#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADCY9	115	ucsc.edu;bcgsc.ca	37	16	4042259	4042259	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:4042259T>C	ENST00000294016.3	-	5	2633	c.2095A>G	c.(2095-2097)Aag>Gag	p.K699E	ADCY9_ENST00000571889.1_5'UTR	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	699					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CACCTTCCCTTCTCCTGCAAG	0.562																																					p.K699E		.											.	ADCY9	139	0			c.A2095G						.						96.0	86.0	89.0					16																	4042259		2197	4300	6497	SO:0001583	missense	115	exon5			TTCCCTTCTCCTG	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2095A>G	16.37:g.4042259T>C	ENSP00000294016:p.Lys699Glu	Somatic	68.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	37	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	T	17.61	3.432475	0.62844	.	.	ENSG00000162104	ENST00000294016	D	0.83591	-1.74	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.82435	0.5036	L	0.53249	1.67	0.46725	D	0.99917	D	0.57257	0.979	P	0.49999	0.628	T	0.79553	-0.1756	10	0.10111	T	0.7	.	15.2182	0.73288	0.0:0.0:0.0:1.0	.	699	O60503	ADCY9_HUMAN	E	699	ENSP00000294016:K699E	ENSP00000294016:K699E	K	-	1	0	ADCY9	3982260	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	4.736000	0.62059	1.994000	0.58287	0.523000	0.50628	AAG	.		0.562	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
AGRN	375790	ucsc.edu;bcgsc.ca	37	1	979269	979269	+	Missense_Mutation	SNP	G	G	T	rs140789461		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:979269G>T	ENST00000379370.2	+	10	1915	c.1865G>T	c.(1864-1866)cGg>cTg	p.R622L		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	622	Kazal-like 7. {ECO:0000255|PROSITE- ProRule:PRU00798}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GTGTGTCCCCGGTGTGAGCAC	0.682																																					p.R622L		.											.	AGRN	136	0			c.G1865T						.						26.0	26.0	26.0					1																	979269		2191	4277	6468	SO:0001583	missense	375790	exon10			GTCCCCGGTGTGA	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.1865G>T	1.37:g.979269G>T	ENSP00000368678:p.Arg622Leu	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_198576	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	37	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033084	0.54896	.	.	ENSG00000188157	ENST00000379370	T	0.27890	1.64	4.5	4.5	0.54988	Proteinase inhibitor I1, Kazal (1);Follistatin-like, N-terminal (1);	0.238055	0.29040	N	0.013335	T	0.41050	0.1142	L	0.35644	1.08	0.40937	D	0.984432	D	0.55605	0.972	D	0.63488	0.915	T	0.15009	-1.0452	10	0.31617	T	0.26	-10.5839	13.0274	0.58823	0.0:0.1621:0.8379:0.0	.	622	O00468	AGRIN_HUMAN	L	622	ENSP00000368678:R622L	ENSP00000368678:R622L	R	+	2	0	AGRN	969132	0.807000	0.29009	0.998000	0.56505	0.808000	0.45660	0.975000	0.29449	2.045000	0.60652	0.561000	0.74099	CGG	G|1.000;A|0.000		0.682	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097990.2	NM_198576	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62293785	62293785	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:62293785T>C	ENST00000378024.4	-	5	8378	c.8104A>G	c.(8104-8106)Atc>Gtc	p.I2702V	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2702					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.I2702F(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GGGGCTTTGATATTCATCTCT	0.458																																					p.I2702V		.											AHNAK,NS,carcinoma,+2	AHNAK	109	1	Substitution - Missense(1)	lung(1)	c.A8104G						.						192.0	190.0	191.0					11																	62293785		2202	4299	6501	SO:0001583	missense	79026	exon5			CTTTGATATTCAT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8104A>G	11.37:g.62293785T>C	ENSP00000367263:p.Ile2702Val	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	11.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	t	2.437	-0.329610	0.05314	.	.	ENSG00000124942	ENST00000378024	T	0.09630	2.96	4.65	-3.77	0.04346	.	.	.	.	.	T	0.05914	0.0154	L	0.38953	1.18	0.09310	N	1	B	0.31009	0.303	B	0.27076	0.076	T	0.43702	-0.9375	9	0.07482	T	0.82	-1.5199	6.7912	0.23701	0.5021:0.0:0.1309:0.367	.	2702	Q09666	AHNK_HUMAN	V	2702	ENSP00000367263:I2702V	ENSP00000367263:I2702V	I	-	1	0	AHNAK	62050361	0.000000	0.05858	0.007000	0.13788	0.768000	0.43524	-5.329000	0.00131	-0.529000	0.06358	0.392000	0.25879	ATC	.		0.458	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
AKT2	208	ucsc.edu;bcgsc.ca	37	19	40741863	40741863	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:40741863G>T	ENST00000392038.2	-	11	1407	c.1109C>A	c.(1108-1110)cCg>cAg	p.P370Q	AKT2_ENST00000424901.1_Missense_Mutation_p.P370Q|AKT2_ENST00000311278.6_Missense_Mutation_p.P327Q|AKT2_ENST00000579047.1_Missense_Mutation_p.P308Q	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2	370	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			GAGCGTGCGCGGGAAGCGGAT	0.647			A		"""ovarian, pancreatic """																																p.P370Q		.		Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	.	AKT2	978	0			c.C1109A						.						60.0	56.0	57.0					19																	40741863		2203	4300	6503	SO:0001583	missense	208	exon11			GTGCGCGGGAAGC	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.1109C>A	19.37:g.40741863G>T	ENSP00000375892:p.Pro370Gln	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	43.0	5.0	NM_001626	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	ENST00000392038.2	37	CCDS12552.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250824	0.59212	.	.	ENSG00000105221	ENST00000392038;ENST00000391844;ENST00000424901;ENST00000311278;ENST00000391845	T;T;T	0.73469	-0.75;-0.75;-0.75	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.047616	0.85682	D	0.000000	D	0.89594	0.6760	M	0.91920	3.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.998;0.999	D	0.91247	0.5026	10	0.87932	D	0	.	18.757	0.91836	0.0:0.0:1.0:0.0	.	308;327;370	B4DG79;Q0VAN0;P31751	.;.;AKT2_HUMAN	Q	370;271;370;327;190	ENSP00000375892:P370Q;ENSP00000399532:P370Q;ENSP00000309428:P327Q	ENSP00000309428:P327Q	P	-	2	0	AKT2	45433703	1.000000	0.71417	0.969000	0.41365	0.924000	0.55760	9.858000	0.99539	2.735000	0.93741	0.555000	0.69702	CCG	.		0.647	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268029.1	NM_001626	
ANKS4B	257629	ucsc.edu;bcgsc.ca	37	16	21261131	21261131	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:21261131T>C	ENST00000311620.5	+	2	317	c.244T>C	c.(244-246)Tca>Cca	p.S82P		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	82					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		CCACTGCGTCTCATTCCTGGT	0.507																																					p.S82P		.											.	ANKS4B	92	0			c.T244C						.						95.0	93.0	94.0					16																	21261131		2025	4192	6217	SO:0001583	missense	257629	exon2			TGCGTCTCATTCC	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.244T>C	16.37:g.21261131T>C	ENSP00000308772:p.Ser82Pro	Somatic	65.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_145865		Missense_Mutation	SNP	ENST00000311620.5	37	CCDS42130.1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.369510	0.61624	.	.	ENSG00000175311	ENST00000311620	T	0.65549	-0.16	5.81	3.51	0.40186	Ankyrin repeat-containing domain (4);	0.199956	0.42682	D	0.000675	T	0.76190	0.3953	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75519	-0.3289	10	0.62326	D	0.03	-1.645	10.5829	0.45265	0.2572:0.0:0.0:0.7428	.	82	Q8N8V4	ANS4B_HUMAN	P	82	ENSP00000308772:S82P	ENSP00000308772:S82P	S	+	1	0	ANKS4B	21168632	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.422000	0.52749	0.426000	0.26116	-0.468000	0.05107	TCA	.		0.507	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865	
ANO4	121601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101381373	101381373	+	Missense_Mutation	SNP	T	T	A	rs576854824		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:101381373T>A	ENST00000392977.3	+	8	869	c.659T>A	c.(658-660)cTg>cAg	p.L220Q	ANO4_ENST00000538618.1_3'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.L185Q|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4	220					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CCAATGAGGCTGGACAAGGAG	0.498										HNSCC(74;0.22)	OREG0022059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L185Q		.											.	ANO4	96	0			c.T554A						.						254.0	234.0	241.0					12																	101381373		2203	4300	6503	SO:0001583	missense	121601	exon7			TGAGGCTGGACAA	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.659T>A	12.37:g.101381373T>A	ENSP00000376703:p.Leu220Gln	Somatic	47.0	0.0	1358	WXS	Illumina HiSeq	Phase_I	39.0	17.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	T	17.65	3.442982	0.63067	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.69561	-0.41;-0.41	5.33	5.33	0.75918	.	0.097548	0.42682	D	0.000680	T	0.63873	0.2548	M	0.67953	2.075	0.80722	D	1	P;B	0.39940	0.696;0.343	B;B	0.33799	0.17;0.133	T	0.70472	-0.4862	10	0.72032	D	0.01	.	15.3283	0.74186	0.0:0.0:0.0:1.0	.	220;185	Q32M45;Q32M45-2	ANO4_HUMAN;.	Q	185;220	ENSP00000376705:L185Q;ENSP00000376703:L220Q	ENSP00000376703:L220Q	L	+	2	0	ANO4	99905504	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.817000	0.86213	2.020000	0.59435	0.533000	0.62120	CTG	.		0.498	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
ANXA4	307	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	70015202	70015202	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:70015202C>T	ENST00000394295.4	+	3	274	c.26C>T	c.(25-27)aCt>aTt	p.T9I	ANXA4_ENST00000536030.1_Intron|ANXA4_ENST00000409920.1_Missense_Mutation_p.T9I	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4	7					epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						AAAGGAGGTACTGTCAAAGCT	0.517																																					p.T9I		.											.	ANXA4	90	0			c.C26T						.						136.0	118.0	124.0					2																	70015202		2203	4300	6503	SO:0001583	missense	307	exon3			GAGGTACTGTCAA	M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.26C>T	2.37:g.70015202C>T	ENSP00000377833:p.Thr9Ile	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	6.0	NM_001153	B4DDF9|Q96F33|Q9BWK1	Missense_Mutation	SNP	ENST00000394295.4	37	CCDS1894.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079885	0.36662	.	.	ENSG00000196975	ENST00000409920;ENST00000394295	T;T	0.13420	2.59;2.59	5.77	5.77	0.91146	.	0.047819	0.85682	D	0.000000	T	0.36138	0.0956	M	0.89478	3.035	0.80722	D	1	P;D	0.63880	0.943;0.993	P;P	0.52710	0.481;0.707	T	0.35943	-0.9768	10	0.87932	D	0	.	15.4963	0.75653	0.0:1.0:0.0:0.0	.	9;9	Q6P452;Q6LES2	.;.	I	9	ENSP00000386756:T9I;ENSP00000377833:T9I	ENSP00000377833:T9I	T	+	2	0	ANXA4	69868706	0.411000	0.25384	0.039000	0.18376	0.066000	0.16364	3.784000	0.55416	2.744000	0.94065	0.561000	0.74099	ACT	.		0.517	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251848.2	NM_001153	
AP1B1	162	ucsc.edu;bcgsc.ca	37	22	29730278	29730278	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr22:29730278A>G	ENST00000405198.1	-	16	2316	c.2285T>C	c.(2284-2286)tTt>tCt	p.F762S	SNORD125_ENST00000459538.1_RNA|AP1B1_ENST00000472057.1_5'UTR|AP1B1_ENST00000357586.2_Missense_Mutation_p.F762S|AP1B1_ENST00000415447.1_Missense_Mutation_p.F755S|AP1B1_ENST00000432560.2_Missense_Mutation_p.F755S|AP1B1_ENST00000356015.2_Missense_Mutation_p.F755S|AP1B1_ENST00000317368.7_Missense_Mutation_p.F735S|AP1B1_ENST00000402502.1_Missense_Mutation_p.F755S			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	762					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CTGGATGGCAAAGTCGGTCAT	0.602																																					p.F762S		.											.	AP1B1	92	0			c.T2285C						.						135.0	115.0	121.0					22																	29730278		2203	4300	6503	SO:0001583	missense	162	exon17			ATGGCAAAGTCGG	L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.2285T>C	22.37:g.29730278A>G	ENSP00000384194:p.Phe762Ser	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_001127	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	ENST00000405198.1	37	CCDS13855.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.467056	0.63625	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447	T;T;T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04;0.04;0.04	5.56	5.56	0.83823	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (1);	0.000000	0.85682	D	0.000000	T	0.81550	0.4846	M	0.86420	2.815	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	D	0.83981	0.0332	10	0.51188	T	0.08	-14.6736	15.3711	0.74564	1.0:0.0:0.0:0.0	.	315;735;755;762;755	B4DS79;F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;.;AP1B1_HUMAN;.	S	762;755;755;762;735;755;755	ENSP00000350199:F762S;ENSP00000348297:F755S;ENSP00000400065:F755S;ENSP00000384194:F762S;ENSP00000319361:F735S;ENSP00000386071:F755S;ENSP00000387612:F755S	ENSP00000319361:F735S	F	-	2	0	AP1B1	28060278	1.000000	0.71417	0.989000	0.46669	0.153000	0.21895	9.251000	0.95483	2.113000	0.64589	0.460000	0.39030	TTT	.		0.602	AP1B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321374.1	NM_001127	
APAF1	317	ucsc.edu;bcgsc.ca	37	12	99061422	99061422	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:99061422G>T	ENST00000551964.1	+	10	2230	c.1494G>T	c.(1492-1494)aaG>aaT	p.K498N	APAF1_ENST00000357310.1_Splice_Site_p.K498N|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000549007.1_Splice_Site_p.K498N|APAF1_ENST00000339433.3_Splice_Site_p.K498N|APAF1_ENST00000547045.1_Splice_Site_p.K498N|APAF1_ENST00000550527.1_Splice_Site_p.K487N|APAF1_ENST00000359972.2_Splice_Site_p.K487N|APAF1_ENST00000552268.1_Intron	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	498					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	AGATGCACAAGGTAAGATGAC	0.363																																					p.K498N		.											.	APAF1	229	0			c.G1494T						.						100.0	92.0	95.0					12																	99061422		2203	4300	6503	SO:0001630	splice_region_variant	317	exon10			GCACAAGGTAAGA	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1494+1G>T	12.37:g.99061422G>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_181868	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	37	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147192	0.37923	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.60299	0.2;0.34;0.29;0.4;0.2;0.29;0.4	5.2	0.205	0.15204	.	0.203652	0.51477	D	0.000095	T	0.50309	0.1608	N	0.12182	0.205	0.80722	D	1	B;B;B;D	0.65815	0.387;0.021;0.023;0.995	B;B;B;D	0.78314	0.405;0.024;0.032;0.991	T	0.44019	-0.9355	10	0.33141	T	0.24	-16.7804	6.1102	0.20096	0.4766:0.0:0.3982:0.1252	.	498;487;498;487	O14727-4;O14727-3;O14727;O14727-2	.;.;APAF_HUMAN;.	N	498;487;498;498;487;498;498	ENSP00000448165:K498N;ENSP00000353059:K487N;ENSP00000349862:K498N;ENSP00000341830:K498N;ENSP00000448449:K487N;ENSP00000449791:K498N;ENSP00000448161:K498N	ENSP00000341830:K498N	K	+	3	2	APAF1	97585553	1.000000	0.71417	0.998000	0.56505	0.493000	0.33554	1.385000	0.34408	0.032000	0.15435	-0.373000	0.07131	AAG	.		0.363	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	Missense_Mutation
APOB	338	broad.mit.edu;bcgsc.ca	37	2	21230939	21230939	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:21230939G>T	ENST00000233242.1	-	26	8928	c.8801C>A	c.(8800-8802)cCc>cAc	p.P2934H		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2934					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGAATCTGGGGCAGGCCCA	0.468																																					p.P2934H		.											.	APOB	175	0			c.C8801A						.						161.0	159.0	160.0					2																	21230939		2203	4300	6503	SO:0001583	missense	338	exon26			AATCTGGGGCAGG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8801C>A	2.37:g.21230939G>T	ENSP00000233242:p.Pro2934His	Somatic	158.0	1.0		WXS	Illumina HiSeq	Phase_I	203.0	9.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	8.555	0.876347	0.17395	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00824	5.65	5.74	2.91	0.33838	.	0.545868	0.17828	N	0.160633	T	0.00724	0.0024	N	0.16233	0.39	0.23598	N	0.997328	B	0.15473	0.013	B	0.14023	0.01	T	0.47724	-0.9095	10	0.13108	T	0.6	.	9.267	0.37647	0.0664:0.0:0.5273:0.4063	.	2934	P04114	APOB_HUMAN	H	2934	ENSP00000233242:P2934H	ENSP00000233242:P2934H	P	-	2	0	APOB	21084444	0.992000	0.36948	0.293000	0.24932	0.646000	0.38490	2.697000	0.47060	0.317000	0.23160	0.561000	0.74099	CCC	.		0.468	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARG1	383	ucsc.edu;bcgsc.ca	37	6	131902378	131902378	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:131902378T>C	ENST00000368087.3	+	4	464	c.325T>C	c.(325-327)Tct>Cct	p.S109P	ARG1_ENST00000356962.2_Missense_Mutation_p.S117P|MED23_ENST00000354577.4_Intron			P05089	ARGI1_HUMAN	arginase 1	109					arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|liver development (GO:0001889)|lung development (GO:0030324)|mammary gland involution (GO:0060056)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of endothelial cell proliferation (GO:0001938)|protein homotrimerization (GO:0070207)|regulation of L-arginine import (GO:0010963)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to herbicide (GO:0009635)|response to manganese ion (GO:0010042)|response to methylmercury (GO:0051597)|response to selenium ion (GO:0010269)|response to vitamin A (GO:0033189)|response to vitamin E (GO:0033197)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	arginase activity (GO:0004053)|manganese ion binding (GO:0030145)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|skin(3)	14	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0106)|OV - Ovarian serous cystadenocarcinoma(155;0.0713)	L-Ornithine(DB00129)	TGGAAGCATCTCTGGCCATGC	0.453																																					p.S117P		.											.	ARG1	91	0			c.T349C						.						94.0	86.0	89.0					6																	131902378		2203	4300	6503	SO:0001583	missense	383	exon4			AGCATCTCTGGCC		CCDS5145.1, CCDS59038.1	6q23	2013-05-01	2013-05-01		ENSG00000118520	ENSG00000118520	3.5.3.1		663	protein-coding gene	gene with protein product		608313	"""arginase, liver"""			22959135	Standard	NM_000045		Approved		uc003qcp.2	P05089	OTTHUMG00000015566	ENST00000368087.3:c.325T>C	6.37:g.131902378T>C	ENSP00000357066:p.Ser109Pro	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001244438	A6NEA0|Q5JWT5|Q5JWT6|Q8TE72|Q9BS50	Missense_Mutation	SNP	ENST00000368087.3	37	CCDS5145.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.624072	0.66901	.	.	ENSG00000118520	ENST00000368087;ENST00000356962;ENST00000476845	D;D;D	0.84944	-1.92;-1.92;-1.92	5.69	4.52	0.55395	Ureohydrolase domain (1);	0.242215	0.42682	D	0.000663	D	0.87509	0.6195	M	0.85542	2.76	0.80722	D	1	P;P	0.51351	0.944;0.892	P;P	0.55545	0.67;0.778	D	0.88326	0.2965	10	0.62326	D	0.03	-4.4459	10.2688	0.43470	0.0:0.0:0.3196:0.6804	.	117;109	P05089-2;P05089	.;ARGI1_HUMAN	P	109;117;109	ENSP00000357066:S109P;ENSP00000349446:S117P;ENSP00000417694:S109P	ENSP00000349446:S117P	S	+	1	0	ARG1	131944071	0.129000	0.22400	1.000000	0.80357	0.975000	0.68041	0.469000	0.22067	0.964000	0.38108	-0.313000	0.08912	TCT	.		0.453	ARG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042223.1		
ARHGAP32	9743	ucsc.edu;bcgsc.ca	37	11	129034323	129034323	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:129034323C>A	ENST00000310343.9	-	2	116		c.e2-1		ARHGAP32_ENST00000524655.1_5'Flank	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CTTCATCTTCCTAGAGATCAA	0.378																																					.		.											.	ARHGAP32	231	0			c.117-1G>T						.						60.0	51.0	54.0					11																	129034323		1559	3573	5132	SO:0001630	splice_region_variant	9743	exon3			ATCTTCCTAGAGA	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.117-1G>T	11.37:g.129034323C>A		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Splice_Site	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.586534	0.66105	.	.	ENSG00000134909	ENST00000310343	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5273	0.84334	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARHGAP32	128539533	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.478000	0.66806	2.573000	0.86826	0.655000	0.94253	.	.		0.378	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	Intron
ARHGEF40	55701	ucsc.edu;bcgsc.ca	37	14	21550156	21550156	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:21550156C>T	ENST00000298694.4	+	14	3256	c.3129C>T	c.(3127-3129)acC>acT	p.T1043T	ARHGEF40_ENST00000298693.3_Silent_p.T1043T			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1043						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TGGAGGTCACCAGCACTGAGG	0.667																																					p.T1043T		.											.	ARHGEF40	228	0			c.C3129T						.						19.0	19.0	19.0					14																	21550156		2196	4287	6483	SO:0001819	synonymous_variant	55701	exon14			GGTCACCAGCACT		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.3129C>T	14.37:g.21550156C>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Silent	SNP	ENST00000298694.4	37	CCDS32041.1																																																																																			.		0.667	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
ASXL1	171023	broad.mit.edu;bcgsc.ca	37	20	31022742	31022752	+	Frame_Shift_Del	DEL	CTAGGAGATGC	CTAGGAGATGC	-	rs372455823|rs145061712		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	CTAGGAGATGC	CTAGGAGATGC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr20:31022742_31022752delCTAGGAGATGC	ENST00000375687.4	+	13	2651_2661	c.2227_2237delCTAGGAGATGC	c.(2227-2238)ctaggagatgccfs	p.LGDA743fs	ASXL1_ENST00000306058.5_Frame_Shift_Del_p.LGDA738fs	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	743					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CACAGATGGGCTAGGAGATGCCTCCCAACTC	0.578			"""F, N, Mis"""		"""MDS, CMML"""																																p.743_746del		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	2057	0			c.2227_2237del						.																																			SO:0001589	frameshift_variant	171023	exon12			GATGGGCTAGGAG	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.2227_2237delCTAGGAGATGC	20.37:g.31022742_31022752delCTAGGAGATGC	ENSP00000364839:p.Leu743fs	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	7.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Frame_Shift_Del	DEL	ENST00000375687.4	37	CCDS13201.1																																																																																			.		0.578	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
ATP13A3	79572	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	194168612	194168612	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:194168612A>C	ENST00000439040.1	-	13	2068	c.1277T>G	c.(1276-1278)aTc>aGc	p.I426S	ATP13A3_ENST00000256031.4_Missense_Mutation_p.I426S			Q9H7F0	AT133_HUMAN	ATPase type 13A3	426						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		AATAGTGTAGATAAACCCAAT	0.353																																					p.I426S		.											.	ATP13A3	69	0			c.T1277G						.						143.0	144.0	144.0					3																	194168612		1849	4099	5948	SO:0001583	missense	79572	exon12			GTGTAGATAAACC	AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.1277T>G	3.37:g.194168612A>C	ENSP00000416508:p.Ile426Ser	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	12.0	NM_024524	Q8NC11|Q96KS1	Missense_Mutation	SNP	ENST00000439040.1	37	CCDS43187.1	.	.	.	.	.	.	.	.	.	.	A	19.99	3.928440	0.73327	.	.	ENSG00000133657	ENST00000439040;ENST00000256031;ENST00000310773	D;D	0.91792	-2.91;-2.91	5.69	5.69	0.88448	ATPase, P-type, ATPase-associated domain (1);	0.273814	0.39475	N	0.001355	D	0.93504	0.7927	L	0.54863	1.705	0.58432	D	0.999999	B	0.26845	0.161	P	0.45712	0.491	D	0.91687	0.5363	10	0.40728	T	0.16	-11.5544	15.9429	0.79771	1.0:0.0:0.0:0.0	.	426	Q9H7F0	AT133_HUMAN	S	426;426;164	ENSP00000416508:I426S;ENSP00000256031:I426S	ENSP00000256031:I426S	I	-	2	0	ATP13A3	195649901	1.000000	0.71417	1.000000	0.80357	0.551000	0.35334	8.660000	0.91121	2.147000	0.66899	0.533000	0.62120	ATC	.		0.353	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524	
ATP8B1	5205	ucsc.edu;bcgsc.ca	37	18	55329818	55329818	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr18:55329818T>C	ENST00000283684.4	-	20	2314	c.2315A>G	c.(2314-2316)cAg>cGg	p.Q772R	RP11-35G9.3_ENST00000599199.1_RNA|ATP8B1_ENST00000536015.1_Missense_Mutation_p.Q772R|RP11-35G9.5_ENST00000588925.1_RNA|RP11-35G9.3_ENST00000592201.1_RNA|RP11-35G9.3_ENST00000591854.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	772					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TCTATTCCTCTGGTTTTCCAT	0.448																																					p.Q772R		.											.	ATP8B1	587	0			c.A2315G						.						79.0	79.0	79.0					18																	55329818		2203	4300	6503	SO:0001583	missense	5205	exon21			TTCCTCTGGTTTT	AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.2315A>G	18.37:g.55329818T>C	ENSP00000283684:p.Gln772Arg	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_005603	Q9BTP8	Missense_Mutation	SNP	ENST00000283684.4	37	CCDS11965.1	.	.	.	.	.	.	.	.	.	.	T	0.136	-1.107218	0.01813	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	T;T	0.28454	1.61;1.61	5.57	4.37	0.52481	HAD-like domain (2);	0.343079	0.24206	N	0.040565	T	0.17238	0.0414	N	0.20401	0.57	0.46222	D	0.998935	B	0.09022	0.002	B	0.12156	0.007	T	0.06826	-1.0805	10	0.02654	T	1	.	12.2656	0.54676	0.0:0.0:0.1422:0.8578	.	772	O43520	AT8B1_HUMAN	R	772	ENSP00000283684:Q772R;ENSP00000445359:Q772R	ENSP00000283684:Q772R	Q	-	2	0	ATP8B1	53480816	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	5.456000	0.66665	0.898000	0.36418	0.260000	0.18958	CAG	.		0.448	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256097.1	NM_005603	
AXIN2	8313	broad.mit.edu;bcgsc.ca	37	17	63526129	63526129	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:63526129C>A	ENST00000375702.5	-	9	2410	c.2302G>T	c.(2302-2304)Ggc>Tgc	p.G768C	AXIN2_ENST00000307078.5_Missense_Mutation_p.G833C			Q9Y2T1	AXIN2_HUMAN	axin 2	833	DIX. {ECO:0000255|PROSITE- ProRule:PRU00069}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						AGAATCCGGCCTTCATACATC	0.522									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.G833C		.											.	AXIN2	658	0			c.G2497T						.						127.0	110.0	116.0					17																	63526129		2203	4300	6503	SO:0001583	missense	8313	exon11	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	TCCGGCCTTCATA	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.2302G>T	17.37:g.63526129C>A	ENSP00000364854:p.Gly768Cys	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	5.0	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	37		.	.	.	.	.	.	.	.	.	.	C	17.18	3.322892	0.60634	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	T;T	0.58210	0.35;0.35	5.57	4.59	0.56863	DIX (3);	0.090757	0.85682	D	0.000000	T	0.76219	0.3957	M	0.86953	2.85	0.58432	D	0.999999	D;D	0.89917	1.0;0.981	D;P	0.97110	1.0;0.783	T	0.80708	-0.1262	10	0.52906	T	0.07	-32.6442	16.5513	0.84473	0.0:0.8694:0.1306:0.0	.	833;768	Q9Y2T1;E7ES00	AXIN2_HUMAN;.	C	833;768	ENSP00000302625:G833C;ENSP00000364854:G768C	ENSP00000302625:G833C	G	-	1	0	AXIN2	60956591	1.000000	0.71417	1.000000	0.80357	0.412000	0.31113	7.755000	0.85180	1.342000	0.45619	-0.304000	0.09214	GGC	.		0.522	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
AXL	558	ucsc.edu;bcgsc.ca	37	19	41726725	41726725	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:41726725G>T	ENST00000301178.4	+	2	460	c.270G>T	c.(268-270)gaG>gaT	p.E90D	AXL_ENST00000594880.1_3'UTR|CTD-2195B23.3_ENST00000598541.1_RNA|AXL_ENST00000359092.3_Missense_Mutation_p.E90D	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	90	Ig-like C2-type 1.|Interaction with GAS6.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						CCCTGGGTGAGGATGAACAGG	0.622																																					p.E90D		.											.	AXL	1403	0			c.G270T						.						60.0	55.0	57.0					19																	41726725		2203	4300	6503	SO:0001583	missense	558	exon2			GGGTGAGGATGAA	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.270G>T	19.37:g.41726725G>T	ENSP00000301178:p.Glu90Asp	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_021913	Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	37	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	G	8.417	0.845590	0.16963	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.65916	-0.18;-0.18	4.56	1.06	0.20224	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.222920	0.38897	N	0.001535	T	0.56529	0.1991	L	0.46819	1.47	0.32279	N	0.56779	B;D	0.57899	0.006;0.981	B;P	0.54401	0.003;0.751	T	0.58668	-0.7596	10	0.26408	T	0.33	-10.9251	2.5598	0.04769	0.463:0.0:0.195:0.342	.	90;90	P30530-2;P30530	.;UFO_HUMAN	D	90	ENSP00000301178:E90D;ENSP00000351995:E90D	ENSP00000301178:E90D	E	+	3	2	AXL	46418565	0.999000	0.42202	0.969000	0.41365	0.432000	0.31715	0.381000	0.20619	-0.001000	0.14495	-1.043000	0.02367	GAG	.		0.622	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2		
B4GALNT3	283358	ucsc.edu;bcgsc.ca	37	12	645454	645454	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:645454T>C	ENST00000266383.5	+	3	357	c.344T>C	c.(343-345)cTc>cCc	p.L115P		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	115					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			GTCCCCTGGCTCTCAGAGGTG	0.453																																					p.L115P		.											.	B4GALNT3	92	0			c.T344C						.						163.0	143.0	150.0					12																	645454		2203	4300	6503	SO:0001583	missense	283358	exon3			CCTGGCTCTCAGA	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.344T>C	12.37:g.645454T>C	ENSP00000266383:p.Leu115Pro	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	56.0	5.0	NM_173593	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	37	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.730216	0.30684	.	.	ENSG00000139044	ENST00000266383	T	0.04970	3.52	5.61	5.61	0.85477	.	0.284385	0.34777	N	0.003699	T	0.10809	0.0264	L	0.36672	1.1	0.58432	D	0.999998	D	0.56521	0.976	P	0.53450	0.726	T	0.30060	-0.9991	10	0.23891	T	0.37	-28.5799	13.1771	0.59633	0.0:0.0:0.0:1.0	.	115	Q6L9W6	B4GN3_HUMAN	P	115	ENSP00000266383:L115P	ENSP00000266383:L115P	L	+	2	0	B4GALNT3	515715	1.000000	0.71417	1.000000	0.80357	0.193000	0.23685	2.785000	0.47782	2.151000	0.67156	0.454000	0.30748	CTC	.		0.453	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
BAZ1A	11177	ucsc.edu;bcgsc.ca	37	14	35227971	35227971	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:35227971A>G	ENST00000382422.2	-	24	4652	c.4325T>C	c.(4324-4326)gTt>gCt	p.V1442A	BAZ1A_ENST00000360310.1_Missense_Mutation_p.V1442A|BAZ1A_ENST00000358716.4_Missense_Mutation_p.V1410A			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1442					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		CAATTCTACAACAAGTTGTTC	0.393																																					p.V1442A		.											.	BAZ1A	291	0			c.T4325C						.						102.0	93.0	96.0					14																	35227971		2203	4300	6503	SO:0001583	missense	11177	exon25			TCTACAACAAGTT	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.4325T>C	14.37:g.35227971A>G	ENSP00000371859:p.Val1442Ala	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_013448	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	.	22.0	4.234070	0.79688	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.33216	1.42;1.42;1.42	5.46	5.46	0.80206	Bromodomain (4);	0.313855	0.32218	N	0.006414	T	0.36880	0.0983	L	0.57536	1.79	0.41722	D	0.989516	B;P	0.34462	0.4;0.454	B;B	0.38156	0.173;0.266	T	0.30937	-0.9961	10	0.72032	D	0.01	.	15.5444	0.76086	1.0:0.0:0.0:0.0	.	1410;1442	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	A	1410;1442;1442;1094	ENSP00000351555:V1410A;ENSP00000371859:V1442A;ENSP00000353458:V1442A	ENSP00000351555:V1410A	V	-	2	0	BAZ1A	34297722	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.484000	0.66844	2.070000	0.61991	0.533000	0.62120	GTT	.		0.393	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
BAZ2A	11176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56993854	56993854	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:56993854C>A	ENST00000551812.1	-	25	5118	c.4925G>T	c.(4924-4926)cGt>cTt	p.R1642L	BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000179765.5_Missense_Mutation_p.R1610L|BAZ2A_ENST00000549884.1_Missense_Mutation_p.R1640L|BAZ2A_ENST00000379441.3_Missense_Mutation_p.R1612L	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1642					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R1642H(2)		breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GCGCCAGACACGAATGCGAGG	0.572																																					p.R1642L		.											.	BAZ2A	22	2	Substitution - Missense(2)	large_intestine(2)	c.G4925T						.						81.0	82.0	82.0					12																	56993854		2002	4179	6181	SO:0001583	missense	11176	exon25			CAGACACGAATGC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.4925G>T	12.37:g.56993854C>A	ENSP00000446880:p.Arg1642Leu	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	29.0	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	37	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001011	0.93227	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	T;T;T;T;T	0.71698	-0.34;-0.34;-0.36;-0.59;-0.36	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.80428	0.4621	L	0.47716	1.5	0.80722	D	1	D;P;B;D	0.89917	0.999;0.524;0.272;1.0	D;P;B;D	0.91635	0.996;0.498;0.302;0.999	T	0.77305	-0.2637	10	0.35671	T	0.21	-14.6921	18.5763	0.91155	0.0:1.0:0.0:0.0	.	1640;1638;1642;1615	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	L	1612;1610;1642;574;1640	ENSP00000368754:R1612L;ENSP00000179765:R1610L;ENSP00000446880:R1642L;ENSP00000448760:R574L;ENSP00000447941:R1640L	ENSP00000179765:R1610L	R	-	2	0	BAZ2A	55280121	1.000000	0.71417	0.962000	0.40283	0.989000	0.77384	5.568000	0.67385	2.763000	0.94921	0.650000	0.86243	CGT	.		0.572	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
BMS1	9790	ucsc.edu;bcgsc.ca	37	10	43279928	43279928	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:43279928T>C	ENST00000374518.5	+	2	149	c.86T>C	c.(85-87)cTc>cCc	p.L29P		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	29					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CTGCAGGATCTCCAGCTAGGA	0.478																																					p.L29P		.											.	BMS1	93	0			c.T86C						.						68.0	76.0	74.0					10																	43279928		2203	4300	6503	SO:0001583	missense	9790	exon2			AGGATCTCCAGCT	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.86T>C	10.37:g.43279928T>C	ENSP00000363642:p.Leu29Pro	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	60.0	5.0	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	T	14.27	2.484593	0.44147	.	.	ENSG00000165733	ENST00000374518	T	0.08282	3.11	4.54	4.54	0.55810	.	0.529195	0.19595	N	0.110526	T	0.23532	0.0569	M	0.77616	2.38	0.53005	D	0.999967	D	0.69078	0.997	P	0.62014	0.897	T	0.01378	-1.1370	10	0.30854	T	0.27	.	10.1811	0.42968	0.0:0.0:0.1672:0.8328	.	29	Q14692	BMS1_HUMAN	P	29	ENSP00000363642:L29P	ENSP00000363642:L29P	L	+	2	0	BMS1	42599934	0.017000	0.18338	0.993000	0.49108	0.742000	0.42306	2.198000	0.42705	1.703000	0.51240	0.411000	0.27672	CTC	.		0.478	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
BOC	91653	ucsc.edu;bcgsc.ca	37	3	112998756	112998756	+	Silent	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:112998756G>T	ENST00000495514.1	+	13	2810	c.2106G>T	c.(2104-2106)tcG>tcT	p.S702S	BOC_ENST00000273395.4_Silent_p.S703S|BOC_ENST00000355385.3_Silent_p.S702S			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	702	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			ACGTGGTGTCGGGCTACAGCG	0.607																																					p.S702S		.											.	BOC	157	0			c.G2106T						.						66.0	67.0	67.0					3																	112998756		2203	4300	6503	SO:0001819	synonymous_variant	91653	exon13			GGTGTCGGGCTAC	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.2106G>T	3.37:g.112998756G>T		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	37	CCDS2971.1																																																																																			.		0.607	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
BRDT	676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	92433718	92433718	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:92433718G>T	ENST00000362005.3	+	5	764	c.346G>T	c.(346-348)Gtt>Ttt	p.V116F	BRDT_ENST00000399546.2_Missense_Mutation_p.V116F|BRDT_ENST00000402388.1_Missense_Mutation_p.V116F|BRDT_ENST00000394530.3_Missense_Mutation_p.V70F|BRDT_ENST00000370389.2_Missense_Mutation_p.V43F	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	116	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AGATGACATTGTTCTTATGGC	0.368																																					p.V116F		.											.	BRDT	374	0			c.G346T						.						103.0	102.0	102.0					1																	92433718		2203	4300	6503	SO:0001583	missense	676	exon4			GACATTGTTCTTA	AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.346G>T	1.37:g.92433718G>T	ENSP00000354568:p.Val116Phe	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	16.0	NM_001242806	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	ENST00000362005.3	37	CCDS735.1	.	.	.	.	.	.	.	.	.	.	G	31	5.058619	0.93846	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000423434;ENST00000394530;ENST00000440509;ENST00000427104;ENST00000448194;ENST00000426141;ENST00000552654;ENST00000402388	T;T;T;T;T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;2.16;1.46;1.46;1.46;1.46;1.46;1.46	5.66	5.66	0.87406	Bromodomain (5);	0.000000	0.64402	D	0.000011	T	0.51618	0.1685	M	0.71920	2.185	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.992;0.992;1.0;1.0	T	0.53613	-0.8414	10	0.87932	D	0	-14.6225	19.7538	0.96281	0.0:0.0:1.0:0.0	.	70;70;116;116	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	F	116;43;116;116;116;70;116;116;116;116;43;116	ENSP00000354568:V116F;ENSP00000359416:V43F;ENSP00000387822:V116F;ENSP00000396351:V116F;ENSP00000378038:V70F;ENSP00000416714:V116F;ENSP00000400002:V116F;ENSP00000410587:V116F;ENSP00000404969:V116F;ENSP00000446599:V43F;ENSP00000384051:V116F	ENSP00000354568:V116F	V	+	1	0	BRDT	92206306	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.681000	0.98653	2.690000	0.91761	0.655000	0.94253	GTT	.		0.368	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
BTNL3	10917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180432823	180432823	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:180432823A>C	ENST00000342868.6	+	8	1536	c.1352A>C	c.(1351-1353)gAc>gCc	p.D451A	RNU6-1036P_ENST00000383959.1_RNA	NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	451	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			GCGATGTATGACGAGGAAAAG	0.483																																					p.D451A		.											.	.	.	0			c.A1352C						.						68.0	63.0	65.0					5																	180432823		1941	4146	6087	SO:0001583	missense	10917	exon8			TGTATGACGAGGA	AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.1352A>C	5.37:g.180432823A>C	ENSP00000341787:p.Asp451Ala	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	30.0	NM_197975	Q496L7|Q9Y2C7	Missense_Mutation	SNP	ENST00000342868.6	37	CCDS47358.1	.	.	.	.	.	.	.	.	.	.	A	12.02	1.811989	0.32053	.	.	ENSG00000168903	ENST00000342868;ENST00000376852	T	0.60797	0.16	2.37	-0.711	0.11230	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.45276	0.1334	L	0.52126	1.63	0.09310	N	1	B;B	0.23650	0.089;0.0	B;B	0.25614	0.062;0.0	T	0.43861	-0.9365	9	0.66056	D	0.02	.	2.1176	0.03718	0.5797:0.0:0.1676:0.2527	.	417;451	C9JDC2;Q6UXE8	.;BTNL3_HUMAN	A	451;417	ENSP00000341787:D451A	ENSP00000341787:D451A	D	+	2	0	BTNL3	180365429	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.006000	0.12833	-0.467000	0.06932	0.164000	0.16699	GAC	.		0.483	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367176.2	NM_197975	
C10orf76	79591	ucsc.edu;bcgsc.ca	37	10	103789456	103789456	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:103789456G>A	ENST00000370033.4	-	5	472	c.353C>T	c.(352-354)aCc>aTc	p.T118I	C10orf76_ENST00000311122.5_Missense_Mutation_p.T118I	NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	118						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AAACCCAGAGGTAGACTTATT	0.488																																					p.T118I		.											.	C10orf76	90	0			c.C353T						.						167.0	161.0	163.0					10																	103789456		2028	4191	6219	SO:0001583	missense	79591	exon5			CCAGAGGTAGACT	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.353C>T	10.37:g.103789456G>A	ENSP00000359050:p.Thr118Ile	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_024541	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	37	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509322	0.64522	.	.	ENSG00000120029	ENST00000370033;ENST00000311122	T;T	0.67698	-0.28;2.27	5.89	5.89	0.94794	.	0.094514	0.85682	D	0.000000	T	0.70640	0.3247	N	0.22421	0.69	0.48185	D	0.999608	B;D	0.67145	0.042;0.996	B;P	0.59948	0.048;0.866	T	0.69514	-0.5125	10	0.40728	T	0.16	-4.7604	20.3009	0.98609	0.0:0.0:1.0:0.0	.	118;118	Q5T2E6;Q5T2E7	CJ076_HUMAN;.	I	118	ENSP00000359050:T118I;ENSP00000312408:T118I	ENSP00000312408:T118I	T	-	2	0	C10orf76	103779446	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.763000	0.85283	2.809000	0.96659	0.555000	0.69702	ACC	.		0.488	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
C11orf57	55216	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	111953659	111953659	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:111953659C>T	ENST00000280352.9	+	6	1478	c.842C>T	c.(841-843)aCa>aTa	p.T281I	C11orf57_ENST00000532163.1_Missense_Mutation_p.T253I|C11orf57_ENST00000393047.3_Missense_Mutation_p.T282I|C11orf57_ENST00000420986.2_Missense_Mutation_p.T281I|TIMM8B_ENST00000507614.1_5'Flank	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	281										autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AAAGTAGCTACAGATGAAAGG	0.393																																					p.T282I		.											.	C11orf57	155	0			c.C845T						.						68.0	69.0	68.0					11																	111953659		2197	4295	6492	SO:0001583	missense	55216	exon6			TAGCTACAGATGA	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.842C>T	11.37:g.111953659C>T	ENSP00000339076:p.Thr281Ile	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_001082969	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Missense_Mutation	SNP	ENST00000280352.9	37	CCDS41715.1	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137339	0.56936	.	.	ENSG00000150776	ENST00000420986;ENST00000532163;ENST00000280352;ENST00000393047;ENST00000393048	.	.	.	5.3	5.3	0.74995	.	0.154187	0.44483	D	0.000445	T	0.37100	0.0991	N	0.24115	0.695	0.30519	N	0.768606	D;D	0.54601	0.967;0.967	P;P	0.49708	0.62;0.62	T	0.38520	-0.9657	9	0.59425	D	0.04	-5.285	11.2376	0.48951	0.141:0.7228:0.1361:0.0	.	282;281	Q6ZUT1-2;Q6ZUT1	.;CK057_HUMAN	I	281;253;281;282;136	.	ENSP00000339076:T281I	T	+	2	0	C11orf57	111458869	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.668000	0.46816	2.745000	0.94114	0.655000	0.94253	ACA	.		0.393	C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195	
UMODL1	89766	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	43523889	43523889	+	Intron	SNP	C	C	T	rs138845188	byFrequency	TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr21:43523889C>T	ENST00000408910.2	+	9	1299				UMODL1_ENST00000400427.1_Intron|UMODL1_ENST00000400424.2_Intron|UMODL1_ENST00000408989.2_Intron|C21orf128_ENST00000329015.2_Missense_Mutation_p.G115E	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1						adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						AGAAATGGCTCCAAGCACCAT	0.547													C|||	5	0.000998403	0.0038	0.0	5008	,	,		21820	0.0		0.0	False		,,,				2504	0.0				.	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	.											.	.	.	0			.						.	C	,,,	2,1382		0,2,690	165.0	146.0	152.0		,,,	1.2	0.0	21	dbSNP_134	152	0,3182		0,0,1591	no	intron,intron,intron,intron	UMODL1	NM_001004416.2,NM_001199527.1,NM_001199528.2,NM_173568.3	,,,	0,2,2281	TT,TC,CC		0.0,0.1445,0.0438	,,,	,,,	43523889	2,4564	692	1591	2283	SO:0001627	intron_variant	150147	.			ATGGCTCCAAGCA		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1300-89C>T	21.37:g.43523889C>T		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	10.0	.	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	RNA	SNP	ENST00000408910.2	37	CCDS42936.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	10.17	1.276715	0.23307	0.001445	0.0	ENSG00000184385	ENST00000329015	T	0.58652	0.32	3.12	1.16	0.20824	.	.	.	.	.	T	0.42765	0.1217	.	.	.	0.09310	N	1	B	0.25312	0.123	B	0.22880	0.042	T	0.39375	-0.9617	8	0.87932	D	0	.	4.4965	0.11839	0.0:0.6382:0.2295:0.1323	.	115	Q8N2C9	CU128_HUMAN	E	115	ENSP00000328495:G115E	ENSP00000328495:G115E	G	-	2	0	C21orf128	42396958	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.139000	0.10358	0.290000	0.22444	0.655000	0.94253	GGA	C|0.999;T|0.000		0.547	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
C6orf211	79624	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	151790078	151790078	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:151790078C>G	ENST00000367294.3	+	5	1418	c.1159C>G	c.(1159-1161)Cag>Gag	p.Q387E	C6orf211_ENST00000545879.1_Missense_Mutation_p.Q268E	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	387										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		TCCATTTCATCAGGCTCTGAA	0.433																																					p.Q387E		.											.	C6orf211	90	0			c.C1159G						.						61.0	66.0	64.0					6																	151790078		2203	4300	6503	SO:0001583	missense	79624	exon5			TTTCATCAGGCTC	AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.1159C>G	6.37:g.151790078C>G	ENSP00000356263:p.Gln387Glu	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	7.0	NM_024573	Q96FC6|Q9UFY5	Missense_Mutation	SNP	ENST00000367294.3	37	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	C	3.723	-0.057229	0.07317	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	T;T	0.05580	3.42;3.42	6.16	2.03	0.26663	Domain of unknown function DUF89 (2);	0.306697	0.36066	N	0.002808	T	0.00936	0.0031	N	0.03253	-0.375	0.31377	N	0.679457	B	0.02656	0.0	B	0.09377	0.004	T	0.50608	-0.8808	10	0.02654	T	1	.	20.5733	0.99360	0.0:0.54:0.46:0.0	.	387	Q9H993	CF211_HUMAN	E	387;268	ENSP00000356263:Q387E;ENSP00000444121:Q268E	ENSP00000356263:Q387E	Q	+	1	0	C6orf211	151831771	0.864000	0.29904	0.467000	0.27180	0.850000	0.48378	1.541000	0.36126	0.430000	0.26230	-0.219000	0.12488	CAG	.		0.433	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1	NM_024573	
CCDC13	152206	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	42754745	42754745	+	Silent	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:42754745G>A	ENST00000310232.6	-	14	1865	c.1782C>T	c.(1780-1782)cgC>cgT	p.R594R		NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	594										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						GCACCACGGTGCGGTGTCGCT	0.607																																					p.R594R		.											.	CCDC13	91	0			c.C1782T						.						116.0	106.0	110.0					3																	42754745		2203	4300	6503	SO:0001819	synonymous_variant	152206	exon14			CACGGTGCGGTGT	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1782C>T	3.37:g.42754745G>A		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	8.0	NM_144719		Silent	SNP	ENST00000310232.6	37	CCDS2705.1																																																																																			.		0.607	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
CCDC136	64753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128449544	128449544	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:128449544A>T	ENST00000297788.4	+	11	2013	c.1646A>T	c.(1645-1647)aAg>aTg	p.K549M	CCDC136_ENST00000464832.1_Intron|CCDC136_ENST00000487361.1_Intron|CCDC136_ENST00000378685.4_Intron	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	549						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						TTGCAGGAAAAGTACAAGGCC	0.587																																					p.K549M		.											.	CCDC136	24	0			c.A1646T						.						21.0	24.0	23.0					7																	128449544		2027	4107	6134	SO:0001583	missense	64753	exon11			AGGAAAAGTACAA		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.1646A>T	7.37:g.128449544A>T	ENSP00000297788:p.Lys549Met	Somatic	248.0	0.0		WXS	Illumina HiSeq	Phase_I	221.0	61.0	NM_022742	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Missense_Mutation	SNP	ENST00000297788.4	37	CCDS47704.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.61|18.61	3.660929|3.660929	0.67700|0.67700	.|.	.|.	ENSG00000128596|ENSG00000128596	ENST00000297788;ENST00000397697;ENST00000320524;ENST00000464672|ENST00000494552	T;T|.	0.35789|.	1.29;1.29|.	5.95|5.95	2.06|2.06	0.26882|0.26882	.|.	0.737577|.	0.12983|.	N|.	0.423081|.	T|T	0.24314|0.24314	0.0589|0.0589	L|L	0.34521|0.34521	1.04|1.04	0.20703|0.20703	N|N	0.999869|0.999869	B;B|.	0.33171|.	0.206;0.4|.	B;B|.	0.30855|.	0.085;0.121|.	T|T	0.21484|0.21484	-1.0244|-1.0244	10|5	0.62326|.	D|.	0.03|.	-19.2775|-19.2775	1.5329|1.5329	0.02539|0.02539	0.5498:0.1492:0.0917:0.2092|0.5498:0.1492:0.0917:0.2092	.|.	549;549|.	Q96JN2-2;Q96JN2|.	.;CC136_HUMAN|.	M|C	549;549;549;140|426	ENSP00000297788:K549M;ENSP00000417991:K140M|.	ENSP00000297788:K549M|.	K|S	+|+	2|1	0|0	CCDC136|CCDC136	128236780|128236780	0.332000|0.332000	0.24722|0.24722	0.785000|0.785000	0.31869|0.31869	0.968000|0.968000	0.65278|0.65278	0.640000|0.640000	0.24705|0.24705	0.499000|0.499000	0.27970|0.27970	0.533000|0.533000	0.62120|0.62120	AAG|AGT	.		0.587	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CCP110	9738	ucsc.edu;bcgsc.ca	37	16	19547850	19547850	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:19547850T>C	ENST00000381396.5	+	4	1106	c.859T>C	c.(859-861)Tca>Cca	p.S287P	CCP110_ENST00000396212.2_Missense_Mutation_p.S287P|CCP110_ENST00000396208.2_Missense_Mutation_p.S287P	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	287					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						ACACTGTGTCTCAGTTATTCC	0.408																																					p.S287P		.											.	CCP110	90	0			c.T859C						.						78.0	75.0	76.0					16																	19547850		2197	4300	6497	SO:0001583	missense	9738	exon4			TGTGTCTCAGTTA	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.859T>C	16.37:g.19547850T>C	ENSP00000370803:p.Ser287Pro	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	41.0	5.0	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	T	10.45	1.354418	0.24512	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.18174	2.23;2.23;2.23	6.07	1.15	0.20763	.	0.263563	0.33477	N	0.004862	T	0.12902	0.0313	L	0.44542	1.39	0.09310	N	1	B;B	0.21381	0.055;0.055	B;B	0.23852	0.049;0.049	T	0.19031	-1.0318	10	0.44086	T	0.13	-14.4893	6.0831	0.19952	0.0:0.2569:0.1217:0.6214	.	287;287	O43303;O43303-2	CP110_HUMAN;.	P	287	ENSP00000379515:S287P;ENSP00000370803:S287P;ENSP00000379511:S287P	ENSP00000370803:S287P	S	+	1	0	CCP110	19455351	0.093000	0.21703	0.116000	0.21606	0.993000	0.82548	0.550000	0.23345	0.153000	0.19213	0.533000	0.62120	TCA	.		0.408	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
CD163L1	283316	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7522105	7522105	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:7522105A>G	ENST00000313599.3	-	15	3944	c.3887T>C	c.(3886-3888)cTg>cCg	p.L1296P	CD163L1_ENST00000396630.1_Missense_Mutation_p.L1296P|CD163L1_ENST00000416109.2_Missense_Mutation_p.L1306P			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1296	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						AGCGTCCCTCAGGGCAGCCAG	0.597																																					p.L1296P		.											.	CD163L1	100	0			c.T3887C						.						107.0	102.0	104.0					12																	7522105		2203	4300	6503	SO:0001583	missense	283316	exon15			TCCCTCAGGGCAG	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3887T>C	12.37:g.7522105A>G	ENSP00000315945:p.Leu1296Pro	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	7.0	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	A	5.498	0.276958	0.10403	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.34859	1.34;1.34;1.34	2.67	-3.22	0.05125	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	2.183560	0.03249	N	0.181566	T	0.21103	0.0508	N	0.11698	0.16	0.09310	N	0.999997	B;B	0.24092	0.03;0.097	B;B	0.29663	0.029;0.105	T	0.18272	-1.0342	10	0.34782	T	0.22	.	5.4847	0.16743	0.3123:0.1919:0.4958:0.0	.	1306;1296	E7EVK4;Q9NR16	.;C163B_HUMAN	P	1296;1306;1296	ENSP00000315945:L1296P;ENSP00000393474:L1306P;ENSP00000379871:L1296P	ENSP00000315945:L1296P	L	-	2	0	CD163L1	7413372	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.207000	0.17395	-0.723000	0.04915	-0.371000	0.07208	CTG	.		0.597	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
CDK14	5218	ucsc.edu;bcgsc.ca	37	7	90741982	90741982	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:90741982G>T	ENST00000380050.3	+	13	1411	c.1280G>T	c.(1279-1281)tGg>tTg	p.W427L	CDK14_ENST00000406263.1_Missense_Mutation_p.W381L|CDK14_ENST00000436577.2_Missense_Mutation_p.W298L|CDK14_ENST00000265741.3_Missense_Mutation_p.W409L			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	427					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						CCACGGCTATGGGAACTCACC	0.493																																					p.W409L	GBM(83;1228 1256 8311 16577 31299)	.											.	CDK14	970	0			c.G1226T						.						71.0	62.0	65.0					7																	90741982		2203	4300	6503	SO:0001583	missense	5218	exon12			GGCTATGGGAACT		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.1280G>T	7.37:g.90741982G>T	ENSP00000369390:p.Trp427Leu	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	G	18.25	3.582952	0.65992	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.69806	-0.33;-0.32;-0.32;-0.43	6.07	5.17	0.71159	Protein kinase-like domain (1);	0.141269	0.51477	D	0.000100	T	0.54046	0.1834	N	0.22421	0.69	0.54753	D	0.999985	B;B;B	0.20459	0.018;0.045;0.018	B;B;B	0.22386	0.015;0.039;0.015	T	0.47433	-0.9118	10	0.21014	T	0.42	-7.9673	16.5444	0.84410	0.0:0.0:0.8684:0.1316	.	298;409;427	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	L	427;409;381;298	ENSP00000369390:W427L;ENSP00000265741:W409L;ENSP00000385034:W381L;ENSP00000398936:W298L	ENSP00000265741:W409L	W	+	2	0	CDK14	90579918	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.819000	0.91997	1.513000	0.48852	0.655000	0.94253	TGG	.		0.493	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
CDK5RAP2	55755	ucsc.edu;bcgsc.ca	37	9	123308036	123308036	+	Silent	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:123308036C>A	ENST00000349780.4	-	5	518	c.339G>T	c.(337-339)ctG>ctT	p.L113L	CDK5RAP2_ENST00000359309.3_Silent_p.L113L|CDK5RAP2_ENST00000360190.4_Silent_p.L113L|CDK5RAP2_ENST00000360822.3_Silent_p.L113L	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	113					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						GTTCCCGCTTCAGACTTTCTA	0.448																																					p.L113L		.											.	CDK5RAP2	229	0			c.G339T						.						156.0	146.0	149.0					9																	123308036		2203	4300	6503	SO:0001819	synonymous_variant	55755	exon5			CCGCTTCAGACTT	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.339G>T	9.37:g.123308036C>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	37	CCDS6823.1																																																																																			.		0.448	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
PSORS1C1	170679	ucsc.edu;bcgsc.ca	37	6	31084904	31084904	+	Intron	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:31084904A>G	ENST00000259881.9	+	1	61				PSORS1C1_ENST00000467107.1_3'UTR|CDSN_ENST00000376288.2_Missense_Mutation_p.F163S	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						GCTGCTGCTGAACTGAAAGCT	0.567																																					p.F163S		.											.	CDSN	92	0			c.T488C						.						47.0	50.0	49.0					6																	31084904		2203	4300	6503	SO:0001627	intron_variant	1041	exon2			CTGCTGAACTGAA	AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+2236A>G	6.37:g.31084904A>G		Somatic	20.0	0.0		WXS	Illumina HiSeq	.	34.0	6.0	NM_001264	B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	37	CCDS34390.1	.	.	.	.	.	.	.	.	.	.	A	3.062	-0.193048	0.06259	.	.	ENSG00000204539	ENST00000376288	T	0.04862	3.54	2.25	-2.93	0.05598	.	.	.	.	.	T	0.00580	0.0019	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45920	-0.9228	9	0.14656	T	0.56	.	6.8555	0.24038	0.3817:0.0:0.6183:0.0	.	163	Q15517	CDSN_HUMAN	S	163	ENSP00000365465:F163S	ENSP00000365465:F163S	F	-	2	0	CDSN	31192883	0.310000	0.24527	0.000000	0.03702	0.000000	0.00434	0.360000	0.20250	-0.748000	0.04753	-0.443000	0.05667	TTC	.		0.567	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068	
CEBPZ	10153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37455644	37455644	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:37455644G>C	ENST00000234170.5	-	2	837	c.692C>G	c.(691-693)tCt>tGt	p.S231C		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	231					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				CCAGGTAGAAGAGGCTCCCTT	0.438																																					p.S231C		.											.	CEBPZ	91	0			c.C692G						.						131.0	134.0	133.0					2																	37455644		2203	4300	6503	SO:0001583	missense	10153	exon2			GTAGAAGAGGCTC	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.692C>G	2.37:g.37455644G>C	ENSP00000234170:p.Ser231Cys	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	30.0	NM_005760	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	37	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058717	0.55325	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.02787	4.16	5.45	4.56	0.56223	.	0.235220	0.41294	N	0.000905	T	0.12092	0.0294	M	0.74258	2.255	0.37729	D	0.925204	D	0.89917	1.0	D	0.64144	0.922	T	0.01334	-1.1382	10	0.87932	D	0	.	11.124	0.48306	0.0:0.139:0.7165:0.1444	.	231	Q03701	CEBPZ_HUMAN	C	231	ENSP00000234170:S231C	ENSP00000234170:S231C	S	-	2	0	CEBPZ	37309148	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	5.406000	0.66357	1.258000	0.44101	0.655000	0.94253	TCT	.		0.438	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
CENPJ	55835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	25466801	25466801	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:25466801C>A	ENST00000381884.4	-	10	3381	c.3196G>T	c.(3196-3198)Gag>Tag	p.E1066*	CENPJ_ENST00000545981.1_Nonsense_Mutation_p.E1066*	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1066					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TCCTTCTTCTCCACCTCGAGG	0.517																																					p.E1066X		.											.	CENPJ	92	0			c.G3196T						.						137.0	133.0	135.0					13																	25466801		2203	4300	6503	SO:0001587	stop_gained	55835	exon10			TCTTCTCCACCTC	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3196G>T	13.37:g.25466801C>A	ENSP00000371308:p.Glu1066*	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	45.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Nonsense_Mutation	SNP	ENST00000381884.4	37	CCDS9310.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.999|8.999	0.979745|0.979745	0.18812|0.18812	.|.	.|.	ENSG00000151849|ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729|ENST00000418179	.|.	.|.	.|.	4.43|4.43	-6.4|-6.4	0.01944|0.01944	.|.	3.307320|.	0.00890|.	N|.	0.002233|.	.|T	.|0.17831	.|0.0428	.|.	.|.	.|.	0.47123|0.47123	A|A	0.999326|0.999326	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.29243	.|-1.0018	.|3	0.10636|.	T|.	0.68|.	.|.	3.1467|3.1467	0.06474|0.06474	0.1362:0.155:0.1234:0.5855|0.1362:0.155:0.1234:0.5855	.|.	.|.	.|.	.|.	X|V	1066|147	.|.	ENSP00000371308:E1066X|.	E|G	-|-	1|2	0|0	CENPJ|CENPJ	24364801|24364801	0.384000|0.384000	0.25164|0.25164	0.000000|0.000000	0.03702|0.03702	0.024000|0.024000	0.10985|0.10985	0.729000|0.729000	0.26028|0.26028	-0.801000|-0.801000	0.04427|0.04427	-0.391000|-0.391000	0.06502|0.06502	GAG|GGA	.		0.517	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179989459	179989459	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:179989459C>T	ENST00000367607.3	+	12	2968	c.2550C>T	c.(2548-2550)agC>agT	p.S850S		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	850					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTGGGGCCAGCATTAACTATG	0.453																																					p.S850S		.											.	CEP350	26	0			c.C2550T						.						146.0	148.0	148.0					1																	179989459		2203	4300	6503	SO:0001819	synonymous_variant	9857	exon12			GGCCAGCATTAAC	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2550C>T	1.37:g.179989459C>T		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	19.0	NM_014810	O75068|Q8TDK3|Q8WY20	Silent	SNP	ENST00000367607.3	37	CCDS1336.1																																																																																			.		0.453	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
CES3	23491	ucsc.edu;bcgsc.ca	37	16	66998383	66998383	+	Silent	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:66998383A>G	ENST00000303334.4	+	5	755	c.684A>G	c.(682-684)ggA>ggG	p.G228G	CES3_ENST00000394037.1_Silent_p.G228G|RP11-361L15.4_ENST00000566869.1_RNA|CES3_ENST00000543856.1_5'Flank	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	228						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		TCTTTGGTGGATCTGCCGGTG	0.587																																					p.G228G		.											.	CES3	517	0			c.A684G						.						100.0	104.0	102.0					16																	66998383		2200	4300	6500	SO:0001819	synonymous_variant	23491	exon5			TGGTGGATCTGCC	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.684A>G	16.37:g.66998383A>G		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_024922	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Silent	SNP	ENST00000303334.4	37	CCDS10826.1																																																																																			.		0.587	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
CHRD	8646	ucsc.edu;bcgsc.ca	37	3	184101103	184101103	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:184101103T>C	ENST00000204604.1	+	11	1463	c.1217T>C	c.(1216-1218)cTg>cCg	p.L406P	CHRD_ENST00000348986.3_Missense_Mutation_p.L406P|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000545352.1_Missense_Mutation_p.L36P|CHRD_ENST00000450923.1_Missense_Mutation_p.L406P	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	406	CHRD 3. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCCGTAGTCCTGCAAAGTGTC	0.602																																					p.L406P		.											.	CHRD	93	0			c.T1217C						.						90.0	80.0	83.0					3																	184101103		2203	4300	6503	SO:0001583	missense	8646	exon11			TAGTCCTGCAAAG	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1217T>C	3.37:g.184101103T>C	ENSP00000204604:p.Leu406Pro	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_003741	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	T	17.68	3.449853	0.63290	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352;ENST00000342610	T;T;T;T	0.49139	0.79;0.79;2.28;0.79	4.65	4.65	0.58169	CHRD (3);	0.164390	0.40640	N	0.001053	T	0.63082	0.2481	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.998;1.0	D;D;D;D	0.83275	0.996;0.991;0.99;0.989	T	0.66646	-0.5871	10	0.87932	D	0	-12.5033	13.2499	0.60045	0.0:0.0:0.0:1.0	.	36;406;406;406	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	P	406;406;406;36;119	ENSP00000204604:L406P;ENSP00000408972:L406P;ENSP00000334036:L406P;ENSP00000442948:L36P	ENSP00000204604:L406P	L	+	2	0	CHRD	185583797	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.942000	0.63547	1.870000	0.54199	0.379000	0.24179	CTG	.		0.602	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
CHUK	1147	ucsc.edu;bcgsc.ca	37	10	101982676	101982676	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:101982676G>T	ENST00000370397.7	-	3	348	c.262C>A	c.(262-264)Cat>Aat	p.H88N		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	88	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	GGCACATCATGAATCAAAATA	0.343																																					p.H88N	Ovarian(159;52 1904 10536 35305 37148)	.											.	CHUK	961	0			c.C262A						.						122.0	107.0	112.0					10																	101982676		2203	4300	6503	SO:0001583	missense	1147	exon3			CATCATGAATCAA	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.262C>A	10.37:g.101982676G>T	ENSP00000359424:p.His88Asn	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001278	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	37	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	G	1.752	-0.488920	0.04352	.	.	ENSG00000213341	ENST00000370397	T	0.63744	-0.06	5.31	4.18	0.49190	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.138283	0.64402	N	0.000005	T	0.24470	0.0593	N	0.00656	-1.285	0.29587	N	0.848714	B	0.02656	0.0	B	0.01281	0.0	T	0.27739	-1.0065	10	0.02654	T	1	-11.5991	10.4806	0.44691	0.0:0.0:0.1948:0.8052	.	88	O15111	IKKA_HUMAN	N	88	ENSP00000359424:H88N	ENSP00000359424:H88N	H	-	1	0	CHUK	101972666	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	5.797000	0.69087	1.025000	0.39708	-0.274000	0.10170	CAT	.		0.343	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
CSNK1A1L	122011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	37678951	37678951	+	Missense_Mutation	SNP	C	C	T	rs201851808		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:37678951C>T	ENST00000379800.3	-	1	852	c.443G>A	c.(442-444)cGt>cAt	p.R148H		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	148	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		ATTACAGTGACGCCCAGTACC	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		20892	0.001		0.0	False		,,,				2504	0.0				p.R148H		.											.	CSNK1A1L	396	0			c.G443A						.						210.0	192.0	198.0					13																	37678951		2203	4300	6503	SO:0001583	missense	122011	exon1			CAGTGACGCCCAG	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.443G>A	13.37:g.37678951C>T	ENSP00000369126:p.Arg148His	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	88.0	NM_145203	Q5T2N2	Missense_Mutation	SNP	ENST00000379800.3	37	CCDS9363.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.499	0.652182	0.14580	.	.	ENSG00000180138	ENST00000379800	T	0.19938	2.11	1.08	1.08	0.20341	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.107353	0.64402	N	0.000011	T	0.29061	0.0722	M	0.91459	3.21	0.39431	D	0.967085	B	0.23735	0.09	B	0.18561	0.022	T	0.32771	-0.9894	10	0.72032	D	0.01	.	7.9927	0.30250	0.0:1.0:0.0:0.0	.	148	Q8N752	KC1AL_HUMAN	H	148	ENSP00000369126:R148H	ENSP00000369126:R148H	R	-	2	0	CSNK1A1L	36576951	0.998000	0.40836	0.684000	0.30055	0.204000	0.24138	1.450000	0.35134	0.871000	0.35750	0.561000	0.74099	CGT	C|0.999;T|0.000		0.413	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
DIP2A	23181	ucsc.edu;bcgsc.ca	37	21	47978170	47978170	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr21:47978170G>T	ENST00000417564.2	+	32	3854	c.3833G>T	c.(3832-3834)tGc>tTc	p.C1278F	DIP2A_ENST00000400274.1_Missense_Mutation_p.C1274F|DIP2A_ENST00000318711.7_Missense_Mutation_p.C1279F			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1278					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GTGCGCACGTGCATGGTGGTC	0.672																																					p.C1278F		.											.	DIP2A	24	0			c.G3833T						.						26.0	31.0	30.0					21																	47978170		2122	4225	6347	SO:0001583	missense	23181	exon32			GCACGTGCATGGT	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3833G>T	21.37:g.47978170G>T	ENSP00000392066:p.Cys1278Phe	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_015151	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	37	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527274	0.85706	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.38722	1.12;1.12;1.12	5.2	5.2	0.72013	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	M	0.74647	2.275	0.80722	D	1	P;D;B	0.76494	0.921;0.999;0.131	P;D;B	0.87578	0.861;0.998;0.328	T	0.65393	-0.6179	10	0.41790	T	0.15	-21.1042	17.7235	0.88359	0.0:0.0:1.0:0.0	.	1279;69;1278	E9PER1;Q9NSX6;Q14689	.;.;DIP2A_HUMAN	F	1274;1279;1278	ENSP00000383133:C1274F;ENSP00000323633:C1279F;ENSP00000392066:C1278F	ENSP00000323633:C1279F	C	+	2	0	DIP2A	46802598	1.000000	0.71417	0.993000	0.49108	0.618000	0.37518	9.618000	0.98365	2.430000	0.82344	0.557000	0.71058	TGC	.		0.672	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
DOCK6	57572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11339690	11339690	+	Silent	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:11339690G>A	ENST00000294618.7	-	23	2751	c.2740C>T	c.(2740-2742)Ctg>Ttg	p.L914L	DOCK6_ENST00000319867.7_Silent_p.L253L	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	914					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						ACCCACTGCAGAGCCAGCTCC	0.647																																					p.L914L		.											.	DOCK6	93	0			c.C2740T						.						32.0	37.0	35.0					19																	11339690		2139	4249	6388	SO:0001819	synonymous_variant	57572	exon23			ACTGCAGAGCCAG		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2740C>T	19.37:g.11339690G>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	15.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	37	CCDS45975.1																																																																																			.		0.647	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
DPH5	51611	ucsc.edu;bcgsc.ca	37	1	101490900	101490900	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:101490900A>T	ENST00000370109.3	-	2	212	c.100T>A	c.(100-102)Tac>Aac	p.Y34N	DPH5_ENST00000370105.3_5'UTR|RP11-421L21.3_ENST00000446527.1_RNA|DPH5_ENST00000342173.7_Missense_Mutation_p.Y34N|RP11-421L21.3_ENST00000453011.1_RNA|DPH5_ENST00000488176.1_Missense_Mutation_p.Y34N	NM_001077394.1|NM_001077395.1|NM_015958.2	NP_001070862.1|NP_001070863.1|NP_057042.2	Q9H2P9	DPH5_HUMAN	diphthamide biosynthesis 5	34					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		diphthine synthase activity (GO:0004164)			endometrium(2)|large_intestine(1)|lung(4)	7		all_epithelial(167;3.1e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0385)|all cancers(265;0.043)|COAD - Colon adenocarcinoma(174;0.151)|Colorectal(144;0.173)|Lung(183;0.198)		ACTGAGGTGTAGGCTTCCAGA	0.507																																					p.Y34N		.											.	DPH5	90	0			c.T100A						.						75.0	74.0	74.0					1																	101490900		1933	4157	6090	SO:0001583	missense	51611	exon2			AGGTGTAGGCTTC	AF132964	CCDS41358.1, CCDS41359.1	1p21.2	2013-05-02	2013-05-02		ENSG00000117543	ENSG00000117543			24270	protein-coding gene	gene with protein product		611075	"""DPH5 homolog (S. cerevisiae)"""			15485916, 23486472	Standard	NM_015958		Approved	CGI-30	uc001dtt.2	Q9H2P9	OTTHUMG00000010829	ENST00000370109.3:c.100T>A	1.37:g.101490900A>T	ENSP00000359127:p.Tyr34Asn	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001077395	A8JZY6|D3DT62|Q9P017|Q9P0I4|Q9Y319	Missense_Mutation	SNP	ENST00000370109.3	37	CCDS41358.1	.	.	.	.	.	.	.	.	.	.	A	33	5.237285	0.95240	.	.	ENSG00000117543	ENST00000370109;ENST00000434818;ENST00000422396;ENST00000342173;ENST00000488176	.	.	.	6.08	6.08	0.98989	Tetrapyrrole methylase (2);Tetrapyrrole methylase, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.86669	0.5988	H	0.96604	3.85	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91106	0.4918	9	0.87932	D	0	-6.7656	16.6512	0.85203	1.0:0.0:0.0:0.0	.	34;34;34	Q9H2P9-5;Q9H2P9;A8JZY6	.;DPH5_HUMAN;.	N	34	.	ENSP00000339630:Y34N	Y	-	1	0	DPH5	101263488	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.124000	0.94394	2.333000	0.79357	0.482000	0.46254	TAC	.		0.507	DPH5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000029881.1	NM_015958	
DYDC1	143241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	82098869	82098869	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:82098869T>C	ENST00000372204.3	-	6	547	c.383A>G	c.(382-384)gAt>gGt	p.D128G	DYDC1_ENST00000421924.2_Missense_Mutation_p.D128G|DYDC1_ENST00000372202.1_Missense_Mutation_p.D128G	NM_138812.3	NP_620167.1	Q8WWB3	DYDC1_HUMAN	DPY30 domain containing 1	128										kidney(1)|large_intestine(3)|skin(1)	5			Colorectal(32;0.229)			ATGTAGAATATCTTCATTCCT	0.264																																					p.D128G		.											.	DYDC1	68	0			c.A383G						.						67.0	60.0	62.0					10																	82098869		2186	4279	6465	SO:0001583	missense	143241	exon5			AGAATATCTTCAT	BC019250	CCDS7366.1	10q22.3	2006-02-01			ENSG00000170788	ENSG00000170788			23460	protein-coding gene	gene with protein product		615154					Standard	NM_138812		Approved	bA36D19.5, DPY30D1	uc031pwj.1	Q8WWB3	OTTHUMG00000018609	ENST00000372204.3:c.383A>G	10.37:g.82098869T>C	ENSP00000361278:p.Asp128Gly	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	288.0	28.0	NM_001269053	A8K927|Q5QP03|Q5QP04|Q6WNP4|Q6ZU87	Missense_Mutation	SNP	ENST00000372204.3	37	CCDS7366.1	.	.	.	.	.	.	.	.	.	.	T	9.869	1.198414	0.22037	.	.	ENSG00000170788	ENST00000372204;ENST00000372202;ENST00000421924;ENST00000454362	.	.	.	4.88	3.74	0.42951	.	0.890365	0.09714	N	0.765370	T	0.19287	0.0463	N	0.08118	0	0.09310	N	1	B;B	0.12630	0.006;0.003	B;B	0.08055	0.003;0.002	T	0.19353	-1.0308	9	0.33141	T	0.24	-7.4756	7.371	0.26802	0.0:0.0983:0.0:0.9017	.	128;128	A8K927;Q8WWB3	.;DYDC1_HUMAN	G	128	.	ENSP00000361276:D128G	D	-	2	0	DYDC1	82088849	0.377000	0.25106	0.092000	0.20876	0.112000	0.19704	1.674000	0.37544	0.989000	0.38761	0.533000	0.62120	GAT	.		0.264	DYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049059.1	NM_138812	
ECH1	1891	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39322023	39322023	+	Silent	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:39322023A>G	ENST00000221418.4	-	2	418	c.186T>C	c.(184-186)tcT>tcC	p.S62S	AC104534.3_ENST00000594769.1_Missense_Mutation_p.L232P|ECH1_ENST00000597805.1_Intron	NM_001398.2	NP_001389.2	Q13011	ECH1_HUMAN	enoyl CoA hydratase 1, peroxisomal	62					fatty acid beta-oxidation (GO:0006635)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	isomerase activity (GO:0016853)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	6	all_cancers(60;9.36e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GTTTCTGCGCAGACGTCACAC	0.572																																					p.S62S		.											.	ECH1	91	0			c.T186C						.						109.0	105.0	106.0					19																	39322023		2203	4300	6503	SO:0001819	synonymous_variant	1891	exon2			CTGCGCAGACGTC	U16660	CCDS33014.1	19q13.1	2010-04-30	2010-04-30			ENSG00000104823			3149	protein-coding gene	gene with protein product		600696	"""enoyl Coenzyme A hydratase 1, peroxisomal"""			7558027	Standard	XM_005258610		Approved	HPXEL		Q13011		ENST00000221418.4:c.186T>C	19.37:g.39322023A>G		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	12.0	NM_001398	A8K745|Q8WVX0|Q96EZ9	Silent	SNP	ENST00000221418.4	37	CCDS33014.1																																																																																			.		0.572	ECH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462650.1		
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38407124	38407124	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:38407124G>T	ENST00000354891.3	+	8	1369	c.1023G>T	c.(1021-1023)agG>agT	p.R341S	EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000322350.5_Missense_Mutation_p.R341S|EGFLAM_ENST00000336740.6_Missense_Mutation_p.R107S	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	341					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					TAATGTCAAGGCTCTTTGACA	0.562																																					p.R341S	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.G1023T						.						139.0	130.0	133.0					5																	38407124		2203	4300	6503	SO:0001583	missense	133584	exon8			GTCAAGGCTCTTT	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1023G>T	5.37:g.38407124G>T	ENSP00000346964:p.Arg341Ser	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	30.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305185	0.81247	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.80566	0.74;0.57;-1.39	5.91	5.91	0.95273	.	0.052871	0.64402	D	0.000001	D	0.89420	0.6710	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.996;0.98	D	0.89304	0.3628	10	0.56958	D	0.05	-0.0346	16.7452	0.85470	0.0:0.1373:0.8627:0.0	.	107;341;341	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	S	341;341;107;107	ENSP00000346964:R341S;ENSP00000313084:R341S;ENSP00000337607:R107S	ENSP00000313084:R341S	R	+	3	2	EGFLAM	38442881	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	1.358000	0.34102	2.802000	0.96397	0.655000	0.94253	AGG	.		0.562	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
EIF4H	7458	broad.mit.edu;bcgsc.ca	37	7	73602087	73602087	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:73602087G>T	ENST00000265753.8	+	2	345	c.206G>T	c.(205-207)aGt>aTt	p.S69I	EIF4H_ENST00000353999.6_Missense_Mutation_p.S69I|EIF4H_ENST00000495187.1_3'UTR	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	69	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						AGCATAAGGAGTGTACGGCTA	0.443																																					p.S69I		.											.	EIF4H	90	0			c.G206T						.						114.0	113.0	113.0					7																	73602087		2203	4298	6501	SO:0001583	missense	7458	exon2			TAAGGAGTGTACG		CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.206G>T	7.37:g.73602087G>T	ENSP00000265753:p.Ser69Ile	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	6.0	NM_022170	A8K3R1|D3DXF6|D3DXF8	Missense_Mutation	SNP	ENST00000265753.8	37	CCDS5564.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000826	0.93227	.	.	ENSG00000106682	ENST00000265753;ENST00000353999	T;T	0.77098	-1.07;-1.07	5.17	5.17	0.71159	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.087359	0.85682	D	0.000000	D	0.91653	0.7362	H	0.95745	3.715	0.80722	D	1	P;P;D;P	0.69078	0.938;0.938;0.997;0.811	D;D;D;P	0.79784	0.911;0.911;0.993;0.79	D	0.93769	0.7073	10	0.66056	D	0.02	-16.8946	17.5839	0.87976	0.0:0.0:1.0:0.0	.	69;69;69;69	B4DMV6;Q75MU2;Q15056-2;Q15056	.;.;.;IF4H_HUMAN	I	69	ENSP00000265753:S69I;ENSP00000265754:S69I	ENSP00000265753:S69I	S	+	2	0	EIF4H	73240023	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.570000	0.98174	2.569000	0.86673	0.462000	0.41574	AGT	.		0.443	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252375.2	NM_022170	
ERP29	10961	ucsc.edu;bcgsc.ca	37	12	112460309	112460309	+	Silent	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:112460309G>T	ENST00000261735.3	+	3	789	c.639G>T	c.(637-639)ggG>ggT	p.G213G	ERP29_ENST00000455836.1_3'UTR|ERP29_ENST00000546477.1_Silent_p.G112G	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	213					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						TAGACCAAGGGGAGGACTTCC	0.502																																					p.G213G		.											.	ERP29	90	0			c.G639T						.						76.0	73.0	74.0					12																	112460309		2203	4300	6503	SO:0001819	synonymous_variant	10961	exon3			CCAAGGGGAGGAC	X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.639G>T	12.37:g.112460309G>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_006817	C9J183|Q3MJC3|Q6FHT4	Silent	SNP	ENST00000261735.3	37	CCDS9158.1																																																																																			.		0.502	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405200.1		
EVPL	2125	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	74019605	74019605	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:74019605G>T	ENST00000301607.3	-	3	582	c.329C>A	c.(328-330)cCg>cAg	p.P110Q	EVPL_ENST00000586740.1_Missense_Mutation_p.P110Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	110	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTCAGCCTGCGGGTGCTTGAG	0.667																																					p.P110Q		.											.	EVPL	93	0			c.C329A						.						33.0	42.0	39.0					17																	74019605		2202	4299	6501	SO:0001583	missense	2125	exon3			GCCTGCGGGTGCT	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.329C>A	17.37:g.74019605G>T	ENSP00000301607:p.Pro110Gln	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	23.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914910	0.72983	.	.	ENSG00000167880	ENST00000301607	T	0.66280	-0.2	4.66	3.67	0.42095	.	0.056975	0.64402	D	0.000001	T	0.73992	0.3658	M	0.64170	1.965	0.46701	D	0.999163	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.75505	-0.3294	10	0.87932	D	0	-40.3397	10.5343	0.44994	0.0756:0.1326:0.7918:0.0	.	110;110	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	110	ENSP00000301607:P110Q	ENSP00000301607:P110Q	P	-	2	0	EVPL	71531200	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	6.067000	0.71193	1.070000	0.40811	0.561000	0.74099	CCG	.		0.667	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
FAM124B	79843	broad.mit.edu;bcgsc.ca	37	2	225244374	225244374	+	Silent	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:225244374G>A	ENST00000409685.3	-	2	1549	c.1284C>T	c.(1282-1284)acC>acT	p.T428T	FAM124B_ENST00000389874.3_3'UTR	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	428										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		TTGTCTTCCTGGTACCAAGGT	0.433																																					p.T428T		.											.	FAM124B	92	0			c.C1284T						.						53.0	50.0	51.0					2																	225244374		692	1591	2283	SO:0001819	synonymous_variant	79843	exon2			CTTCCTGGTACCA	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.1284C>T	2.37:g.225244374G>A		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	6.0	NM_001122779	A6NNC7|Q8NBZ4|Q8TAV7	Silent	SNP	ENST00000409685.3	37	CCDS46527.1																																																																																			.		0.433	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
FAM13B	51306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	137284796	137284796	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:137284796C>T	ENST00000033079.3	-	17	2393	c.1942G>A	c.(1942-1944)Ggc>Agc	p.G648S	FAM13B_ENST00000425075.2_Missense_Mutation_p.G552S|FAM13B_ENST00000420893.2_Missense_Mutation_p.G648S	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	648					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AGAGAAGAGCCAAAGCTTTTT	0.388																																					p.G648S		.											.	.	.	0			c.G1942A						.						175.0	167.0	169.0					5																	137284796		2203	4300	6503	SO:0001583	missense	51306	exon17			AAGAGCCAAAGCT	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1942G>A	5.37:g.137284796C>T	ENSP00000033079:p.Gly648Ser	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	19.0	NM_001101800	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	37	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	C	33	5.248572	0.95305	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.26518	2.89;1.73;2.88	5.06	5.06	0.68205	.	0.255560	0.36628	N	0.002484	T	0.49253	0.1546	L	0.56396	1.775	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;P	0.91635	0.939;0.999;0.871	T	0.45145	-0.9281	10	0.52906	T	0.07	-5.838	18.4225	0.90595	0.0:1.0:0.0:0.0	.	552;648;648	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	S	648;552;648	ENSP00000033079:G648S;ENSP00000394669:G552S;ENSP00000388521:G648S	ENSP00000033079:G648S	G	-	1	0	FAM13B	137312695	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.414000	0.80117	2.508000	0.84585	0.650000	0.86243	GGC	.		0.388	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
FAM160B2	64760	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	21959694	21959694	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr8:21959694C>A	ENST00000289921.7	+	15	1906	c.1860C>A	c.(1858-1860)agC>agA	p.S620R		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	620										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						AGCCATACAGCCTGAACCTGC	0.612																																					p.S620R		.											.	.	.	0			c.C1860A						.						72.0	78.0	76.0					8																	21959694		2129	4225	6354	SO:0001583	missense	64760	exon15			ATACAGCCTGAAC	AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1860C>A	8.37:g.21959694C>A	ENSP00000289921:p.Ser620Arg	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	9.0	NM_022749	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	ENST00000289921.7	37	CCDS6021.2	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518746	0.64634	.	.	ENSG00000158863	ENST00000289921;ENST00000356512	T	0.44083	0.93	5.47	4.59	0.56863	.	0.228496	0.47455	D	0.000228	T	0.42854	0.1221	L	0.50333	1.59	0.36860	D	0.888358	P	0.42827	0.791	P	0.44422	0.449	T	0.55509	-0.8130	10	0.87932	D	0	-22.4736	12.5263	0.56087	0.0:0.9166:0.0:0.0833	.	620	Q86V87	F16B2_HUMAN	R	620;38	ENSP00000289921:S620R	ENSP00000289921:S620R	S	+	3	2	FAM160B2	22015639	0.956000	0.32656	1.000000	0.80357	0.998000	0.95712	0.044000	0.13992	2.562000	0.86427	0.561000	0.74099	AGC	.		0.612	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375334.2		
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92531317	92531317	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:92531317T>A	ENST00000298047.6	+	9	5155	c.5138T>A	c.(5137-5139)aTc>aAc	p.I1713N	FAT3_ENST00000525166.1_Missense_Mutation_p.I1563N|FAT3_ENST00000409404.2_Missense_Mutation_p.I1713N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1713	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATTAATGGGATCTTTACCATA	0.398										TCGA Ovarian(4;0.039)																											p.I1713N		.											.	FAT3	73	0			c.T5138A						.						108.0	107.0	107.0					11																	92531317		1957	4143	6100	SO:0001583	missense	120114	exon9			ATGGGATCTTTAC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.5138T>A	11.37:g.92531317T>A	ENSP00000298047:p.Ile1713Asn	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	56.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	12.04	1.818661	0.32145	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.50277	0.75;0.75;0.75	5.93	-2.4	0.06583	.	.	.	.	.	T	0.29458	0.0734	N	0.25485	0.75	0.09310	N	1	B	0.28605	0.217	B	0.24541	0.054	T	0.15206	-1.0445	9	0.30854	T	0.27	.	9.459	0.38772	0.0:0.5162:0.1259:0.3579	.	1713	Q8TDW7-3	.	N	1713;1713;1563	ENSP00000298047:I1713N;ENSP00000387040:I1713N;ENSP00000432586:I1563N	ENSP00000298047:I1713N	I	+	2	0	FAT3	92170965	0.000000	0.05858	0.001000	0.08648	0.809000	0.45718	0.103000	0.15292	-0.421000	0.07416	0.482000	0.46254	ATC	.		0.398	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FBXW5	54461	ucsc.edu;bcgsc.ca	37	9	139837928	139837928	+	Missense_Mutation	SNP	C	C	T	rs141420875		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:139837928C>T	ENST00000325285.3	-	3	303	c.224G>A	c.(223-225)cGg>cAg	p.R75Q	C8G_ENST00000224181.3_5'Flank|FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	75					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GTCATACAGCCGCTGGAACTC	0.657																																					p.R75Q		.											.	FBXW5	226	0			c.G224A						.		GLN/ARG	0,4402		0,0,2201	56.0	42.0	47.0		224	3.7	0.1	9	dbSNP_134	47	1,8593	1.2+/-3.3	0,1,4296	no	missense	FBXW5	NM_018998.2	43	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	75/567	139837928	1,12995	2201	4297	6498	SO:0001583	missense	54461	exon3			TACAGCCGCTGGA	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.224G>A	9.37:g.139837928C>T	ENSP00000313034:p.Arg75Gln	Somatic	60.0	1.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_018998	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Missense_Mutation	SNP	ENST00000325285.3	37	CCDS7014.1	.	.	.	.	.	.	.	.	.	.	c	34	5.369917	0.95900	0.0	1.16E-4	ENSG00000159069	ENST00000325285;ENST00000428398;ENST00000443788	T;T;D	0.85556	-0.33;1.48;-2.0	4.58	3.68	0.42216	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);F-box domain, Skp2-like (1);	0.060798	0.64402	D	0.000004	D	0.91372	0.7278	M	0.82323	2.585	0.51482	D	0.999928	D	0.89917	1.0	D	0.80764	0.994	D	0.89697	0.3902	10	0.30078	T	0.28	-20.8381	12.2096	0.54371	0.0:0.9167:0.0:0.0833	.	75	Q969U6	FBXW5_HUMAN	Q	75	ENSP00000313034:R75Q;ENSP00000404829:R75Q;ENSP00000394011:R75Q	ENSP00000313034:R75Q	R	-	2	0	FBXW5	138957749	1.000000	0.71417	0.111000	0.21465	0.943000	0.58893	7.227000	0.78070	0.888000	0.36160	0.556000	0.70494	CGG	C|1.000;T|0.000		0.657	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1	NM_018998	
FCRL3	115352	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	157667132	157667132	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:157667132C>T	ENST00000368184.3	-	6	933	c.642G>A	c.(640-642)caG>caA	p.Q214Q	FCRL3_ENST00000368186.5_Silent_p.Q214Q|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	214	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					GTGGAGAGAGCTGGGTCTCAC	0.557																																					p.Q214Q		.											.	FCRL3	156	0			c.G642A						.						73.0	77.0	76.0					1																	157667132		2203	4300	6503	SO:0001819	synonymous_variant	115352	exon6			AGAGAGCTGGGTC	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.642G>A	1.37:g.157667132C>T		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	8.0	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	ENST00000368184.3	37	CCDS1167.1																																																																																			.		0.557	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
FCAMR	83953	broad.mit.edu;bcgsc.ca	37	1	207134362	207134362	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:207134362T>C	ENST00000324852.4	-	6	1333	c.859A>G	c.(859-861)Acc>Gcc	p.T287A	FCAMR_ENST00000450945.2_Intron|FCAMR_ENST00000400962.3_Intron|FCAMR_ENST00000486178.1_5'Flank	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	242					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						GCTGGCCTGGTTGCTCCTGGG	0.577																																					p.T287A	Ovarian(199;1883 2142 16966 44409 45154)	.											.	FCAMR	91	0			c.A859G						.						125.0	107.0	112.0					1																	207134362		692	1591	2283	SO:0001583	missense	83953	exon6			GCCTGGTTGCTCC	AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.859A>G	1.37:g.207134362T>C	ENSP00000316491:p.Thr287Ala	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	8.0	NM_001170631	Q32M82|Q8WWV5|Q96SA2	Missense_Mutation	SNP	ENST00000324852.4	37	CCDS53468.1	.	.	.	.	.	.	.	.	.	.	T	9.527	1.109892	0.20714	.	.	ENSG00000162897	ENST00000324852;ENST00000367087	T	0.04970	3.52	5.23	1.51	0.23008	.	0.205810	0.33040	N	0.005352	T	0.03827	0.0108	L	0.34521	1.04	0.09310	N	0.999999	B;B	0.24963	0.115;0.024	B;B	0.15870	0.014;0.005	T	0.43829	-0.9367	10	0.19147	T	0.46	-6.0512	3.8835	0.09088	0.0:0.1534:0.4466:0.4	.	262;242	D2KTA8;Q8WWV6	.;FCAMR_HUMAN	A	287;263	ENSP00000316491:T287A	ENSP00000316491:T287A	T	-	1	0	FCAMR	205200985	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.231000	0.17872	0.063000	0.16370	0.459000	0.35465	ACC	.		0.577	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088969.2	NM_032029	
GATA6	2627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	19780725	19780725	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr18:19780725C>T	ENST00000269216.3	+	7	2004	c.1727C>T	c.(1726-1728)tCg>tTg	p.S576L	GATA6_ENST00000581694.1_Missense_Mutation_p.S576L|RP11-627G18.1_ENST00000583442.1_RNA	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	576					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			AGTCTCGCCTCGCCGGCCGAA	0.682																																					p.S576L	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	.											.	GATA6	514	0			c.C1727T						.						68.0	52.0	57.0					18																	19780725		2203	4300	6503	SO:0001583	missense	2627	exon7			TCGCCTCGCCGGC	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1727C>T	18.37:g.19780725C>T	ENSP00000269216:p.Ser576Leu	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	12.0	NM_005257	B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	37	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278368	0.80692	.	.	ENSG00000141448	ENST00000269216	D	0.98075	-4.7	5.81	4.94	0.65067	.	0.295719	0.33057	N	0.005323	D	0.96349	0.8809	M	0.66939	2.045	0.54753	D	0.999981	B	0.24768	0.111	B	0.14578	0.011	D	0.94761	0.7936	10	0.66056	D	0.02	-15.671	14.8494	0.70284	0.0:0.9314:0.0:0.0686	.	576	Q92908	GATA6_HUMAN	L	576	ENSP00000269216:S576L	ENSP00000269216:S576L	S	+	2	0	GATA6	18034723	0.998000	0.40836	0.729000	0.30791	0.967000	0.64934	3.730000	0.55006	1.467000	0.48044	0.655000	0.94253	TCG	.		0.682	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257	
GDE1	51573	ucsc.edu;bcgsc.ca	37	16	19533181	19533181	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:19533181C>T	ENST00000353258.3	-	1	286	c.106G>A	c.(106-108)Ggc>Agc	p.G36S	CCP110_ENST00000396212.2_5'Flank|CCP110_ENST00000396208.2_5'Flank|CCP110_ENST00000381396.5_5'Flank	NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	36					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						AAGAGGCTGCCGGTGAGGAGG	0.662																																					p.G36S		.											.	GDE1	70	0			c.G106A						.						17.0	22.0	20.0					16																	19533181		2193	4297	6490	SO:0001583	missense	51573	exon1			GGCTGCCGGTGAG		CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.106G>A	16.37:g.19533181C>T	ENSP00000261386:p.Gly36Ser	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_016641	O43334|Q6PKF7|Q7KYR4	Missense_Mutation	SNP	ENST00000353258.3	37	CCDS10578.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393080	0.42410	.	.	ENSG00000006007	ENST00000353258	T	0.22743	1.94	5.02	2.86	0.33363	.	0.505215	0.22442	N	0.060001	T	0.16642	0.0400	L	0.47716	1.5	0.29305	N	0.868403	B	0.30114	0.269	B	0.23716	0.048	T	0.10042	-1.0647	10	0.18710	T	0.47	-13.5632	12.4938	0.55916	0.2988:0.7012:0.0:0.0	.	36	Q9NZC3	GDE1_HUMAN	S	36	ENSP00000261386:G36S	ENSP00000261386:G36S	G	-	1	0	GDE1	19440682	0.965000	0.33210	1.000000	0.80357	0.576000	0.36127	2.237000	0.43061	1.418000	0.47098	0.561000	0.74099	GGC	.		0.662	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254274.2	NM_016641	
GFPT1	2673	ucsc.edu;bcgsc.ca	37	2	69581700	69581700	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:69581700C>T	ENST00000357308.4	-	8	784	c.606G>A	c.(604-606)agG>agA	p.R202R	GFPT1_ENST00000361060.5_Splice_Site_p.R202R	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	202	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						GGCTACCTCGCCTGTAAATTG	0.328																																					p.R202R		.											.	GFPT1	91	0			c.G606A						.						97.0	98.0	97.0					2																	69581700		2203	4300	6503	SO:0001630	splice_region_variant	2673	exon8			ACCTCGCCTGTAA		CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.606-1G>A	2.37:g.69581700C>T		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001244710	Q53QE6|Q9BXF8	Silent	SNP	ENST00000357308.4	37	CCDS58713.1																																																																																			.		0.328	GFPT1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			Silent
GH2	2689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	61957832	61957832	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:61957832G>T	ENST00000423893.2	-	5	564	c.503C>A	c.(502-504)tCc>tAc	p.S168Y	GH2_ENST00000449787.2_Missense_Mutation_p.S153Y|GH2_ENST00000332800.7_Silent_p.V252V|GH2_ENST00000456543.2_Missense_Mutation_p.P167T			P01242	SOM2_HUMAN	growth hormone 2	168					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						CTTGCTGTAGGACTGATTGAA	0.542																																					p.S168Y		.											.	GH2	93	0			c.C503A						.						189.0	157.0	168.0					17																	61957832		2203	4300	6503	SO:0001583	missense	2689	exon5			CTGTAGGACTGAT	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.503C>A	17.37:g.61957832G>T	ENSP00000409294:p.Ser168Tyr	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	241.0	48.0	NM_002059	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	37	CCDS11647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.41|11.41	1.631433|1.631433	0.28978|0.28978	.|.	.|.	ENSG00000136487|ENSG00000136487	ENST00000456543|ENST00000423893;ENST00000449787	D|D;D	0.90844|0.87029	-2.74|-2.2;-2.2	2.74|2.74	2.74|2.74	0.32292|0.32292	.|Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.|.	.|.	.|.	.|.	D|D	0.88291|0.88291	0.6397|0.6397	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|B;B	0.12630|0.26744	0.006|0.158;0.013	B|B;B	0.12156|0.42495	0.007|0.389;0.06	D|D	0.88642|0.88642	0.3176|0.3176	8|8	0.54805|0.87932	T|D	0.06|0	.|.	12.4782|12.4782	0.55827|0.55827	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	167|168;153	O14644|P01242;O14643	.|SOM2_HUMAN;.	T|Y	167|168;153	ENSP00000394122:P167T|ENSP00000409294:S168Y;ENSP00000410618:S153Y	ENSP00000394122:P167T|ENSP00000409294:S168Y	P|S	-|-	1|2	0|0	GH2|GH2	59311564|59311564	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.022000|0.022000	0.10575|0.10575	6.244000|6.244000	0.72391|0.72391	1.531000|1.531000	0.49152|0.49152	0.306000|0.306000	0.20318|0.20318	CCT|TCC	.		0.542	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
GLUD2	2747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	120182439	120182439	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chrX:120182439G>A	ENST00000328078.1	+	1	978	c.901G>A	c.(901-903)Gat>Aat	p.D301N		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	301					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AGGGTTTAGAGATAAAACATT	0.408																																					p.D301N		.											.	GLUD2	131	0			c.G901A						.						198.0	178.0	185.0					X																	120182439		2203	4300	6503	SO:0001583	missense	2747	exon1			TTTAGAGATAAAA	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.901G>A	X.37:g.120182439G>A	ENSP00000327589:p.Asp301Asn	Somatic	298.0	0.0		WXS	Illumina HiSeq	Phase_I	379.0	96.0	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996636	0.35226	.	.	ENSG00000182890	ENST00000328078	D	0.96522	-4.04	2.3	0.373	0.16178	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.091849	0.64402	D	0.000001	D	0.92041	0.7478	L	0.41124	1.26	0.43593	D	0.995942	B	0.20052	0.041	B	0.27262	0.078	D	0.83479	0.0063	10	0.54805	T	0.06	-2.2924	5.9678	0.19334	0.3085:0.0:0.6915:0.0	.	301	P49448	DHE4_HUMAN	N	301	ENSP00000327589:D301N	ENSP00000327589:D301N	D	+	1	0	GLUD2	120010120	1.000000	0.71417	0.720000	0.30636	0.938000	0.57974	6.619000	0.74219	-0.116000	0.11893	0.472000	0.43445	GAT	.		0.408	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
GPI	2821	ucsc.edu;bcgsc.ca	37	19	34857692	34857692	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:34857692A>G	ENST00000356487.5	+	3	459	c.218A>G	c.(217-219)aAg>aGg	p.K73R	GPI_ENST00000415930.3_Missense_Mutation_p.K112R|GPI_ENST00000586425.1_Missense_Mutation_p.K73R	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	73					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					TCCTAGGCCAAGTCCAGGGGC	0.617																																					p.K112R		.											.	GPI	228	0			c.A335G						.						80.0	83.0	82.0					19																	34857692		2203	4300	6503	SO:0001583	missense	2821	exon4			AGGCCAAGTCCAG	M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.218A>G	19.37:g.34857692A>G	ENSP00000348877:p.Lys73Arg	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001184722	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	37	CCDS12437.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.768814	0.49680	.	.	ENSG00000105220	ENST00000415930;ENST00000356487;ENST00000392234	D;D	0.93076	-3.16;-3.16	5.24	5.24	0.73138	.	0.084041	0.85682	D	0.000000	D	0.86887	0.6041	N	0.03891	-0.335	0.53688	D	0.999975	B;B;B;B	0.26577	0.001;0.022;0.153;0.0	B;B;B;B	0.38194	0.03;0.032;0.267;0.005	D	0.84062	0.0375	10	0.28530	T	0.3	-5.2256	15.0899	0.72185	1.0:0.0:0.0:0.0	.	73;112;394;73	B4DE36;B4DG39;Q59F85;P06744	.;.;.;G6PI_HUMAN	R	112;73;394	ENSP00000405573:K112R;ENSP00000348877:K73R	ENSP00000348877:K73R	K	+	2	0	GPI	39549532	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.637000	0.61346	2.120000	0.65058	0.459000	0.35465	AAG	.		0.617	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3		
GPR161	23432	broad.mit.edu;bcgsc.ca	37	1	168054960	168054960	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:168054960C>A	ENST00000367838.1	-	8	1712	c.1399G>T	c.(1399-1401)Gcc>Tcc	p.A467S	GPR161_ENST00000271357.5_Missense_Mutation_p.A467S|GPR161_ENST00000537209.1_Missense_Mutation_p.A487S|GPR161_ENST00000367835.1_Missense_Mutation_p.A467S|GPR161_ENST00000539777.1_Missense_Mutation_p.A389S|GPR161_ENST00000546300.1_Missense_Mutation_p.A353S|GPR161_ENST00000367836.1_Missense_Mutation_p.A335S|GPR161_ENST00000361697.2_Missense_Mutation_p.A467S	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	467					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					ATGGCTTTGGCCAAGCTTGCT	0.522																																					p.A487S		.											.	GPR161	90	0			c.G1459T						.						64.0	62.0	63.0					1																	168054960		2203	4300	6503	SO:0001583	missense	23432	exon7			CTTTGGCCAAGCT	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.1399G>T	1.37:g.168054960C>A	ENSP00000356812:p.Ala467Ser	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	9.0	NM_001267609	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	37	CCDS1268.1	.	.	.	.	.	.	.	.	.	.	C	34	5.361402	0.95877	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;D;T;D;D;T;T	0.86097	-0.55;-0.55;-2.07;-0.55;-1.6;-1.64;-0.5;-0.55	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.90556	0.7040	L	0.59436	1.845	0.39206	D	0.963236	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;0.999	D;D;D;D;D	0.83275	0.996;0.991;0.996;0.991;0.991	D	0.90293	0.4324	9	0.72032	D	0.01	-34.0592	19.9878	0.97354	0.0:1.0:0.0:0.0	.	487;353;389;487;467	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8	.;.;.;.;GP161_HUMAN	S	467;467;335;467;353;389;487;467	ENSP00000356812:A467S;ENSP00000271357:A467S;ENSP00000356810:A335S;ENSP00000356809:A467S;ENSP00000444348:A353S;ENSP00000437576:A389S;ENSP00000441039:A487S;ENSP00000355194:A467S	ENSP00000271357:A467S	A	-	1	0	GPR161	166321584	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.345000	0.79337	2.819000	0.97034	0.650000	0.86243	GCC	.		0.522	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
GPR63	81491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	97247241	97247241	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:97247241G>T	ENST00000229955.3	-	2	712	c.367C>A	c.(367-369)Cta>Ata	p.L123I	GPR63_ENST00000417980.1_Missense_Mutation_p.L123I	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		GCAAAAGCTAGGCTGGCAAGG	0.438																																					p.L123I		.											.	GPR63	92	0			c.C367A						.						84.0	83.0	83.0					6																	97247241		2203	4300	6503	SO:0001583	missense	81491	exon2			AAGCTAGGCTGGC	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.367C>A	6.37:g.97247241G>T	ENSP00000229955:p.Leu123Ile	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	13.0	NM_030784	Q9UJH3	Missense_Mutation	SNP	ENST00000229955.3	37	CCDS5036.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276635	0.59758	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	D;D;D	0.91124	-2.79;-2.79;-2.79	5.1	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	0.093957	0.44483	D	0.000441	D	0.93848	0.8032	H	0.96239	3.79	0.53005	D	0.999963	P	0.52170	0.951	P	0.56514	0.8	D	0.93615	0.6942	10	0.87932	D	0	-1.0651	6.1511	0.20313	0.198:0.0:0.6553:0.1468	.	123	Q9BZJ6	GPR63_HUMAN	I	147;123;123;123	ENSP00000393170:L123I;ENSP00000229955:L123I;ENSP00000358273:L123I	ENSP00000229955:L123I	L	-	1	2	GPR63	97353962	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.864000	0.56024	1.267000	0.44247	0.555000	0.69702	CTA	.		0.438	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
GRB7	2886	ucsc.edu;bcgsc.ca	37	17	37902252	37902252	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:37902252G>T	ENST00000309156.4	+	13	1614	c.1357G>T	c.(1357-1359)Ggc>Tgc	p.G453C	GRB7_ENST00000445327.2_Splice_Site_p.G476C|GRB7_ENST00000394209.2_Splice_Site_p.G453C|GRB7_ENST00000309185.3_Intron|GRB7_ENST00000394204.1_Intron|GRB7_ENST00000394211.3_Splice_Site_p.G453C	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	453	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CTTGGTAGACGGGTAAGGGGC	0.622																																					p.G476C		.											.	GRB7	848	0			c.G1426T						.						79.0	84.0	83.0					17																	37902252		2203	4300	6503	SO:0001630	splice_region_variant	2886	exon13			GTAGACGGGTAAG	D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.1358+1G>T	17.37:g.37902252G>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001242442	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	ENST00000309156.4	37	CCDS11345.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890294	0.72524	.	.	ENSG00000141738	ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.21	5.21	0.72293	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.94361	0.8187	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96189	0.9136	10	0.87932	D	0	-25.1061	17.5314	0.87816	0.0:0.0:1.0:0.0	.	453	Q14451	GRB7_HUMAN	C	453;453;453;476	ENSP00000310771:G453C;ENSP00000377761:G453C;ENSP00000377759:G453C;ENSP00000403459:G476C	ENSP00000310771:G453C	G	+	1	0	GRB7	35155778	1.000000	0.71417	0.997000	0.53966	0.278000	0.26855	9.728000	0.98792	2.438000	0.82558	0.655000	0.94253	GGC	.		0.622	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257024.2	NM_005310	Missense_Mutation
GUCY1B2	2974	broad.mit.edu;ucsc.edu;mdanderson.org	37	13	51591120	51591120	+	RNA	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:51591120T>C	ENST00000493639.2	-	0	1513					NR_003923.2		O75343	GCYB2_HUMAN	guanylate cyclase 1, soluble, beta 2 (pseudogene)						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)										ACGTTCACTATTTGTATAGGT	0.413																																					.		.											.	.	.	0			.						.						250.0	212.0	223.0					13																	51591120		692	1591	2283			2974	.			TCACTATTTGTAT	AF038499		13q14.3	2012-04-19	2012-04-19		ENSG00000123201	ENSG00000123201	4.6.1.2		4686	pseudogene	pseudogene		603695	"""guanylate cyclase 1, soluble, beta 2"""			9889008, 10449911	Standard	NR_003923		Approved	GC-SB2	uc010tgo.2	O75343	OTTHUMG00000016940		13.37:g.51591120T>C		Somatic	104.0	2.0		WXS	Illumina HiSeq	Phase_I	92.0	13.0	.	Q9NZ64	RNA	SNP	ENST00000493639.2	37																																																																																				.		0.413	GUCY1B2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000045014.3		
HDAC10	83933	ucsc.edu;bcgsc.ca	37	22	50687294	50687294	+	Missense_Mutation	SNP	G	G	A	rs199648733		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr22:50687294G>A	ENST00000216271.5	-	9	1134	c.782C>T	c.(781-783)tCg>tTg	p.S261L	HDAC10_ENST00000448072.1_Intron|HDAC10_ENST00000349505.4_Intron|MAPK12_ENST00000497036.1_5'UTR|HDAC10_ENST00000498366.1_Intron	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	261	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AAATCCTGCCGAGACCAGCAC	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		14346	0.001		0.0	False		,,,				2504	0.0				p.S261L		.											.	HDAC10	226	0			c.C782T						.	G	,LEU/SER	0,4394		0,0,2197	39.0	37.0	37.0		,782	3.9	0.0	22		37	1,8595	1.2+/-3.3	0,1,4297	no	intron,missense	HDAC10	NM_001159286.1,NM_032019.5	,145	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	,possibly-damaging	,261/670	50687294	1,12989	2197	4298	6495	SO:0001583	missense	83933	exon9			CCTGCCGAGACCA	AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.782C>T	22.37:g.50687294G>A	ENSP00000216271:p.Ser261Leu	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_032019	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Missense_Mutation	SNP	ENST00000216271.5	37	CCDS14088.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.32	2.201511	0.38905	0.0	1.16E-4	ENSG00000100429	ENST00000216271	T	0.72942	-0.7	4.89	3.87	0.44632	Histone deacetylase domain (2);	0.338259	0.27917	N	0.017333	D	0.85191	0.5640	H	0.96662	3.86	0.23107	N	0.998285	D	0.54397	0.966	P	0.52823	0.71	T	0.80885	-0.1182	10	0.87932	D	0	-9.6495	12.9805	0.58562	0.0802:0.0:0.9198:0.0	.	261	Q969S8	HDA10_HUMAN	L	261	ENSP00000216271:S261L	ENSP00000216271:S261L	S	-	2	0	HDAC10	49029421	1.000000	0.71417	0.020000	0.16555	0.023000	0.10783	5.623000	0.67757	1.049000	0.40321	-0.311000	0.09066	TCG	G|0.999;A|0.000		0.672	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104141.4	NM_032019	
HELZ2	85441	ucsc.edu;bcgsc.ca	37	20	62199797	62199797	+	Silent	SNP	G	G	A	rs541656406		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr20:62199797G>A	ENST00000467148.1	-	5	1713	c.1644C>T	c.(1642-1644)acC>acT	p.T548T	HELZ2_ENST00000479540.1_5'Flank|HELZ2_ENST00000427522.2_5'Flank	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	548					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AGGTCTTGCCGGTGCCAAAGG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		18875	0.0		0.0	False		,,,				2504	0.001				p.T548T		.											.	.	.	0			c.C1644T						.						42.0	38.0	40.0					20																	62199797		2191	4293	6484	SO:0001819	synonymous_variant	85441	exon6			CTTGCCGGTGCCA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.1644C>T	20.37:g.62199797G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	.	51.0	4.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.		0.657	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HSPG2	3339	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22173039	22173039	+	Missense_Mutation	SNP	C	C	T	rs545072429		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:22173039C>T	ENST00000374695.3	-	63	8297	c.8218G>A	c.(8218-8220)Gaa>Aaa	p.E2740K	HSPG2_ENST00000430507.1_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2740	Ig-like C2-type 13.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTCTCCCCTTCGGCCACGTGT	0.622													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17870	0.0		0.0	False		,,,				2504	0.0				p.E2740K		.											.	HSPG2	141	0			c.G8218A						.						62.0	63.0	63.0					1																	22173039		2203	4300	6503	SO:0001583	missense	3339	exon63			CCCCTTCGGCCAC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8218G>A	1.37:g.22173039C>T	ENSP00000363827:p.Glu2740Lys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	8.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631349	0.67015	.	.	ENSG00000142798	ENST00000374695;ENST00000453796	T;T	0.18502	2.21;2.52	4.94	4.94	0.65067	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41001	D	0.000969	T	0.40791	0.1131	M	0.80847	2.515	0.44295	D	0.997163	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.38045	-0.9679	10	0.09590	T	0.72	.	15.683	0.77388	0.0:1.0:0.0:0.0	.	680;2740	Q59EG0;P98160	.;PGBM_HUMAN	K	2740;155	ENSP00000363827:E2740K;ENSP00000396310:E155K	ENSP00000363827:E2740K	E	-	1	0	HSPG2	22045626	0.999000	0.42202	0.853000	0.33588	0.191000	0.23601	5.418000	0.66429	2.292000	0.77174	0.561000	0.74099	GAA	.		0.622	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
IL21R	50615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27460454	27460454	+	Silent	SNP	G	G	T	rs56002407	byFrequency	TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:27460454G>T	ENST00000337929.3	+	9	1940	c.1467G>T	c.(1465-1467)acG>acT	p.T489T	IL21R_ENST00000395754.4_Silent_p.T489T|IL21R_ENST00000395755.1_Silent_p.T489T|IL21R_ENST00000564089.1_Silent_p.T489T|IL21R-AS1_ENST00000563191.1_RNA	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	489					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						ATATGGACACGTTTGACAGTG	0.677			T	BCL6	NHL																																p.T511T		.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	660	0			c.G1533T						.						47.0	41.0	43.0					16																	27460454		2196	4298	6494	SO:0001819	synonymous_variant	50615	exon10			GGACACGTTTGAC	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1467G>T	16.37:g.27460454G>T		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	11.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Silent	SNP	ENST00000337929.3	37	CCDS10630.1																																																																																			G|0.999;A|0.001		0.677	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
HYDIN	54768	ucsc.edu;bcgsc.ca	37	16	70884538	70884538	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:70884538A>G	ENST00000393567.2	-	74	12614	c.12464T>C	c.(12463-12465)tTc>tCc	p.F4155S	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4155					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTTTGGTGTGAAGAAAATATC	0.408																																					p.F4155S		.											.	HYDIN	92	0			c.T12464C						.						64.0	55.0	58.0					16																	70884538		1852	4101	5953	SO:0001583	missense	54768	exon74			GGTGTGAAGAAAA	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12464T>C	16.37:g.70884538A>G	ENSP00000377197:p.Phe4155Ser	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.518924	0.85495	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01767	4.65	5.56	5.56	0.83823	.	0.000000	0.34879	U	0.003610	T	0.10895	0.0266	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00280	-1.1852	10	0.72032	D	0.01	.	15.366	0.74523	1.0:0.0:0.0:0.0	.	4154	F8WD23	.	S	4155;4154	ENSP00000377197:F4155S	ENSP00000313052:F4154S	F	-	2	0	HYDIN	69442039	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.952000	0.75989	2.113000	0.64589	0.418000	0.28097	TTC	.		0.408	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IRGQ	126298	ucsc.edu;bcgsc.ca	37	19	44097315	44097315	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:44097315C>T	ENST00000602269.1	-	2	920	c.735G>A	c.(733-735)ttG>ttA	p.L245L	IRGQ_ENST00000601520.1_5'Flank|L34079.2_ENST00000594374.1_5'Flank|IRGQ_ENST00000422989.1_Silent_p.L245L			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	245	IRG-type G.									endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				CGCCAGGATCCAATCCAAGCA	0.692																																					p.L245L		.											.	IRGQ	92	0			c.G735A						.						37.0	43.0	41.0					19																	44097315		2202	4298	6500	SO:0001819	synonymous_variant	126298	exon3			AGGATCCAATCCA	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.735G>A	19.37:g.44097315C>T		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_001007561	B2RNP3	Silent	SNP	ENST00000602269.1	37	CCDS33040.1																																																																																			.		0.692	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561	
ITGA1	3672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	52233253	52233253	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:52233253C>T	ENST00000282588.6	+	24	3445	c.2987C>T	c.(2986-2988)cCa>cTa	p.P996L	CTD-2175A23.1_ENST00000505701.1_RNA|CTD-2175A23.1_ENST00000503559.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	996					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				GGATCTTTTCCAATGCCAGAG	0.358																																					p.P996L		.											ITGA1,NS,carcinoma,+1	ITGA1	228	0			c.C2987T						.						183.0	177.0	179.0					5																	52233253		2203	4300	6503	SO:0001583	missense	3672	exon24			CTTTTCCAATGCC	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2987C>T	5.37:g.52233253C>T	ENSP00000282588:p.Pro996Leu	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	73.0	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	37	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553746	0.86231	.	.	ENSG00000213949	ENST00000282588	T	0.45276	0.9	5.69	5.69	0.88448	Integrin alpha-2 (1);	0.318638	0.33161	N	0.005211	T	0.59115	0.2170	L	0.52573	1.65	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	T	0.55490	-0.8133	10	0.45353	T	0.12	.	16.731	0.85435	0.0:1.0:0.0:0.0	.	996	P56199	ITA1_HUMAN	L	996	ENSP00000282588:P996L	ENSP00000282588:P996L	P	+	2	0	ITGA1	52269010	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.586000	0.60984	2.688000	0.91661	0.585000	0.79938	CCA	.		0.358	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
KATNA1	11104	ucsc.edu;bcgsc.ca	37	6	149922743	149922743	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:149922743A>G	ENST00000335647.5	-	6	919	c.875T>C	c.(874-876)cTt>cCt	p.L292P	KATNA1_ENST00000367411.2_Missense_Mutation_p.L292P|KATNA1_ENST00000335643.8_Missense_Mutation_p.L216P|KATNA1_ENST00000494504.1_5'UTR					katanin p60 (ATPase containing) subunit A 1											endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		TTCAAACAGAAGACGAACAAG	0.383																																					p.L292P		.											.	KATNA1	91	0			c.T875C						.						111.0	105.0	107.0					6																	149922743		2203	4300	6503	SO:0001583	missense	11104	exon7			AACAGAAGACGAA	AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.875T>C	6.37:g.149922743A>G	ENSP00000335106:p.Leu292Pro	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_007044		Missense_Mutation	SNP	ENST00000335647.5	37	CCDS5217.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.625072	0.87560	.	.	ENSG00000186625	ENST00000335647;ENST00000335643;ENST00000367411	D;D;D	0.94650	-3.48;-3.15;-3.48	5.86	5.86	0.93980	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	L	0.28649	0.875	0.80722	D	1	D;D;D	0.89917	1.0;0.993;1.0	D;D;D	0.80764	0.994;0.935;0.994	D	0.93617	0.6944	9	.	.	.	-8.4229	16.2526	0.82494	1.0:0.0:0.0:0.0	.	292;216;292	A8K7S5;O75449-2;O75449	.;.;KTNA1_HUMAN	P	292;216;292	ENSP00000335106:L292P;ENSP00000335180:L216P;ENSP00000356381:L292P	.	L	-	2	0	KATNA1	149964436	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.307000	0.96226	2.241000	0.73720	0.482000	0.46254	CTT	.		0.383	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042641.2	NM_007044	
KCNF1	3754	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	11053487	11053487	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:11053487C>T	ENST00000295082.1	+	1	1425	c.935C>T	c.(934-936)aCc>aTc	p.T312I		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	312					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		GGCCTGCAGACCCTCACCTAT	0.622																																					p.T312I		.											.	KCNF1	91	0			c.C935T						.						61.0	59.0	60.0					2																	11053487		2203	4300	6503	SO:0001583	missense	3754	exon1			TGCAGACCCTCAC	AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.935C>T	2.37:g.11053487C>T	ENSP00000295082:p.Thr312Ile	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	19.0	NM_002236	O43527|Q585L3	Missense_Mutation	SNP	ENST00000295082.1	37	CCDS1676.1	.	.	.	.	.	.	.	.	.	.	c	17.50	3.404087	0.62288	.	.	ENSG00000162975	ENST00000295082	D	0.98684	-5.07	4.74	4.74	0.60224	Ion transport (1);	0.105772	0.64402	D	0.000005	D	0.96642	0.8904	N	0.11427	0.14	0.80722	D	1	D	0.55605	0.972	P	0.57620	0.824	D	0.94414	0.7634	10	0.02654	T	1	.	18.1029	0.89512	0.0:1.0:0.0:0.0	.	312	Q9H3M0	KCNF1_HUMAN	I	312	ENSP00000295082:T312I	ENSP00000295082:T312I	T	+	2	0	KCNF1	10970938	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.348000	0.79779	0.556000	0.70494	ACC	.		0.622	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239265.1	NM_002236	
KDM4C	23081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	6793123	6793123	+	Silent	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:6793123T>C	ENST00000381309.3	+	2	700	c.135T>C	c.(133-135)ggT>ggC	p.G45G	KDM4C_ENST00000543771.1_Silent_p.G45G|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000401787.3_Silent_p.G45G|KDM4C_ENST00000381306.3_Silent_p.G45G|KDM4C_ENST00000536108.1_5'UTR|KDM4C_ENST00000535193.1_Silent_p.G67G|KDM4C_ENST00000442236.2_5'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	45	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						ATCGTGCGGGTCTTGCAAAGG	0.418																																					p.G67G		.											.	KDM4C	228	0			c.T201C						.						81.0	79.0	80.0					9																	6793123		2203	4300	6503	SO:0001819	synonymous_variant	23081	exon2			TGCGGGTCTTGCA	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.135T>C	9.37:g.6793123T>C		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	27.0	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Silent	SNP	ENST00000381309.3	37	CCDS6471.1																																																																																			.		0.418	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
KDSR	2531	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	61018193	61018193	+	Silent	SNP	T	T	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr18:61018193T>G	ENST00000406396.3	-	6	928	c.537A>C	c.(535-537)ggA>ggC	p.G179G	KDSR_ENST00000326575.5_Intron	NM_002035.2	NP_002026.1	Q06136	KDSR_HUMAN	3-ketodihydrosphingosine reductase	179					3-keto-sphinganine metabolic process (GO:0006666)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-dehydrosphinganine reductase activity (GO:0047560)			endometrium(2)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	9						AACCGAATAATCCCAACTGTC	0.522																																					p.G179G		.											.	KDSR	227	0			c.A537C						.						127.0	120.0	122.0					18																	61018193		2203	4300	6503	SO:0001819	synonymous_variant	2531	exon6			GAATAATCCCAAC		CCDS11982.1	18q21	2011-09-20	2008-02-20	2008-02-20	ENSG00000119537	ENSG00000119537	1.1.1.102	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	4021	protein-coding gene	gene with protein product	"""3-dehydrosphinganine reductase"", ""short chain dehydrogenase/reductase family 35C, member 1"""	136440	"""follicular lymphoma variant translocation 1"""	FVT1		8417785, 15328338, 17420465, 19027726	Standard	NM_002035		Approved	DHSR, SDR35C1	uc010dpw.3	Q06136	OTTHUMG00000132792	ENST00000406396.3:c.537A>C	18.37:g.61018193T>G		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	8.0	NM_002035	B2R5Y1|B4DMX0	Silent	SNP	ENST00000406396.3	37	CCDS11982.1																																																																																			.		0.522	KDSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256200.2		
RIC1	57589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5742973	5742973	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:5742973T>G	ENST00000414202.2	+	9	1197	c.1006T>G	c.(1006-1008)Ttt>Gtt	p.F336V	KIAA1432_ENST00000449720.2_Missense_Mutation_p.F257V|KIAA1432_ENST00000418622.3_Missense_Mutation_p.F257V|KIAA1432_ENST00000251879.6_Missense_Mutation_p.F336V|KIAA1432_ENST00000381532.2_Missense_Mutation_p.F257V	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		ATGGAGTGTTTTTGGAGCACA	0.368																																					p.F336V		.											.	KIAA1432	90	0			c.T1006G						.						178.0	176.0	176.0					9																	5742973		2203	4300	6503	SO:0001583	missense	57589	exon9			AGTGTTTTTGGAG																												ENST00000414202.2:c.1006T>G	9.37:g.5742973T>G	ENSP00000416696:p.Phe336Val	Somatic	253.0	0.0		WXS	Illumina HiSeq	Phase_I	328.0	115.0	NM_001206557		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.6|25.6	4.657677|4.657677	0.88154|0.88154	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000545641|ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	.|T;T;T;T;T	.|0.56776	.|0.44;0.44;0.44;0.44;0.44	6.17|6.17	6.17|6.17	0.99709|0.99709	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.74084|0.74084	0.3670|0.3670	M|M	0.82716|0.82716	2.605|2.605	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.69479	.|0.941;0.957;0.964	T|T	0.74538|0.74538	-0.3632|-0.3632	6|10	.|0.38643	.|T	.|0.18	-24.1883|-24.1883	16.8222|16.8222	0.85835|0.85835	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|257;336;336	.|B7ZM67;Q4ADV7;G5E932	.|.;RIC1_HUMAN;.	C|V	264|336;336;257;257;257	.|ENSP00000251879:F336V;ENSP00000416696:F336V;ENSP00000370943:F257V;ENSP00000402240:F257V;ENSP00000398823:F257V	.|ENSP00000251879:F336V	F|F	+|+	2|1	0|0	KIAA1432|KIAA1432	5732973|5732973	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.838000|0.838000	0.47535|0.47535	7.637000|7.637000	0.83313|0.83313	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	TTT|TTT	.		0.368	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
KIAA1468	57614	broad.mit.edu;bcgsc.ca	37	18	59942653	59942653	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr18:59942653G>A	ENST00000398130.2	+	22	3146	c.2914G>A	c.(2914-2916)Ggt>Agt	p.G972S	KIAA1468_ENST00000256858.6_Missense_Mutation_p.G1006S	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	972										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				TTTGTGGTATGGTGTTGTCCA	0.373																																					p.G972S		.											.	KIAA1468	158	0			c.G2914A						.						158.0	137.0	144.0					18																	59942653		2203	4300	6503	SO:0001583	missense	57614	exon22			TGGTATGGTGTTG	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.2914G>A	18.37:g.59942653G>A	ENSP00000381198:p.Gly972Ser	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	14.0	NM_020854		Missense_Mutation	SNP	ENST00000398130.2	37	CCDS11979.2	.	.	.	.	.	.	.	.	.	.	G	35	5.473104	0.96274	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.68025	-0.3;-0.3	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.097389	0.64402	D	0.000001	T	0.77391	0.4123	L	0.51422	1.61	0.80722	D	1	P;P;D	0.67145	0.602;0.909;0.996	B;P;D	0.64144	0.204;0.555;0.922	T	0.74197	-0.3743	9	.	.	.	-5.1958	19.9847	0.97341	0.0:0.0:1.0:0.0	.	1006;972;616	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	S	972;1006	ENSP00000381198:G972S;ENSP00000256858:G1006S	.	G	+	1	0	KIAA1468	58093633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.800000	0.96347	0.644000	0.83932	GGT	.		0.373	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	
KLHL34	257240	ucsc.edu;bcgsc.ca	37	X	21675562	21675562	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chrX:21675562C>T	ENST00000379499.2	-	1	886	c.345G>A	c.(343-345)ctG>ctA	p.L115L		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	115						extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						CACAGAGCCCCAGGGCCTCAG	0.642																																					p.L115L		.											.	KLHL34	131	0			c.G345A						.						16.0	15.0	15.0					X																	21675562		2201	4291	6492	SO:0001819	synonymous_variant	257240	exon1			GAGCCCCAGGGCC	AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.345G>A	X.37:g.21675562C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_153270		Silent	SNP	ENST00000379499.2	37	CCDS14199.1																																																																																			.		0.642	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056022.1	NM_153270	
LETMD1	25875	ucsc.edu;bcgsc.ca	37	12	51449625	51449625	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:51449625T>C	ENST00000262055.4	+	5	520	c.481T>C	c.(481-483)Ttt>Ctt	p.F161L	LETMD1_ENST00000552739.1_Missense_Mutation_p.F44L|LETMD1_ENST00000380123.2_Silent_p.C94C|LETMD1_ENST00000550929.1_Missense_Mutation_p.F105L|LETMD1_ENST00000548516.1_Intron|LETMD1_ENST00000547008.1_Intron|LETMD1_ENST00000418425.2_Missense_Mutation_p.F174L	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	161	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						CAGGTACCTGTTTCCCAGGCA	0.423																																					p.F174L		.											.	LETMD1	90	0			c.T520C						.						92.0	88.0	89.0					12																	51449625		2203	4300	6503	SO:0001583	missense	25875	exon5			TACCTGTTTCCCA	AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.481T>C	12.37:g.51449625T>C	ENSP00000262055:p.Phe161Leu	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_001243689	A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	ENST00000262055.4	37	CCDS8806.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.332829	0.81801	.	.	ENSG00000050426	ENST00000551477;ENST00000550755;ENST00000550929;ENST00000262055;ENST00000549340;ENST00000418425;ENST00000448283;ENST00000552739	T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5	5.08	5.08	0.68730	LETM1-like (1);	0.052665	0.85682	D	0.000000	T	0.61751	0.2372	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.61697	0.99;0.978;0.957;0.978	P;P;P;P	0.53006	0.701;0.715;0.689;0.715	T	0.66984	-0.5785	10	0.87932	D	0	-16.4859	14.2814	0.66216	0.0:0.0:0.0:1.0	.	111;174;44;161	F8VVQ3;B3KXK7;F8VP71;Q6P1Q0	.;.;.;LTMD1_HUMAN	L	128;67;105;161;111;174;111;44	ENSP00000446862:F128L;ENSP00000450163:F105L;ENSP00000262055:F161L;ENSP00000449896:F111L;ENSP00000389903:F174L;ENSP00000450333:F44L	ENSP00000262055:F161L	F	+	1	0	LETMD1	49735892	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.910000	0.69931	2.281000	0.76405	0.533000	0.62120	TTT	.		0.423	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404710.1	NM_015416	
LIPI	149998	ucsc.edu;bcgsc.ca	37	21	15579152	15579152	+	Intron	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr21:15579152A>G	ENST00000536861.1	-	1	46				LIPI_ENST00000344577.2_Silent_p.V31V			Q6XZB0	LIPI_HUMAN	lipase, member I						lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		tcaggcacacaactagAAGCC	0.343																																					p.V31V		.											.	LIPI	70	0			c.T93C						.						81.0	82.0	81.0					21																	15579152		2203	4300	6503	SO:0001627	intron_variant	149998	exon1			GCACACAACTAGA	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.46+3968T>C	21.37:g.15579152A>G		Somatic	21.0	0.0		WXS	Illumina HiSeq	.	33.0	6.0	NM_198996	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Silent	SNP	ENST00000536861.1	37																																																																																				.		0.343	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
LRFN1	57622	ucsc.edu;bcgsc.ca	37	19	39804874	39804874	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:39804874A>G	ENST00000248668.4	-	1	1102	c.1103T>C	c.(1102-1104)tTc>tCc	p.F368S	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	368	Ig-like.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GATACAAGTGAAGGTGCCACT	0.692																																					p.F368S		.											.	LRFN1	70	0			c.T1103C						.						25.0	31.0	29.0					19																	39804874		2174	4274	6448	SO:0001583	missense	57622	exon1			CAAGTGAAGGTGC	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1103T>C	19.37:g.39804874A>G	ENSP00000248668:p.Phe368Ser	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_020862	Q8TBS9	Missense_Mutation	SNP	ENST00000248668.4	37	CCDS46071.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.551596	0.65311	.	.	ENSG00000128011	ENST00000248668	T	0.79454	-1.27	4.53	4.53	0.55603	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47093	D	0.000247	D	0.85885	0.5801	M	0.71206	2.165	0.58432	D	0.999994	D	0.71674	0.998	D	0.76575	0.988	D	0.87312	0.2312	10	0.87932	D	0	.	11.8469	0.52389	1.0:0.0:0.0:0.0	.	368	Q9P244	LRFN1_HUMAN	S	368	ENSP00000248668:F368S	ENSP00000248668:F368S	F	-	2	0	LRFN1	44496714	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.948000	0.70249	1.905000	0.55150	0.533000	0.62120	TTC	.		0.692	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463835.1	NM_020862	
LRFN5	145581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	42356583	42356583	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:42356583G>A	ENST00000298119.4	+	3	1944	c.755G>A	c.(754-756)aGg>aAg	p.R252K	LRFN5_ENST00000554171.1_Missense_Mutation_p.R252K|LRFN5_ENST00000554120.1_Missense_Mutation_p.R252K	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	252	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TTGTGGTTGAGGCGTCTGTCC	0.443										HNSCC(30;0.082)																											p.R252K		.											.	LRFN5	97	0			c.G755A						.						171.0	170.0	170.0					14																	42356583		2203	4300	6503	SO:0001583	missense	145581	exon3			GGTTGAGGCGTCT	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.755G>A	14.37:g.42356583G>A	ENSP00000298119:p.Arg252Lys	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	9.0	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937910	0.73557	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.52057	0.68;0.68;0.68	5.69	5.69	0.88448	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.64402	D	0.000006	T	0.67392	0.2888	M	0.66560	2.04	0.58432	D	0.999999	D;P	0.58970	0.984;0.947	D;D	0.69824	0.966;0.925	T	0.67007	-0.5779	10	0.52906	T	0.07	.	17.3157	0.87224	0.0:0.0:1.0:0.0	.	252;252	G3V364;Q96NI6	.;LRFN5_HUMAN	K	252	ENSP00000298119:R252K;ENSP00000451897:R252K;ENSP00000451067:R252K	ENSP00000298119:R252K	R	+	2	0	LRFN5	41426333	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.676000	0.91093	0.557000	0.71058	AGG	.		0.443	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
LRRC6	23639	ucsc.edu;bcgsc.ca	37	8	133673830	133673830	+	Silent	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr8:133673830A>G	ENST00000519595.1	-	2	152	c.54T>C	c.(52-54)tgT>tgC	p.C18C	LRRC6_ENST00000520446.1_5'UTR|LRRC6_ENST00000518642.1_Silent_p.C18C|LRRC6_ENST00000250173.1_Silent_p.C18C			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	18					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.C18C(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			AAAAAATGACACAGTCGTTGT	0.363																																					p.C18C		.											.	LRRC6	92	1	Substitution - coding silent(1)	lung(1)	c.T54C						.						68.0	66.0	67.0					8																	133673830		2203	4300	6503	SO:0001819	synonymous_variant	23639	exon2			AATGACACAGTCG	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.54T>C	8.37:g.133673830A>G		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	47.0	5.0	NM_012472	Q13648|Q4G183	Silent	SNP	ENST00000519595.1	37																																																																																				.		0.363	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472	
LSG1	55341	ucsc.edu;bcgsc.ca	37	3	194380824	194380824	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:194380824A>G	ENST00000265245.5	-	6	874	c.560T>C	c.(559-561)cTc>cCc	p.L187P		NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	187	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		TCTAAACAGGAGTGGGTTTCG	0.423																																					p.L187P		.											.	LSG1	90	0			c.T560C						.						133.0	117.0	122.0					3																	194380824		2203	4300	6503	SO:0001583	missense	55341	exon6			AACAGGAGTGGGT		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.560T>C	3.37:g.194380824A>G	ENSP00000265245:p.Leu187Pro	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	54.0	5.0	NM_018385	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	37	CCDS33922.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.708651	0.89018	.	.	ENSG00000041802	ENST00000265245	T	0.48836	0.8	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.72211	0.3432	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.77694	-0.2492	10	0.87932	D	0	.	15.8522	0.78940	1.0:0.0:0.0:0.0	.	187	Q9H089	LSG1_HUMAN	P	187	ENSP00000265245:L187P	ENSP00000265245:L187P	L	-	2	0	LSG1	195862113	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	8.631000	0.90991	2.285000	0.76669	0.533000	0.62120	CTC	.		0.423	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385	
LY75	4065	broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	160737645	160737646	+	Missense_Mutation	DNP	CT	CT	AA			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C|T	C|T	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:160737645_160737646CT>AA	ENST00000263636.4	-	8	1379_1380	c.1352_1353AG>TT	c.(1351-1353)gAG>gTT	p.E451V	LY75_ENST00000554112.1_Missense_Mutation_p.E451V|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.E451V|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.E451V|LY75_ENST00000553424.1_Missense_Mutation_p.E451V	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	451	C-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GAACATTTGGCTCATTCTCATC	0.386																																					p.E451D|p.E451V		.											.	LY75	90	0			c.G1353T|c.A1352T						.																																			SO:0001583	missense	4065	exon8			ATTTGGCTCATTC|TTTGGCTCATTCT	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.1352_1353delinsAA	2.37:g.160737645_160737646delinsAA	ENSP00000263636:p.Glu451Val	Somatic	83.0	1.0|0.0		WXS	Illumina HiSeq	Phase_I	120.0|119.0	50.0|49.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	37	CCDS2211.1																																																																																			.		0.386	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
MAD1L1	8379	ucsc.edu;bcgsc.ca	37	7	2041757	2041757	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:2041757C>T	ENST00000406869.1	-	14	1917		c.e14-1		MAD1L1_ENST00000399654.2_Splice_Site|MAD1L1_ENST00000265854.7_Splice_Site|MAD1L1_ENST00000402746.1_Splice_Site			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		ACAGCTGAGCCTGCAAGACAA	0.622																																					.		.											.	MAD1L1	1083	0			c.1360-1G>A						.						106.0	123.0	117.0					7																	2041757		2056	4204	6260	SO:0001630	splice_region_variant	8379	exon15			CTGAGCCTGCAAG	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1360-1G>A	7.37:g.2041757C>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_003550	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Splice_Site	SNP	ENST00000406869.1	37	CCDS43539.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943650	0.73672	.	.	ENSG00000002822	ENST00000402746;ENST00000399654;ENST00000406869;ENST00000265854;ENST00000438959;ENST00000444373	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5576	0.84490	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MAD1L1	2008283	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	4.391000	0.59652	2.589000	0.87451	0.650000	0.86243	.	.		0.622	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322871.1	NM_003550	Intron
MAN1A1	4121	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	119511012	119511012	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:119511012C>T	ENST00000368468.3	-	10	1804	c.1363G>A	c.(1363-1365)Gga>Aga	p.G455R		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	455					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		TAAGTTAGTCCGCTGCTAGAC	0.468																																					p.G455R	Ovarian(136;8 1825 12608 33541 47587)	.											.	MAN1A1	517	0			c.G1363A						.						73.0	67.0	69.0					6																	119511012		2203	4300	6503	SO:0001583	missense	4121	exon10			TTAGTCCGCTGCT	AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1363G>A	6.37:g.119511012C>T	ENSP00000357453:p.Gly455Arg	Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	49.0	13.0	NM_005907	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	ENST00000368468.3	37	CCDS5122.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763928	0.89932	.	.	ENSG00000111885	ENST00000368468	T	0.71817	-0.6	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.85630	0.5741	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87256	0.2276	10	0.62326	D	0.03	-4.2762	19.4267	0.94743	0.0:1.0:0.0:0.0	.	455	P33908	MA1A1_HUMAN	R	455	ENSP00000357453:G455R	ENSP00000357453:G455R	G	-	1	0	MAN1A1	119552711	1.000000	0.71417	0.115000	0.21578	0.729000	0.41735	7.818000	0.86416	2.596000	0.87737	0.655000	0.94253	GGA	.		0.468	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1	NM_005907	
MAN1A2	10905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	118035855	118035855	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:118035855G>T	ENST00000356554.3	+	9	1990	c.1255G>T	c.(1255-1257)Gca>Tca	p.A419S		NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	419					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		AGACCATGAGGCAAGAAAGAT	0.363																																					p.A419S	Ovarian(33;199 881 8228 13687 31538)	.											.	MAN1A2	90	0			c.G1255T						.						142.0	127.0	132.0					1																	118035855		2203	4300	6503	SO:0001583	missense	10905	exon9			CATGAGGCAAGAA	AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.1255G>T	1.37:g.118035855G>T	ENSP00000348959:p.Ala419Ser	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	24.0	NM_006699	Q9H510	Missense_Mutation	SNP	ENST00000356554.3	37	CCDS895.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.031081|4.031081	0.75504|0.75504	.|.	.|.	ENSG00000198162|ENSG00000198162	ENST00000356554;ENST00000369450|ENST00000449370	T|.	0.72051|.	-0.62|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64294|0.64294	0.2585|0.2585	L|L	0.61387|0.61387	1.9|1.9	0.80722|0.80722	D|D	1|1	B;B|.	0.13145|.	0.002;0.007|.	B;B|.	0.20384|.	0.012;0.029|.	T|T	0.63726|0.63726	-0.6572|-0.6572	10|5	0.22706|.	T|.	0.39|.	-15.6666|-15.6666	16.0138|16.0138	0.80422|0.80422	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	183;419|.	A6NLR2;O60476|.	.;MA1A2_HUMAN|.	S|S	419;183|151	ENSP00000348959:A419S|.	ENSP00000348959:A419S|.	A|R	+|+	1|3	0|2	MAN1A2|MAN1A2	117837378|117837378	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.992000|0.992000	0.81027|0.81027	9.313000|9.313000	0.96297|0.96297	2.378000|2.378000	0.81104|0.81104	0.655000|0.655000	0.94253|0.94253	GCA|AGG	.		0.363	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699	
NDUFAF3	25915	ucsc.edu;mdanderson.org	37	3	49057609	49057609	+	5'Flank	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:49057609C>T	ENST00000326925.6	+	0	0				DALRD3_ENST00000440857.1_Intron|DALRD3_ENST00000441576.2_5'Flank|DALRD3_ENST00000341949.4_5'Flank|NDUFAF3_ENST00000326912.4_5'Flank|DALRD3_ENST00000496568.1_Intron|NDUFAF3_ENST00000395458.2_5'Flank|DALRD3_ENST00000313778.5_Intron|NDUFAF3_ENST00000451378.2_5'Flank|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000395462.4_5'Flank|MIR191_ENST00000384873.1_RNA	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3						mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						CACGACATTCCCGATGGCTTC	0.602																																					.		.											.	.	.	0			.						.						74.0	73.0	73.0					3																	49057609		1568	3582	5150	SO:0001631	upstream_gene_variant	494337	.			ACATTCCCGATGG		CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773		3.37:g.49057609C>T	Exception_encountered	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	39.0	9.0	.		RNA	SNP	ENST00000326925.6	37	CCDS2784.1																																																																																			.		0.602	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345683.2	NM_199069	
MLXIP	22877	ucsc.edu;bcgsc.ca	37	12	122622025	122622025	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:122622025G>T	ENST00000319080.7	+	12	2174	c.2042G>T	c.(2041-2043)tGc>tTc	p.C681F	MLXIP_ENST00000538698.1_Missense_Mutation_p.C288F					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GGTCGGGACTGCCCAAACTCA	0.617																																					p.C681F	Esophageal Squamous(105;787 1493 16200 18566 52466)	.											.	MLXIP	92	0			c.G2042T						.						49.0	53.0	52.0					12																	122622025		1979	4152	6131	SO:0001583	missense	22877	exon12			GGGACTGCCCAAA	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2042G>T	12.37:g.122622025G>T	ENSP00000312834:p.Cys681Phe	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_014938		Missense_Mutation	SNP	ENST00000319080.7	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.11|12.11	1.838611|1.838611	0.32513|0.32513	.|.	.|.	ENSG00000175727|ENSG00000175727	ENST00000542417|ENST00000319080;ENST00000538698;ENST00000539039;ENST00000366272	.|T;T;T	.|0.46063	.|2.53;1.9;0.88	5.19|5.19	3.33|3.33	0.38152|0.38152	.|.	.|0.666666	.|0.16611	.|N	.|0.206907	T|T	0.29256|0.29256	0.0728|0.0728	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|P	.|0.44195	.|0.828	.|B	.|0.40782	.|0.34	T|T	0.02053|0.02053	-1.1222|-1.1222	4|9	.|0.16896	.|T	.|0.51	-1.9266|-1.9266	8.8936|8.8936	0.35449|0.35449	0.0792:0.1494:0.7714:0.0|0.0792:0.1494:0.7714:0.0	.|.	.|681	.|Q9HAP2	.|MLXIP_HUMAN	S|F	17|681;288;288;152	.|ENSP00000312834:C681F;ENSP00000440769:C288F;ENSP00000445891:C152F	.|ENSP00000312834:C681F	A|C	+|+	1|2	0|0	MLXIP|MLXIP	121187978|121187978	0.967000|0.967000	0.33354|0.33354	0.351000|0.351000	0.25721|0.25721	0.793000|0.793000	0.44817|0.44817	2.584000|2.584000	0.46102|0.46102	0.554000|0.554000	0.29061|0.29061	0.563000|0.563000	0.77884|0.77884	GCC|TGC	.		0.617	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938	
MORC3	23515	broad.mit.edu;bcgsc.ca	37	21	37741557	37741557	+	Silent	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr21:37741557C>A	ENST00000400485.1	+	15	1967	c.1891C>A	c.(1891-1893)Cga>Aga	p.R631R	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	631					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						CTCATCATCCCGATGCGACCA	0.453																																					p.R631R		.											.	MORC3	92	0			c.C1891A						.						201.0	195.0	197.0					21																	37741557		2108	4230	6338	SO:0001819	synonymous_variant	23515	exon15			TCATCCCGATGCG	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1891C>A	21.37:g.37741557C>A		Somatic	132.0	1.0		WXS	Illumina HiSeq	Phase_I	157.0	7.0	NM_015358	A8KA92|Q9UEZ2	Silent	SNP	ENST00000400485.1	37	CCDS42924.1																																																																																			.		0.453	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
MTMR7	9108	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	17198903	17198903	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr8:17198903T>C	ENST00000180173.5	-	6	735	c.701A>G	c.(700-702)gAc>gGc	p.D234G	MTMR7_ENST00000521857.1_Missense_Mutation_p.D234G|MTMR7_ENST00000523571.1_5'UTR	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	234	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		ATAAACGAAGTCACTTCCTGG	0.557																																					p.D234G		.											.	MTMR7	91	0			c.A701G						.						177.0	110.0	133.0					8																	17198903		2203	4300	6503	SO:0001583	missense	9108	exon6			ACGAAGTCACTTC	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.701A>G	8.37:g.17198903T>C	ENSP00000180173:p.Asp234Gly	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	12.0	NM_004686	A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.191393	0.38707	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.90197	-2.63;-2.63	4.94	3.78	0.43462	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.220883	0.49916	N	0.000131	D	0.83801	0.5333	L	0.29908	0.895	0.80722	D	1	P;B	0.35139	0.486;0.01	B;B	0.35550	0.205;0.02	T	0.80176	-0.1491	10	0.33940	T	0.23	.	10.9107	0.47108	0.0:0.0741:0.0:0.9259	.	234;234	Q9Y216-2;Q9Y216	.;MTMR7_HUMAN	G	234	ENSP00000180173:D234G;ENSP00000429733:D234G	ENSP00000180173:D234G	D	-	2	0	MTMR7	17243274	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	3.252000	0.51461	1.017000	0.39495	0.460000	0.39030	GAC	.		0.557	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686	
NCAM1	4684	broad.mit.edu;bcgsc.ca	37	11	113130930	113130930	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:113130930G>T	ENST00000533760.1	+	16	2231	c.1632G>T	c.(1630-1632)aaG>aaT	p.K544N	NCAM1_ENST00000316851.7_Missense_Mutation_p.K662N|NCAM1_ENST00000397957.4_3'UTR	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	672	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TCATGCTGAAGTCCCTGGACT	0.552																																					p.K698N		.											.	NCAM1	23	0			c.G2094T						.						102.0	108.0	106.0					11																	113130930		1939	4136	6075	SO:0001583	missense	4684	exon18			GCTGAAGTCCCTG		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1632G>T	11.37:g.113130930G>T	ENSP00000473281:p.Lys544Asn	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	7.0	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	G	14.44	2.536450	0.45176	.	.	ENSG00000149294	ENST00000531044;ENST00000316851;ENST00000433634	T	0.57107	0.42	5.53	3.33	0.38152	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.195170	0.42821	U	0.000656	T	0.45135	0.1327	.	.	.	0.45390	D	0.998375	B;B;B;B	0.22604	0.039;0.072;0.052;0.045	B;B;B;B	0.24155	0.026;0.023;0.039;0.051	T	0.47018	-0.9149	9	0.52906	T	0.07	-17.5953	12.6691	0.56857	0.2086:0.0:0.7914:0.0	.	544;662;672;697	E9PLH7;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	N	544;662;127	ENSP00000318472:K662N	ENSP00000318472:K662N	K	+	3	2	NCAM1	112636140	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.963000	0.40452	1.343000	0.45638	0.561000	0.74099	AAG	.		0.552	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
NCOR2	9612	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	124821719	124821753	+	Splice_Site	DEL	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	-	rs373637496|rs368900171		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	AGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:124821719_124821753delAGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC	ENST00000405201.1	-	38	5688_5695	c.5688_5695delGCCTGACCGCCTTCTCTCCTCCCCCAGGTCCACCT	c.(5686-5697)aggcctgaccgc>aggc	p.RPDR1896fs	NCOR2_ENST00000404121.2_Splice_Site_p.RPDR1457fs|NCOR2_ENST00000397355.1_Splice_Site_p.RPDR1887fs|NCOR2_ENST00000404621.1_Splice_Site_p.RPDR1886fs|NCOR2_ENST00000429285.2_Splice_Site_p.RPDR1886fs|NCOR2_ENST00000356219.3_Splice_Site_p.RPDR1903fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1907					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GAGGAGGTGGAGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGCAGTCATGGGA	0.647																																					p.1896_1899del		.											.	NCOR2	229	0			c.5688_5695del						.																																			SO:0001630	splice_region_variant	9612	exon40			AGGTGGAGGTGGA	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5688-1GCCTGACCGCCTTCTCTCCTCCCCCAGGTCCACCT>-	12.37:g.124821719_124821753delAGGTGGACCTGGGGGAGGAGAGAAGGCGGTCAGGC		Somatic	303.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	16.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Del	DEL	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.647	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	Frame_Shift_Del
NEK11	79858	broad.mit.edu;bcgsc.ca	37	3	130828741	130828741	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:130828741T>C	ENST00000510769.1	+	4	684	c.431T>C	c.(430-432)cTg>cCg	p.L144P	NEK11_ENST00000356918.4_Missense_Mutation_p.L144P|NEK11_ENST00000426022.2_3'UTR|NEK11_ENST00000429253.2_Missense_Mutation_p.L144P|NEK11_ENST00000510688.1_Missense_Mutation_p.L144P|NEK11_ENST00000507910.1_Missense_Mutation_p.L144P|AC121332.1_ENST00000390784.1_RNA|NEK11_ENST00000511262.1_Missense_Mutation_p.L144P|NEK11_ENST00000412440.2_5'UTR|NEK11_ENST00000383366.4_Missense_Mutation_p.L144P|NEK11_ENST00000508196.1_Missense_Mutation_p.L144P					NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						CAGCTGCTGCTGGGAGTTGAC	0.358																																					p.L144P		.											.	NEK11	848	0			c.T431C						.						77.0	83.0	81.0					3																	130828741		2203	4299	6502	SO:0001583	missense	79858	exon5			TGCTGCTGGGAGT	AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.431T>C	3.37:g.130828741T>C	ENSP00000421549:p.Leu144Pro	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	252.0	19.0	NM_024800		Missense_Mutation	SNP	ENST00000510769.1	37		.	.	.	.	.	.	.	.	.	.	T	21.2	4.117181	0.77323	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000356918;ENST00000510688;ENST00000511262;ENST00000383366;ENST00000507910;ENST00000508196	T;T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	6.09	6.09	0.99107	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.40728	N	0.001036	T	0.79919	0.4529	M	0.79343	2.45	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.998;1.0;0.999	D;D;D;D;D	0.91635	0.983;0.999;0.979;0.991;0.977	T	0.82257	-0.0547	10	0.87932	D	0	.	15.651	0.77091	0.0:0.0:0.0:1.0	.	144;144;144;144;144	Q8NG66-3;E9PHI8;Q8NG66-4;Q8NG66;Q8NG66-2	.;.;.;NEK11_HUMAN;.	P	144	ENSP00000421549:L144P;ENSP00000397180:L144P;ENSP00000349389:L144P;ENSP00000423458:L144P;ENSP00000425114:L144P;ENSP00000372857:L144P;ENSP00000426662:L144P;ENSP00000421851:L144P	ENSP00000349389:L144P	L	+	2	0	NEK11	132311431	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.787000	0.69013	2.336000	0.79503	0.523000	0.50628	CTG	.		0.358	NEK11-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000356757.1	NM_024800	
NOTCH2	4853	ucsc.edu;bcgsc.ca	37	1	120512321	120512321	+	Silent	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:120512321A>G	ENST00000256646.2	-	6	1140	c.921T>C	c.(919-921)aaT>aaC	p.N307N		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	307	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGACAGGCATTGGGCTGCA	0.498			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.N307N		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	1441	0			c.T921C						.						138.0	109.0	119.0					1																	120512321		2203	4300	6503	SO:0001819	synonymous_variant	4853	exon6	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	ACAGGCATTGGGC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.921T>C	1.37:g.120512321A>G		Somatic	95.0	0.0		WXS	Illumina HiSeq	.	63.0	6.0	NM_001200001	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1																																																																																			.		0.498	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NXF1	10482	ucsc.edu;bcgsc.ca	37	11	62571039	62571039	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:62571039G>T	ENST00000532297.1	-	4	850	c.221C>A	c.(220-222)cCc>cAc	p.P74H	NXF1_ENST00000531131.1_Intron|NXF1_ENST00000531709.2_Missense_Mutation_p.P74H|NXF1_ENST00000439713.2_Missense_Mutation_p.P74H|NXF1_ENST00000294172.2_Missense_Mutation_p.P74H			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	74	Interaction with ALYREF/THOC4.|Major non-specific RNA-binding.|RNA-binding (RBD).				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTGGTATAGGGGTTGCTGTG	0.498																																					p.P74H		.											.	NXF1	228	0			c.C221A						.						90.0	82.0	85.0					11																	62571039		2201	4299	6500	SO:0001583	missense	10482	exon3			GTATAGGGGTTGC	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.221C>A	11.37:g.62571039G>T	ENSP00000436679:p.Pro74His	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	34	5.377856	0.95945	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875;ENST00000439713;ENST00000533671;ENST00000531474	T;T;T;T	0.63255	0.47;0.47;0.27;-0.03	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.76751	0.4031	M	0.72353	2.195	0.58432	D	0.999997	D;D;D	0.89917	0.998;1.0;1.0	P;D;D	0.85130	0.904;0.997;0.988	T	0.79347	-0.1841	10	0.87932	D	0	-18.1575	12.944	0.58362	0.0:0.0:1.0:0.0	.	117;87;74	E9PIN3;Q59E96;Q9UBU9	.;.;NXF1_HUMAN	H	74;74;117;74;14;14	ENSP00000294172:P74H;ENSP00000436679:P74H;ENSP00000435742:P117H;ENSP00000408864:P74H	ENSP00000294172:P74H	P	-	2	0	NXF1	62327615	1.000000	0.71417	0.988000	0.46212	0.945000	0.59286	3.845000	0.55880	2.418000	0.82041	0.655000	0.94253	CCC	.		0.498	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
OBSCN	84033	ucsc.edu;bcgsc.ca	37	1	228525715	228525715	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:228525715G>T	ENST00000422127.1	+	67	16915	c.16871G>T	c.(16870-16872)cGg>cTg	p.R5624L	OBSCN_ENST00000366707.4_Missense_Mutation_p.R3258L|OBSCN_ENST00000284548.11_Missense_Mutation_p.R5624L|OBSCN_ENST00000570156.2_Missense_Mutation_p.R6581L|OBSCN_ENST00000366709.4_Missense_Mutation_p.R2743L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5624	SH3.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ATCACGCTGCGGGAAGGCCAG	0.632																																					p.R6581L		.											.	OBSCN	403	0			c.G19742T						.						41.0	41.0	41.0					1																	228525715		2195	4293	6488	SO:0001583	missense	84033	exon78			CGCTGCGGGAAGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16871G>T	1.37:g.228525715G>T	ENSP00000409493:p.Arg5624Leu	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	53.0	5.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375291	0.82682	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.63096	0.36;-0.02;0.03;0.53	4.35	4.35	0.52113	Src homology-3 domain (2);	0.081903	0.47455	D	0.000223	T	0.57213	0.2038	N	0.22421	0.69	0.33193	D	0.551184	D;D	0.61697	0.982;0.99	P;P	0.58454	0.694;0.839	T	0.66412	-0.5930	10	0.56958	D	0.05	.	5.4029	0.16306	0.2503:0.0:0.7497:0.0	.	5624;5624	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	L	5624;5624;3258;2743	ENSP00000284548:R5624L;ENSP00000409493:R5624L;ENSP00000355668:R3258L;ENSP00000355670:R2743L	ENSP00000284548:R5624L	R	+	2	0	OBSCN	226592338	1.000000	0.71417	0.975000	0.42487	0.681000	0.39784	6.171000	0.71926	2.431000	0.82371	0.491000	0.48974	CGG	.		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR2G2	81470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247751732	247751732	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:247751732C>T	ENST00000320065.1	+	1	71	c.71C>T	c.(70-72)cCt>cTt	p.P24L	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	24			P -> A (in dbSNP:rs12737801).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TCTGATTATCCTCAGTTACAG	0.418																																					p.P24L		.											.	OR2G2	68	0			c.C71T						.						195.0	188.0	190.0					1																	247751732		2203	4300	6503	SO:0001583	missense	81470	exon1			ATTATCCTCAGTT	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.71C>T	1.37:g.247751732C>T	ENSP00000326349:p.Pro24Leu	Somatic	285.0	0.0		WXS	Illumina HiSeq	Phase_I	372.0	89.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	37	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897411	0.52121	.	.	ENSG00000177489	ENST00000320065	T	0.00421	7.46	3.79	3.79	0.43588	.	0.000000	0.33235	U	0.005126	T	0.01353	0.0044	M	0.87097	2.86	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.18999	-1.0319	10	0.66056	D	0.02	.	13.2409	0.59995	0.0:1.0:0.0:0.0	.	24	Q8NGZ5	OR2G2_HUMAN	L	24	ENSP00000326349:P24L	ENSP00000326349:P24L	P	+	2	0	OR2G2	245818355	0.000000	0.05858	0.714000	0.30535	0.942000	0.58702	-0.014000	0.12656	1.925000	0.55765	0.591000	0.81541	CCT	.		0.418	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
OR8D1	283159	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124180637	124180637	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:124180637G>T	ENST00000357821.2	-	1	96	c.26C>A	c.(25-27)gCa>gAa	p.A9E		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		AAACTGAGCTGCCATAGAATA	0.433																																					p.A9E		.											.	OR8D1	71	0			c.C26A						.						53.0	57.0	56.0					11																	124180637		2201	4298	6499	SO:0001583	missense	283159	exon1			TGAGCTGCCATAG	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.26C>A	11.37:g.124180637G>T	ENSP00000350474:p.Ala9Glu	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	7.0	NM_001002917	B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	ENST00000357821.2	37	CCDS31706.1	.	.	.	.	.	.	.	.	.	.	g	12.26	1.884929	0.33255	.	.	ENSG00000196341	ENST00000357821	T	0.00509	6.91	4.42	-6.59	0.01830	.	1.109350	0.07216	U	0.860115	T	0.00271	0.0008	N	0.16066	0.365	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44050	-0.9353	10	0.87932	D	0	.	5.6486	0.17604	0.513:0.0:0.2683:0.2186	.	9	Q8WZ84	OR8D1_HUMAN	E	9	ENSP00000350474:A9E	ENSP00000350474:A9E	A	-	2	0	OR8D1	123685847	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.610000	0.05629	-0.950000	0.03659	0.603000	0.83216	GCA	.		0.433	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387285.1	NM_001002917	
OSGEPL1	64172	ucsc.edu;bcgsc.ca	37	2	190618641	190618641	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:190618641C>A	ENST00000264151.5	-	5	1066		c.e5+1		Y_RNA_ENST00000411317.1_RNA|OSGEPL1_ENST00000522700.1_Splice_Site|OSGEPL1_ENST00000519810.1_Splice_Site	NM_022353.2	NP_071748.2			O-sialoglycoprotein endopeptidase-like 1											large_intestine(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			ATAAAACTTACCAGTACTGCA	0.358																																					.		.											.	.	.	0			c.963+1G>T						.						44.0	44.0	44.0					2																	190618641		1856	4100	5956	SO:0001630	splice_region_variant	64172	exon6			AACTTACCAGTAC	AJ295148	CCDS46472.1	2q32	2011-08-12			ENSG00000128694	ENSG00000128694			23075	protein-coding gene	gene with protein product						19578062	Standard	NM_022353		Approved	Qri7	uc002uqz.1	Q9H4B0	OTTHUMG00000164096	ENST00000264151.5:c.963+1G>T	2.37:g.190618641C>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_022353		Splice_Site	SNP	ENST00000264151.5	37	CCDS46472.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294197	0.81025	.	.	ENSG00000128694	ENST00000264151;ENST00000519810;ENST00000522700	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3233	0.94252	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	OSGEPL1	190326886	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.597000	0.82733	2.791000	0.96007	0.650000	0.86243	.	.		0.358	OSGEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377257.1	NM_022353	Intron
PAFAH2	5051	ucsc.edu;bcgsc.ca	37	1	26317250	26317250	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:26317250A>G	ENST00000374282.3	-	2	237	c.58T>C	c.(58-60)Tgt>Cgt	p.C20R	PAFAH2_ENST00000374284.1_Missense_Mutation_p.C20R|PAFAH2_ENST00000493892.1_5'UTR	NM_000437.3	NP_000428.2	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2, 40kDa	20					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|phospholipid binding (GO:0005543)			NS(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	9		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		ACATCCCCACAGCCTACGAGG	0.547																																					p.C20R		.											.	PAFAH2	70	0			c.T58C						.						107.0	89.0	95.0					1																	26317250		2203	4300	6503	SO:0001583	missense	5051	exon2			CCCCACAGCCTAC	D87845	CCDS270.1	1p34.3	2008-09-19	2002-08-29		ENSG00000158006	ENSG00000158006			8579	protein-coding gene	gene with protein product		602344	"""platelet-activating factor acetylhydrolase 2 (40kD)"""			8955149, 9494101	Standard	NM_000437		Approved	HSD-PLA2	uc001bld.4	Q99487	OTTHUMG00000007437	ENST00000374282.3:c.58T>C	1.37:g.26317250A>G	ENSP00000363400:p.Cys20Arg	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_000437	D3DPK1|O15458|Q5SY02	Missense_Mutation	SNP	ENST00000374282.3	37	CCDS270.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167284	0.78339	.	.	ENSG00000158006	ENST00000374282;ENST00000374284;ENST00000439092;ENST00000441420	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	T	0.78233	0.4251	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.74490	-0.3648	10	0.22706	T	0.39	-16.1568	12.53	0.56109	1.0:0.0:0.0:0.0	.	20	Q99487	PAFA2_HUMAN	R	20	ENSP00000363400:C20R;ENSP00000363402:C20R;ENSP00000408313:C20R;ENSP00000411011:C20R	ENSP00000363400:C20R	C	-	1	0	PAFAH2	26189837	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.639000	0.61361	2.272000	0.75746	0.459000	0.35465	TGT	.		0.547	PAFAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019544.1	NM_000437	
PCDH12	51294	ucsc.edu;bcgsc.ca	37	5	141335557	141335557	+	Silent	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:141335557G>A	ENST00000231484.3	-	1	3070	c.1860C>T	c.(1858-1860)acC>acT	p.T620T	AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	620	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGCCACAATGGTTGTCAAAA	0.587																																					p.T620T		.											.	PCDH12	93	0			c.C1860T						.						73.0	67.0	69.0					5																	141335557		2203	4300	6503	SO:0001819	synonymous_variant	51294	exon1			CACAATGGTTGTC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.1860C>T	5.37:g.141335557G>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	37	CCDS4269.1																																																																																			.		0.587	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
PCDH8	5100	ucsc.edu;bcgsc.ca	37	13	53422154	53422154	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:53422154T>C	ENST00000377942.3	-	1	621	c.418A>G	c.(418-420)Atc>Gtc	p.I140V	PCDH8_ENST00000338862.4_Missense_Mutation_p.I140V	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	140	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		TCTACCGGGATCTGGGCCCTG	0.692																																					p.I140V	GBM(36;25 841 9273 49207)	.											.	PCDH8	153	0			c.A418G						.						34.0	32.0	33.0					13																	53422154		2198	4295	6493	SO:0001583	missense	5100	exon1			CCGGGATCTGGGC	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.418A>G	13.37:g.53422154T>C	ENSP00000367177:p.Ile140Val	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_032949	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	37	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	T	12.60	1.986369	0.35036	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000448969	T;T	0.60040	0.22;0.22	4.35	4.35	0.52113	Cadherin (2);Cadherin-like (1);	0.000000	0.41294	D	0.000904	T	0.56411	0.1983	L	0.52573	1.65	0.37073	D	0.898641	B;B	0.32918	0.39;0.283	B;B	0.40825	0.341;0.324	T	0.62220	-0.6900	10	0.34782	T	0.22	.	12.8956	0.58098	0.0:0.0:0.0:1.0	.	140;140	O95206-2;O95206	.;PCDH8_HUMAN	V	140	ENSP00000367177:I140V;ENSP00000341350:I140V	ENSP00000341350:I140V	I	-	1	0	PCDH8	52320155	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.519000	0.45546	1.845000	0.53610	0.454000	0.30748	ATC	.		0.692	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
PCSK6	5046	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	101929687	101929687	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr15:101929687G>T	ENST00000348070.1	-	10	1288	c.1289C>A	c.(1288-1290)gCc>gAc	p.A430D	PCSK6_ENST00000358417.3_Missense_Mutation_p.A430D|PCSK6_ENST00000398181.2_Missense_Mutation_p.A430D|PCSK6_ENST00000344273.2_Missense_Mutation_p.A430D|PCSK6_ENST00000331826.7_Missense_Mutation_p.A265D|PCSK6_ENST00000561177.1_5'UTR	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	431	Peptidase S8.				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TAGAGCCAAGGCGATGATGCC	0.493																																					.		.											.	PCSK6	46	0			.						.						69.0	74.0	72.0					15																	101929687		2040	4201	6241	SO:0001583	missense	5046	.			GCCAAGGCGATGA		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1289C>A	15.37:g.101929687G>T	ENSP00000305056:p.Ala430Asp	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	11.0	.	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Missense_Mutation	SNP	ENST00000348070.1	37		.	.	.	.	.	.	.	.	.	.	G	29.8	5.033864	0.93575	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	D;D;D;D;D;D	0.93659	-3.26;-3.26;-2.36;-3.26;-3.26;-3.26	5.74	5.74	0.90152	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.106709	0.64402	D	0.000007	D	0.98554	0.9517	H	0.99675	4.695	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.999;0.998;0.998;0.999;0.999;0.996;0.999	D	0.99529	1.0960	10	0.87932	D	0	-49.7235	18.9079	0.92471	0.0:0.0:1.0:0.0	.	431;336;430;431;430;430;431;431;430	P29122;Q59H04;E7EUC8;P29122-4;E7EWH5;E7EQ62;P29122-8;P29122-7;E7EM82	PCSK6_HUMAN;.;.;.;.;.;.;.;.	D	430;430;335;430;430;265	ENSP00000305056:A430D;ENSP00000351193:A430D;ENSP00000381246:A335D;ENSP00000344410:A430D;ENSP00000381243:A430D;ENSP00000332052:A265D	ENSP00000332052:A265D	A	-	2	0	PCSK6	99747210	1.000000	0.71417	0.995000	0.50966	0.951000	0.60555	9.701000	0.98710	2.702000	0.92279	0.655000	0.94253	GCC	.		0.493	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002570	
PDGFB	5155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	22	39621841	39621841	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr22:39621841G>A	ENST00000331163.6	-	6	1400	c.613C>T	c.(613-615)Caa>Taa	p.Q205*	PDGFB_ENST00000381551.4_Nonsense_Mutation_p.Q190*	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	205					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)		COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					ACCCGAGTTTGGGGCGTTTTG	0.592			T	COL1A1	DFSP																																p.Q205X		.		Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	.	PDGFB	1270	0			c.C613T						.						81.0	69.0	73.0					22																	39621841		2203	4300	6503	SO:0001587	stop_gained	5155	exon6			GAGTTTGGGGCGT		CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.613C>T	22.37:g.39621841G>A	ENSP00000330382:p.Gln205*	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	13.0	NM_002608	G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Nonsense_Mutation	SNP	ENST00000331163.6	37	CCDS13987.1	.	.	.	.	.	.	.	.	.	.	G	43	10.183253	0.99354	.	.	ENSG00000100311	ENST00000331163;ENST00000381551	.	.	.	5.04	4.01	0.46588	.	0.531612	0.19911	N	0.103299	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-16.7667	11.9389	0.52888	0.0:0.0:0.8258:0.1742	.	.	.	.	X	205;190	.	ENSP00000330382:Q205X	Q	-	1	0	PDGFB	37951787	1.000000	0.71417	0.987000	0.45799	0.934000	0.57294	4.089000	0.57685	1.350000	0.45770	-0.181000	0.13052	CAA	.		0.592	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321043.1	NM_002608	
PDYN	5173	ucsc.edu;bcgsc.ca	37	20	1963617	1963617	+	Silent	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr20:1963617T>C	ENST00000217305.2	-	3	339	c.114A>G	c.(112-114)aaA>aaG	p.K38K	PDYN_ENST00000540134.1_Silent_p.K38K|PDYN_ENST00000539905.1_Silent_p.K38K|RP4-684O24.5_ENST00000446562.1_RNA	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	38					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GATTGATAGGTTTGGGACCAT	0.612																																					p.K38K		.											.	PDYN	92	0			c.A114G						.						76.0	64.0	68.0					20																	1963617		2203	4300	6503	SO:0001819	synonymous_variant	5173	exon3			GATAGGTTTGGGA		CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.114A>G	20.37:g.1963617T>C		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001190898	A8K0Q3	Silent	SNP	ENST00000217305.2	37	CCDS13023.1																																																																																			.		0.612	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077569.2		
PGBD1	84547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28268801	28268801	+	Missense_Mutation	SNP	G	G	C	rs143874020		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:28268801G>C	ENST00000405948.2	+	7	1590	c.1170G>C	c.(1168-1170)tgG>tgC	p.W390C	PGBD1_ENST00000259883.3_Missense_Mutation_p.W390C	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	390						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						AAAAGAGTTGGACCAAAAGAG	0.413																																					p.W390C		.											.	PGBD1	94	0			c.G1170C						.	G	CYS/TRP,CYS/TRP	1,4405	2.1+/-5.4	0,1,2202	65.0	69.0	68.0		1170,1170	4.5	1.0	6	dbSNP_134	68	0,8600		0,0,4300	no	missense,missense	PGBD1	NM_001184743.1,NM_032507.3	215,215	0,1,6502	CC,CG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	390/810,390/810	28268801	1,13005	2203	4300	6503	SO:0001583	missense	84547	exon7			GAGTTGGACCAAA	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1170G>C	6.37:g.28268801G>C	ENSP00000385213:p.Trp390Cys	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	24.0	NM_001184743	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.612478	0.46631	2.27E-4	0.0	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.02369	4.32;4.32	4.54	4.54	0.55810	.	0.195133	0.25836	N	0.027990	T	0.04724	0.0128	L	0.32530	0.975	0.58432	D	0.999993	D	0.89917	1.0	D	0.75020	0.985	T	0.42799	-0.9430	10	0.87932	D	0	-16.3181	12.9975	0.58654	0.0:0.0:1.0:0.0	.	390	Q96JS3	PGBD1_HUMAN	C	390	ENSP00000385213:W390C;ENSP00000259883:W390C	ENSP00000259883:W390C	W	+	3	0	PGBD1	28376780	0.998000	0.40836	0.976000	0.42696	0.862000	0.49288	4.406000	0.59748	2.521000	0.84997	0.655000	0.94253	TGG	G|1.000;C|0.000		0.413	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		
PITRM1	10531	ucsc.edu;bcgsc.ca	37	10	3186531	3186531	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:3186531C>A	ENST00000224949.4	-	22	2519	c.2485G>T	c.(2485-2487)Gat>Tat	p.D829Y	PITRM1_ENST00000451104.2_Missense_Mutation_p.D731Y|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000380994.1_Missense_Mutation_p.D387Y|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1-AS1_ENST00000441377.1_RNA|PITRM1_ENST00000464395.1_5'UTR|PITRM1_ENST00000380989.2_Missense_Mutation_p.D830Y			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	829					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						ACGTGGGCATCTCCACCAGAG	0.498																																					p.D830Y		.											.	PITRM1	91	0			c.G2488T						.						29.0	35.0	33.0					10																	3186531		1929	4114	6043	SO:0001583	missense	10531	exon22			GGGCATCTCCACC	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.2485G>T	10.37:g.3186531C>A	ENSP00000224949:p.Asp829Tyr	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001242307	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	10.35|10.35	1.324898|1.324898	0.24080|0.24080	.|.	.|.	ENSG00000107959|ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104;ENST00000455371;ENST00000424714|ENST00000451454	T;T;T;T;T;T|.	0.53857|.	3.7;3.7;3.06;3.57;1.78;0.6|.	4.41|4.41	1.88|1.88	0.25563|0.25563	Peptidase M16, C-terminal (1);|.	1.230850|.	0.05661|.	N|.	0.586871|.	T|T	0.21761|0.21761	0.0524|0.0524	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;P;P;P;P|.	0.52061|.	0.016;0.95;0.495;0.495;0.937|.	B;P;B;B;B|.	0.44359|.	0.003;0.447;0.319;0.319;0.436|.	T|T	0.24297|0.24297	-1.0164|-1.0164	10|5	0.62326|.	D|.	0.03|.	-3.095|-3.095	5.6132|5.6132	0.17416|0.17416	0.0:0.2952:0.0:0.7048|0.0:0.2952:0.0:0.7048	.|.	822;731;830;829;822|.	E9PDX6;E7ES23;C9JSL2;Q5JRX3;B4DH07|.	.;.;.;PREP_HUMAN;.|.	Y|I	829;822;830;387;731;10;48|162	ENSP00000224949:D829Y;ENSP00000370377:D830Y;ENSP00000370382:D387Y;ENSP00000401201:D731Y;ENSP00000399307:D10Y;ENSP00000402072:D48Y|.	ENSP00000224949:D829Y|.	D|R	-|-	1|2	0|0	PITRM1|PITRM1	3176531|3176531	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	0.302000|0.302000	0.19192|0.19192	0.239000|0.239000	0.21243|0.21243	0.462000|0.462000	0.41574|0.41574	GAT|AGA	.		0.498	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
PKHD1L1	93035	broad.mit.edu;bcgsc.ca	37	8	110495217	110495217	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr8:110495217G>A	ENST00000378402.5	+	57	9563	c.9459G>A	c.(9457-9459)ggG>ggA	p.G3153G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3153	G8 2. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTTCTTTAGGGGTGTTTGGTG	0.368										HNSCC(38;0.096)																											p.G3153G		.											.	PKHD1L1	145	0			c.G9459A						.						156.0	150.0	152.0					8																	110495217		1847	4091	5938	SO:0001630	splice_region_variant	93035	exon57			TTTAGGGGTGTTT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9458-1G>A	8.37:g.110495217G>A		Somatic	219.0	0.0		WXS	Illumina HiSeq	Phase_I	282.0	13.0	NM_177531	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	37	CCDS47911.1																																																																																			.		0.368	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	Silent
PLCB3	5331	ucsc.edu;bcgsc.ca	37	11	64031579	64031579	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:64031579A>G	ENST00000540288.1	+	22	2750	c.2647A>G	c.(2647-2649)Agt>Ggt	p.S883G	PLCB3_ENST00000325234.5_Missense_Mutation_p.S816G|PLCB3_ENST00000279230.6_Missense_Mutation_p.S883G	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	883					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CATTGGGGAGAGTGAGGTGAG	0.667																																					p.S883G		.											.	PLCB3	228	0			c.A2647G						.						30.0	35.0	33.0					11																	64031579		2201	4297	6498	SO:0001583	missense	5331	exon22			GGGGAGAGTGAGG	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2647A>G	11.37:g.64031579A>G	ENSP00000443631:p.Ser883Gly	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_000932	A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	37	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	a	6.684	0.494863	0.12702	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.22134	2.09;2.09;1.97	5.25	4.08	0.47627	.	0.366682	0.28712	N	0.014400	T	0.14270	0.0345	L	0.33485	1.01	0.25924	N	0.983083	B;B	0.27498	0.18;0.003	B;B	0.29862	0.108;0.007	T	0.21109	-1.0255	10	0.27785	T	0.31	.	5.2656	0.15597	0.7575:0.0:0.0844:0.1581	.	816;883	G5E960;Q01970	.;PLCB3_HUMAN	G	883;883;816	ENSP00000279230:S883G;ENSP00000443631:S883G;ENSP00000324660:S816G	ENSP00000279230:S883G	S	+	1	0	PLCB3	63788155	0.091000	0.21658	0.767000	0.31495	0.304000	0.27724	1.513000	0.35823	0.786000	0.33708	0.454000	0.30748	AGT	.		0.667	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
PLD2	5338	ucsc.edu;bcgsc.ca	37	17	4714131	4714131	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:4714131G>T	ENST00000263088.6	+	10	1026	c.895G>T	c.(895-897)Gca>Tca	p.A299S	PLD2_ENST00000572940.1_Missense_Mutation_p.A299S	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	299	PH.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	CTACCGGCAGGCACGGTGGTG	0.602																																					p.A299S		.											.	PLD2	291	0			c.G895T						.						73.0	75.0	75.0					17																	4714131		2203	4300	6503	SO:0001583	missense	5338	exon10			CGGCAGGCACGGT	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.895G>T	17.37:g.4714131G>T	ENSP00000263088:p.Ala299Ser	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001243108	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	ENST00000263088.6	37	CCDS11057.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.705687	0.89018	.	.	ENSG00000129219	ENST00000263088	T	0.22539	1.95	5.11	5.11	0.69529	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.194052	0.45867	D	0.000339	T	0.31638	0.0803	M	0.79693	2.465	0.52099	D	0.999941	B;B;B	0.18863	0.018;0.031;0.01	B;B;B	0.26310	0.012;0.068;0.016	T	0.08371	-1.0725	10	0.39692	T	0.17	-9.3011	16.0993	0.81158	0.0:0.0:1.0:0.0	.	156;299;299	B7Z905;O14939-2;O14939	.;.;PLD2_HUMAN	S	299	ENSP00000263088:A299S	ENSP00000263088:A299S	A	+	1	0	PLD2	4661099	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.903000	0.56318	2.657000	0.90304	0.557000	0.71058	GCA	.		0.602	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663	
PLXNC1	10154	ucsc.edu;bcgsc.ca	37	12	94613937	94613937	+	Missense_Mutation	SNP	A	A	G	rs374991360		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:94613937A>G	ENST00000258526.4	+	6	1949	c.1700A>G	c.(1699-1701)aAa>aGa	p.K567R		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	567					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GCAACCTACAAAGGTATGTGG	0.448																																					p.K567R		.											.	PLXNC1	92	0			c.A1700G						.	A	ARG/LYS	0,4406		0,0,2203	111.0	121.0	118.0		1700	-3.2	0.0	12		118	1,8599	1.2+/-3.3	0,1,4299	no	missense	PLXNC1	NM_005761.2	26	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	567/1569	94613937	1,13005	2203	4300	6503	SO:0001583	missense	10154	exon6			CCTACAAAGGTAT	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1700A>G	12.37:g.94613937A>G	ENSP00000258526:p.Lys567Arg	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_005761	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	A	1.790	-0.479672	0.04383	0.0	1.16E-4	ENSG00000136040	ENST00000258526	T	0.06687	3.27	4.48	-3.17	0.05202	.	1.093090	0.07306	N	0.874929	T	0.05640	0.0148	L	0.27053	0.805	0.23435	N	0.997686	B	0.02656	0.0	B	0.01281	0.0	T	0.46721	-0.9171	10	0.15952	T	0.53	.	9.6451	0.39863	0.3191:0.0:0.6809:0.0	.	567	O60486	PLXC1_HUMAN	R	567	ENSP00000258526:K567R	ENSP00000258526:K567R	K	+	2	0	PLXNC1	93138068	0.338000	0.24775	0.040000	0.18447	0.015000	0.08874	-0.476000	0.06591	-0.382000	0.07870	-1.007000	0.02485	AAA	.		0.448	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
PPAT	5471	broad.mit.edu;bcgsc.ca	37	4	57273817	57273817	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr4:57273817T>C	ENST00000264220.2	-	2	331	c.194A>G	c.(193-195)aAg>aGg	p.K65R	PPAT_ENST00000507648.1_5'UTR|AC068620.1_ENST00000598320.1_5'Flank	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	65	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	CAAATTTACCTTGTGTGATTT	0.443																																					p.K65R		.											.	PPAT	90	0			c.A194G						.						142.0	113.0	123.0					4																	57273817		2203	4300	6503	SO:0001630	splice_region_variant	5471	exon2			TTTACCTTGTGTG		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.195+1A>G	4.37:g.57273817T>C		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	6.0	NM_002703		Missense_Mutation	SNP	ENST00000264220.2	37	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.869832	0.91587	.	.	ENSG00000128059	ENST00000264220	T	0.79845	-1.31	5.36	5.36	0.76844	Glutamine amidotransferase, type II (1);	0.091874	0.64402	D	0.000001	D	0.83454	0.5258	M	0.63843	1.955	0.80722	D	1	P	0.41848	0.763	P	0.48571	0.582	D	0.83669	0.0165	10	0.44086	T	0.13	-28.4354	15.3375	0.74269	0.0:0.0:0.0:1.0	.	65	Q06203	PUR1_HUMAN	R	65	ENSP00000264220:K65R	ENSP00000264220:K65R	K	-	2	0	PPAT	56968574	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.870000	0.75526	2.006000	0.58801	0.482000	0.46254	AAG	.		0.443	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	Missense_Mutation
PPP2R3A	5523	ucsc.edu;bcgsc.ca	37	3	135745924	135745924	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:135745924T>C	ENST00000264977.3	+	3	2863	c.2246T>C	c.(2245-2247)aTg>aCg	p.M749T	PPP2R3A_ENST00000334546.2_Missense_Mutation_p.M128T|PPP2R3A_ENST00000490467.1_Missense_Mutation_p.M13T|PPP2R3A_ENST00000492624.2_Missense_Mutation_p.M13T	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	749					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ATTTATGAAATGGGGAAAATT	0.398																																					p.M749T		.											.	PPP2R3A	662	0			c.T2246C						.						29.0	28.0	28.0					3																	135745924		2203	4300	6503	SO:0001583	missense	5523	exon3			ATGAAATGGGGAA	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2246T>C	3.37:g.135745924T>C	ENSP00000264977:p.Met749Thr	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	37	CCDS3087.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.003656	0.54254	.	.	ENSG00000073711	ENST00000264977;ENST00000490467;ENST00000334546;ENST00000492624	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.59500	0.2198	M	0.61703	1.905	0.54753	D	0.999982	P;P	0.51791	0.948;0.474	P;B	0.53450	0.726;0.258	T	0.63444	-0.6636	10	0.72032	D	0.01	.	15.2067	0.73183	0.0:0.0:0.0:1.0	.	128;749	Q06190-2;Q06190	.;P2R3A_HUMAN	T	749;13;128;13	ENSP00000264977:M749T;ENSP00000419344:M13T;ENSP00000334748:M128T;ENSP00000417231:M13T	ENSP00000264977:M749T	M	+	2	0	PPP2R3A	137228614	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.649000	0.83500	2.195000	0.70347	0.477000	0.44152	ATG	.		0.398	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
PPP6R3	55291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68338555	68338555	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:68338555A>C	ENST00000393800.2	+	12	1580	c.1326A>C	c.(1324-1326)gaA>gaC	p.E442D	PPP6R3_ENST00000527403.2_Missense_Mutation_p.E442D|PPP6R3_ENST00000524904.1_Missense_Mutation_p.E442D|PPP6R3_ENST00000534534.1_Missense_Mutation_p.E210D|PPP6R3_ENST00000529710.1_Missense_Mutation_p.E391D|PPP6R3_ENST00000265636.5_Missense_Mutation_p.E391D|PPP6R3_ENST00000393799.2_Missense_Mutation_p.E442D|PPP6R3_ENST00000393801.3_Missense_Mutation_p.E442D|PPP6R3_ENST00000524845.1_Missense_Mutation_p.E442D|PPP6R3_ENST00000265637.4_Missense_Mutation_p.E442D	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	442					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AAGCCTGGGAAATGAATGAGA	0.294																																					p.E442D		.											.	PPP6R3	91	0			c.A1326C						.						78.0	90.0	86.0					11																	68338555		2199	4294	6493	SO:0001583	missense	55291	exon12			CTGGGAAATGAAT	AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.1326A>C	11.37:g.68338555A>C	ENSP00000377389:p.Glu442Asp	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	19.0	NM_001164162	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	ENST00000393800.2	37	CCDS53672.1	.	.	.	.	.	.	.	.	.	.	A	14.11	2.437276	0.43224	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190	T;T;T;T;T;T;T;T;T;T;T	0.27256	1.68;1.68;1.71;1.78;1.78;1.68;1.69;1.73;1.73;1.78;1.77	5.62	-1.36	0.09085	.	0.440687	0.26753	N	0.022672	T	0.15609	0.0376	L	0.43646	1.37	0.26014	N	0.981956	B;B;B;B;B;B;B;B	0.14805	0.0;0.0;0.001;0.011;0.005;0.006;0.002;0.001	B;B;B;B;B;B;B;B	0.26416	0.003;0.003;0.022;0.025;0.041;0.069;0.003;0.008	T	0.13495	-1.0507	10	0.34782	T	0.22	.	0.8448	0.01159	0.1876:0.2696:0.2929:0.2499	.	154;210;391;442;442;442;442;391	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;.;.;PP6R3_HUMAN;.;.	D	442;442;210;442;442;442;442;391;391;442;178	ENSP00000377388:E442D;ENSP00000377389:E442D;ENSP00000434429:E210D;ENSP00000431415:E442D;ENSP00000265637:E442D;ENSP00000433058:E442D;ENSP00000377390:E442D;ENSP00000265636:E391D;ENSP00000437329:E391D;ENSP00000433565:E442D;ENSP00000436209:E178D	ENSP00000265636:E391D	E	+	3	2	PPP6R3	68095131	0.818000	0.29161	0.991000	0.47740	0.989000	0.77384	-0.047000	0.11963	-0.154000	0.11118	-0.496000	0.04628	GAA	.		0.294	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312	
PRDM2	7799	ucsc.edu;bcgsc.ca	37	1	14113012	14113012	+	Intron	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:14113012A>G	ENST00000235372.7	+	8	5892				PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.N1680S|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.N1479S|PRDM2_ENST00000413440.1_Missense_Mutation_p.N1479S	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TTTTCTAGGAACTTCCTGTAG	0.343																																					p.N1680S		.											.	PRDM2	116	0			c.A5039G						.						186.0	170.0	176.0					1																	14113012		2203	4300	6503	SO:0001627	intron_variant	7799	exon9			CTAGGAACTTCCT	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.5036+3686A>G	1.37:g.14113012A>G		Somatic	47.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.883286	0.33255	.	.	ENSG00000116731	ENST00000311066;ENST00000413440;ENST00000343137	T;T;T	0.01516	4.81;4.82;4.82	5.83	4.71	0.59529	.	.	.	.	.	T	0.01421	0.0046	N	0.08118	0	0.23765	N	0.996906	B;B	0.16802	0.007;0.019	B;B	0.17722	0.009;0.019	T	0.48490	-0.9031	9	0.87932	D	0	.	9.4344	0.38630	0.9196:0.0:0.0804:0.0	.	1538;1680	Q5THJ0;Q13029-2	.;.	S	1680;1479;1479	ENSP00000312352:N1680S;ENSP00000411103:N1479S;ENSP00000341621:N1479S	ENSP00000312352:N1680S	N	+	2	0	PRDM2	13985599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.883000	0.48554	1.052000	0.40392	0.533000	0.62120	AAC	.		0.343	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PRMT7	54496	ucsc.edu;bcgsc.ca	37	16	68373424	68373424	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:68373424C>A	ENST00000339507.5	+	8	1534	c.704C>A	c.(703-705)cCa>cAa	p.P235Q	PRMT7_ENST00000441236.1_Missense_Mutation_p.P185Q|PRMT7_ENST00000449359.3_Missense_Mutation_p.P185Q|PRMT7_ENST00000348497.4_Missense_Mutation_p.P161Q|PRMT7_ENST00000564441.1_3'UTR			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	235	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		CAGGTGTCACCAGCCGACTTT	0.567																																					p.P235Q		.											.	PRMT7	90	0			c.C704A						.						84.0	65.0	71.0					16																	68373424		2198	4300	6498	SO:0001583	missense	54496	exon8			TGTCACCAGCCGA	AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.704C>A	16.37:g.68373424C>A	ENSP00000343103:p.Pro235Gln	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	19.0	4.0	NM_019023	B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	ENST00000339507.5	37	CCDS10866.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389420	0.25118	.	.	ENSG00000132600	ENST00000449359;ENST00000441236;ENST00000348497;ENST00000339507	T;T	0.76060	-0.99;0.98	5.62	3.55	0.40652	.	0.338596	0.36167	N	0.002751	T	0.67183	0.2866	L	0.49350	1.555	0.09310	N	0.999996	B;B;B;B	0.32071	0.147;0.355;0.077;0.058	B;B;B;B	0.37239	0.099;0.244;0.017;0.068	T	0.55250	-0.8170	10	0.22706	T	0.39	-6.9187	9.3927	0.38383	0.0:0.7746:0.1449:0.0805	.	185;161;235;235	Q9NVM4-3;Q9NVM4-2;Q9NVM4;Q9NVM4-4	.;.;ANM7_HUMAN;.	Q	185;185;161;235	ENSP00000345775:P161Q;ENSP00000343103:P235Q	ENSP00000343103:P235Q	P	+	2	0	PRMT7	66930925	0.000000	0.05858	0.019000	0.16419	0.505000	0.33919	0.950000	0.29122	1.511000	0.48818	-0.150000	0.13652	CCA	.		0.567	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268892.3	NM_019023	
PRUNE2	158471	broad.mit.edu;bcgsc.ca	37	9	79325022	79325022	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:79325022G>T	ENST00000376718.3	-	8	2291	c.2168C>A	c.(2167-2169)cCt>cAt	p.P723H	PRUNE2_ENST00000428286.1_Missense_Mutation_p.P364H	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	723					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						ACCCAGTTCAGGCTGACCAAA	0.458																																					p.P723H		.											.	PRUNE2	157	0			c.C2168A						.						55.0	50.0	51.0					9																	79325022		1568	3582	5150	SO:0001583	missense	158471	exon8			AGTTCAGGCTGAC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2168C>A	9.37:g.79325022G>T	ENSP00000365908:p.Pro723His	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	10.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	G	0.175	-1.067664	0.01934	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.23147	1.92;1.92	5.97	3.95	0.45737	.	0.827505	0.10661	N	0.648731	T	0.22627	0.0546	L	0.41236	1.265	0.09310	N	0.999995	B	0.09022	0.002	B	0.09377	0.004	T	0.12837	-1.0532	10	0.39692	T	0.17	-2.3495	10.5838	0.45271	0.0:0.0:0.5776:0.4224	.	723	Q8WUY3	PRUN2_HUMAN	H	723;364;722	ENSP00000365908:P723H;ENSP00000397425:P364H	ENSP00000365908:P723H	P	-	2	0	PRUNE2	78514842	0.008000	0.16893	0.003000	0.11579	0.030000	0.12068	1.017000	0.29989	1.484000	0.48361	0.655000	0.94253	CCT	.		0.458	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PSG8	440533	ucsc.edu;bcgsc.ca	37	19	43262154	43262154	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:43262154G>T	ENST00000306511.4	-	3	806	c.709C>A	c.(709-711)Ccg>Acg	p.P237T	PSG8_ENST00000404209.4_Splice_Site_p.P237T|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000401467.2_Intron|PSG8_ENST00000406636.3_Splice_Site_p.P115T	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	237						extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				AAATACTCACGGAGGAGATTC	0.532																																					p.P237T		.											.	PSG8	90	0			c.C709A						.						184.0	193.0	190.0					19																	43262154		2203	4299	6502	SO:0001630	splice_region_variant	440533	exon3			ACTCACGGAGGAG	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.709+1C>A	19.37:g.43262154G>T		Somatic	42.0	0.0		WXS	Illumina HiSeq	.	37.0	5.0	NM_001130167	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	CCDS33037.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	1.070|1.070	-0.670057|-0.670057	0.03403|0.03403	.|.	.|.	ENSG00000124467|ENSG00000124467	ENST00000292109|ENST00000404209;ENST00000406636;ENST00000426252;ENST00000306511	.|T;T;T	.|0.26373	.|1.89;1.74;1.89	1.53|1.53	-0.0785|-0.0785	0.13714|0.13714	.|.	.|.	.|.	.|.	.|.	T|T	0.24699|0.24699	0.0599|0.0599	M|M	0.75085|0.75085	2.285|2.285	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.24675	.|0.109;0.038;0.026;0.015	.|B;B;B;B	.|0.26770	.|0.073;0.008;0.017;0.008	T|T	0.30794|0.30794	-0.9966|-0.9966	5|8	.|.	.|.	.|.	.|.	3.5414|3.5414	0.07812|0.07812	0.7465:0.0:0.2535:0.0|0.7465:0.0:0.2535:0.0	.|.	.|115;237;237;237	.|Q9UQ74-2;Q9UQ74;Q9UQ74-3;A5PKV3	.|.;PSG8_HUMAN;.;.	N|T	112|237;115;49;237	.|ENSP00000385869:P237T;ENSP00000385081:P115T;ENSP00000305005:P237T	.|.	H|P	-|-	1|1	0|0	PSG8|PSG8	47953994|47953994	0.001000|0.001000	0.12720|0.12720	0.009000|0.009000	0.14445|0.14445	0.007000|0.007000	0.05969|0.05969	-0.649000|-0.649000	0.05384|0.05384	-0.135000|-0.135000	0.11495|0.11495	-0.708000|-0.708000	0.03648|0.03648	CAT|CCG	.		0.532	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		Missense_Mutation
PSME2	5721	ucsc.edu;bcgsc.ca	37	14	24615416	24615416	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:24615416C>A	ENST00000216802.5	-	2	721		c.e2+1		PSME2_ENST00000560410.1_Intron|RNF31_ENST00000559275.1_5'Flank|RNF31_ENST00000324103.6_5'Flank|RNF31_ENST00000382687.3_5'Flank|PSME2_ENST00000471700.2_Splice_Site	NM_002818.2	NP_002809.2	Q9UL46	PSME2_HUMAN	proteasome (prosome, macropain) activator subunit 2 (PA28 beta)						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)				endometrium(1)|lung(3)|prostate(2)	6				GBM - Glioblastoma multiforme(265;0.00839)		CAGAGACTTACCTCCTGGAAA	0.488																																					.		.											.	PSME2	90	0			c.81+1G>T						.						95.0	96.0	96.0					14																	24615416		2203	4300	6503	SO:0001630	splice_region_variant	5721	exon3			GACTTACCTCCTG		CCDS9614.1	14q11.2	2010-03-10			ENSG00000100911	ENSG00000100911		"""Proteasome (prosome, macropain) subunits"""	9569	protein-coding gene	gene with protein product		602161				7789512	Standard	NM_002818		Approved	PA28beta	uc001wmj.3	Q9UL46	OTTHUMG00000028797	ENST00000216802.5:c.81+1G>T	14.37:g.24615416C>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_002818	Q15129	Splice_Site	SNP	ENST00000216802.5	37	CCDS9614.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891535	0.52014	.	.	ENSG00000100911	ENST00000216802	.	.	.	4.96	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9859	0.35994	0.0:0.9007:0.0:0.0993	.	.	.	.	.	-1	.	.	.	-	.	.	PSME2	23685256	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	4.181000	0.58303	1.315000	0.45114	0.561000	0.74099	.	.		0.488	PSME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071918.3	NM_002818	Intron
PTPRQ	374462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	81004359	81004359	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:81004359G>C	ENST00000266688.5	+	33	4861	c.4861G>C	c.(4861-4863)Gaa>Caa	p.E1621Q				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1667	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TGCATATGTAGAAGGGAAGTC	0.333																																					p.E1453Q		.											.	.	.	0			c.G4357C						.						89.0	71.0	76.0					12																	81004359		692	1589	2281	SO:0001583	missense	374462	exon25			TATGTAGAAGGGA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4861G>C	12.37:g.81004359G>C	ENSP00000266688:p.Glu1621Gln	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	16.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.28|12.28	1.890434|1.890434	0.33348|0.33348	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.37584|.	1.19|.	6.05|6.05	6.05|6.05	0.98169|0.98169	Fibronectin, type III (2);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|.	0.75946|.	0.3919|.	.|.	.|.	.|.	0.35947|0.35947	D|D	0.833661|0.833661	B|.	0.28713|.	0.22|.	B|.	0.34180|.	0.177|.	T|.	0.76774|.	-0.2835|.	8|.	0.13853|.	T|.	0.58|.	.|.	20.6013|20.6013	0.99457|0.99457	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1667|.	Q9UMZ3|.	PTPRQ_HUMAN|.	Q|Y	1621|1321	ENSP00000266688:E1621Q|.	ENSP00000266688:E1621Q|.	E|X	+|+	1|3	0|2	PTPRQ|PTPRQ	79528490|79528490	1.000000|1.000000	0.71417|0.71417	0.836000|0.836000	0.33094|0.33094	0.183000|0.183000	0.23260|0.23260	4.097000|4.097000	0.57741|0.57741	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	GAA|TAG	.		0.333	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
QPCTL	54814	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46202122	46202122	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:46202122C>T	ENST00000012049.5	+	5	1071	c.850C>T	c.(850-852)Cgc>Tgc	p.R284C	QPCTL_ENST00000366382.4_Missense_Mutation_p.R190C	NM_017659.3	NP_060129.2	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like	284					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(1)|lung(5)|skin(1)|stomach(1)	11		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		CCACTTCCCTCGCACGGTCCG	0.622																																					p.R284C		.											.	QPCTL	91	0			c.C850T						.						86.0	86.0	86.0					19																	46202122		2203	4300	6503	SO:0001583	missense	54814	exon5			TTCCCTCGCACGG	AK000091	CCDS12672.1, CCDS54282.1	19q13.32	2014-09-04			ENSG00000011478	ENSG00000011478			25952	protein-coding gene	gene with protein product	"""glutaminyl cyclase-like"""						Standard	NM_017659		Approved	FLJ20084	uc010xxr.2	Q9NXS2	OTTHUMG00000182131	ENST00000012049.5:c.850C>T	19.37:g.46202122C>T	ENSP00000012049:p.Arg284Cys	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	8.0	NM_017659	Q53HE4|Q96F74	Missense_Mutation	SNP	ENST00000012049.5	37	CCDS12672.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490634	0.64074	.	.	ENSG00000011478	ENST00000012049;ENST00000366382	T;T	0.22743	1.94;1.94	5.93	4.86	0.63082	Peptidase M28 (1);	0.465466	0.27172	N	0.020594	T	0.32675	0.0837	L	0.48642	1.525	0.42936	D	0.99433	D	0.65815	0.995	P	0.55577	0.779	T	0.01786	-1.1274	10	0.66056	D	0.02	-20.0088	14.3267	0.66526	0.1484:0.8516:0.0:0.0	.	284	Q9NXS2	QPCTL_HUMAN	C	284;190	ENSP00000012049:R284C;ENSP00000387944:R190C	ENSP00000012049:R284C	R	+	1	0	QPCTL	50893962	0.377000	0.25106	0.670000	0.29842	0.442000	0.32017	1.266000	0.33039	2.826000	0.97356	0.655000	0.94253	CGC	.		0.622	QPCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459656.1	NM_017659	
RAD51	5888	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	40993273	40993273	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr15:40993273A>G	ENST00000267868.3	+	3	367	c.99A>G	c.(97-99)atA>atG	p.I33M	RAD51_ENST00000423169.2_Missense_Mutation_p.I33M|RAD51_ENST00000557850.1_Missense_Mutation_p.I33M|RAD51_ENST00000532743.1_Missense_Mutation_p.I33M|RAD51_ENST00000382643.3_Missense_Mutation_p.I33M	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	33					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		AGTGTGGCATAAATGCCAACG	0.388								Homologous recombination																													p.I33M		.											.	RAD51	563	0			c.A99G						.						81.0	81.0	81.0					15																	40993273		2203	4300	6503	SO:0001583	missense	5888	exon3			TGGCATAAATGCC	D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.99A>G	15.37:g.40993273A>G	ENSP00000267868:p.Ile33Met	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	6.0	NM_001164270	B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Missense_Mutation	SNP	ENST00000267868.3	37	CCDS10062.1	.	.	.	.	.	.	.	.	.	.	A	18.38	3.611764	0.66558	.	.	ENSG00000051180	ENST00000527860;ENST00000423169;ENST00000382642;ENST00000267868;ENST00000532743;ENST00000382643;ENST00000526763	T;T;T;T;T;T	0.62364	0.37;0.03;0.45;0.58;0.58;0.37	5.74	1.78	0.24846	DNA repair Rad51/transcription factor NusA, alpha-helical (1);	0.082388	0.85682	D	0.000000	T	0.75503	0.3858	M	0.76727	2.345	0.58432	D	0.999999	D;D;P	0.63880	0.993;0.993;0.946	D;P;P	0.68039	0.955;0.821;0.736	T	0.78211	-0.2292	10	0.87932	D	0	-18.9911	13.1979	0.59749	0.6212:0.3788:0.0:0.0	.	33;33;33	Q06609-3;Q6ZNA8;Q06609	.;.;RAD51_HUMAN	M	33	ENSP00000432759:I33M;ENSP00000406602:I33M;ENSP00000267868:I33M;ENSP00000433924:I33M;ENSP00000372088:I33M;ENSP00000431897:I33M	ENSP00000267868:I33M	I	+	3	3	RAD51	38780565	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.895000	0.39778	0.480000	0.27534	-0.460000	0.05396	ATA	.		0.388	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252358.1	NM_002875, NM_133487	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	48953728	48953728	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:48953728A>G	ENST00000267163.4	+	14	1470		c.e14-1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GTTTGTTTGTAGCGATACAAA	0.333		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											.		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	3784	25	Whole gene deletion(15)|Unknown(10)	bone(11)|breast(5)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.1333-2A>G	GRCh37	CS030552	RB1	S		.						18.0	19.0	19.0					13																	48953728		2200	4299	6499	SO:0001630	splice_region_variant	5925	exon14	Familial Cancer Database		GTTTGTAGCGATA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1333-1A>G	13.37:g.48953728A>G		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	48.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	37	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605344	0.87157	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0294	0.80567	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47851729	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.469000	0.90395	2.185000	0.69588	0.455000	0.32223	.	.		0.333	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		Intron
RGS11	8786	ucsc.edu;bcgsc.ca	37	16	321559	321559	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:321559C>A	ENST00000397770.3	-	10	684	c.667G>T	c.(667-669)Gca>Tca	p.A223S	ARHGDIG_ENST00000464609.1_Intron|RGS11_ENST00000316163.5_Missense_Mutation_p.A202S|RGS11_ENST00000359740.5_Missense_Mutation_p.A212S			O94810	RGS11_HUMAN	regulator of G-protein signaling 11	223	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)	8		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				TGGAAATCTGCACTCTTGGTC	0.617																																					p.A223S		.											.	RGS11	227	0			c.G667T						.						104.0	101.0	102.0					16																	321559		2203	4300	6503	SO:0001583	missense	8786	exon10			AATCTGCACTCTT	AF035153	CCDS10403.1, CCDS42088.1, CCDS66884.1	16p13.3	2008-07-28	2007-08-14		ENSG00000076344	ENSG00000076344		"""Regulators of G-protein signaling"""	9993	protein-coding gene	gene with protein product		603895	"""regulator of G-protein signalling 11"""			9789084	Standard	NM_001286486		Approved		uc002cgj.1	O94810	OTTHUMG00000064893	ENST00000397770.3:c.667G>T	16.37:g.321559C>A	ENSP00000380876:p.Ala223Ser	Somatic	47.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_183337	O75883|Q4TT71|Q4TT72	Missense_Mutation	SNP	ENST00000397770.3	37	CCDS42088.1	.	.	.	.	.	.	.	.	.	.	C	4.343	0.063078	0.08388	.	.	ENSG00000076344	ENST00000397770;ENST00000316163;ENST00000359740	T;T;T	0.29917	1.55;1.55;1.55	4.93	-9.85	0.00476	G-protein gamma domain (3);	4.895910	0.00357	N	0.000022	T	0.11410	0.0278	N	0.15975	0.35	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.29488	-1.0010	10	0.07813	T	0.8	-20.8448	1.5061	0.02486	0.3198:0.2778:0.2724:0.13	.	212;223;223	O94810-2;Q4TT70;O94810	.;.;RGS11_HUMAN	S	223;202;212	ENSP00000380876:A223S;ENSP00000319069:A202S;ENSP00000352778:A212S	ENSP00000319069:A202S	A	-	1	0	RGS11	261560	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.602000	0.05680	-3.045000	0.00262	-0.538000	0.04264	GCA	.		0.617	RGS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139325.2		
RHPN1	114822	ucsc.edu;bcgsc.ca	37	8	144459602	144459602	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr8:144459602C>A	ENST00000289013.6	+	4	459	c.358C>A	c.(358-360)Ctg>Atg	p.L120M		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	120	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			GACCAAGGAGCTGGACTGGTC	0.587																																					p.L120M		.											.	RHPN1	67	0			c.C358A						.						76.0	83.0	81.0					8																	144459602		2032	4196	6228	SO:0001583	missense	114822	exon4			AAGGAGCTGGACT	AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.358C>A	8.37:g.144459602C>A	ENSP00000289013:p.Leu120Met	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_052924	Q8TAV1|Q96PV9	Missense_Mutation	SNP	ENST00000289013.6	37	CCDS47927.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144281	0.57044	.	.	ENSG00000158106	ENST00000289013	T	0.19250	2.16	4.22	1.89	0.25635	.	0.271754	0.32244	N	0.006367	T	0.39358	0.1075	M	0.71581	2.175	0.35188	D	0.773073	D	0.69078	0.997	D	0.67103	0.949	T	0.53344	-0.8452	10	0.72032	D	0.01	-14.1828	9.5944	0.39565	0.0:0.769:0.0:0.231	.	120	Q8TCX5-2	.	M	120	ENSP00000289013:L120M	ENSP00000289013:L120M	L	+	1	2	RHPN1	144530745	0.968000	0.33430	1.000000	0.80357	0.894000	0.52154	0.501000	0.22578	0.716000	0.32124	0.313000	0.20887	CTG	.		0.587	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381417.1		
RNF20	56254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104315030	104315030	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr9:104315030A>T	ENST00000389120.3	+	13	1986	c.1896A>T	c.(1894-1896)gaA>gaT	p.E632D	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	632					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TGAAGATTGAACTCAAGTAAG	0.363																																					p.E632D		.											.	RNF20	231	0			c.A1896T						.						52.0	55.0	54.0					9																	104315030		2203	4300	6503	SO:0001583	missense	56254	exon13			GATTGAACTCAAG	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1896A>T	9.37:g.104315030A>T	ENSP00000373772:p.Glu632Asp	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	222.0	56.0	NM_019592	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	37	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	A	13.48	2.248373	0.39797	.	.	ENSG00000155827	ENST00000389120	T	0.33865	1.39	6.17	-2.09	0.07232	.	0.043508	0.85682	D	0.000000	T	0.20536	0.0494	L	0.33485	1.01	0.58432	D	0.99999	B	0.26483	0.15	B	0.25405	0.06	T	0.03394	-1.1041	10	0.29301	T	0.29	-23.1248	6.8613	0.24067	0.3312:0.0:0.4641:0.2047	.	632	Q5VTR2	BRE1A_HUMAN	D	632	ENSP00000373772:E632D	ENSP00000373772:E632D	E	+	3	2	RNF20	103354851	0.669000	0.27502	0.998000	0.56505	0.762000	0.43233	-0.184000	0.09698	-0.027000	0.13873	0.533000	0.62120	GAA	.		0.363	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
RPS3	6188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	75110602	75110602	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:75110602A>G	ENST00000531188.1	+	1	73	c.11A>G	c.(10-12)cAa>cGa	p.Q4R	RPS3_ENST00000530164.1_Missense_Mutation_p.Q4R|RPS3_ENST00000278572.6_Missense_Mutation_p.Q4R|RPS3_ENST00000527446.1_Missense_Mutation_p.Q4R|RPS3_ENST00000526608.1_Missense_Mutation_p.Q4R|SNORD15A_ENST00000384214.1_RNA|RPS3_ENST00000534440.1_Missense_Mutation_p.Q4R|RPS3_ENST00000524851.1_Missense_Mutation_p.Q4R	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	4					cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						ATGGCAGTGCAAATATCCAAG	0.662																																					p.Q4R		.											.	RPS3	90	0			c.A11G						.						47.0	49.0	48.0					11																	75110602		2200	4293	6493	SO:0001583	missense	6188	exon1			CAGTGCAAATATC		CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.11A>G	11.37:g.75110602A>G	ENSP00000434643:p.Gln4Arg	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	31.0	NM_001256802	B2R7N5|J3KN86|Q498B5|Q8NI95	Missense_Mutation	SNP	ENST00000531188.1	37	CCDS8236.1	.	.	.	.	.	.	.	.	.	.	a	14.36	2.513561	0.44763	.	.	ENSG00000149273	ENST00000531188;ENST00000530164;ENST00000530689;ENST00000278572;ENST00000534440;ENST00000527446;ENST00000526608;ENST00000527273;ENST00000524851	.	.	.	5.74	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.60431	0.2268	M	0.62266	1.93	0.58432	D	0.999992	B	0.06786	0.001	B	0.27500	0.08	T	0.62905	-0.6755	9	0.72032	D	0.01	-1.5195	10.7726	0.46332	0.8411:0.1589:0.0:0.0	.	4	P23396	RS3_HUMAN	R	4	.	ENSP00000278572:Q4R	Q	+	2	0	RPS3	74788250	1.000000	0.71417	0.949000	0.38748	0.132000	0.20833	6.324000	0.72896	2.194000	0.70268	0.449000	0.29647	CAA	.		0.662	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2	NM_001005	
RSAD2	91543	ucsc.edu;bcgsc.ca	37	2	7033836	7033836	+	Splice_Site	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:7033836T>C	ENST00000382040.3	+	5	1057		c.e5+2		RSAD2_ENST00000541728.1_Splice_Site	NM_080657.4	NP_542388.2			radical S-adenosyl methionine domain containing 2											endometrium(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)	20	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		GATGAATATGTGAGTATTTCC	0.323																																					.		.											.	RSAD2	90	0			c.921+2T>C						.						97.0	99.0	98.0					2																	7033836		2202	4300	6502	SO:0001630	splice_region_variant	91543	exon5			AATATGTGAGTAT	AF442151	CCDS1656.1	2p25.2	2008-02-05			ENSG00000134321	ENSG00000134321			30908	protein-coding gene	gene with protein product		607810				11752458	Standard	NM_080657		Approved	cig5, viperin, vig1	uc002qyp.1	Q8WXG1	OTTHUMG00000090352	ENST00000382040.3:c.921+2T>C	2.37:g.7033836T>C		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	63.0	6.0	NM_080657		Splice_Site	SNP	ENST00000382040.3	37	CCDS1656.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.515353	0.85389	.	.	ENSG00000134321	ENST00000382040;ENST00000541728	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2988	0.82793	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RSAD2	6951287	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.520000	0.81821	2.311000	0.77944	0.533000	0.62120	.	.		0.323	RSAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206724.2	NM_080657	Intron
SCARA3	51435	ucsc.edu;bcgsc.ca	37	8	27516828	27516828	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr8:27516828G>C	ENST00000301904.3	+	5	1161	c.1141G>C	c.(1141-1143)Gtg>Ctg	p.V381L	SCARA3_ENST00000337221.4_Missense_Mutation_p.V381L	NM_016240.2	NP_057324.2	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3	381					receptor-mediated endocytosis (GO:0006898)|response to oxidative stress (GO:0006979)|UV protection (GO:0009650)	collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)			breast(1)|large_intestine(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	9		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)		CCTGGATGACGTGCGGCTCTC	0.562																																					p.V381L		.											.	SCARA3	228	0			c.G1141C						.						148.0	112.0	124.0					8																	27516828		2203	4300	6503	SO:0001583	missense	51435	exon5			GATGACGTGCGGC	AB007829	CCDS34870.1, CCDS34871.1	8p21	2010-03-24			ENSG00000168077	ENSG00000168077			19000	protein-coding gene	gene with protein product	"""macrophage scavenger receptor-like 1"""	602728				9747040, 9580669	Standard	NM_182826		Approved	CSR1, CSR, MSLR1, APC7, MSRL1	uc003xga.1	Q6AZY7	OTTHUMG00000163898	ENST00000301904.3:c.1141G>C	8.37:g.27516828G>C	ENSP00000301904:p.Val381Leu	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_182826	Q9UM15|Q9UM16	Missense_Mutation	SNP	ENST00000301904.3	37	CCDS34871.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684694	0.68157	.	.	ENSG00000168077	ENST00000337221;ENST00000301904	D;D	0.97186	-4.28;-4.28	5.93	5.93	0.95920	.	0.056062	0.64402	D	0.000001	D	0.96241	0.8774	L	0.27053	0.805	0.48762	D	0.999705	D;D	0.63880	0.992;0.993	P;P	0.58172	0.834;0.753	D	0.94751	0.7927	10	0.23302	T	0.38	-27.1872	17.8477	0.88736	0.0:0.0:1.0:0.0	.	381;381	Q6AZY7-2;Q6AZY7	.;SCAR3_HUMAN	L	381	ENSP00000337985:V381L;ENSP00000301904:V381L	ENSP00000301904:V381L	V	+	1	0	SCARA3	27572747	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	9.333000	0.96459	2.826000	0.97356	0.655000	0.94253	GTG	.		0.562	SCARA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376258.2	NM_016240	
SCN3B	55800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123513234	123513234	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr11:123513234A>T	ENST00000392770.2	-	3	1167	c.365T>A	c.(364-366)gTg>gAg	p.V122E	SCN3B_ENST00000299333.3_Missense_Mutation_p.V122E|SCN3B_ENST00000530277.1_Missense_Mutation_p.V122E	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	122	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCCCGGGACACATTGCAGGT	0.602																																					p.V122E		.											.	SCN3B	156	0			c.T365A						.						104.0	96.0	99.0					11																	123513234		2202	4299	6501	SO:0001583	missense	55800	exon3			CGGGACACATTGC	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.365T>A	11.37:g.123513234A>T	ENSP00000376523:p.Val122Glu	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	18.0	NM_018400	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	ENST00000392770.2	37	CCDS8442.1	.	.	.	.	.	.	.	.	.	.	A	32	5.160704	0.94727	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836	D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.110193	0.64402	D	0.000008	D	0.97430	0.9159	M	0.79805	2.47	0.80722	D	1	D	0.63046	0.992	P	0.62089	0.898	D	0.97985	1.0351	10	0.87932	D	0	-9.7242	16.5655	0.84588	1.0:0.0:0.0:0.0	.	122	Q9NY72	SCN3B_HUMAN	E	122	ENSP00000376523:V122E;ENSP00000299333:V122E;ENSP00000432785:V122E;ENSP00000435554:V122E	ENSP00000299333:V122E	V	-	2	0	SCN3B	123018444	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.285000	0.89914	2.302000	0.77476	0.533000	0.62120	GTG	.		0.602	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	NM_018400	
SEC23A	10484	ucsc.edu;bcgsc.ca	37	14	39555106	39555106	+	Silent	SNP	A	A	G	rs531405804		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:39555106A>G	ENST00000307712.6	-	7	1205	c.688T>C	c.(688-690)Tta>Cta	p.L230L	SEC23A_ENST00000545328.2_Silent_p.L201L|SEC23A_ENST00000537403.1_Silent_p.L28L|SEC23A_ENST00000536508.1_Silent_p.L104L	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	230					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		ACTGGTTGTAAGAATCTAAGA	0.373																																					p.L230L		.											.	SEC23A	95	0			c.T688C						.						100.0	109.0	106.0					14																	39555106		2203	4300	6503	SO:0001819	synonymous_variant	10484	exon7			GTTGTAAGAATCT	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.688T>C	14.37:g.39555106A>G		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_006364	B2R5P4|B3KXI2|Q8NE16	Silent	SNP	ENST00000307712.6	37	CCDS9668.1																																																																																			.		0.373	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
SELL	6402	broad.mit.edu;bcgsc.ca	37	1	169672458	169672458	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:169672458C>A	ENST00000236147.4	-	6	1089	c.929G>T	c.(928-930)gGg>gTg	p.G310V	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	297	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					TTTCTTCTTCCCAATTAACTC	0.428																																					p.G310V		.											.	SELL	90	0			c.G929T						.						93.0	84.0	87.0					1																	169672458		1879	4121	6000	SO:0001583	missense	6402	exon6			TTCTTCCCAATTA	M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.929G>T	1.37:g.169672458C>A	ENSP00000236147:p.Gly310Val	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	225.0	14.0	NM_000655	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	ENST00000236147.4	37	CCDS53427.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.567038	0.45694	.	.	ENSG00000188404	ENST00000236147	T	0.73258	-0.73	4.71	4.71	0.59529	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.53938	D	0.000054	D	0.89619	0.6767	H	0.98883	4.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93173	0.6568	10	0.87932	D	0	-29.0906	15.5447	0.76090	0.0:1.0:0.0:0.0	.	310;297	Q8WW79;P14151	.;LYAM1_HUMAN	V	310	ENSP00000236147:G310V	ENSP00000236147:G310V	G	-	2	0	SELL	167939082	0.961000	0.32948	0.126000	0.21872	0.030000	0.12068	4.358000	0.59442	2.602000	0.87976	0.650000	0.86243	GGG	.		0.428	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084233.1	NM_000655	
SERPINF1	5176	ucsc.edu;bcgsc.ca	37	17	1675351	1675351	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:1675351G>T	ENST00000254722.4	+	5	788	c.625G>T	c.(625-627)Ggt>Tgt	p.G209C		NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	209					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						TCTCCTTCTCGGTGTGGCGCA	0.448																																					p.G209C		.											.	SERPINF1	227	0			c.G625T						.						115.0	108.0	110.0					17																	1675351		2203	4300	6503	SO:0001583	missense	5176	exon5			CTTCTCGGTGTGG	M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.625G>T	17.37:g.1675351G>T	ENSP00000254722:p.Gly209Cys	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_002615	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Missense_Mutation	SNP	ENST00000254722.4	37	CCDS11012.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528395	0.27299	.	.	ENSG00000132386	ENST00000254722	D	0.84442	-1.85	5.79	3.61	0.41365	Serpin domain (3);	0.138368	0.64402	D	0.000004	D	0.90587	0.7049	L	0.56769	1.78	0.18873	N	0.999988	D	0.89917	1.0	D	0.83275	0.996	D	0.84953	0.0872	10	0.72032	D	0.01	.	16.6422	0.85129	0.0:0.0:0.7529:0.2471	.	209	P36955	PEDF_HUMAN	C	209	ENSP00000254722:G209C	ENSP00000254722:G209C	G	+	1	0	SERPINF1	1622101	0.994000	0.37717	0.172000	0.22920	0.049000	0.14656	2.417000	0.44653	1.441000	0.47550	0.561000	0.74099	GGT	.		0.448	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207109.4	NM_002615	
SFRP4	6424	broad.mit.edu;bcgsc.ca	37	7	37955917	37955917	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:37955917A>G	ENST00000436072.2	-	1	600	c.223T>C	c.(223-225)Ttc>Ctc	p.F75L	EPDR1_ENST00000476620.1_Intron	NM_003014.3	NP_003005.2	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related protein 4	75	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|cell differentiation (GO:0030154)|decidualization (GO:0046697)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|menstrual cycle phase (GO:0022601)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of sodium-dependent phosphate transport (GO:2000119)|phosphate ion homeostasis (GO:0055062)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of receptor internalization (GO:0002092)|response to hormone (GO:0009725)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						CAGAGGAAGAAGCGCAGCACG	0.632																																					p.F75L		.											.	SFRP4	658	0			c.T223C						.						145.0	115.0	126.0					7																	37955917		2203	4300	6503	SO:0001583	missense	6424	exon1			GGAAGAAGCGCAG	AF026692	CCDS5453.1	7p14.1	2008-07-18			ENSG00000106483	ENSG00000106483		"""Secreted frizzled-related proteins"""	10778	protein-coding gene	gene with protein product		606570				10211996	Standard	NM_003014		Approved	frpHE, FRP-4, FRPHE	uc003tfo.4	Q6FHJ7	OTTHUMG00000023026	ENST00000436072.2:c.223T>C	7.37:g.37955917A>G	ENSP00000410715:p.Phe75Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	6.0	NM_003014	B4DYC1|O14877|Q05BG7|Q1ZYW2|Q4G124|Q6FHM0|Q6PD64	Missense_Mutation	SNP	ENST00000436072.2	37	CCDS5453.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.745250	0.89663	.	.	ENSG00000106483	ENST00000436072	T	0.78816	-1.21	4.36	4.36	0.52297	Frizzled domain (5);	0.000000	0.85682	D	0.000000	T	0.81019	0.4736	L	0.38692	1.165	0.44073	D	0.996827	D	0.65815	0.995	D	0.67231	0.95	T	0.81724	-0.0802	10	0.51188	T	0.08	.	12.6605	0.56811	1.0:0.0:0.0:0.0	.	75	Q6FHJ7	SFRP4_HUMAN	L	75	ENSP00000410715:F75L	ENSP00000410715:F75L	F	-	1	0	SFRP4	37922442	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	8.924000	0.92827	1.825000	0.53177	0.528000	0.53228	TTC	.		0.632	SFRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220017.2	NM_003014	
SIGLEC8	27181	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51957481	51957481	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:51957481C>A	ENST00000321424.3	-	6	1303	c.1237G>T	c.(1237-1239)Gcc>Tcc	p.A413S	SIGLEC8_ENST00000430817.1_Missense_Mutation_p.A304S|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.A320S|SIGLEC8_ENST00000597352.1_5'Flank	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	413					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		ACCTGAGAGGCCGAGCCCCTG	0.597																																					p.A413S		.											.	SIGLEC8	94	0			c.G1237T						.						103.0	90.0	95.0					19																	51957481		2203	4300	6503	SO:0001583	missense	27181	exon6			GAGAGGCCGAGCC	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.1237G>T	19.37:g.51957481C>A	ENSP00000321077:p.Ala413Ser	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	16.0	NM_014442	Q7Z728	Missense_Mutation	SNP	ENST00000321424.3	37	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	10.04	1.241456	0.22711	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.63255	1.32;-0.03;1.07	1.91	-3.51	0.04696	.	.	.	.	.	T	0.44829	0.1312	L	0.49126	1.545	0.09310	N	1	P;B;B	0.49961	0.93;0.291;0.373	B;B;B	0.41236	0.351;0.099;0.085	T	0.41431	-0.9509	9	0.16896	T	0.51	.	3.0325	0.06111	0.2332:0.5079:0.0:0.2589	.	304;320;413	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	S	304;413;320	ENSP00000389142:A304S;ENSP00000321077:A413S;ENSP00000339448:A320S	ENSP00000321077:A413S	A	-	1	0	SIGLEC8	56649293	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.854000	0.04299	-0.784000	0.04528	0.502000	0.49764	GCC	.		0.597	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
SLC18A1	6570	ucsc.edu;bcgsc.ca	37	8	20036702	20036702	+	Missense_Mutation	SNP	C	C	A	rs17215808	byFrequency	TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr8:20036702C>A	ENST00000276373.5	-	3	684	c.418G>T	c.(418-420)Ggg>Tgg	p.G140W	SLC18A1_ENST00000437980.1_Missense_Mutation_p.G140W|SLC18A1_ENST00000519026.1_Missense_Mutation_p.G140W|SLC18A1_ENST00000440926.1_Missense_Mutation_p.G140W|SLC18A1_ENST00000265808.7_Missense_Mutation_p.G140W|SLC18A1_ENST00000381608.4_Missense_Mutation_p.G140W	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	140			G -> R (in dbSNP:rs17215808).		monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	AACAGAACCCCGACCCGGGTA	0.552																																					p.G140W		.											.	SLC18A1	92	0			c.G418T						.						86.0	84.0	84.0					8																	20036702		2203	4300	6503	SO:0001583	missense	6570	exon4			GAACCCCGACCCG		CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.418G>T	8.37:g.20036702C>A	ENSP00000276373:p.Gly140Trp	Somatic	65.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001142324	E9PDJ5|Q9BRE4	Missense_Mutation	SNP	ENST00000276373.5	37	CCDS6013.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.161787	0.57368	.	.	ENSG00000036565	ENST00000265808;ENST00000276373;ENST00000440926;ENST00000437980;ENST00000519026;ENST00000381608;ENST00000522513	T;T;T;T;T;T;D	0.86097	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-2.07	5.95	5.95	0.96441	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.94781	0.8315	H	0.94345	3.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95572	0.8639	10	0.87932	D	0	-17.275	17.887	0.88858	0.0:1.0:0.0:0.0	.	140;140;140	E9PB33;E9PDJ5;P54219	.;.;VMAT1_HUMAN	W	140	ENSP00000265808:G140W;ENSP00000276373:G140W;ENSP00000387549:G140W;ENSP00000413361:G140W;ENSP00000429664:G140W;ENSP00000371021:G140W;ENSP00000428999:G140W	ENSP00000265808:G140W	G	-	1	0	SLC18A1	20080982	1.000000	0.71417	0.204000	0.23530	0.093000	0.18481	7.030000	0.76484	2.824000	0.97209	0.655000	0.94253	GGG	C|0.998;T|0.002		0.552	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1		
SLC38A7	55238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	58706093	58706093	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:58706093G>T	ENST00000570101.1	-	8	1821	c.938C>A	c.(937-939)tCc>tAc	p.S313Y	SLC38A7_ENST00000564010.1_Missense_Mutation_p.S224Y|SLC38A7_ENST00000566953.1_5'UTR|SLC38A7_ENST00000219320.4_Missense_Mutation_p.S313Y|SLC38A7_ENST00000564100.1_Intron			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	313					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						CGAGGGATAGGACAGGAGCAC	0.622																																					p.S313Y		.											.	SLC38A7	69	0			c.C938A						.						50.0	40.0	43.0					16																	58706093		2187	4289	6476	SO:0001583	missense	55238	exon9			GGATAGGACAGGA	BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.938C>A	16.37:g.58706093G>T	ENSP00000454646:p.Ser313Tyr	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	26.0	NM_018231	Q53GJ9|Q9H9I5	Missense_Mutation	SNP	ENST00000570101.1	37	CCDS10800.1	.	.	.	.	.	.	.	.	.	.	G	32	5.151293	0.94645	.	.	ENSG00000103042	ENST00000219320	T	0.02812	4.15	5.36	5.36	0.76844	.	0.110975	0.64402	D	0.000004	T	0.16428	0.0395	M	0.77313	2.365	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.00215	-1.1911	9	.	.	.	.	18.0759	0.89427	0.0:0.0:1.0:0.0	.	313	Q9NVC3	S38A7_HUMAN	Y	313	ENSP00000219320:S313Y	.	S	-	2	0	SLC38A7	57263594	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.360000	0.97119	2.497000	0.84241	0.591000	0.81541	TCC	.		0.622	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422206.2	NM_018231	
SLC41A3	54946	broad.mit.edu;bcgsc.ca	37	3	125786988	125786988	+	Silent	SNP	G	G	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:125786988G>C	ENST00000315891.6	-	2	313	c.75C>G	c.(73-75)ccC>ccG	p.P25P	AC117422.1_ENST00000581281.1_RNA|SLC41A3_ENST00000346785.5_Silent_p.P25P|SLC41A3_ENST00000360370.4_Silent_p.P25P|SLC41A3_ENST00000508835.1_Intron|SLC41A3_ENST00000514023.1_5'UTR	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		CTGTGCTGAGGGGGTGAGGAA	0.657																																					p.P25P		.											.	SLC41A3	90	0			c.C75G						.						64.0	63.0	64.0					3																	125786988		2203	4300	6503	SO:0001819	synonymous_variant	54946	exon2			GCTGAGGGGGTGA		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.75C>G	3.37:g.125786988G>C		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	5.0	NM_001008486	A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Silent	SNP	ENST00000315891.6	37	CCDS33843.1																																																																																			.		0.657	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370886.1	NM_017836	
SNCAIP	9627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	121767681	121767681	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:121767681C>T	ENST00000261368.8	+	6	1462	c.1200C>T	c.(1198-1200)tgC>tgT	p.C400C	SNCAIP_ENST00000379536.2_Silent_p.C340C|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000503116.2_Silent_p.C447C|SNCAIP_ENST00000542191.1_5'UTR|SNCAIP_ENST00000261367.7_Silent_p.C447C|SNCAIP_ENST00000504884.2_3'UTR|SNCAIP_ENST00000379538.3_Silent_p.C34C|SNCAIP_ENST00000379533.2_Silent_p.C447C	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	400					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		AGTTGGAGTGCGTACGCTGGA	0.403																																					p.C400C		.											.	SNCAIP	92	0			c.C1200T						.						112.0	99.0	103.0					5																	121767681		2203	4300	6503	SO:0001819	synonymous_variant	9627	exon6			GGAGTGCGTACGC	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1200C>T	5.37:g.121767681C>T		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	37.0	NM_005460	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Silent	SNP	ENST00000261368.8	37	CCDS4131.1																																																																																			.		0.403	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
SNRPB	6628	ucsc.edu;bcgsc.ca	37	20	2443362	2443362	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr20:2443362G>T	ENST00000438552.2	-	6	767	c.605C>A	c.(604-606)cCa>cAa	p.P202Q	SNORD119_ENST00000515997.1_RNA|SNRPB_ENST00000381342.2_Missense_Mutation_p.P202Q|SNRPB_ENST00000339610.6_Missense_Mutation_p.P123Q	NM_198216.1	NP_937859.1	P14678	RSMB_HUMAN	small nuclear ribonucleoprotein polypeptides B and B1	202	Repeat-rich region.				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	10						GATCCCCATTGGGGGACCCAT	0.582																																					p.P202Q		.											.	SNRPB	227	0			c.C605A						.						36.0	41.0	39.0					20																	2443362		2197	4282	6479	SO:0001583	missense	6628	exon6			CCCATTGGGGGAC		CCDS13026.1, CCDS13027.1	20p13	2011-10-11			ENSG00000125835	ENSG00000125835			11153	protein-coding gene	gene with protein product		182282		SNRPB1		1376292	Standard	NM_003091		Approved	COD, SmB/SmB', Sm-B/B', snRNP-B	uc002wfz.1	P14678	OTTHUMG00000031694	ENST00000438552.2:c.605C>A	20.37:g.2443362G>T	ENSP00000412566:p.Pro202Gln	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_003091	Q15490|Q6IB35|Q9UIS5	Missense_Mutation	SNP	ENST00000438552.2	37	CCDS13026.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210858	0.58343	.	.	ENSG00000125835	ENST00000381342;ENST00000438552;ENST00000303103;ENST00000339610	T;T	0.56776	0.63;0.44	5.86	5.86	0.93980	.	0.047906	0.85682	D	0.000000	T	0.70298	0.3208	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.71674	0.994;0.998;0.998;0.998	D;D;D;D	0.76071	0.987;0.987;0.987;0.987	T	0.71331	-0.4625	10	0.87932	D	0	.	17.6803	0.88241	0.0:0.0:1.0:0.0	.	123;202;202;202	A8MT02;B4DVS0;Q66K91;P14678	.;.;.;RSMB_HUMAN	Q	202;202;202;123	ENSP00000370746:P202Q;ENSP00000412566:P202Q	ENSP00000303591:P202Q	P	-	2	0	SNRPB	2391362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.441000	0.97557	2.775000	0.95449	0.655000	0.94253	CCA	.		0.582	SNRPB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077585.2		
SPATA20	64847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48629417	48629417	+	Silent	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:48629417G>A	ENST00000356488.4	+	13	1868	c.1785G>A	c.(1783-1785)gcG>gcA	p.A595A	SPATA20_ENST00000006658.6_Silent_p.A611A|SPATA20_ENST00000393244.3_Silent_p.A551A|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	595					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGGAGAGTGCGTGGCTCGAGT	0.657																																					p.A611A		.											.	SPATA20	90	0			c.G1833A						.						31.0	35.0	33.0					17																	48629417		2202	4299	6501	SO:0001819	synonymous_variant	64847	exon14			GAGTGCGTGGCTC		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1785G>A	17.37:g.48629417G>A		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	20.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	37	CCDS58563.1																																																																																			.		0.657	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
SRCAP	10847	ucsc.edu;bcgsc.ca	37	16	30750595	30750595	+	Silent	SNP	A	A	G	rs541111114		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:30750595A>G	ENST00000262518.4	+	34	9619	c.9234A>G	c.(9232-9234)ggA>ggG	p.G3078G	SRCAP_ENST00000395059.2_Silent_p.G3016G|RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000344771.4_Silent_p.G2920G	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	3078					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GAATGCGAGGACGGAAGAGTG	0.602													A|||	1	0.000199681	0.0	0.0014	5008	,	,		15830	0.0		0.0	False		,,,				2504	0.0				p.G3078G		.											.	SRCAP	94	0			c.A9234G						.						68.0	64.0	65.0					16																	30750595		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon34			GCGAGGACGGAAG	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.9234A>G	16.37:g.30750595A>G		Somatic	52.0	1.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SREK1	140890	ucsc.edu;bcgsc.ca	37	5	65440291	65440291	+	5'Flank	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr5:65440291G>T	ENST00000380918.3	+	0	0				SREK1_ENST00000334121.6_Silent_p.A29A|AC025442.3_ENST00000521596.1_RNA	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TGTCGTCGGCGGTGACCAGCG	0.632																																					p.A29A	GBM(10;31 347 27684 38976 41583)	.											.	SREK1	91	0			c.G87T						.						20.0	28.0	25.0					5																	65440291		1832	3999	5831	SO:0001631	upstream_gene_variant	140890	exon1			GTCGGCGGTGACC	AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809		5.37:g.65440291G>T	Exception_encountered	Somatic	31.0	0.0		WXS	Illumina HiSeq	.	32.0	5.0	NM_001270493	A4FTW3|Q2M1J0|Q86X37	Silent	SNP	ENST00000380918.3	37	CCDS3991.1																																																																																			.		0.632	SREK1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381118.1	NM_001077199	
SYCE1L	100130958	ucsc.edu;bcgsc.ca	37	16	77242387	77242387	+	Silent	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr16:77242387G>T	ENST00000378644.4	+	4	262	c.207G>T	c.(205-207)ctG>ctT	p.L69L	RP11-538I12.2_ENST00000569032.1_RNA	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	69					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)				breast(1)|prostate(1)	2						GTGAGGAACTGAGAGAGACCC	0.493																																					p.L69L		.											.	.	.	0			c.G207T						.						108.0	108.0	108.0					16																	77242387		692	1591	2283	SO:0001819	synonymous_variant	100130958	exon4			GGAACTGAGAGAG		CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.207G>T	16.37:g.77242387G>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_001129979	A6NF23	Silent	SNP	ENST00000378644.4	37	CCDS45533.1																																																																																			.		0.493	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433889.1	NM_001129979	
SYCP1	6847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	115401205	115401205	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr1:115401205A>G	ENST00000369522.3	+	6	569	c.329A>G	c.(328-330)tAt>tGt	p.Y110C	SYCP1_ENST00000369518.1_Missense_Mutation_p.Y110C	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	110					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAAAACTGTATAAGGAGGCT	0.308																																					p.Y110C		.											.	SYCP1	91	0			c.A329G						.						66.0	70.0	68.0					1																	115401205		2203	4299	6502	SO:0001583	missense	6847	exon6			AACTGTATAAGGA	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.329A>G	1.37:g.115401205A>G	ENSP00000358535:p.Tyr110Cys	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	204.0	88.0	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	CCDS879.1	.	.	.	.	.	.	.	.	.	.	A	10.99	1.508092	0.27036	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.58210	0.35;0.35;0.35	5.05	3.92	0.45320	.	0.273076	0.37095	N	0.002259	T	0.55862	0.1947	M	0.62723	1.935	0.34251	D	0.678766	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.60073	-0.7334	10	0.42905	T	0.14	-3.66	11.0156	0.47687	0.8602:0.0:0.0:0.1397	.	110;110	B7ZLS9;Q15431	.;SYCP1_HUMAN	C	110	ENSP00000358535:Y110C;ENSP00000410011:Y110C;ENSP00000358531:Y110C	ENSP00000358531:Y110C	Y	+	2	0	SYCP1	115202728	1.000000	0.71417	0.965000	0.40720	0.064000	0.16182	5.029000	0.64121	0.776000	0.33473	-0.377000	0.06932	TAT	.		0.308	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
TAX1BP1	8887	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	27831697	27831697	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:27831697G>A	ENST00000396319.2	+	9	1199	c.1111G>A	c.(1111-1113)Gtc>Atc	p.V371I	TAX1BP1_ENST00000433216.2_Missense_Mutation_p.V214I|TAX1BP1_ENST00000265393.6_Missense_Mutation_p.V371I|TAX1BP1_ENST00000543117.1_Missense_Mutation_p.V371I|TAX1BP1_ENST00000409980.1_Missense_Mutation_p.V371I	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	371	Oligomerization.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)			breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			GCAAGAAGTTGTCTTTCTGGC	0.418																																					p.V371I		.											.	TAX1BP1	153	0			c.G1111A						.						111.0	102.0	105.0					7																	27831697		2203	4300	6503	SO:0001583	missense	8887	exon9			GAAGTTGTCTTTC	U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1111G>A	7.37:g.27831697G>A	ENSP00000379612:p.Val371Ile	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	10.0	NM_006024	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Missense_Mutation	SNP	ENST00000396319.2	37	CCDS5415.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838833	0.32513	.	.	ENSG00000106052	ENST00000543117;ENST00000265393;ENST00000409980;ENST00000433216;ENST00000396319	T;T;T;T;T	0.09445	2.98;2.98;2.98;2.98;2.98	6.05	2.1	0.27182	.	0.191163	0.28236	N	0.016081	T	0.05960	0.0155	L	0.29908	0.895	0.19775	N	0.999953	B;B;B	0.14438	0.01;0.003;0.0	B;B;B	0.18871	0.023;0.008;0.005	T	0.37502	-0.9703	10	0.18276	T	0.48	-1.05	2.3459	0.04271	0.2013:0.2287:0.451:0.1189	.	214;371;371	E7ENV2;Q86VP1;Q86VP1-2	.;TAXB1_HUMAN;.	I	371;371;371;214;371	ENSP00000444811:V371I;ENSP00000265393:V371I;ENSP00000386515:V371I;ENSP00000391907:V214I;ENSP00000379612:V371I	ENSP00000265393:V371I	V	+	1	0	TAX1BP1	27798222	0.973000	0.33851	1.000000	0.80357	0.945000	0.59286	0.481000	0.22260	0.436000	0.26393	-0.145000	0.13849	GTC	.		0.418	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214142.1	NM_006024	
THBS1	7057	ucsc.edu;bcgsc.ca	37	15	39876571	39876571	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr15:39876571A>T	ENST00000260356.5	+	6	1139	c.974A>T	c.(973-975)tAc>tTc	p.Y325F		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	325	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		GGAGTTCAGTACAGAAATAAC	0.468																																					p.Y325F		.											.	THBS1	653	0			c.A974T						.						111.0	111.0	111.0					15																	39876571		2200	4297	6497	SO:0001583	missense	7057	exon6			TTCAGTACAGAAA		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.974A>T	15.37:g.39876571A>T	ENSP00000260356:p.Tyr325Phe	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	37	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	A	10.43	1.348374	0.24426	.	.	ENSG00000137801	ENST00000260356	T	0.75050	-0.9	5.88	5.88	0.94601	von Willebrand factor, type C (3);	0.000000	0.32852	N	0.005571	T	0.70561	0.3238	L	0.58428	1.81	0.36055	D	0.841068	P	0.35821	0.523	B	0.40199	0.322	T	0.70360	-0.4893	10	0.02654	T	1	-38.4244	15.4523	0.75282	1.0:0.0:0.0:0.0	.	325	P07996	TSP1_HUMAN	F	325	ENSP00000260356:Y325F	ENSP00000260356:Y325F	Y	+	2	0	THBS1	37663863	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.255000	0.65462	2.247000	0.74100	0.533000	0.62120	TAC	.		0.468	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
THSD7A	221981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	11485864	11485864	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr7:11485864G>T	ENST00000423059.4	-	13	3139	c.2888C>A	c.(2887-2889)gCa>gAa	p.A963E	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	963	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CACAGGTTGTGCATTATATTT	0.398										HNSCC(18;0.044)																											p.A963E		.											.	THSD7A	71	0			c.C2888A						.						213.0	199.0	203.0					7																	11485864		1872	4119	5991	SO:0001583	missense	221981	exon13			GGTTGTGCATTAT		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2888C>A	7.37:g.11485864G>T	ENSP00000406482:p.Ala963Glu	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	54.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680427	0.88542	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59083	0.29	5.74	4.87	0.63330	.	0.045699	0.85682	D	0.000000	T	0.65913	0.2737	L	0.47716	1.5	0.80722	D	1	D	0.63046	0.992	P	0.61477	0.889	T	0.63102	-0.6712	10	0.29301	T	0.29	.	14.6117	0.68519	0.0698:0.0:0.9302:0.0	.	963	Q9UPZ6	THS7A_HUMAN	E	963	ENSP00000406482:A963E	ENSP00000262042:A963E	A	-	2	0	THSD7A	11452389	1.000000	0.71417	0.867000	0.34043	0.981000	0.71138	8.018000	0.88722	1.434000	0.47414	0.591000	0.81541	GCA	.		0.398	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
TLR8	51311	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	12937428	12937428	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chrX:12937428C>G	ENST00000218032.6	+	2	356	c.269C>G	c.(268-270)aCt>aGt	p.T90S	TLR8_ENST00000311912.5_Missense_Mutation_p.T108S	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	90					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	CAAAATCTCACTAAAATAAAT	0.418																																					p.T90S		.											.	TLR8	629	0			c.C269G						.						113.0	113.0	113.0					X																	12937428		2203	4300	6503	SO:0001583	missense	51311	exon2			ATCTCACTAAAAT	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.269C>G	X.37:g.12937428C>G	ENSP00000218032:p.Thr90Ser	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	49.0	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615897	0.46631	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.57107	0.42;0.42	5.2	3.41	0.39046	.	0.199084	0.25388	N	0.031036	T	0.57446	0.2054	L	0.45051	1.395	0.09310	N	1	D;D	0.67145	0.982;0.996	P;D	0.66979	0.823;0.948	T	0.47749	-0.9093	10	0.59425	D	0.04	.	4.9567	0.14044	0.1425:0.5564:0.0:0.301	.	90;108	Q9NR97;D1CS70	TLR8_HUMAN;.	S	90;108	ENSP00000218032:T90S;ENSP00000312082:T108S	ENSP00000218032:T90S	T	+	2	0	TLR8	12847349	0.094000	0.21725	0.002000	0.10522	0.908000	0.53690	0.887000	0.28254	0.418000	0.25898	0.523000	0.50628	ACT	.		0.418	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
TMEM106A	113277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41368750	41368750	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:41368750A>C	ENST00000331615.3	+	7	842	c.605A>C	c.(604-606)gAa>gCa	p.E202A	LINC00854_ENST00000593624.1_RNA|TMEM106A_ENST00000541594.1_Missense_Mutation_p.E154A|TMEM106A_ENST00000536052.1_Missense_Mutation_p.E155A|LINC00854_ENST00000595400.1_RNA|LINC00854_ENST00000427995.1_RNA|TMEM106A_ENST00000588659.1_Missense_Mutation_p.E202A	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	202						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		ATACGGGATGAAAACACATAG	0.498																																					p.E202A		.											.	.	.	0			c.A605C						.						256.0	220.0	233.0					17																	41368750		2203	4296	6499	SO:0001583	missense	113277	exon7			GGGATGAAAACAC	AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.605A>C	17.37:g.41368750A>C	ENSP00000330774:p.Glu202Ala	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	19.0	NM_145041	A8K2X2|B7Z698	Missense_Mutation	SNP	ENST00000331615.3	37	CCDS11462.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.825993	0.50739	.	.	ENSG00000184988	ENST00000331615;ENST00000536052;ENST00000541594	T;T;T	0.24350	1.86;1.86;1.86	5.07	3.99	0.46301	.	0.694941	0.14548	N	0.312806	T	0.41073	0.1143	M	0.80982	2.52	0.31795	N	0.629097	P;P;P	0.51449	0.945;0.818;0.945	P;B;P	0.52672	0.706;0.3;0.706	T	0.50955	-0.8766	10	0.44086	T	0.13	13.3063	8.2242	0.31560	0.9073:0.0:0.0927:0.0	.	155;154;202	B7Z779;B7Z698;Q96A25	.;.;T106A_HUMAN	A	202;155;154	ENSP00000330774:E202A;ENSP00000439835:E155A;ENSP00000439844:E154A	ENSP00000330774:E202A	E	+	2	0	TMEM106A	38724276	0.998000	0.40836	1.000000	0.80357	0.972000	0.66771	2.384000	0.44362	2.028000	0.59812	0.533000	0.62120	GAA	.		0.498	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453470.2	NM_145041	
TMEM55B	90809	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20926842	20926842	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:20926842G>A	ENST00000250489.4	-	7	996	c.710C>T	c.(709-711)gCa>gTa	p.A237V	TMEM55B_ENST00000554028.1_Missense_Mutation_p.A70V|TMEM55B_ENST00000398020.4_Missense_Mutation_p.A244V			Q86T03	TM55B_HUMAN	transmembrane protein 55B	237						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			endometrium(3)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	11	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)		ATATCGCCGTGCATGCTTCCA	0.488																																					p.A244V		.											.	TMEM55B	90	0			c.C731T						.						85.0	72.0	77.0					14																	20926842		2203	4300	6503	SO:0001583	missense	90809	exon7			CGCCGTGCATGCT	BC002867	CCDS9551.1, CCDS41911.1	14q11.1	2002-11-27	2005-07-18	2005-07-18	ENSG00000165782	ENSG00000165782			19299	protein-coding gene	gene with protein product		609865	"""chromosome 14 open reading frame 9"""	C14orf9			Standard	NM_144568		Approved	MGC26684	uc001vxk.2	Q86T03	OTTHUMG00000029545	ENST00000250489.4:c.710C>T	14.37:g.20926842G>A	ENSP00000250489:p.Ala237Val	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	16.0	NM_001100814	B2RA35|Q86U09|Q8WUC0|Q9BU67|Q9NSU8	Missense_Mutation	SNP	ENST00000250489.4	37	CCDS9551.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026549	0.93518	.	.	ENSG00000165782	ENST00000250489;ENST00000398020;ENST00000554028	T	0.77098	-1.07	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.84079	0.5393	L	0.51422	1.61	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.67103	0.949;0.915	T	0.82746	-0.0305	10	0.37606	T	0.19	-5.1952	17.2147	0.86940	0.0:0.0:1.0:0.0	.	237;244	Q86T03;Q86T03-2	TM55B_HUMAN;.	V	237;244;70	ENSP00000451350:A70V	ENSP00000250489:A237V	A	-	2	0	TMEM55B	19996682	1.000000	0.71417	0.982000	0.44146	0.998000	0.95712	8.555000	0.90693	2.600000	0.87896	0.563000	0.77884	GCA	.		0.488	TMEM55B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000073643.3	NM_144568	
TNFRSF6B	8771	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	62329759	62329759	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr20:62329759G>A	ENST00000369996.1	+	3	846	c.746G>A	c.(745-747)gGc>gAc	p.G249D	RTEL1-TNFRSF6B_ENST00000482936.1_3'UTR|ARFRP1_ENST00000485858.1_5'Flank	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	249					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			CCAAGGGCGGGCCGCGCGGCC	0.716																																					p.G249D		.											.	TNFRSF6B	651	0			c.G746A						.						7.0	8.0	8.0					20																	62329759		2030	3986	6016	SO:0001583	missense	8771	exon3			GGGCGGGCCGCGC	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.746G>A	20.37:g.62329759G>A	ENSP00000359013:p.Gly249Asp	Somatic	41.0	2.0		WXS	Illumina HiSeq	Phase_I	32.0	12.0	NM_003823		Missense_Mutation	SNP	ENST00000369996.1	37	CCDS13532.1	.	.	.	.	.	.	.	.	.	.	G	9.197	1.027461	0.19512	.	.	ENSG00000243509	ENST00000370006;ENST00000369996	T	0.69926	-0.44	3.57	3.57	0.40892	.	.	.	.	.	T	0.56292	0.1975	L	0.40543	1.245	0.09310	N	1	D	0.54207	0.965	P	0.47864	0.559	T	0.43686	-0.9376	9	0.08837	T	0.75	-24.7184	6.7658	0.23566	0.1454:0.0:0.8546:0.0	.	249	O95407	TNF6B_HUMAN	D	249	ENSP00000359013:G249D	ENSP00000359010:G249D	G	+	2	0	TNFRSF6B	61800203	0.000000	0.05858	0.124000	0.21820	0.102000	0.19082	-0.384000	0.07389	1.675000	0.50919	0.313000	0.20887	GGC	.		0.716	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080182.1		
TNKS2	80351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	93609319	93609319	+	Missense_Mutation	SNP	G	G	A	rs556843721		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:93609319G>A	ENST00000371627.4	+	20	3041	c.2662G>A	c.(2662-2664)Gag>Aag	p.E888K		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	888	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				TCTTGGACTTGAGCACCTAAT	0.323													G|||	1	0.000199681	0.0	0.0	5008	,	,		18403	0.0		0.0	False		,,,				2504	0.001				p.E888K		.											.	TNKS2	541	0			c.G2662A						.						114.0	109.0	110.0					10																	93609319		2203	4300	6503	SO:0001583	missense	80351	exon20			GGACTTGAGCACC	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.2662G>A	10.37:g.93609319G>A	ENSP00000360689:p.Glu888Lys	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	47.0	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	37	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	35	5.451636	0.96205	.	.	ENSG00000107854	ENST00000371627	D	0.88818	-2.43	5.52	5.52	0.82312	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.64402	D	0.000017	D	0.92977	0.7765	M	0.87758	2.905	0.80722	D	1	P	0.42161	0.772	P	0.46940	0.532	D	0.93365	0.6730	10	0.54805	T	0.06	.	19.4315	0.94772	0.0:0.0:1.0:0.0	.	888	Q9H2K2	TNKS2_HUMAN	K	888	ENSP00000360689:E888K	ENSP00000360689:E888K	E	+	1	0	TNKS2	93599299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.954000	0.87848	2.594000	0.87642	0.585000	0.79938	GAG	.		0.323	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
TRPM7	54822	ucsc.edu;bcgsc.ca	37	15	50978728	50978728	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr15:50978728C>A	ENST00000313478.7	-	1	284	c.3G>T	c.(1-3)atG>atT	p.M1I	TRPM7_ENST00000560955.1_Splice_Site_p.M1I|RN7SL354P_ENST00000469282.2_RNA	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GGTCCAGTACCATTCTCCTCA	0.667																																					p.M1I		.											.	TRPM7	392	0			c.G3T						.						37.0	44.0	42.0					15																	50978728		2007	4163	6170	SO:0001630	splice_region_variant	54822	exon1			CAGTACCATTCTC	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.3+1G>T	15.37:g.50978728C>A		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	37	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558510	0.65538	.	.	ENSG00000092439	ENST00000313478	T	0.50277	0.75	4.45	4.45	0.53987	.	0.152425	0.44902	U	0.000414	T	0.44561	0.1299	.	.	.	0.80722	D	1	P	0.35872	0.525	B	0.42214	0.38	T	0.30001	-0.9993	8	.	.	.	.	12.7832	0.57489	0.0:1.0:0.0:0.0	.	1	Q96QT4	TRPM7_HUMAN	I	1	ENSP00000320239:M1I	.	M	-	3	0	TRPM7	48766020	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.081000	0.50120	2.457000	0.83068	0.455000	0.32223	ATG	.		0.667	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	Missense_Mutation
TRPV2	51393	ucsc.edu;bcgsc.ca	37	17	16335314	16335314	+	Silent	SNP	C	C	A	rs373212963		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:16335314C>A	ENST00000338560.7	+	12	2088	c.1689C>A	c.(1687-1689)ccC>ccA	p.P563P	TRPV2_ENST00000577397.1_Silent_p.P133P|TRPV2_ENST00000583241.1_3'UTR	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	563					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CTTGGCGCCCCGAAGCTCCTA	0.647																																					p.P563P		.											.	TRPV2	91	0			c.C1689A						.						42.0	42.0	42.0					17																	16335314		2203	4300	6503	SO:0001819	synonymous_variant	51393	exon12			GCGCCCCGAAGCT	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1689C>A	17.37:g.16335314C>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_016113	A6NML2|A8K0Z0|Q9Y670	Silent	SNP	ENST00000338560.7	37	CCDS32576.1																																																																																			.		0.647	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130464.2	NM_016113	
TSHR	7253	ucsc.edu;bcgsc.ca	37	14	81609800	81609800	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr14:81609800C>T	ENST00000541158.2	+	11	1720	c.1398C>T	c.(1396-1398)taC>taT	p.Y466Y	RP11-114N19.3_ENST00000557775.1_RNA|TSHR_ENST00000298171.2_Silent_p.Y466Y			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	466					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TGGGGATGTACCTGCTCCTCA	0.537			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																														p.Y466Y		.	yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	.	TSHR	1650	0			c.C1398T						.						729.0	564.0	620.0					14																	81609800		2203	4300	6503	SO:0001819	synonymous_variant	7253	exon10			GATGTACCTGCTC	AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.1398C>T	14.37:g.81609800C>T		Somatic	50.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_000369	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Silent	SNP	ENST00000541158.2	37	CCDS9872.1																																																																																			.		0.537	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413364.1	NM_000369	
TTN	7273	broad.mit.edu;bcgsc.ca	37	2	179419651	179419651	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr2:179419651T>C	ENST00000591111.1	-	281	83836	c.83612A>G	c.(83611-83613)gAa>gGa	p.E27871G	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E26944G|TTN_ENST00000460472.2_Missense_Mutation_p.E20447G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E20639G|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E29512G|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E20572G			Q8WZ42	TITIN_HUMAN	titin	27871	Ig-like 130.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGTTTTAATTCATAGCATCC	0.433																																					p.E29512G		.											.	TTN	636	0			c.A88535G						.						93.0	89.0	90.0					2																	179419651		1941	4146	6087	SO:0001583	missense	7273	exon331			TTTAATTCATAGC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83612A>G	2.37:g.179419651T>C	ENSP00000465570:p.Glu27871Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	5.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	17.82	3.483890	0.63962	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.66	5.66	0.87406	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.59622	0.2207	L	0.52364	1.645	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.72338	0.958;0.958;0.958;0.977	T	0.62096	-0.6926	9	0.87932	D	0	.	16.1819	0.81915	0.0:0.0:0.0:1.0	.	20447;20572;20639;27871	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	26944;20447;20639;20572;20444	ENSP00000343764:E26944G;ENSP00000434586:E20447G;ENSP00000340554:E20639G;ENSP00000352154:E20572G	ENSP00000340554:E20639G	E	-	2	0	TTN	179127897	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	4.943000	0.63554	2.279000	0.76181	0.533000	0.62120	GAA	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TYK2	7297	ucsc.edu;bcgsc.ca	37	19	10476467	10476467	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:10476467T>C	ENST00000525621.1	-	7	1218	c.737A>G	c.(736-738)cAg>cGg	p.Q246R	TYK2_ENST00000264818.6_Missense_Mutation_p.Q246R|TYK2_ENST00000524462.1_Missense_Mutation_p.Q61R|TYK2_ENST00000529370.1_Missense_Mutation_p.Q246R	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	246	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TCGGCCCGGCTGGAAGTCCCG	0.672																																					p.Q246R		.											.	TYK2	1009	0			c.A737G						.						14.0	14.0	14.0					19																	10476467		2181	4258	6439	SO:0001583	missense	7297	exon7			CCCGGCTGGAAGT		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.737A>G	19.37:g.10476467T>C	ENSP00000431885:p.Gln246Arg	Somatic	55.0	1.0		WXS	Illumina HiSeq	.	51.0	4.0	NM_003331	Q6QB10|Q96CH0	Missense_Mutation	SNP	ENST00000525621.1	37	CCDS12236.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.596|3.596	-0.082525|-0.082525	0.07141|0.07141	.|.	.|.	ENSG00000105397|ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000529370|ENST00000525220	T;T;T;T|.	0.81247|.	-0.97;-0.93;-0.93;-1.47|.	4.66|4.66	2.52|2.52	0.30459|0.30459	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);|.	0.287385|.	0.23874|.	N|.	0.043714|.	T|T	0.45216|0.45216	0.1331|0.1331	L|L	0.38838|0.38838	1.175|1.175	0.38401|0.38401	D|D	0.945658|0.945658	B;B|.	0.17268|.	0.016;0.021|.	B;B|.	0.16289|.	0.015;0.013|.	T|T	0.29150|0.29150	-1.0021|-1.0021	10|5	0.12430|.	T|.	0.62|.	-25.5102|-25.5102	7.5934|7.5934	0.28033|0.28033	0.0:0.1794:0.0:0.8206|0.0:0.1794:0.0:0.8206	.|.	246;246|.	E9PPF2;P29597|.	.;TYK2_HUMAN|.	R|G	61;246;246;246|25	ENSP00000433203:Q61R;ENSP00000431885:Q246R;ENSP00000264818:Q246R;ENSP00000432728:Q246R|.	ENSP00000264818:Q246R|.	Q|S	-|-	2|1	0|0	TYK2|TYK2	10337467|10337467	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.085000|0.085000	0.17905|0.17905	2.283000|2.283000	0.43470|0.43470	0.283000|0.283000	0.22279|0.22279	0.459000|0.459000	0.35465|0.35465	CAG|AGC	.		0.672	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389443.1		
UBE2J1	51465	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	90047985	90047985	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr6:90047985C>T	ENST00000435041.2	-	5	645	c.367G>A	c.(367-369)Gga>Aga	p.G123R		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	123					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		GCTCCCTCTCCTTTTGTTGGC	0.358																																					p.G123R		.											.	UBE2J1	226	0			c.G367A						.						145.0	146.0	146.0					6																	90047985		2203	4300	6503	SO:0001583	missense	51465	exon5			CCTCTCCTTTTGT	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.367G>A	6.37:g.90047985C>T	ENSP00000451261:p.Gly123Arg	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	11.0	NM_016021	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Missense_Mutation	SNP	ENST00000435041.2	37	CCDS5021.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.972914	0.92919	.	.	ENSG00000198833	ENST00000435041;ENST00000536477	T	0.40476	1.03	5.55	5.55	0.83447	Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.67804	0.2932	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.72798	-0.4184	10	0.52906	T	0.07	-6.3346	19.4946	0.95067	0.0:1.0:0.0:0.0	.	123	Q9Y385	UB2J1_HUMAN	R	123;108	ENSP00000451261:G123R	ENSP00000354684:G123R	G	-	1	0	UBE2J1	90104704	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.440000	0.80464	2.604000	0.88044	0.650000	0.86243	GGA	.		0.358	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
UBE2N	7334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	93804590	93804590	+	Missense_Mutation	SNP	C	C	G	rs555116824		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr12:93804590C>G	ENST00000318066.2	-	3	715	c.338G>C	c.(337-339)aGt>aCt	p.S113T	UBE2N_ENST00000550657.1_3'UTR|UBE2N_ENST00000552442.1_Intron|UBE2N_ENST00000549833.1_Missense_Mutation_p.S50T	NM_003348.3	NP_003339.1	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N	113					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|DNA double-strand break processing (GO:0000729)|double-strand break repair via homologous recombination (GO:0000724)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone ubiquitination (GO:0016574)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone modification (GO:0031058)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|postreplication repair (GO:0006301)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of DNA repair (GO:0006282)|regulation of histone ubiquitination (GO:0033182)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-MMS2 complex (GO:0031372)|UBC13-UEV1A complex (GO:0035370)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|liver(2)|lung(5)	10						ATTGGGAGCACTTAACAAGGC	0.463								Direct reversal of damage;Rad6 pathway																													p.S113T	Pancreas(197;738 2228 30225 32034 33454)	.											.	UBE2N	659	0			c.G338C						.						154.0	134.0	141.0					12																	93804590		2203	4300	6503	SO:0001583	missense	7334	exon3			GGAGCACTTAACA	D83004	CCDS31875.1	12q22	2011-05-19	2011-05-19			ENSG00000177889		"""Ubiquitin-conjugating enzymes E2"""	12492	protein-coding gene	gene with protein product		603679	"""ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)"", ""ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)"""			8902611	Standard	NM_003348		Approved	UbcH-ben, UBC13, MGC8489	uc001tcp.3	P61088	OTTHUMG00000170156	ENST00000318066.2:c.338G>C	12.37:g.93804590C>G	ENSP00000316176:p.Ser113Thr	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	24.0	NM_003348	Q16781|Q53Y81	Missense_Mutation	SNP	ENST00000318066.2	37	CCDS31875.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675421	0.67928	.	.	ENSG00000177889	ENST00000318066;ENST00000549833	T;T	0.37584	1.19;1.19	5.94	5.94	0.96194	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.43500	0.1250	L	0.49699	1.58	0.80722	D	1	P	0.38617	0.64	P	0.45232	0.474	T	0.05750	-1.0866	9	0.16896	T	0.51	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	113	P61088	UBE2N_HUMAN	T	113;50	ENSP00000316176:S113T;ENSP00000450260:S50T	ENSP00000316176:S113T	S	-	2	0	UBE2N	92328721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.633000	0.67825	2.820000	0.97059	0.650000	0.86243	AGT	.		0.463	UBE2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407710.1	NM_003348	
USO1	8615	ucsc.edu;bcgsc.ca	37	4	76703966	76703966	+	Silent	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr4:76703966T>C	ENST00000538159.1	+	9	816	c.816T>C	c.(814-816)tcT>tcC	p.S272S	USO1_ENST00000514213.2_Silent_p.S255S			O60763	USO1_HUMAN	USO1 vesicle transport factor	270	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ATGAAAATTCTGGCTGGTCTG	0.318																																					.		.											.	USO1	25	0			.						.						41.0	40.0	40.0					4																	76703966		1819	4086	5905	SO:0001819	synonymous_variant	8615	.			AAATTCTGGCTGG	AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.816T>C	4.37:g.76703966T>C		Somatic	32.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	.	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Silent	SNP	ENST00000538159.1	37																																																																																				.		0.318	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_003715	
USP4	7375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49365180	49365180	+	Missense_Mutation	SNP	G	G	C	rs536745381		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:49365180G>C	ENST00000265560.4	-	3	345	c.299C>G	c.(298-300)gCg>gGg	p.A100G	USP4_ENST00000351842.4_Missense_Mutation_p.A100G|USP4_ENST00000416417.1_Missense_Mutation_p.A100G|USP4_ENST00000415188.1_Missense_Mutation_p.A100G	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	100	DUSP. {ECO:0000255|PROSITE- ProRule:PRU00613}.|Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TTTATTCCACGCCTCGGTAGG	0.438																																					p.A100G		.											.	USP4	660	0			c.C299G						.						138.0	125.0	130.0					3																	49365180		2203	4300	6503	SO:0001583	missense	7375	exon3			TTCCACGCCTCGG	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.299C>G	3.37:g.49365180G>C	ENSP00000265560:p.Ala100Gly	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	19.0	NM_199443	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141378	0.57044	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.35605	1.78;1.9;1.3	6.07	6.07	0.98685	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (3);	0.000000	0.85682	D	0.000000	T	0.41994	0.1183	L	0.41906	1.305	0.80722	D	1	B;B	0.27656	0.137;0.184	B;B	0.41510	0.123;0.359	T	0.12293	-1.0553	10	0.18276	T	0.48	-24.2326	19.2374	0.93866	0.0:0.0:1.0:0.0	.	100;100	Q13107-2;Q13107	.;UBP4_HUMAN	G	100	ENSP00000341028:A100G;ENSP00000265560:A100G;ENSP00000400623:A100G	ENSP00000265560:A100G	A	-	2	0	USP4	49340184	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.620000	0.83070	2.885000	0.99019	0.655000	0.94253	GCG	.		0.438	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
VAX1	11023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	118896079	118896079	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr10:118896079C>G	ENST00000369206.5	-	2	332	c.333G>C	c.(331-333)caG>caC	p.Q111H	VAX1_ENST00000277905.2_Missense_Mutation_p.Q111H	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	111					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		GCCGATAGAGCTGCTCCGCGG	0.647																																					p.Q111H		.											.	VAX1	92	0			c.G333C						.						42.0	39.0	40.0					10																	118896079		2203	4300	6503	SO:0001583	missense	11023	exon2			ATAGAGCTGCTCC	AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.333G>C	10.37:g.118896079C>G	ENSP00000358207:p.Gln111His	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	31.0	NM_199131	B1AVW5|Q6ZSX0	Missense_Mutation	SNP	ENST00000369206.5	37	CCDS44483.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760083	0.49468	.	.	ENSG00000148704	ENST00000277905;ENST00000369206	D;D	0.98044	-4.68;-4.68	4.03	4.03	0.46877	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99266	0.9744	H	0.98370	4.215	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.83275	0.996;0.995	D	0.98496	1.0612	10	0.87932	D	0	-4.9345	16.3358	0.83060	0.0:1.0:0.0:0.0	.	111;111	Q5SQQ9;Q5SQQ9-2	VAX1_HUMAN;.	H	111	ENSP00000277905:Q111H;ENSP00000358207:Q111H	ENSP00000277905:Q111H	Q	-	3	2	VAX1	118886069	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.499000	0.66937	2.083000	0.62718	0.455000	0.32223	CAG	.		0.647	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050559.3	XM_301242	
VWA8	23078	ucsc.edu;bcgsc.ca	37	13	42486237	42486237	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr13:42486237C>T	ENST00000379310.3	-	3	377	c.309G>A	c.(307-309)ggG>ggA	p.G103G	VWA8_ENST00000281496.6_Silent_p.G103G	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	103						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.G103G(1)									AAACATCTTGCCCCAAAAGAT	0.393																																					p.G103G		.											.	.	.	1	Substitution - coding silent(1)	endometrium(1)	c.G309A						.						120.0	124.0	123.0					13																	42486237		2203	4300	6503	SO:0001819	synonymous_variant	23078	exon3			ATCTTGCCCCAAA	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.309G>A	13.37:g.42486237C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																			.		0.393	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
XPNPEP2	7512	broad.mit.edu;bcgsc.ca	37	X	128893154	128893154	+	Splice_Site	SNP	A	A	G			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chrX:128893154A>G	ENST00000371106.3	+	15	1559		c.e15-1			NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound							anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						CCTTCTCCATAGGGACGGGAC	0.587																																					.		.											.	XPNPEP2	130	0			c.1368-2A>G						.						119.0	93.0	102.0					X																	128893154		2203	4300	6503	SO:0001630	splice_region_variant	7512	exon15			CTCCATAGGGACG	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1368-1A>G	X.37:g.128893154A>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	5.0	NM_003399	A0AV16|O75994	Splice_Site	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085853	0.55861	.	.	ENSG00000122121	ENST00000371106	.	.	.	5.97	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3992	0.49860	0.8503:0.1497:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	XPNPEP2	128720835	1.000000	0.71417	0.595000	0.28798	0.818000	0.46254	7.343000	0.79319	0.837000	0.34925	0.486000	0.48141	.	.		0.587	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	Intron
ZIC3	7547	ucsc.edu;bcgsc.ca	37	X	136649386	136649386	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chrX:136649386T>C	ENST00000287538.5	+	1	1086	c.536T>C	c.(535-537)gTg>gCg	p.V179A	RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_Missense_Mutation_p.V179A	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	179					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					ACAGGGCACGTGGACAACAAC	0.701																																					p.V179A		.											.	ZIC3	195	0			c.T536C						.						27.0	30.0	29.0					X																	136649386		2174	4232	6406	SO:0001583	missense	7547	exon1			GGCACGTGGACAA	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.536T>C	X.37:g.136649386T>C	ENSP00000287538:p.Val179Ala	Somatic	86.0	0.0		WXS	Illumina HiSeq	.	43.0	6.0	NM_003413	B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	37	CCDS14663.1	.	.	.	.	.	.	.	.	.	.	t	11.25	1.583296	0.28268	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	T;T	0.53857	0.6;0.6	4.68	4.68	0.58851	.	0.064411	0.64402	D	0.000009	T	0.41834	0.1176	L	0.40543	1.245	0.52099	D	0.999946	B	0.19583	0.037	B	0.12156	0.007	T	0.25606	-1.0127	10	0.22706	T	0.39	.	12.0626	0.53570	0.0:0.0:0.0:1.0	.	179	O60481	ZIC3_HUMAN	A	179	ENSP00000287538:V179A;ENSP00000359638:V179A	ENSP00000287538:V179A	V	+	2	0	ZIC3	136477052	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.790000	0.69038	1.727000	0.51537	0.483000	0.47432	GTG	.		0.701	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
ZNF536	9745	ucsc.edu;bcgsc.ca	37	19	31039499	31039499	+	Silent	SNP	G	G	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:31039499G>T	ENST00000355537.3	+	4	3120	c.2973G>T	c.(2971-2973)tcG>tcT	p.S991S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	991					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CGGGCTCCTCGGTAACTGTGC	0.582																																					p.S991S		.											.	ZNF536	144	0			c.G2973T						.						70.0	71.0	71.0					19																	31039499		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon4			CTCCTCGGTAACT		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2973G>T	19.37:g.31039499G>T		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																			.		0.582	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF132	7691	ucsc.edu;bcgsc.ca	37	19	58945522	58945522	+	Missense_Mutation	SNP	G	G	T	rs200662557		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr19:58945522G>T	ENST00000254166.3	-	3	1689	c.1289C>A	c.(1288-1290)cCg>cAg	p.P430Q		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	430					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		GCATTCATACGGTCTTTCTCC	0.468																																					p.P430Q		.											.	ZNF132	92	0			c.C1289A						.						128.0	125.0	126.0					19																	58945522		2203	4300	6503	SO:0001583	missense	7691	exon3			TCATACGGTCTTT	U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1289C>A	19.37:g.58945522G>T	ENSP00000254166:p.Pro430Gln	Somatic	45.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_003433	Q32MI9	Missense_Mutation	SNP	ENST00000254166.3	37	CCDS12980.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439684	0.63067	.	.	ENSG00000131849	ENST00000254166	T	0.28454	1.61	3.43	2.38	0.29361	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.56187	0.1968	M	0.85197	2.74	0.32681	N	0.515455	D	0.89917	1.0	D	0.85130	0.997	T	0.66677	-0.5863	9	0.87932	D	0	.	9.9133	0.41419	0.1083:0.0:0.8917:0.0	.	430	P52740	ZN132_HUMAN	Q	430	ENSP00000254166:P430Q	ENSP00000254166:P430Q	P	-	2	0	ZNF132	63637334	0.997000	0.39634	0.004000	0.12327	0.939000	0.58152	2.528000	0.45624	0.727000	0.32360	0.655000	0.94253	CCG	G|0.999;A|0.000		0.468	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467035.1	NM_003433	
ZNF620	253639	broad.mit.edu;bcgsc.ca	37	3	40557547	40557547	+	Silent	SNP	C	C	A	rs148212912		TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:40557547C>A	ENST00000314529.6	+	5	611	c.462C>A	c.(460-462)acC>acA	p.T154T	ZNF620_ENST00000418905.1_Silent_p.T40T	NM_175888.3	NP_787084.1	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(1)|urinary_tract(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TCACAGATACCTCAGCCAGGC	0.438																																					p.T154T		.											.	ZNF620	91	0			c.C462A						.						38.0	39.0	39.0					3																	40557547		2203	4300	6503	SO:0001819	synonymous_variant	253639	exon5			AGATACCTCAGCC	AK093599	CCDS33740.1, CCDS58825.1	3p21.33	2013-01-08			ENSG00000177842	ENSG00000177842		"""Zinc fingers, C2H2-type"", ""-"""	28742	protein-coding gene	gene with protein product						12477932	Standard	NM_175888		Approved	MGC50836	uc003ckk.4	Q6ZNG0	OTTHUMG00000156044	ENST00000314529.6:c.462C>A	3.37:g.40557547C>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	5.0	NM_175888	Q8N223	Silent	SNP	ENST00000314529.6	37	CCDS33740.1																																																																																			C|1.000;T|0.000		0.438	ZNF620-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342824.1	XM_171060	
ZNF660	285349	ucsc.edu;bcgsc.ca	37	3	44636365	44636365	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr3:44636365T>C	ENST00000322734.2	+	3	1013	c.680T>C	c.(679-681)tTc>tCc	p.F227S	RP11-944L7.4_ENST00000457331.1_RNA	NM_173658.2	NP_775929.2	Q6AZW8	ZN660_HUMAN	zinc finger protein 660	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)	6				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		GGAAAAACTTTCATCTTAAGG	0.378																																					p.F227S		.											.	ZNF660	90	0			c.T680C						.						79.0	85.0	83.0					3																	44636365		2203	4300	6503	SO:0001583	missense	285349	exon3			AAACTTTCATCTT	AK094189	CCDS2716.1	3p21.32	2013-01-08			ENSG00000144792	ENSG00000144792		"""Zinc fingers, C2H2-type"""	26720	protein-coding gene	gene with protein product							Standard	NM_173658		Approved	FLJ36870	uc003cnl.1	Q6AZW8	OTTHUMG00000133097	ENST00000322734.2:c.680T>C	3.37:g.44636365T>C	ENSP00000324605:p.Phe227Ser	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_173658	Q7Z331|Q8N9M8	Missense_Mutation	SNP	ENST00000322734.2	37	CCDS2716.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002613	0.74932	.	.	ENSG00000144792	ENST00000322734	T	0.44482	0.92	4.35	4.35	0.52113	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.65491	0.2696	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69862	-0.5030	8	.	.	.	.	12.9362	0.58316	0.0:0.0:0.0:1.0	.	227	Q6AZW8	ZN660_HUMAN	S	227	ENSP00000324605:F227S	.	F	+	2	0	ZNF660	44611369	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.767000	0.68850	1.943000	0.56356	0.528000	0.53228	TTC	.		0.378	ZNF660-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256756.4	NM_173658	
ZNHIT3	9326	ucsc.edu;bcgsc.ca	37	17	34848721	34848721	+	Silent	SNP	C	C	T			TCGA-G3-A25Y-01A-11D-A16V-10	TCGA-G3-A25Y-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6b50391f-d890-4ca0-b942-beab0f8bf1c9	9cfc4adf-3fd0-4f1f-b9e1-5f7a6e1469df	g.chr17:34848721C>T	ENST00000225410.4	+	3	248	c.183C>T	c.(181-183)acC>acT	p.T61T	ZNHIT3_ENST00000490126.2_5'UTR|ZNHIT3_ENST00000588253.1_5'UTR|RNA5SP439_ENST00000517103.1_RNA|ZNHIT3_ENST00000590858.1_Intron|ZNHIT3_ENST00000592616.1_Silent_p.T61T	NM_004773.2	NP_004764.1	Q15649	ZNHI3_HUMAN	zinc finger, HIT-type containing 3	61					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			lung(1)|pancreas(1)|prostate(1)	3		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0188)		CTACCAAAACCGTAAAGCCTG	0.443																																					p.T61T	Pancreas(89;112 2361 26810)	.											.	ZNHIT3	90	0			c.C183T						.						91.0	90.0	90.0					17																	34848721		2203	4300	6503	SO:0001819	synonymous_variant	9326	exon3			CAAAACCGTAAAG	L40410	CCDS11312.1, CCDS62156.1	17q21.1	2014-04-10	2010-09-15	2005-09-08	ENSG00000108278	ENSG00000273611		"""Zinc fingers, HIT-type"""	12309	protein-coding gene	gene with protein product		604500	"""thyroid hormone receptor interactor 3"", ""zinc finger, HIT type 3"""	TRIP3		7776974	Standard	NM_004773		Approved		uc002hms.1	Q15649	OTTHUMG00000188436	ENST00000225410.4:c.183C>T	17.37:g.34848721C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	54.0	5.0	NM_004773	A8K493|K7EQP1|Q8WVJ3	Silent	SNP	ENST00000225410.4	37	CCDS11312.1																																																																																			.		0.443	ZNHIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256697.1	NM_004773	
