.85682	D	0.000000	D	0.88916	0.6567	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.87728	0.2577	10	0.41790	T	0.15	.	19.3587	0.94425	0.0:1.0:0.0:0.0	.	1323	Q92547	TOPB1_HUMAN	S	1323	ENSP00000260810:A1323S	ENSP00000260810:A1323S	A	-	1	0	TOPBP1	134813991	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	7.818000	0.86416	2.573000	0.86826	0.655000	0.94253	GCA	.		0.468	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7577531	7577531	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:7577531delG	ENST00000269305.4	-	7	939	c.750delC	c.(748-750)cccfs	p.P250fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.P250fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P250fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.P250fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P250fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.P250fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	250	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> Q (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(5)|p.P250P(4)|p.P250L(2)|p.M246_P250delMNRRP(2)|p.P250_L252delPIL(2)|p.P250Q(2)|p.N247_P250delNRRP(1)|p.R248_P250delRRP(1)|p.P250_T253delPILT(1)|p.P250_I251insXXXXXX(1)|p.P250_I251insXXXXXXX(1)|p.R249_P250delRP(1)|p.P250_I251insX(1)|p.I251fs*96(1)|p.R249_T256delRPILTIIT(1)|p.R249_I251delRPI(1)|p.I251fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGATGGGCCTCCGGT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P250fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,-1	TP53	70225	36	Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Substitution - Missense(4)|Substitution - coding silent(4)|Insertion - In frame(3)|Insertion - Frameshift(2)	biliary_tract(5)|breast(4)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(3)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|genital_tract(1)|peritoneum(1)|oesophagus(1)|lung(1)|ovary(1)	c.750delC						.						154.0	112.0	126.0					17																	7577531		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GAGGATGGGCCTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.750delC	17.37:g.7577531delG	ENSP00000269305:p.Pro250fs	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	354.0	91.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRIM51	84767	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55657422	55657422	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:55657422G>A	ENST00000449290.2	+	6	858	c.766G>A	c.(766-768)Gag>Aag	p.E256K	TRIM51_ENST00000244891.3_Missense_Mutation_p.E113K	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	256						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TTGCAGGTATGAGTCTCTGCT	0.453																																					p.E256K		.											.	.	.	0			c.G766A						.						63.0	57.0	59.0					11																	55657422		2201	4296	6497	SO:0001583	missense	84767	exon6			AGGTATGAGTCTC	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.766G>A	11.37:g.55657422G>A	ENSP00000395086:p.Glu256Lys	Somatic	185.0	1.0		WXS	Illumina HiSeq	Phase_I	234.0	23.0	NM_032681	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	37		.	.	.	.	.	.	.	.	.	.	.	6.704	0.498546	0.12762	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.05649	3.41;3.41	0.471	0.471	0.16752	.	.	.	.	.	T	0.09818	0.0241	M	0.82823	2.61	0.09310	N	1	B	0.32425	0.371	B	0.31337	0.128	T	0.17623	-1.0363	8	0.37606	T	0.19	.	.	.	.	.	256	Q9BSJ1	SPRY5_HUMAN	K	256;113	ENSP00000395086:E256K;ENSP00000244891:E113K	ENSP00000244891:E113K	E	+	1	0	SPRYD5	55413998	0.029000	0.19370	0.041000	0.18516	0.068000	0.16541	0.704000	0.25661	0.500000	0.27991	0.162000	0.16502	GAG	.		0.453	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
TSPAN18	90139	ucsc.edu;bcgsc.ca	37	11	44939590	44939590	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:44939590G>T	ENST00000520358.2	+	6	741	c.326G>T	c.(325-327)aGg>aTg	p.R109M	TSPAN18_ENST00000340160.3_Missense_Mutation_p.R109M			Q96SJ8	TSN18_HUMAN	tetraspanin 18	109						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						TTCATCTTCAGGGAAAATGTA	0.557																																					p.R109M		.											.	TSPAN18	68	0			c.G326T						.						125.0	108.0	114.0					11																	44939590		2203	4299	6502	SO:0001583	missense	90139	exon5			TCTTCAGGGAAAA	AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.326G>T	11.37:g.44939590G>T	ENSP00000429993:p.Arg109Met	Somatic	24.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_130783	Q6UY44|Q8NBI9	Missense_Mutation	SNP	ENST00000520358.2	37	CCDS7910.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.302907|4.302907	0.81136|0.81136	.|.	.|.	ENSG00000157570|ENSG00000157570	ENST00000518429|ENST00000533786;ENST00000533080;ENST00000520358;ENST00000520999;ENST00000340160	.|T;T;T;T;T	.|0.81163	.|-1.46;-1.46;-1.46;-1.46;-1.46	5.24|5.24	5.24|5.24	0.73138|0.73138	.|Tetraspanin, EC2 domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89213|0.89213	0.6651|0.6651	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.77557	.|0.979;0.99	D|D	0.89139|0.89139	0.3515|0.3515	5|10	.|0.49607	.|T	.|0.09	.|.	18.8352|18.8352	0.92159|0.92159	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|109;109	.|Q8WUV1;Q96SJ8	.|.;TSN18_HUMAN	H|M	112|109;44;109;119;109	.|ENSP00000433592:R109M;ENSP00000433362:R44M;ENSP00000429993:R109M;ENSP00000427942:R119M;ENSP00000339820:R109M	.|ENSP00000339820:R109M	Q|R	+|+	3|2	2|0	TSPAN18|TSPAN18	44896166|44896166	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.987000|0.987000	0.75469|0.75469	8.062000|8.062000	0.89475|0.89475	2.449000|2.449000	0.82847|0.82847	0.561000|0.561000	0.74099|0.74099	CAG|AGG	.		0.557	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376197.3	NM_130783	
TRPC6	7225	ucsc.edu;bcgsc.ca	37	11	101353776	101353776	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:101353776G>T	ENST00000344327.3	-	5	1838	c.1414C>A	c.(1414-1416)Cct>Act	p.P472T	TRPC6_ENST00000532133.1_Missense_Mutation_p.P472T|TRPC6_ENST00000360497.4_Missense_Mutation_p.P417T|TRPC6_ENST00000348423.4_Missense_Mutation_p.P356T	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	472					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GTTTCATTAGGAAGGAGTTTT	0.428																																					p.P472T	Colon(166;1315 1927 11094 12848 34731)	.											.	TRPC6	93	0			c.C1414A						.						173.0	150.0	158.0					11																	101353776		2203	4299	6502	SO:0001583	missense	7225	exon5			CATTAGGAAGGAG	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1414C>A	11.37:g.101353776G>T	ENSP00000340913:p.Pro472Thr	Somatic	66.0	0.0		WXS	Illumina HiSeq	.	97.0	10.0	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564253	0.86335	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.79352	-1.15;-1.26;-0.99;-1.25	5.64	5.64	0.86602	.	0.156984	0.64402	D	0.000019	D	0.84088	0.5395	L	0.55481	1.735	0.80722	D	1	D;D;D	0.71674	0.998;0.984;0.997	D;P;P	0.66351	0.943;0.818;0.878	T	0.78298	-0.2258	10	0.11794	T	0.64	-8.0678	19.6991	0.96045	0.0:0.0:1.0:0.0	.	417;356;472	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	T	472;472;356;417	ENSP00000340913:P472T;ENSP00000435574:P472T;ENSP00000343672:P356T;ENSP00000353687:P417T	ENSP00000340913:P472T	P	-	1	0	TRPC6	100858986	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.993000	0.88291	2.646000	0.89796	0.591000	0.81541	CCT	.		0.428	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
TTBK2	146057	ucsc.edu;bcgsc.ca	37	15	43067421	43067421	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr15:43067421A>G	ENST00000267890.6	-	13	2018	c.1910T>C	c.(1909-1911)cTg>cCg	p.L637P		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	637					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CTGGAGTTCCAGCCTATCTGT	0.488																																					p.L637P		.											.	TTBK2	338	0			c.T1910C						.						88.0	86.0	87.0					15																	43067421		1860	4103	5963	SO:0001583	missense	146057	exon13			AGTTCCAGCCTAT	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.1910T>C	15.37:g.43067421A>G	ENSP00000267890:p.Leu637Pro	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	42.0	6.0	NM_173500	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	37	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	A	18.49	3.634773	0.67130	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.56941	0.43	5.24	5.24	0.73138	.	0.171902	0.38605	N	0.001622	T	0.69142	0.3078	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	T	0.72459	-0.4287	10	0.87932	D	0	.	15.322	0.74129	1.0:0.0:0.0:0.0	.	568;637	Q6IQ55-2;Q6IQ55	.;TTBK2_HUMAN	P	637;567;1042	ENSP00000267890:L637P	ENSP00000263802:L1042P	L	-	2	0	TTBK2	40854713	1.000000	0.71417	0.986000	0.45419	0.660000	0.38997	8.276000	0.89894	2.201000	0.70794	0.528000	0.53228	CTG	.		0.488	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500	
TTN	7273	broad.mit.edu;bcgsc.ca	37	2	179416798	179416798	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:179416798A>G	ENST00000591111.1	-	285	86130	c.85906T>C	c.(85906-85908)Tca>Cca	p.S28636P	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S21404P|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S27709P|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S21337P|TTN_ENST00000460472.2_Missense_Mutation_p.S21212P|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S30277P			Q8WZ42	TITIN_HUMAN	titin	28636	Fibronectin type-III 108. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCAACACTTGAACACACCATC	0.438																																					p.S30277P		.											.	TTN	636	0			c.T90829C						.						131.0	130.0	130.0					2																	179416798		2039	4209	6248	SO:0001583	missense	7273	exon335			CACTTGAACACAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.85906T>C	2.37:g.179416798A>G	ENSP00000465570:p.Ser28636Pro	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	6.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	16.98	3.270424	0.59540	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.76	5.76	0.90799	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68229	0.2978	L	0.51853	1.615	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.70923	-0.4740	9	0.87932	D	0	.	16.075	0.80962	1.0:0.0:0.0:0.0	.	21212;21337;21404;28636	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	27709;21212;21404;21337;21209	ENSP00000343764:S27709P;ENSP00000434586:S21212P;ENSP00000340554:S21404P;ENSP00000352154:S21337P	ENSP00000340554:S21404P	S	-	1	0	TTN	179125044	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.195000	0.70347	0.533000	0.62120	TCA	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UCK2	7371	broad.mit.edu;ucsc.edu	37	1	165859537	165859537	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:165859537C>T	ENST00000367879.4	+	2	499	c.196C>T	c.(196-198)Cgt>Tgt	p.R66C	UCK2_ENST00000372212.4_Missense_Mutation_p.R66C	NM_012474.4	NP_036606.2	Q9BZX2	UCK2_HUMAN	uridine-cytidine kinase 2	66					cellular response to oxygen levels (GO:0071453)|CTP salvage (GO:0044211)|feeding behavior (GO:0007631)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to axon injury (GO:0048678)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					TAGCTTCTACCGTGTCCTTAC	0.552																																					p.R66C		.											.	UCK2	91	0			c.C196T						.						109.0	94.0	99.0					1																	165859537		2203	4300	6503	SO:0001583	missense	7371	exon2			TTCTACCGTGTCC	AF236637	CCDS1252.1	1p32	2012-10-02	2004-07-13	2004-07-14	ENSG00000143179	ENSG00000143179	2.7.1.48		12562	protein-coding gene	gene with protein product		609329	"""uridine monophosphate kinase"""	UMPK			Standard	NM_012474		Approved		uc001gdp.3	Q9BZX2	OTTHUMG00000040117	ENST00000367879.4:c.196C>T	1.37:g.165859537C>T	ENSP00000356853:p.Arg66Cys	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	5.0	NM_012474	Q5VV91|Q7KZV3|Q92528|Q96KG5|Q9BU42	Missense_Mutation	SNP	ENST00000367879.4	37	CCDS1252.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.724103	0.30593	.	.	ENSG00000143179	ENST00000367879;ENST00000372212	.	.	.	5.76	4.85	0.62838	Phosphoribulokinase/uridine kinase (1);	0.100735	0.64402	D	0.000003	T	0.55545	0.1927	M	0.85945	2.785	0.58432	D	0.999995	P	0.47106	0.89	P	0.45119	0.47	T	0.67094	-0.5757	8	0.56958	D	0.05	-10.8724	13.9629	0.64193	0.1529:0.8471:0.0:0.0	.	66	Q9BZX2	UCK2_HUMAN	C	66	.	ENSP00000356853:R66C	R	+	1	0	UCK2	164126161	1.000000	0.71417	0.989000	0.46669	0.168000	0.22595	2.161000	0.42358	1.405000	0.46838	-0.182000	0.12963	CGT	.		0.552	UCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096753.1	NM_012474	
UNC79	57578	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	94173201	94173201	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:94173201A>G	ENST00000393151.2	+	50	7859	c.7859A>G	c.(7858-7860)cAg>cGg	p.Q2620R	UNC79_ENST00000256339.4_Missense_Mutation_p.Q2443R|UNC79_ENST00000555664.1_Missense_Mutation_p.Q2581R|UNC79_ENST00000553484.1_Missense_Mutation_p.Q2642R			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2620					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AAAATGGCCCAGGTGGAGATC	0.562																																					p.Q2443R		.											.	.	.	0			c.A7328G						.						74.0	77.0	76.0					14																	94173201		2203	4300	6503	SO:0001583	missense	57578	exon50			TGGCCCAGGTGGA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7859A>G	14.37:g.94173201A>G	ENSP00000376858:p.Gln2620Arg	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	7.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	A	23.8	4.459372	0.84317	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.41400	1.02;1.11;1.0;1.02	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.65154	0.2664	M	0.73217	2.22	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.68010	-0.5522	10	0.87932	D	0	-18.5018	16.6438	0.85155	1.0:0.0:0.0:0.0	.	2642	C9JQL1	.	R	2443;2581;2642;2620;2642	ENSP00000256339:Q2443R;ENSP00000450868:Q2581R;ENSP00000451360:Q2642R;ENSP00000376858:Q2620R	ENSP00000256339:Q2443R	Q	+	2	0	KIAA1409	93242954	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.333000	0.79357	0.533000	0.62120	CAG	.		0.562	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
USH2A	7399	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216538320	216538320	+	Silent	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:216538320A>G	ENST00000307340.3	-	4	1145	c.759T>C	c.(757-759)acT>acC	p.T253T	USH2A_ENST00000366943.2_Silent_p.T253T|USH2A_ENST00000366942.3_Silent_p.T253T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	253					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTATTTGCACAGTACCAGATG	0.323										HNSCC(13;0.011)																											p.T253T		.											.	USH2A	115	0			c.T759C						.						116.0	110.0	112.0					1																	216538320		2202	4300	6502	SO:0001819	synonymous_variant	7399	exon4			TTGCACAGTACCA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.759T>C	1.37:g.216538320A>G		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	18.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.323	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
WDR26	80232	broad.mit.edu;bcgsc.ca	37	1	224588723	224588723	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:224588723T>C	ENST00000414423.2	-	9	1541	c.1348A>G	c.(1348-1350)Aca>Gca	p.T450A	WDR26_ENST00000366852.2_3'UTR|WDR26_ENST00000295024.6_Missense_Mutation_p.T303A|MIR4742_ENST00000581069.1_RNA|WDR26_ENST00000479727.1_5'Flank	NM_001115113.2|NM_025160.6	NP_001108585.2|NP_079436.4	Q9H7D7	WDR26_HUMAN	WD repeat domain 26	450						cytoplasm (GO:0005737)|nucleus (GO:0005634)				biliary_tract(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	18				GBM - Glioblastoma multiforme(131;0.0104)		GCCACACTTGTCAAACTGTCT	0.448																																					p.T450A		.											.	WDR26	90	0			c.A1348G						.						94.0	81.0	86.0					1																	224588723		2203	4300	6503	SO:0001583	missense	80232	exon9			CACTTGTCAAACT	AK024669	CCDS31037.1, CCDS31037.2	1q42.13	2013-01-09			ENSG00000162923	ENSG00000162923		"""WD repeat domain containing"""	21208	protein-coding gene	gene with protein product	"""GID complex subunit 7 homolog (S. cerevisiae)"""						Standard	NM_001115113		Approved	FLJ21016, GID7	uc001hop.4	Q9H7D7	OTTHUMG00000037636	ENST00000414423.2:c.1348A>G	1.37:g.224588723T>C	ENSP00000408108:p.Thr450Ala	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	5.0	NM_025160	A0MNN3|Q4G100|Q59EC4|Q5GLZ9|Q86UY4|Q9H3C2	Missense_Mutation	SNP	ENST00000414423.2	37	CCDS31037.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.87|18.87	3.715681|3.715681	0.68844|0.68844	.|.	.|.	ENSG00000162923|ENSG00000162923	ENST00000480676|ENST00000414423;ENST00000295024	.|T;T	.|0.63417	.|-0.04;-0.04	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59004|0.59004	0.2162|0.2162	L|L	0.49513|0.49513	1.565|1.565	0.80722|0.80722	D|D	1|1	.|B	.|0.30482	.|0.281	.|B	.|0.34093	.|0.175	T|T	0.55405|0.55405	-0.8146|-0.8146	5|10	.|0.23891	.|T	.|0.37	.|.	16.0607|16.0607	0.80836|0.80836	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|434	.|Q9H7D7-2	.|.	G|A	83|450;303	.|ENSP00000408108:T450A;ENSP00000295024:T303A	.|ENSP00000295024:T303A	D|T	-|-	2|1	0|0	WDR26|WDR26	222655346|222655346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.963000|0.963000	0.63663|0.63663	7.977000|7.977000	0.88081|0.88081	2.200000|2.200000	0.70718|0.70718	0.477000|0.477000	0.44152|0.44152	GAC|ACA	.		0.448	WDR26-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091760.2	NM_025160	
XPO6	23214	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28167768	28167768	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr16:28167768T>A	ENST00000304658.5	-	7	1224	c.724A>T	c.(724-726)Agt>Tgt	p.S242C	XPO6_ENST00000565698.1_Missense_Mutation_p.S228C|XPO6_ENST00000561488.1_5'Flank	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	242					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						ATATACTCACTCTCCACATCA	0.483																																					p.S242C		.											.	XPO6	227	0			c.A724T						.						104.0	106.0	105.0					16																	28167768		1979	4160	6139	SO:0001583	missense	23214	exon7			ACTCACTCTCCAC	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.724A>T	16.37:g.28167768T>A	ENSP00000302790:p.Ser242Cys	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	9.0	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109432	0.77096	.	.	ENSG00000169180	ENST00000304658	T	0.46451	0.87	5.87	5.87	0.94306	Exportin-1/Importin-beta-like (1);Armadillo-type fold (1);	0.035322	0.85682	D	0.000000	T	0.61515	0.2353	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.981;0.983	T	0.63620	-0.6596	10	0.66056	D	0.02	-11.1188	14.5226	0.67863	0.0:0.0:0.0:1.0	.	242;242	B7ZM10;Q96QU8	.;XPO6_HUMAN	C	242	ENSP00000302790:S242C	ENSP00000302790:S242C	S	-	1	0	XPO6	28075269	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.240000	0.72363	2.371000	0.80710	0.533000	0.62120	AGT	.		0.483	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
YLPM1	56252	broad.mit.edu;bcgsc.ca	37	14	75266169	75266169	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:75266169T>C	ENST00000325680.7	+	5	4293	c.4169T>C	c.(4168-4170)gTt>gCt	p.V1390A	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.V1195A	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1195					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CGAGATTATGTTCCTGACAGA	0.493																																					p.V1390A		.											.	YLPM1	71	0			c.T4169C						.						230.0	218.0	222.0					14																	75266169		1965	4156	6121	SO:0001583	missense	56252	exon5			ATTATGTTCCTGA	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.4169T>C	14.37:g.75266169T>C	ENSP00000324463:p.Val1390Ala	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	8.0	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000325680.7	37	CCDS45135.1	.	.	.	.	.	.	.	.	.	.	T	11.92	1.783728	0.31593	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.96	5.96	0.96718	.	0.356997	0.23933	N	0.043131	T	0.30885	0.0779	L	0.44542	1.39	0.26973	N	0.965531	B	0.25850	0.136	B	0.21151	0.033	T	0.21280	-1.0250	9	0.14252	T	0.57	-3.7954	8.7088	0.34371	0.0:0.1405:0.0:0.8595	.	1390	P49750-4	.	A	1390;1195;1103	.	ENSP00000238571:V1195A	V	+	2	0	YLPM1	74335922	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.594000	0.36697	2.280000	0.76307	0.519000	0.50382	GTT	.		0.493	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404451.1	NM_019589	
ZFPL1	7542	ucsc.edu;bcgsc.ca	37	11	64854053	64854053	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:64854053G>T	ENST00000294258.3	+	4	533	c.381G>T	c.(379-381)tgG>tgT	p.W127C	AP003068.6_ENST00000525544.2_5'Flank|CDCA5_ENST00000404147.3_5'Flank|CDCA5_ENST00000275517.3_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	127					regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						CAGTCAACTGGGCCCGGGCAG	0.652																																					p.W127C		.											.	ZFPL1	91	0			c.G381T						.						54.0	60.0	58.0					11																	64854053		2201	4297	6498	SO:0001583	missense	7542	exon4			CAACTGGGCCCGG		CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.381G>T	11.37:g.64854053G>T	ENSP00000294258:p.Trp127Cys	Somatic	85.0	0.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_006782	A8K7E9|O14616|Q9UID0	Missense_Mutation	SNP	ENST00000294258.3	37	CCDS8092.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344704	0.82022	.	.	ENSG00000162300	ENST00000294258;ENST00000526334;ENST00000526945;ENST00000532200	T	0.53857	0.6	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.77343	0.4116	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81777	-0.0777	10	0.72032	D	0.01	-18.6083	16.632	0.85036	0.0:0.0:1.0:0.0	.	127	O95159	ZFPL1_HUMAN	C	127;127;121;127	ENSP00000294258:W127C	ENSP00000294258:W127C	W	+	3	0	ZFPL1	64610629	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.794000	0.91867	2.521000	0.84997	0.462000	0.41574	TGG	.		0.652	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385196.1	NM_006782	
ZNF133	7692	ucsc.edu;bcgsc.ca	37	20	18296815	18296815	+	Silent	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr20:18296815T>C	ENST00000316358.4	+	4	1417	c.1320T>C	c.(1318-1320)tgT>tgC	p.C440C	ZNF133_ENST00000538547.1_Silent_p.C345C|ZNF133_ENST00000402618.2_Silent_p.C377C|ZNF133_ENST00000401790.1_Silent_p.C440C|ZNF133_ENST00000535822.1_Silent_p.C345C|ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000377671.3_Silent_p.C439C|RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000396026.3_Silent_p.C443C	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	440					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						CGTATGTTTGTGGGGTGTGTG	0.557																																					p.C439C		.											.	ZNF133	92	0			c.T1317C						.						62.0	63.0	63.0					20																	18296815		2203	4300	6503	SO:0001819	synonymous_variant	7692	exon4			TGTTTGTGGGGTG	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.1320T>C	20.37:g.18296815T>C		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001083330	A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Silent	SNP	ENST00000316358.4	37																																																																																				.		0.557	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000127616.1	NM_003434	
ZNF395	55893	ucsc.edu;bcgsc.ca	37	8	28218433	28218433	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr8:28218433A>G	ENST00000344423.5	-	2	340	c.209T>C	c.(208-210)cTt>cCt	p.L70P	ZNF395_ENST00000523095.1_Missense_Mutation_p.L70P|ZNF395_ENST00000523202.1_Missense_Mutation_p.L70P	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	70					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CACCTGCTGAAGGCCCGAGGT	0.627																																					p.L70P		.											.	ZNF395	90	0			c.T209C						.						32.0	34.0	33.0					8																	28218433		2203	4300	6503	SO:0001583	missense	55893	exon2			TGCTGAAGGCCCG	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.209T>C	8.37:g.28218433A>G	ENSP00000340494:p.Leu70Pro	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	ENST00000344423.5	37	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	A	6.567	0.472958	0.12461	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095;ENST00000521912;ENST00000520290;ENST00000521185;ENST00000522795	D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07	5.0	2.54	0.30619	.	0.376689	0.23028	N	0.052774	T	0.71273	0.3320	N	0.25647	0.755	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63603	-0.6600	10	0.48119	T	0.1	-10.0432	2.7663	0.05321	0.6102:0.0:0.186:0.2037	.	70	Q9H8N7	ZN395_HUMAN	P	70	ENSP00000340494:L70P;ENSP00000429640:L70P;ENSP00000428452:L70P;ENSP00000427934:L70P	ENSP00000340494:L70P	L	-	2	0	ZNF395	28274352	0.125000	0.22332	0.909000	0.35828	0.041000	0.13682	0.094000	0.15107	0.820000	0.34516	0.533000	0.62120	CTT	.		0.627	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
ZNF543	125919	ucsc.edu;bcgsc.ca	37	19	57840605	57840605	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:57840605A>G	ENST00000321545.4	+	4	2120	c.1775A>G	c.(1774-1776)aAt>aGt	p.N592S		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	592					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GAGTTTTTGAATATCACCACT	0.408																																					p.N592S		.											.	ZNF543	92	0			c.A1775G						.						64.0	65.0	64.0					19																	57840605		2203	4300	6503	SO:0001583	missense	125919	exon4			TTTTGAATATCAC	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1775A>G	19.37:g.57840605A>G	ENSP00000322545:p.Asn592Ser	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_213598	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	37	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	A	7.165	0.586535	0.13749	.	.	ENSG00000178229	ENST00000321545	T	0.06294	3.32	2.57	1.54	0.23209	.	.	.	.	.	T	0.05502	0.0145	L	0.38175	1.15	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.36383	-0.9750	9	0.45353	T	0.12	.	5.8479	0.18675	0.8632:0.0:0.1368:0.0	.	592	Q08ER8	ZN543_HUMAN	S	592	ENSP00000322545:N592S	ENSP00000322545:N592S	N	+	2	0	ZNF543	62532417	0.121000	0.22262	0.001000	0.08648	0.003000	0.03518	0.912000	0.28597	0.402000	0.25451	0.379000	0.24179	AAT	.		0.408	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
ZNF549	256051	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58048901	58048901	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr19:58048901C>A	ENST00000376233.3	+	4	710	c.529C>A	c.(529-531)Ctg>Atg	p.L177M	ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF549_ENST00000240719.3_Missense_Mutation_p.L164M|ZNF549_ENST00000594943.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	177					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAAAATTCCTCTGTCAGACAA	0.483																																					p.L177M		.											.	ZNF549	91	0			c.C529A						.						57.0	57.0	57.0					19																	58048901		2203	4300	6503	SO:0001583	missense	256051	exon4			ATTCCTCTGTCAG	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.529C>A	19.37:g.58048901C>A	ENSP00000365407:p.Leu177Met	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	6.0	NM_001199295	B3KV91|O43336|Q8NAR4	Missense_Mutation	SNP	ENST00000376233.3	37	CCDS56106.1	.	.	.	.	.	.	.	.	.	.	C	2.390	-0.340094	0.05243	.	.	ENSG00000121406	ENST00000240719;ENST00000376233	T;T	0.06933	3.27;3.24	2.76	-5.53	0.02552	.	.	.	.	.	T	0.05135	0.0137	N	0.14661	0.345	0.09310	N	1	B;B	0.29508	0.012;0.246	B;B	0.37144	0.003;0.242	T	0.45833	-0.9234	9	0.46703	T	0.11	.	6.1306	0.20203	0.5399:0.287:0.1732:0.0	.	177;164	Q6P9A3;Q6P9A3-2	ZN549_HUMAN;.	M	164;177	ENSP00000240719:L164M;ENSP00000365407:L177M	ENSP00000240719:L164M	L	+	1	2	ZNF549	62740713	0.210000	0.23517	0.000000	0.03702	0.001000	0.01503	1.215000	0.32431	-1.095000	0.03050	-0.950000	0.02660	CTG	.		0.483	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	
ZYX	7791	ucsc.edu;bcgsc.ca	37	7	143087737	143087737	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:143087737C>A	ENST00000322764.5	+	10	2026	c.1681C>A	c.(1681-1683)Ctc>Atc	p.L561I	ZYX_ENST00000449423.2_Missense_Mutation_p.L474I|EPHA1_ENST00000458129.1_5'UTR|ZYX_ENST00000392910.2_Missense_Mutation_p.L404I	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin	561	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					CGGTCACGTGCTCTGTCGGAA	0.617																																					p.L561I		.											.	ZYX	90	0			c.C1681A						.						94.0	72.0	80.0					7																	143087737		2202	4294	6496	SO:0001583	missense	7791	exon10			CACGTGCTCTGTC	X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.1681C>A	7.37:g.143087737C>A	ENSP00000324422:p.Leu561Ile	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_003461	A4D2G6|Q6I9S4	Missense_Mutation	SNP	ENST00000322764.5	37	CCDS5883.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965767	0.74131	.	.	ENSG00000159840	ENST00000322764;ENST00000354434;ENST00000449423;ENST00000392910	D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53	4.19	3.22	0.36961	Zinc finger, LIM-type (4);	0.000000	0.53938	U	0.000043	D	0.92616	0.7654	M	0.78637	2.42	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	D	0.91975	0.5590	10	0.72032	D	0.01	.	6.8474	0.23996	0.1754:0.7344:0.0:0.0903	.	474;561	B4DQR8;Q15942	.;ZYX_HUMAN	I	561;529;474;404	ENSP00000324422:L561I;ENSP00000346417:L529I;ENSP00000394158:L474I;ENSP00000376642:L404I	ENSP00000324422:L561I	L	+	1	0	ZYX	142797859	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	2.613000	0.46351	2.052000	0.61016	0.305000	0.20034	CTC	.		0.617	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156296.2	NM_003461	
