#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA12	26154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	215843664	215843664	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:215843664C>T	ENST00000272895.7	-	32	5060	c.4841G>A	c.(4840-4842)gGa>gAa	p.G1614E	ABCA12_ENST00000389661.4_Missense_Mutation_p.G1296E	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1614					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AACAAGCTCTCCCCCAATATC	0.498																																					p.G1614E	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12	99	0			c.G4841A						.						158.0	139.0	145.0					2																	215843664		2203	4300	6503	SO:0001583	missense	26154	exon32			AGCTCTCCCCCAA	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4841G>A	2.37:g.215843664C>T	ENSP00000272895:p.Gly1614Glu	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	22.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304121	0.81136	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.62639	0.01;0.01	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000002	T	0.74152	0.3679	L	0.43554	1.36	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77004	0.989;0.979	T	0.72944	-0.4138	10	0.45353	T	0.12	.	19.4492	0.94860	0.0:1.0:0.0:0.0	.	1614;1296	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	E	1614;1296	ENSP00000272895:G1614E;ENSP00000374312:G1296E	ENSP00000272895:G1614E	G	-	2	0	ABCA12	215551909	0.995000	0.38212	0.998000	0.56505	0.901000	0.52897	4.063000	0.57499	2.669000	0.90835	0.655000	0.94253	GGA	.		0.498	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ABCA13	154664	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48443391	48443391	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr7:48443391G>T	ENST00000435803.1	+	39	12009	c.11985G>T	c.(11983-11985)agG>agT	p.R3995S		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3995	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GCATGTCGAGGACCGTGGTTC	0.572																																					p.R3995S		.											.	ABCA13	521	0			c.G11985T						.						91.0	92.0	92.0					7																	48443391		2008	4168	6176	SO:0001583	missense	154664	exon39			GTCGAGGACCGTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11985G>T	7.37:g.48443391G>T	ENSP00000411096:p.Arg3995Ser	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	14.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	9.789	1.177279	0.21787	.	.	ENSG00000179869	ENST00000435803	D	0.93307	-3.2	6.17	1.96	0.26148	ATPase, AAA+ type, core (1);ABC transporter-like (2);	1.053980	0.07446	N	0.898305	D	0.85767	0.5773	N	0.17764	0.52	0.09310	N	1	B;B	0.30146	0.27;0.097	B;B	0.26693	0.072;0.032	T	0.76580	-0.2907	10	0.56958	D	0.05	.	3.9532	0.09379	0.1998:0.1068:0.5712:0.1222	.	1697;3995	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	S	3995	ENSP00000411096:R3995S	ENSP00000411096:R3995S	R	+	3	2	ABCA13	48413937	0.001000	0.12720	0.198000	0.23420	0.316000	0.28119	-0.199000	0.09491	0.484000	0.27630	-0.176000	0.13171	AGG	.		0.572	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCA7	10347	ucsc.edu;bcgsc.ca	37	19	1058628	1058628	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:1058628T>C	ENST00000263094.6	+	38	5392	c.5161T>C	c.(5161-5163)Ttc>Ctc	p.F1721L	ABCA7_ENST00000433129.1_Missense_Mutation_p.F1721L|ABCA7_ENST00000435683.2_Missense_Mutation_p.F1583L	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1721					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGACAGGCAGTTCCAGTCACC	0.552																																					p.F1721L		.											.	ABCA7	98	0			c.T5161C						.						58.0	59.0	59.0					19																	1058628		2203	4300	6503	SO:0001583	missense	10347	exon38			AGGCAGTTCCAGT	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5161T>C	19.37:g.1058628T>C	ENSP00000263094:p.Phe1721Leu	Somatic	60.0	0.0		WXS	Illumina HiSeq	.	41.0	5.0	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.91|14.91	2.674982|2.674982	0.47781|0.47781	.|.	.|.	ENSG00000064687|ENSG00000064687	ENST00000263094;ENST00000433129|ENST00000525073	D;D|.	0.86497|.	-2.13;-2.13|.	4.23|4.23	4.23|4.23	0.50019|0.50019	.|.	.|.	.|.	.|.	.|.	T|T	0.50582|0.50582	0.1624|0.1624	L|L	0.51853|0.51853	1.615|1.615	0.29602|0.29602	N|N	0.847596|0.847596	B;B|.	0.27594|.	0.024;0.182|.	B;B|.	0.33295|.	0.062;0.161|.	T|T	0.49542|0.49542	-0.8929|-0.8929	9|5	0.12103|.	T|.	0.63|.	.|.	12.266|12.266	0.54679|0.54679	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	846;1721|.	D6W5Y0;Q8IZY2|.	.;ABCA7_HUMAN|.	L|A	1721|152	ENSP00000263094:F1721L;ENSP00000414062:F1721L|.	ENSP00000263094:F1721L|.	F|V	+|+	1|2	0|0	ABCA7|ABCA7	1009628|1009628	0.356000|0.356000	0.24930|0.24930	0.819000|0.819000	0.32651|0.32651	0.991000|0.991000	0.79684|0.79684	1.554000|1.554000	0.36266|0.36266	1.768000|1.768000	0.52137|0.52137	0.459000|0.459000	0.35465|0.35465	TTC|GTT	.		0.552	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ABCB1	5243	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	87214868	87214868	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr7:87214868delT	ENST00000265724.3	-	5	663	c.246delA	c.(244-246)gcafs	p.A82fs	ABCB1_ENST00000543898.1_Frame_Shift_Del_p.A82fs	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	82	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CTAAATTTCCTGCATTTGCAA	0.393																																					p.A82fs		.											.	ABCB1	582	0			c.246delA						.						93.0	91.0	92.0					7																	87214868		2203	4300	6503	SO:0001589	frameshift_variant	5243	exon5			ATTTCCTGCATTT	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.246delA	7.37:g.87214868delT	ENSP00000265724:p.Ala82fs	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	11.0	NM_000927	A8K294|B5AK60|Q12755|Q14812	Frame_Shift_Del	DEL	ENST00000265724.3	37	CCDS5608.1																																																																																			.		0.393	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
ABCC9	10060	ucsc.edu;bcgsc.ca	37	12	21991070	21991070	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr12:21991070G>T	ENST00000261201.4	-	28	3507	c.3508C>A	c.(3508-3510)Cct>Act	p.P1170T	ABCC9_ENST00000345162.2_Missense_Mutation_p.P1134T|ABCC9_ENST00000261200.4_Missense_Mutation_p.P1170T|RP11-729I10.2_ENST00000539874.1_RNA	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1170	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CAGAGCAGAGGGAGCTGGGTA	0.443																																					p.P1170T		.											.	ABCC9	96	0			c.C3508A						.						124.0	121.0	122.0					12																	21991070		2203	4300	6503	SO:0001583	missense	10060	exon28			GCAGAGGGAGCTG	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3508C>A	12.37:g.21991070G>T	ENSP00000261201:p.Pro1170Thr	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_005691	O60707	Missense_Mutation	SNP	ENST00000261201.4	37	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713755	0.89112	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.31	5.31	0.75309	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97056	0.9038	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98304	1.0520	10	0.87932	D	0	-16.824	19.1802	0.93620	0.0:0.0:1.0:0.0	.	1170;1170	O60706;O60706-2	ABCC9_HUMAN;.	T	1170;797;1170;1134	ENSP00000261200:P1170T;ENSP00000440521:P797T;ENSP00000261201:P1170T;ENSP00000261202:P1134T	ENSP00000261200:P1170T	P	-	1	0	ABCC9	21882337	1.000000	0.71417	0.997000	0.53966	0.914000	0.54420	9.640000	0.98453	2.748000	0.94277	0.650000	0.86243	CCT	.		0.443	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
ADAMTS18	170692	ucsc.edu;bcgsc.ca	37	16	77329000	77329000	+	Silent	SNP	T	T	C	rs142130362		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr16:77329000T>C	ENST00000282849.5	-	19	3244	c.2826A>G	c.(2824-2826)acA>acG	p.T942T		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	942	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						CCTTGCTGCATGTACTCCATT	0.468																																					p.T942T		.											.	ADAMTS18	1036	0			c.A2826G						.	T		1,4395	2.1+/-5.4	0,1,2197	102.0	67.0	79.0		2826	-6.5	0.0	16	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous	ADAMTS18	NM_199355.2		0,1,6497	CC,CT,TT		0.0,0.0227,0.0077		942/1222	77329000	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	170692	exon19			GCTGCATGTACTC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2826A>G	16.37:g.77329000T>C		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_199355	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																			T|1.000;C|0.000		0.468	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
ACSF3	197322	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	89167289	89167289	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr16:89167289C>T	ENST00000317447.4	+	3	577	c.200C>T	c.(199-201)aCg>aTg	p.T67M	ACSF3_ENST00000406948.3_Missense_Mutation_p.T67M|ACSF3_ENST00000378345.4_Intron	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	67					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		GGCCGCCACACGTACAGGGAG	0.677																																					p.T67M		.											.	ACSF3	68	0			c.C200T						.						31.0	33.0	32.0					16																	89167289		2198	4300	6498	SO:0001583	missense	197322	exon3			GCCACACGTACAG	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.200C>T	16.37:g.89167289C>T	ENSP00000320646:p.Thr67Met	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	6.0	NM_174917	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	ENST00000317447.4	37	CCDS10974.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946237	0.53079	.	.	ENSG00000176715	ENST00000317447;ENST00000537290;ENST00000406948	T;T;T	0.68181	-0.31;-0.31;-0.31	5.26	5.26	0.73747	AMP-dependent synthetase/ligase (1);	0.092858	0.64402	D	0.000001	D	0.89448	0.6718	H	0.98295	4.195	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.93619	0.6946	10	0.87932	D	0	-38.638	18.8714	0.92317	0.0:1.0:0.0:0.0	.	67	Q4G176	ACSF3_HUMAN	M	67	ENSP00000320646:T67M;ENSP00000440734:T67M;ENSP00000384627:T67M	ENSP00000320646:T67M	T	+	2	0	ACSF3	87694790	0.998000	0.40836	0.962000	0.40283	0.018000	0.09664	3.525000	0.53502	2.455000	0.83008	0.650000	0.86243	ACG	.		0.677	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917	
ADGB	79747	ucsc.edu;bcgsc.ca	37	6	147006934	147006934	+	Silent	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:147006934T>C	ENST00000397944.3	+	10	1357	c.1281T>C	c.(1279-1281)ttT>ttC	p.F427F	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	427					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						TTTATTTGTTTGAAAACAAGA	0.343																																					p.F427F		.											.	.	.	0			c.T1281C						.						159.0	133.0	141.0					6																	147006934		692	1590	2282	SO:0001819	synonymous_variant	79747	exon10			TTTGTTTGAAAAC	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.1281T>C	6.37:g.147006934T>C		Somatic	27.0	0.0		WXS	Illumina HiSeq	.	64.0	6.0	NM_024694	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	37																																																																																				.		0.343	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
AP3B2	8120	ucsc.edu;bcgsc.ca	37	15	83331891	83331891	+	Silent	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:83331891G>T	ENST00000261722.3	-	21	2742	c.2535C>A	c.(2533-2535)acC>acA	p.T845T	AP3B2_ENST00000535359.1_Silent_p.T864T|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Silent_p.T813T	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	845					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			ACGGTACCAGGGTGGAGTCTG	0.632																																					p.T845T		.											.	AP3B2	94	0			c.C2535A						.						28.0	31.0	30.0					15																	83331891		2042	4184	6226	SO:0001819	synonymous_variant	8120	exon21			TACCAGGGTGGAG	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2535C>A	15.37:g.83331891G>T		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	37	CCDS45331.1																																																																																			.		0.632	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
AGBL1	123624	ucsc.edu;bcgsc.ca	37	15	86838529	86838529	+	Missense_Mutation	SNP	T	T	C	rs190282686		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:86838529T>C	ENST00000441037.2	+	16	2221	c.2126T>C	c.(2125-2127)gTc>gCc	p.V709A	AGBL1-AS1_ENST00000564487.1_RNA|AGBL1-AS1_ENST00000566878.1_RNA|AGBL1_ENST00000389298.3_Missense_Mutation_p.V440A|AGBL1_ENST00000421325.2_Missense_Mutation_p.V709A	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	709					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CTCAAAGAGGTCTACTTCCGG	0.453													T|||	1	0.000199681	0.0	0.0	5008	,	,		19292	0.0		0.001	False		,,,				2504	0.0				p.V709A		.											.	.	.	0			c.T2126C						.						70.0	70.0	70.0					15																	86838529		1941	4149	6090	SO:0001583	missense	123624	exon16			AAGAGGTCTACTT	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2126T>C	15.37:g.86838529T>C	ENSP00000413001:p.Val709Ala	Somatic	30.0	1.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	ENST00000441037.2	37	CCDS58398.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	T	15.75	2.925321	0.52759	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10860	2.83;2.84	5.42	5.42	0.78866	.	0.422789	0.22792	N	0.055584	T	0.16557	0.0398	L	0.40543	1.245	0.30575	N	0.763151	B;B;D	0.56746	0.171;0.171;0.977	B;B;P	0.52066	0.138;0.138;0.689	T	0.02398	-1.1165	10	0.35671	T	0.21	-14.4503	13.6996	0.62599	0.0:0.0:0.0:1.0	.	408;440;709	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	A	738;709;440	ENSP00000397173:V709A;ENSP00000373949:V440A	ENSP00000373949:V440A	V	+	2	0	AGBL1	84639533	1.000000	0.71417	0.729000	0.30791	0.778000	0.44026	6.505000	0.73708	2.170000	0.68504	0.528000	0.53228	GTC	T|0.999;C|0.000		0.453	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
ARVCF	421	ucsc.edu;bcgsc.ca	37	22	19967280	19967280	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr22:19967280C>T	ENST00000263207.3	-	6	1673	c.1382G>A	c.(1381-1383)cGt>cAt	p.R461H	ARVCF_ENST00000401994.1_Missense_Mutation_p.R398H|ARVCF_ENST00000406522.1_Missense_Mutation_p.R398H|ARVCF_ENST00000487793.1_5'Flank|ARVCF_ENST00000406259.1_Missense_Mutation_p.R461H|ARVCF_ENST00000344269.3_Missense_Mutation_p.R398H	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	461					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					GACAAGCTCACGGACCTCGTT	0.657																																					p.R461H		.											.	ARVCF	91	0			c.G1382A						.						28.0	23.0	25.0					22																	19967280		2196	4296	6492	SO:0001583	missense	421	exon6			AGCTCACGGACCT		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1382G>A	22.37:g.19967280C>T	ENSP00000263207:p.Arg461His	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	44.0	5.0	NM_001670	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523910	0.64747	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54	4.71	4.71	0.59529	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82508	0.5052	M	0.69463	2.115	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.82261	-0.0545	9	.	.	.	-6.2794	18.2393	0.89961	0.0:1.0:0.0:0.0	.	461	O00192	ARVC_HUMAN	H	461;398;398;398;461	ENSP00000263207:R461H;ENSP00000342042:R398H;ENSP00000384341:R398H;ENSP00000384732:R398H;ENSP00000385444:R461H	.	R	-	2	0	ARVCF	18347280	0.983000	0.35010	0.958000	0.39756	0.241000	0.25554	2.595000	0.46197	2.618000	0.88619	0.655000	0.94253	CGT	.		0.657	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
ASIC3	9311	ucsc.edu;mdanderson.org	37	7	150746506	150746506	+	Splice_Site	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr7:150746506G>A	ENST00000349064.5	+	1	732	c.534G>A	c.(532-534)acG>acA	p.T178T	ASIC3_ENST00000357922.4_Splice_Site_p.T178T|ASIC3_ENST00000297512.8_Splice_Site_p.T178T	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	178					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										ACTTCACCACGGTGAGCTGAC	0.622																																					p.T178T		.											.	.	.	0			c.G534A						.						66.0	66.0	66.0					7																	150746506		2203	4300	6503	SO:0001630	splice_region_variant	9311	exon1			CACCACGGTGAGC	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.534+1G>A	7.37:g.150746506G>A		Somatic	14.0	0.0		WXS	Illumina HiSeq	.	17.0	8.0	NM_020322	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1																																																																																			.		0.622	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	Silent
ATP1A3	478	broad.mit.edu;mdanderson.org	37	19	42489335	42489335	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:42489335G>A	ENST00000302102.5	-	8	878	c.728C>T	c.(727-729)aCg>aTg	p.T243M	ATP1A3_ENST00000602133.1_Missense_Mutation_p.T213M|ATP1A3_ENST00000543770.1_Missense_Mutation_p.T254M|ATP1A3_ENST00000545399.1_Missense_Mutation_p.T256M|ATP1A3_ENST00000468774.2_5'Flank	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	243					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GCCCCGAGCCGTGCCTGCAGG	0.687																																					p.T256M		.											.	ATP1A3	92	0			c.C767T						.						26.0	25.0	25.0					19																	42489335		2201	4299	6500	SO:0001583	missense	478	exon8			CGAGCCGTGCCTG		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.728C>T	19.37:g.42489335G>A	ENSP00000302397:p.Thr243Met	Somatic	26.0	1.0		WXS	Illumina HiSeq	Phase_I	23.0	8.0	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086986	0.76642	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000543770	D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76	4.27	4.27	0.50696	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.96002	0.8698	M	0.93507	3.425	0.80722	D	1	D;D;D;D	0.76494	0.997;0.997;0.999;0.993	P;P;D;P	0.64410	0.772;0.723;0.925;0.818	D	0.97081	0.9784	10	0.87932	D	0	.	14.5723	0.68220	0.0:0.0:1.0:0.0	.	256;254;243;243	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	M	243;243;256;213;254	ENSP00000302397:T243M;ENSP00000411503:T243M;ENSP00000444688:T256M;ENSP00000437577:T254M	ENSP00000302397:T243M	T	-	2	0	ATP1A3	47181175	1.000000	0.71417	0.966000	0.40874	0.667000	0.39255	9.712000	0.98738	2.117000	0.64856	0.478000	0.44815	ACG	.		0.687	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
ATP1B4	23439	ucsc.edu;bcgsc.ca	37	X	119509404	119509404	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chrX:119509404T>C	ENST00000218008.3	+	5	797	c.740T>C	c.(739-741)aTc>aCc	p.I247T	ATP1B4_ENST00000539306.1_Missense_Mutation_p.I204T|ATP1B4_ENST00000361319.3_Missense_Mutation_p.I243T	NM_001142447.2	NP_001135919.1	Q9UN42	AT1B4_HUMAN	ATPase, Na+/K+ transporting, beta 4 polypeptide	247					monovalent inorganic cation transport (GO:0015672)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|nuclear inner membrane (GO:0005637)|sodium:potassium-exchanging ATPase complex (GO:0005890)	monovalent inorganic cation transmembrane transporter activity (GO:0015077)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	33						CAGCCCTGCATCCTTCTAAAG	0.478																																					p.I247T		.											.	ATP1B4	131	0			c.T740C						.						146.0	129.0	135.0					X																	119509404		2203	4300	6503	SO:0001583	missense	23439	exon5			CCTGCATCCTTCT	AF158383	CCDS14598.1, CCDS48158.1	Xq24	2012-10-22	2010-04-20		ENSG00000101892	ENSG00000101892		"""ATPases / P-type"""	808	protein-coding gene	gene with protein product	"""Na,K-ATPase beta m-subunit"""		"""ATPase, (Na+)/K+ transporting, beta 4 polypeptide"""			10456317, 17592128	Standard	NM_012069		Approved		uc004esr.3	Q9UN42	OTTHUMG00000022299	ENST00000218008.3:c.740T>C	X.37:g.119509404T>C	ENSP00000218008:p.Ile247Thr	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001142447	Q17RR0|Q9UN41	Missense_Mutation	SNP	ENST00000218008.3	37	CCDS48158.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.709737	0.68730	.	.	ENSG00000101892	ENST00000218008;ENST00000361319;ENST00000539306	T;T;T	0.34667	1.35;1.35;1.35	5.19	5.19	0.71726	.	0.046517	0.85682	D	0.000000	T	0.65749	0.2721	M	0.89968	3.075	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;1.0;0.999	D;D;D;D	0.72982	0.979;0.969;0.979;0.964	T	0.73898	-0.3837	10	0.87932	D	0	-21.5653	13.3032	0.60336	0.0:0.0:0.0:1.0	.	204;212;247;243	B7ZKW0;B7ZKV9;Q9UN42;Q9UN42-2	.;.;AT1B4_HUMAN;.	T	247;243;204	ENSP00000218008:I247T;ENSP00000355346:I243T;ENSP00000443334:I204T	ENSP00000218008:I247T	I	+	2	0	ATP1B4	119393432	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.634000	0.83273	1.734000	0.51633	0.430000	0.28490	ATC	.		0.478	ATP1B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058095.1	NM_001142447	
BRAP	8315	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	112093435	112093435	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr12:112093435G>C	ENST00000327551.6	-	10	1296	c.1156C>G	c.(1156-1158)Ctg>Gtg	p.L386V	BRAP_ENST00000539060.1_Missense_Mutation_p.L237V|BRAP_ENST00000419234.4_Missense_Mutation_p.L416V			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						TGAGATTCCAGCTGGCTTGTT	0.383																																					p.L416V	Pancreas(146;846 1904 7830 25130 26065)	.											.	BRAP	710	0			c.C1246G						.						155.0	134.0	141.0					12																	112093435		2203	4300	6503	SO:0001583	missense	8315	exon10			ATTCCAGCTGGCT	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1156C>G	12.37:g.112093435G>C	ENSP00000330813:p.Leu386Val	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	38.0	NM_006768	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000327551.6	37		.	.	.	.	.	.	.	.	.	.	G	19.68	3.873277	0.72180	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	T;T;T	0.70164	-0.46;-0.46;-0.46	5.16	4.27	0.50696	.	0.000000	0.85682	D	0.000000	D	0.84000	0.5376	M	0.92459	3.31	0.80722	D	1	P;D	0.69078	0.956;0.997	P;D	0.78314	0.899;0.991	D	0.86081	0.1544	10	0.59425	D	0.04	-10.2253	10.9941	0.47565	0.1504:0.0:0.8496:0.0	.	237;416	B4DRM1;Q7Z569	.;BRAP_HUMAN	V	416;237;386;198	ENSP00000403524:L416V;ENSP00000441659:L237V;ENSP00000330813:L386V	ENSP00000330813:L386V	L	-	1	2	BRAP	110577818	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.188000	0.65093	1.181000	0.42912	0.561000	0.74099	CTG	.		0.383	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
BTBD18	643376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57512438	57512438	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:57512438G>T	ENST00000436147.3	-	2	1494	c.1307C>A	c.(1306-1308)tCc>tAc	p.S436Y	RP11-691N7.6_ENST00000531074.1_Intron|TMX2-CTNND1_ENST00000528395.1_Intron|BTBD18_ENST00000422652.1_Missense_Mutation_p.S436Y			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18	436										endometrium(3)|kidney(1)	4						GTGGTCTGGGGAGTGGCTAGC	0.488																																					p.S436Y		.											.	.	.	0			c.C1307A						.						107.0	85.0	92.0					11																	57512438		692	1591	2283	SO:0001583	missense	643376	exon3			TCTGGGGAGTGGC		CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203	ENST00000436147.3:c.1307C>A	11.37:g.57512438G>T	ENSP00000397020:p.Ser436Tyr	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	26.0	NM_001145101		Missense_Mutation	SNP	ENST00000436147.3	37	CCDS44603.1	.	.	.	.	.	.	.	.	.	.	G	11.00	1.509478	0.27036	.	.	ENSG00000233436	ENST00000422652;ENST00000436147	T;T	0.80033	-1.33;-1.33	5.31	4.32	0.51571	.	.	.	.	.	T	0.71108	0.3301	L	0.27053	0.805	0.23882	N	0.996575	P	0.46912	0.886	B	0.44133	0.442	T	0.63506	-0.6622	9	0.59425	D	0.04	.	8.0183	0.30393	0.1106:0.0:0.8894:0.0	.	436	B2RXH4	BTBDI_HUMAN	Y	436	ENSP00000394472:S436Y;ENSP00000397020:S436Y	ENSP00000394472:S436Y	S	-	2	0	BTBD18	57269014	0.993000	0.37304	0.994000	0.49952	0.204000	0.24138	1.672000	0.37523	2.764000	0.94973	0.557000	0.71058	TCC	.		0.488	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393718.2	NM_001145101	
C3orf67	200844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	58855185	58855185	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:58855185C>T	ENST00000482387.1	-	5	605	c.509G>A	c.(508-510)cGa>cAa	p.R170Q	C3orf67_ENST00000472469.1_Missense_Mutation_p.R90Q|RP11-147N17.1_ENST00000463703.1_RNA|RP11-147N17.1_ENST00000493123.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.R170Q|RP11-147N17.1_ENST00000482372.1_RNA|RP11-147N17.1_ENST00000492031.1_RNA			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	170										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		CTGGCATGATCGGTTATTTTT	0.368																																					p.R170Q		.											.	C3orf67	68	0			c.G509A						.						119.0	111.0	114.0					3																	58855185		2203	4300	6503	SO:0001583	missense	200844	exon9			CATGATCGGTTAT	AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.509G>A	3.37:g.58855185C>T	ENSP00000417122:p.Arg170Gln	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	46.0	NM_198463	B9EKV6|Q6ZV69	Missense_Mutation	SNP	ENST00000482387.1	37		.	.	.	.	.	.	.	.	.	.	C	9.809	1.182661	0.21870	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000472469	T;T;T	0.51817	0.69;0.69;0.69	5.85	0.366	0.16136	.	0.925114	0.09158	N	0.840614	T	0.19485	0.0468	N	0.03016	-0.435	0.09310	N	1	B;B	0.26876	0.162;0.028	B;B	0.17979	0.02;0.007	T	0.17107	-1.0380	10	0.27785	T	0.31	-0.0162	5.3638	0.16103	0.0:0.5302:0.14:0.3298	.	90;170	C9J3M8;Q6ZVT6-2	.;.	Q	170;170;90	ENSP00000295966:R170Q;ENSP00000417122:R170Q;ENSP00000417271:R90Q	ENSP00000295966:R170Q	R	-	2	0	C3orf67	58830225	0.347000	0.24853	0.000000	0.03702	0.384000	0.30261	-0.026000	0.12392	-0.225000	0.09913	0.655000	0.94253	CGA	.		0.368	C3orf67-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000353803.1	NM_198463	
CADPS	8618	broad.mit.edu;bcgsc.ca	37	3	62578422	62578422	+	Splice_Site	SNP	A	A	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:62578422A>C	ENST00000383710.4	-	7	1676	c.1327T>G	c.(1327-1329)Tgg>Ggg	p.W443G	CADPS_ENST00000357948.3_Splice_Site_p.W443G|CADPS_ENST00000283269.9_Splice_Site_p.W443G	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	443	C2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TGGGTGCCCCAGCTGCAGACA	0.517																																					p.W443G		.											.	CADPS	281	0			c.T1327G						.						87.0	80.0	82.0					3																	62578422		2203	4300	6503	SO:0001630	splice_region_variant	8618	exon7			TGCCCCAGCTGCA	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1326-1T>G	3.37:g.62578422A>C		Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	5.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.181456	0.78677	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	D;D;D	0.85773	-2.03;-2.03;-2.03	5.41	5.41	0.78517	C2 calcium-dependent membrane targeting (1);	0.000000	0.85682	D	0.000000	D	0.92443	0.7601	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;0.981;0.997	D;D;D	0.91635	0.999;0.969;0.986	D	0.93472	0.6820	10	0.87932	D	0	.	15.7244	0.77743	1.0:0.0:0.0:0.0	.	443;443;443	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	G	443	ENSP00000373215:W443G;ENSP00000350632:W443G;ENSP00000283269:W443G	ENSP00000283269:W443G	W	-	1	0	CADPS	62553462	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.149000	0.94659	2.171000	0.68590	0.533000	0.62120	TGG	.		0.517	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	Missense_Mutation
CAPSL	133690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	35910562	35910562	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr5:35910562A>T	ENST00000397367.2	-	3	347	c.221T>A	c.(220-222)gTc>gAc	p.V74D	CAPSL_ENST00000514524.1_Missense_Mutation_p.V74D|CAPSL_ENST00000397366.1_Missense_Mutation_p.V74D	NM_144647.3	NP_653248.3	Q8WWF8	CAPSL_HUMAN	calcyphosine-like	74	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(10)|skin(1)|urinary_tract(1)	19	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)			TTTTTCCATGACCACAGCATA	0.328																																					p.V74D		.											.	CAPSL	91	0			c.T221A						.						98.0	99.0	99.0					5																	35910562		2202	4300	6502	SO:0001583	missense	133690	exon3			TCCATGACCACAG	BC017586	CCDS3912.2	5p13.2	2013-01-10			ENSG00000152611	ENSG00000152611		"""EF-hand domain containing"""	28375	protein-coding gene	gene with protein product						12477932	Standard	NM_001042625		Approved	MGC26610	uc003jju.1	Q8WWF8	OTTHUMG00000131109	ENST00000397367.2:c.221T>A	5.37:g.35910562A>T	ENSP00000380524:p.Val74Asp	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	36.0	NM_144647		Missense_Mutation	SNP	ENST00000397367.2	37	CCDS3912.2	.	.	.	.	.	.	.	.	.	.	A	7.610	0.674700	0.14841	.	.	ENSG00000152611	ENST00000397367;ENST00000397366;ENST00000513623;ENST00000514524	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	5.18	5.18	0.71444	EF-hand-like domain (1);	0.296699	0.36167	N	0.002749	T	0.28764	0.0713	N	0.00268	-1.735	0.54753	D	0.999982	B	0.02656	0.0	B	0.01281	0.0	T	0.44772	-0.9306	10	0.07030	T	0.85	-18.4972	15.0286	0.71687	1.0:0.0:0.0:0.0	.	74	Q8WWF8	CAPSL_HUMAN	D	74	ENSP00000380524:V74D;ENSP00000380523:V74D;ENSP00000424806:V74D;ENSP00000421018:V74D	ENSP00000380523:V74D	V	-	2	0	CAPSL	35946319	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	3.836000	0.55813	1.959000	0.56917	0.379000	0.24179	GTC	.		0.328	CAPSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253772.2	NM_144647	
CASR	846	ucsc.edu;bcgsc.ca	37	3	122003982	122003982	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:122003982A>G	ENST00000490131.1	+	7	3553	c.3181A>G	c.(3181-3183)Agc>Ggc	p.S1061G	CASR_ENST00000296154.5_Missense_Mutation_p.S1061G|CASR_ENST00000498619.1_Missense_Mutation_p.S1071G	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	1061					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CAGTTCACAGAGCTTTGTCAT	0.522																																					p.S1071G		.											.	CASR	97	0			c.A3211G						.						91.0	88.0	89.0					3																	122003982		2199	4295	6494	SO:0001583	missense	846	exon7			TCACAGAGCTTTG	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.3181A>G	3.37:g.122003982A>G	ENSP00000418685:p.Ser1061Gly	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	A	9.967	1.224372	0.22457	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89196	-2.48;-2.48;-2.48	5.48	1.82	0.25136	.	0.254751	0.40302	N	0.001123	T	0.79890	0.4524	L	0.27053	0.805	0.27322	N	0.957015	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.69049	-0.5248	10	0.44086	T	0.13	.	9.2767	0.37703	0.7817:0.0:0.2183:0.0	.	1071;1061	E7ENE0;P41180	.;CASR_HUMAN	G	1061;1071;1061	ENSP00000418685:S1061G;ENSP00000420194:S1071G;ENSP00000296154:S1061G	ENSP00000296154:S1061G	S	+	1	0	CASR	123486672	0.987000	0.35691	0.682000	0.30024	0.963000	0.63663	1.631000	0.37092	0.478000	0.27488	0.454000	0.30748	AGC	.		0.522	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
CCDC6	8030	ucsc.edu;bcgsc.ca	37	10	61554242	61554242	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:61554242G>T	ENST00000263102.6	-	8	1450	c.1219C>A	c.(1219-1221)Cat>Aat	p.H407N		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	407						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GTGATACCATGGGATGTTCCC	0.507			T	RET	NSCLC																																p.H407N		.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	.	CCDC6	686	0			c.C1219A						.						147.0	122.0	131.0					10																	61554242		2203	4300	6503	SO:0001583	missense	8030	exon8			TACCATGGGATGT	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.1219C>A	10.37:g.61554242G>T	ENSP00000263102:p.His407Asn	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_005436	Q15250|Q6GSG7	Missense_Mutation	SNP	ENST00000263102.6	37	CCDS7257.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639713	0.67244	.	.	ENSG00000108091	ENST00000263102	T	0.47869	0.83	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.56543	0.1992	L	0.51422	1.61	0.80722	D	1	P	0.45126	0.851	P	0.55391	0.775	T	0.43114	-0.9411	10	0.09338	T	0.73	-15.4373	19.1934	0.93677	0.0:0.0:1.0:0.0	.	407	Q16204	CCDC6_HUMAN	N	407	ENSP00000263102:H407N	ENSP00000263102:H407N	H	-	1	0	CCDC6	61224248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.718000	0.92993	0.650000	0.86243	CAT	.		0.507	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
CDH8	1006	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	61859057	61859057	+	Missense_Mutation	SNP	T	T	C	rs376133486		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr16:61859057T>C	ENST00000577390.1	-	5	1648	c.694A>G	c.(694-696)Atg>Gtg	p.M232V	CDH8_ENST00000584337.1_Missense_Mutation_p.M232V|CDH8_ENST00000299345.6_Missense_Mutation_p.M232V|CDH8_ENST00000577730.1_Missense_Mutation_p.M232V	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	232	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		TCTCTGTCCATGTTGGGAAGG	0.453																																					p.M232V		.											.	CDH8	161	0			c.A694G						.	T	VAL/MET	1,4405	2.1+/-5.4	0,1,2202	105.0	93.0	97.0		694	6.0	1.0	16		97	0,8600		0,0,4300	no	missense	CDH8	NM_001796.4	21	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	possibly-damaging	232/800	61859057	1,13005	2203	4300	6503	SO:0001583	missense	1006	exon5			TGTCCATGTTGGG	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.694A>G	16.37:g.61859057T>C	ENSP00000462701:p.Met232Val	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	25.0	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.801043	0.90538	2.27E-4	0.0	ENSG00000150394	ENST00000299345	T	0.46063	0.88	6.02	6.02	0.97574	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.52821	0.1758	L	0.31526	0.94	0.80722	D	1	D;P	0.71674	0.998;0.939	D;P	0.66084	0.941;0.724	T	0.56056	-0.8042	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	48;232	Q3LID3;P55286	.;CADH8_HUMAN	V	232	ENSP00000299345:M232V	ENSP00000299345:M232V	M	-	1	0	CDH8	60416558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.991000	0.88244	2.304000	0.77564	0.528000	0.53228	ATG	.		0.453	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
CHD5	26038	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	6196807	6196807	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:6196807A>T	ENST00000262450.3	-	16	2654	c.2555T>A	c.(2554-2556)cTc>cAc	p.L852H	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GTTGTTCTTGAGGCGGTGGGC	0.657																																					p.L852H		.											.	CHD5	719	0			c.T2555A						.						38.0	41.0	40.0					1																	6196807		2203	4300	6503	SO:0001583	missense	26038	exon16			TTCTTGAGGCGGT	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2555T>A	1.37:g.6196807A>T	ENSP00000262450:p.Leu852His	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	17.0	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055912	0.76074	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	D	0.95482	-3.72	4.57	4.57	0.56435	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.56097	D	0.000024	D	0.98321	0.9443	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99548	1.0965	10	0.87932	D	0	-28.3778	14.2217	0.65830	1.0:0.0:0.0:0.0	.	852	Q8TDI0	CHD5_HUMAN	H	852;368;260;260	ENSP00000262450:L852H	ENSP00000262450:L852H	L	-	2	0	CHD5	6119394	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.223000	0.95203	1.828000	0.53243	0.260000	0.18958	CTC	.		0.657	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
CEP350	9857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	180064893	180064893	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:180064893T>C	ENST00000367607.3	+	35	9165	c.8747T>C	c.(8746-8748)gTc>gCc	p.V2916A	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2916					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTATTGGCAGTCCCCCATACT	0.388																																					p.V2916A		.											.	CEP350	26	0			c.T8747C						.						100.0	95.0	97.0					1																	180064893		2203	4300	6503	SO:0001583	missense	9857	exon35			TGGCAGTCCCCCA	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.8747T>C	1.37:g.180064893T>C	ENSP00000356579:p.Val2916Ala	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	31.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.471563	0.84533	.	.	ENSG00000135837	ENST00000367607;ENST00000417046	T	0.72615	-0.67	5.98	5.98	0.97165	.	0.167110	0.27802	N	0.017792	D	0.84229	0.5426	M	0.77103	2.36	0.58432	D	0.999995	D;D	0.76494	0.994;0.999	D;D	0.75484	0.97;0.986	D	0.84706	0.0731	9	.	.	.	.	16.4566	0.84019	0.0:0.0:0.0:1.0	.	2916;2916	E7EU22;Q5VT06	.;CE350_HUMAN	A	2916;380	ENSP00000356579:V2916A	.	V	+	2	0	CEP350	178331516	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.519000	0.73768	2.293000	0.77203	0.477000	0.44152	GTC	.		0.388	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
CPEB4	80315	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	173382915	173382915	+	Silent	SNP	G	G	T	rs199562365		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr5:173382915G>T	ENST00000265085.5	+	10	3419	c.1965G>T	c.(1963-1965)gtG>gtT	p.V655V	CPEB4_ENST00000519467.1_3'UTR|CPEB4_ENST00000334035.5_Silent_p.V638V|CPEB4_ENST00000522336.1_Silent_p.V265V|CPEB4_ENST00000517880.1_Silent_p.V248V|CPEB4_ENST00000520867.1_Silent_p.V630V	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	655	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GATTGCAGGTGGAAGTTAAGC	0.423																																					p.V655V		.											.	CPEB4	90	0			c.G1965T						.						90.0	88.0	89.0					5																	173382915		2203	4300	6503	SO:0001819	synonymous_variant	80315	exon10			GCAGGTGGAAGTT	BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1965G>T	5.37:g.173382915G>T		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	6.0	NM_030627	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Silent	SNP	ENST00000265085.5	37	CCDS4390.1																																																																																			G|0.999;A|0.001		0.423	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252964.2	NM_030627	
CPT1A	1374	ucsc.edu;bcgsc.ca	37	11	68525193	68525193	+	Silent	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:68525193A>G	ENST00000265641.5	-	19	2395	c.2241T>C	c.(2239-2241)tcT>tcC	p.S747S	CPT1A_ENST00000540367.1_Intron|CPT1A_ENST00000539743.1_Silent_p.S747S|CPT1A_ENST00000376618.2_Intron	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	747					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	CAAAGCGATGAGAATCCTTTC	0.393																																					p.S747S		.											.	CPT1A	149	0			c.T2241C						.						96.0	94.0	94.0					11																	68525193		2200	4294	6494	SO:0001819	synonymous_variant	1374	exon19			GCGATGAGAATCC	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.2241T>C	11.37:g.68525193A>G		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001876	Q8TCU0|Q9BWK0	Silent	SNP	ENST00000265641.5	37	CCDS8185.1																																																																																			.		0.393	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41275047	41275047	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:41275047C>T	ENST00000349496.5	+	9	1493	c.1213C>T	c.(1213-1215)Ctt>Ttt	p.L405F	CTNNB1_ENST00000405570.1_Missense_Mutation_p.L405F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.L398F|CTNNB1_ENST00000396183.3_Missense_Mutation_p.L405F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.L405F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	405					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CCTTGGGACTCTTGTTCAGCT	0.418		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.L405F	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	24361	0			c.C1213T						.						150.0	143.0	146.0					3																	41275047		2203	4300	6503	SO:0001583	missense	1499	exon9	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GGGACTCTTGTTC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1213C>T	3.37:g.41275047C>T	ENSP00000344456:p.Leu405Phe	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	18.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939289	0.92526	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14	5.86	5.86	0.93980	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.91236	0.7238	M	0.91090	3.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	D	0.92265	0.5820	10	0.87932	D	0	-0.542	20.1865	0.98220	0.0:1.0:0.0:0.0	.	333;398;405	B4DSW9;B4DGU4;P35222	.;.;CTNB1_HUMAN	F	405;405;405;398;405	ENSP00000385604:L405F;ENSP00000379486:L405F;ENSP00000344456:L405F;ENSP00000411226:L398F;ENSP00000379488:L405F	ENSP00000344456:L405F	L	+	1	0	CTNNB1	41250051	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.775000	0.95449	0.655000	0.94253	CTT	.		0.418	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CUL9	23113	ucsc.edu;bcgsc.ca	37	6	43172823	43172823	+	Missense_Mutation	SNP	G	G	T	rs375196817		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:43172823G>T	ENST00000252050.4	+	23	4686	c.4602G>T	c.(4600-4602)ttG>ttT	p.L1534F	CUL9_ENST00000354495.3_Missense_Mutation_p.L1424F|CUL9_ENST00000372647.2_Missense_Mutation_p.L1534F	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1534					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CTGGCGCCTTGCTGCAGCAGT	0.572																																					p.L1534F		.											.	CUL9	529	0			c.G4602T						.						48.0	49.0	49.0					6																	43172823		2203	4300	6503	SO:0001583	missense	23113	exon23			CGCCTTGCTGCAG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.4602G>T	6.37:g.43172823G>T	ENSP00000252050:p.Leu1534Phe	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	25.0	5.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030267	0.75504	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.76060	-0.99;-0.99;-0.99	5.35	3.46	0.39613	Cullin, N-terminal (1);	0.253039	0.31092	N	0.008269	T	0.75781	0.3896	M	0.68593	2.085	0.43467	D	0.995675	D;P;P	0.55605	0.972;0.872;0.872	D;P;P	0.64321	0.924;0.888;0.888	T	0.77859	-0.2431	10	0.59425	D	0.04	-9.0872	9.0725	0.36502	0.0782:0.1466:0.7752:0.0	.	1424;1534;1534	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	F	1534;1424;1534	ENSP00000252050:L1534F;ENSP00000346490:L1424F;ENSP00000361730:L1534F	ENSP00000252050:L1534F	L	+	3	2	CUL9	43280801	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	3.401000	0.52601	1.263000	0.44181	0.561000	0.74099	TTG	.		0.572	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
DDX42	11325	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61890756	61890756	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr17:61890756G>T	ENST00000578681.1	+	16	2445	c.1844G>T	c.(1843-1845)cGg>cTg	p.R615L	DDX42_ENST00000457800.2_Missense_Mutation_p.R615L|DDX42_ENST00000389924.2_Missense_Mutation_p.R615L|DDX42_ENST00000583590.1_Missense_Mutation_p.R615L|DDX42_ENST00000359353.5_Missense_Mutation_p.R496L	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	615	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						GACCTGGTCCGGAACTTGGAA	0.522																																					p.R615L		.											.	DDX42	230	0			c.G1844T						.						117.0	95.0	102.0					17																	61890756		2203	4300	6503	SO:0001583	missense	11325	exon15			TGGTCCGGAACTT	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.1844G>T	17.37:g.61890756G>T	ENSP00000464050:p.Arg615Leu	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	23.0	NM_203499	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	ENST00000578681.1	37	CCDS32704.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793936	0.90453	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.23147	1.92;1.92	5.52	5.52	0.82312	Helicase, C-terminal (1);	0.207947	0.46758	D	0.000280	T	0.42675	0.1213	L	0.35341	1.055	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.74348	0.983;0.94	T	0.27434	-1.0074	10	0.87932	D	0	-11.7694	18.809	0.92050	0.0:0.0:1.0:0.0	.	161;615	B3KV84;Q86XP3	.;DDX42_HUMAN	L	615;615;332	ENSP00000374574:R615L;ENSP00000390121:R615L	ENSP00000352308:R332L	R	+	2	0	DDX42	59244488	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.841000	0.99482	2.764000	0.94973	0.650000	0.86243	CGG	.		0.522	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372	
DHRS9	10170	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	169938117	169938117	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:169938117T>A	ENST00000327239.4	+	5	1530	c.26T>A	c.(25-27)cTa>cAa	p.L9Q	DHRS9_ENST00000436483.2_Missense_Mutation_p.L9Q|DHRS9_ENST00000428522.1_Missense_Mutation_p.L9Q|DHRS9_ENST00000412271.1_Missense_Mutation_p.L9Q|DHRS9_ENST00000357546.2_Missense_Mutation_p.L9Q|DHRS9_ENST00000421653.1_Intron|DHRS9_ENST00000432060.2_Missense_Mutation_p.L69Q|DHRS9_ENST00000602501.1_Missense_Mutation_p.L9Q	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9	9					9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						CTAGGCCTCCTAATCCTCTGT	0.418																																					p.L9Q		.											.	DHRS9	90	0			c.T26A						.						105.0	103.0	103.0					2																	169938117		2203	4300	6503	SO:0001583	missense	10170	exon5			GCCTCCTAATCCT	AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.26T>A	2.37:g.169938117T>A	ENSP00000316670:p.Leu9Gln	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	11.0	NM_005771	B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Missense_Mutation	SNP	ENST00000327239.4	37	CCDS2231.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.941804	0.73557	.	.	ENSG00000073737	ENST00000327239;ENST00000357546;ENST00000432060;ENST00000428522;ENST00000450153;ENST00000436483;ENST00000412271	D;D;D;D;D;D;D	0.86627	-2.03;-2.03;-2.15;-2.03;-1.61;-2.03;-2.03	5.88	5.88	0.94601	.	0.220080	0.39475	N	0.001341	D	0.83640	0.5298	L	0.41492	1.28	0.37890	D	0.930686	P;P	0.39022	0.613;0.655	B;B	0.38264	0.269;0.15	D	0.86609	0.1871	10	0.59425	D	0.04	.	15.9494	0.79820	0.0:0.0:0.0:1.0	.	69;9	B7Z416;Q9BPW9	.;DHRS9_HUMAN	Q	9;9;69;9;9;9;9	ENSP00000316670:L9Q;ENSP00000350154:L9Q;ENSP00000389241:L69Q;ENSP00000388564:L9Q;ENSP00000391214:L9Q;ENSP00000407167:L9Q;ENSP00000407747:L9Q	ENSP00000316670:L9Q	L	+	2	0	DHRS9	169646363	0.952000	0.32445	0.594000	0.28785	0.872000	0.50106	3.204000	0.51082	2.242000	0.73789	0.533000	0.62120	CTA	.		0.418	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333612.3	NM_005771	
DNTT	1791	ucsc.edu;bcgsc.ca	37	10	98064323	98064323	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:98064323G>T	ENST00000371174.2	+	1	171	c.69G>T	c.(67-69)atG>atT	p.M23I	RP11-35J23.1_ENST00000454484.2_RNA|DNTT_ENST00000419175.1_Missense_Mutation_p.M23I			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	23					DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		GTGCCTTGATGGCCTCCTCTC	0.577																																					p.M23I		.											.	DNTT	228	0			c.G69T						.						49.0	55.0	53.0					10																	98064323		2203	4300	6503	SO:0001583	missense	1791	exon1			CTTGATGGCCTCC	AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.69G>T	10.37:g.98064323G>T	ENSP00000360216:p.Met23Ile	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001017520	Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	ENST00000371174.2	37	CCDS7447.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.816502	0.32145	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.10960	2.82;2.82	5.76	4.79	0.61399	.	0.603260	0.19094	N	0.122870	T	0.10508	0.0257	L	0.39898	1.24	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10730	-1.0617	10	0.33940	T	0.23	-13.1793	12.9636	0.58472	0.0:0.0:0.8072:0.1927	.	23;23	P04053-2;P04053	.;TDT_HUMAN	I	23	ENSP00000401169:M23I;ENSP00000360216:M23I	ENSP00000360216:M23I	M	+	3	0	DNTT	98054313	0.008000	0.16893	0.060000	0.19600	0.123000	0.20343	1.230000	0.32612	2.726000	0.93360	0.655000	0.94253	ATG	.		0.577	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049607.1	NM_004088	
DPYSL4	10570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134018356	134018356	+	Silent	SNP	T	T	C	rs368616410		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:134018356T>C	ENST00000338492.4	+	14	1805	c.1641T>C	c.(1639-1641)gaT>gaC	p.D547D	DPYSL4_ENST00000368627.1_Silent_p.D387D|DPYSL4_ENST00000368629.1_Silent_p.D387D	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	547					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CTCAGGCTGATGACCACATCG	0.622																																					p.D547D		.											.	DPYSL4	514	0			c.T1641C						.	T		1,4405	2.1+/-5.4	0,1,2202	162.0	153.0	156.0		1641	-3.2	0.8	10		156	0,8600		0,0,4300	no	coding-synonymous	DPYSL4	NM_006426.2		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		547/573	134018356	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10570	exon14			GGCTGATGACCAC	AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.1641T>C	10.37:g.134018356T>C		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	29.0	NM_006426	B2RMQ1|D3DRG5|O00240|Q5T0Q7	Silent	SNP	ENST00000338492.4	37	CCDS7665.1																																																																																			.		0.622	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2		
EHMT1	79813	ucsc.edu;bcgsc.ca	37	9	140693366	140693366	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr9:140693366G>T	ENST00000460843.1	+	17	2634	c.2607G>T	c.(2605-2607)caG>caT	p.Q869H		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	869					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TCAACTGTCAGGTACAGCCAC	0.567																																					p.Q869H		.											.	EHMT1	154	0			c.G2607T						.						151.0	113.0	126.0					9																	140693366		2203	4300	6503	SO:0001630	splice_region_variant	79813	exon17			CTGTCAGGTACAG	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.2607+1G>T	9.37:g.140693366G>T		Somatic	25.0	0.0		WXS	Illumina HiSeq	.	23.0	4.0	NM_024757	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	ENST00000460843.1	37	CCDS7050.2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438036	0.83885	.	.	ENSG00000181090	ENST00000371400;ENST00000460843	T	0.65732	-0.17	5.61	5.61	0.85477	Ankyrin repeat-containing domain (4);	0.050142	0.85682	D	0.000000	T	0.77025	0.4070	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.77645	-0.2510	10	0.66056	D	0.02	.	19.6207	0.95654	0.0:0.0:1.0:0.0	.	869	Q9H9B1	EHMT1_HUMAN	H	838;869	ENSP00000417980:Q869H	ENSP00000360453:Q838H	Q	+	3	2	EHMT1	139813187	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	8.776000	0.91776	2.646000	0.89796	0.561000	0.74099	CAG	.		0.567	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757	Missense_Mutation
ENGASE	64772	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	77077980	77077980	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr17:77077980G>T	ENST00000579016.1	+	7	873	c.873G>T	c.(871-873)agG>agT	p.R291S	ENGASE_ENST00000539857.2_Splice_Site_p.R105S	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	291	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.					cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						TGCTTCTCAGGGTCTTCTTTG	0.607																																					p.R291S		.											.	ENGASE	91	0			c.G873T						.						95.0	105.0	102.0					17																	77077980		1951	4141	6092	SO:0001630	splice_region_variant	64772	exon7			TCTCAGGGTCTTC	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.873-1G>T	17.37:g.77077980G>T		Somatic	99.0	1.0		WXS	Illumina HiSeq	Phase_I	116.0	37.0	NM_001042573	Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	ENST00000579016.1	37	CCDS42394.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634643	0.47049	.	.	ENSG00000167280	ENST00000311595;ENST00000545583	.	.	.	4.34	1.27	0.21489	Glycoside hydrolase, family 85 (1);	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	M	0.73217	2.22	0.49687	D	0.999815	P;P;B	0.49185	0.92;0.722;0.067	P;B;B	0.47603	0.551;0.338;0.064	T	0.55095	-0.8194	8	.	.	.	.	8.401	0.32586	0.3253:0.0:0.6747:0.0	.	105;291;291	B4DVK0;Q8NFI3;Q8NFI3-3	.;ENASE_HUMAN;.	S	291	.	.	R	+	3	2	ENGASE	74589575	1.000000	0.71417	0.991000	0.47740	0.475000	0.33008	1.833000	0.39161	0.140000	0.18849	0.313000	0.20887	AGG	.		0.607	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395807.1	NM_022759	Missense_Mutation
EPB41L3	23136	ucsc.edu;bcgsc.ca	37	18	5397364	5397364	+	Missense_Mutation	SNP	G	G	T	rs140230336	byFrequency	TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr18:5397364G>T	ENST00000341928.2	-	18	2874	c.2534C>A	c.(2533-2535)cCg>cAg	p.P845Q	EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000427684.2_Missense_Mutation_p.P142Q|EPB41L3_ENST00000400111.3_Missense_Mutation_p.P623Q|EPB41L3_ENST00000342933.3_Missense_Mutation_p.P845Q|EPB41L3_ENST00000540638.2_Missense_Mutation_p.P623Q|EPB41L3_ENST00000544123.1_Missense_Mutation_p.P676Q|EPB41L3_ENST00000542146.1_Missense_Mutation_p.P150Q	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	845	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						AGTGCTAAGCGGCAGGTGGTG	0.587																																					p.P845Q		.											.	EPB41L3	95	0			c.C2534A						.						53.0	57.0	56.0					18																	5397364		2203	4300	6503	SO:0001583	missense	23136	exon18			CTAAGCGGCAGGT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2534C>A	18.37:g.5397364G>T	ENSP00000343158:p.Pro845Gln	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	5.945	0.358363	0.11239	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;D;T;T;T;D	0.82803	-1.37;-1.51;0.06;0.04;-1.37;-1.65	5.94	1.6	0.23607	.	1.588400	0.02962	N	0.143216	T	0.79375	0.4435	N	0.11064	0.09	0.26304	N	0.977929	B;D;B;B;B;B;B;B	0.89917	0.041;1.0;0.263;0.007;0.0;0.001;0.016;0.102	B;D;B;B;B;B;B;B	0.91635	0.028;0.999;0.183;0.01;0.002;0.017;0.01;0.026	T	0.69884	-0.5024	10	0.09843	T	0.71	.	3.1073	0.06346	0.0878:0.1354:0.4001:0.3767	.	676;142;150;237;514;623;845;80	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	Q	845;514;676;514;142;150;845;623	ENSP00000343158:P845Q;ENSP00000441174:P676Q;ENSP00000392195:P142Q;ENSP00000442233:P150Q;ENSP00000341138:P845Q;ENSP00000382981:P623Q	ENSP00000343158:P845Q	P	-	2	0	EPB41L3	5387364	0.043000	0.20138	0.117000	0.21633	0.009000	0.06853	0.335000	0.19806	0.364000	0.24374	0.591000	0.81541	CCG	G|0.998;A|0.002		0.587	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
EPHA3	2042	ucsc.edu;bcgsc.ca	37	3	89391167	89391167	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:89391167C>A	ENST00000336596.2	+	5	1458	c.1233C>A	c.(1231-1233)gcC>gcA	p.A411A	EPHA3_ENST00000494014.1_Silent_p.A411A|EPHA3_ENST00000452448.2_Silent_p.A411A	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	411	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.A411A(2)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AGATTGATGCCGTTAATGGGG	0.498										TSP Lung(6;0.00050)																											p.A411A		.											.	EPHA3	1500	2	Substitution - coding silent(2)	central_nervous_system(2)	c.C1233A						.						86.0	70.0	75.0					3																	89391167		2203	4300	6503	SO:0001819	synonymous_variant	2042	exon5			TGATGCCGTTAAT	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1233C>A	3.37:g.89391167C>A		Somatic	42.0	0.0		WXS	Illumina HiSeq	.	53.0	5.0	NM_005233	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1																																																																																			.		0.498	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
EPHA6	285220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	97202883	97202883	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:97202883T>C	ENST00000514100.1	+	7	598	c.356T>C	c.(355-357)aTt>aCt	p.I119T	EPHA6_ENST00000389672.5_Missense_Mutation_p.I727T|EPHA6_ENST00000502694.1_Missense_Mutation_p.I119T|EPHA6_ENST00000442602.2_Missense_Mutation_p.I93T	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	633	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AGAATTCGTATTGAGAGAGTC	0.358																																					p.I727T		.											.	EPHA6	1561	0			c.T2180C						.						95.0	95.0	95.0					3																	97202883		1851	4110	5961	SO:0001583	missense	285220	exon10			TTCGTATTGAGAG	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.356T>C	3.37:g.97202883T>C	ENSP00000421711:p.Ile119Thr	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	39.0	NM_001080448	D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37		.	.	.	.	.	.	.	.	.	.	T	21.8	4.198363	0.79015	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67	5.42	5.42	0.78866	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.89389	0.6701	L	0.59967	1.855	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.996;1.0	D;D;D;D	0.91635	0.999;0.999;0.99;0.999	D	0.90503	0.4475	9	0.87932	D	0	.	15.5233	0.75881	0.0:0.0:0.0:1.0	.	93;632;119;119	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	T	727;119;119;93	ENSP00000374323:I727T;ENSP00000421711:I119T;ENSP00000423950:I119T;ENSP00000403100:I93T	ENSP00000374323:I727T	I	+	2	0	EPHA6	98685573	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.695000	0.84257	2.071000	0.62044	0.454000	0.30748	ATT	.		0.358	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
ERGIC2	51290	ucsc.edu;bcgsc.ca	37	12	29509352	29509352	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr12:29509352T>C	ENST00000360150.4	-	8	610	c.535A>G	c.(535-537)Aat>Gat	p.N179D		NM_016570.2	NP_057654.2	Q96RQ1	ERGI2_HUMAN	ERGIC and golgi 2	179					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)				endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)					GCTACTTTATTGACATATAGA	0.318																																					p.N179D		.											.	ERGIC2	91	0			c.A535G						.						146.0	145.0	145.0					12																	29509352		1841	4101	5942	SO:0001583	missense	51290	exon8			CTTTATTGACATA	AF216751	CCDS41765.1	12p11.22	2006-02-08							30208	protein-coding gene	gene with protein product		612236				11445006, 12932305	Standard	NM_016570		Approved	PTX1, Erv41	uc001riv.3	Q96RQ1		ENST00000360150.4:c.535A>G	12.37:g.29509352T>C	ENSP00000353270:p.Asn179Asp	Somatic	37.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_016570	A6NHH6|Q53GY2|Q8N2Q9|Q9BVV9|Q9NZA3	Missense_Mutation	SNP	ENST00000360150.4	37	CCDS41765.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.415068	0.83449	.	.	ENSG00000087502	ENST00000360150;ENST00000201023;ENST00000546839;ENST00000550353	.	.	.	4.96	4.96	0.65561	Domain of unknown function DUF1692 (1);	0.000000	0.85682	D	0.000000	T	0.81211	0.4775	M	0.88775	2.98	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.84709	0.0733	9	0.72032	D	0.01	.	12.6013	0.56499	0.0:0.0:0.0:1.0	.	179	Q96RQ1	ERGI2_HUMAN	D	179;187;179;161	.	ENSP00000201023:N187D	N	-	1	0	ERGIC2	29400619	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.141000	0.77330	1.865000	0.54081	0.477000	0.44152	AAT	.		0.318	ERGIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403489.1	NM_016570	
ESRP1	54845	ucsc.edu;bcgsc.ca	37	8	95654259	95654259	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr8:95654259A>G	ENST00000433389.2	+	2	398	c.208A>G	c.(208-210)Ata>Gta	p.I70V	RP11-22C11.2_ENST00000562760.1_RNA|ESRP1_ENST00000423620.2_Missense_Mutation_p.I70V|ESRP1_ENST00000454170.2_Missense_Mutation_p.I70V|ESRP1_ENST00000358397.5_Missense_Mutation_p.I70V	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	70					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						AGAAACTAAAATAGACGTCGA	0.597																																					p.I70V		.											.	ESRP1	94	0			c.A208G						.						69.0	77.0	74.0					8																	95654259		1960	4158	6118	SO:0001583	missense	54845	exon2			ACTAAAATAGACG	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.208A>G	8.37:g.95654259A>G	ENSP00000405738:p.Ile70Val	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.318311	0.40996	.	.	ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	4.96	3.78	0.43462	Ribonuclease H-like (1);	0.243433	0.41712	D	0.000828	T	0.29850	0.0746	N	0.14661	0.345	0.32812	D	0.501555	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.001;0.001;0.002;0.001	T	0.27640	-1.0068	10	0.16896	T	0.51	-5.3599	7.2182	0.25971	0.7734:0.1479:0.0786:0.0	.	70;70;70;70;70	Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.;.;.;.;ESRP1_HUMAN	V	70	ENSP00000407349:I70V;ENSP00000405738:I70V;ENSP00000351168:I70V;ENSP00000402766:I70V	ENSP00000351168:I70V	I	+	1	0	ESRP1	95723435	0.998000	0.40836	1.000000	0.80357	0.883000	0.51084	1.531000	0.36018	0.709000	0.31976	0.533000	0.62120	ATA	.		0.597	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
FAM193A	8603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	2698242	2698242	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr4:2698242G>T	ENST00000324666.5	+	16	2907	c.2556G>T	c.(2554-2556)ttG>ttT	p.L852F	FAM193A_ENST00000545951.1_Missense_Mutation_p.L852F|FAM193A_ENST00000505311.1_Missense_Mutation_p.L852F|FAM193A_ENST00000382839.3_Missense_Mutation_p.L852F|FAM193A_ENST00000502458.1_Missense_Mutation_p.L874F	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	852										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						AGGATTTGTTGCAGTTTATAA	0.502																																					p.L874F		.											.	FAM193A	93	0			c.G2622T						.						113.0	107.0	109.0					4																	2698242		2203	4300	6503	SO:0001583	missense	8603	exon17			TTTGTTGCAGTTT	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.2556G>T	4.37:g.2698242G>T	ENSP00000324587:p.Leu852Phe	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	54.0	NM_001256667	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	37	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781587	0.70222	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.56275	0.58;0.99;0.56;0.58;0.47	5.26	-5.2	0.02823	.	0.077181	0.53938	D	0.000059	T	0.59878	0.2226	M	0.64404	1.975	0.49687	D	0.999815	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.996	D;D;D;P;P	0.68192	0.956;0.94;0.956;0.9;0.9	T	0.63576	-0.6606	10	0.87932	D	0	-14.2123	9.918	0.41446	0.1826:0.244:0.5734:0.0	.	852;874;852;874;852	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	F	852;852;852;874;706	ENSP00000372290:L852F;ENSP00000324587:L852F;ENSP00000443617:L852F;ENSP00000427505:L874F;ENSP00000427260:L706F	ENSP00000324587:L852F	L	+	3	2	FAM193A	2668040	0.916000	0.31088	0.444000	0.26895	0.934000	0.57294	0.095000	0.15127	-0.970000	0.03569	-0.331000	0.08364	TTG	.		0.502	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
FCGR1A	2209	bcgsc.ca;mdanderson.org	37	1	149761838	149761838	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:149761838C>A	ENST00000369168.4	+	5	842	c.788C>A	c.(787-789)gCc>gAc	p.A263D	RP11-196G18.3_ENST00000428289.1_RNA|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000545683.1_Intron	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	263	Ig-like C2-type 3.				antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGCGAGGCTGCCACAGAGGAT	0.517																																					p.A263D		.											.	FCGR1A	23	0			c.C788A						.						1.0	2.0	1.0					1																	149761838		1113	2649	3762	SO:0001583	missense	2209	exon5			AGGCTGCCACAGA	BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.788C>A	1.37:g.149761838C>A	ENSP00000358165:p.Ala263Asp	Somatic	165.0	2.0		WXS	Illumina HiSeq	Phase_1	203.0	91.0	NM_000566	P12315|Q5QNW7|Q92495|Q92663	Missense_Mutation	SNP	ENST00000369168.4	37	CCDS933.1	.	.	.	.	.	.	.	.	.	.	C	7.707	0.694294	0.15039	.	.	ENSG00000150337	ENST00000444948;ENST00000369168	T;T	0.12255	2.7;2.7	3.36	1.48	0.22813	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.214490	0.02526	N	0.093110	T	0.06962	0.0177	L	0.58669	1.825	0.09310	N	0.999997	B	0.23128	0.08	B	0.33295	0.161	T	0.38520	-0.9657	10	0.41790	T	0.15	.	5.314	0.15845	0.0:0.734:0.0:0.266	.	263	P12314	FCGR1_HUMAN	D	171;263	ENSP00000394279:A171D;ENSP00000358165:A263D	ENSP00000358165:A263D	A	+	2	0	FCGR1A	148028462	0.833000	0.29383	0.078000	0.20375	0.012000	0.07955	0.878000	0.28126	0.427000	0.26145	-0.192000	0.12808	GCC	.		0.517	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566	
FGA	2243	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	155505870	155505870	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr4:155505870C>A	ENST00000302053.3	-	6	2085	c.2007G>T	c.(2005-2007)ttG>ttT	p.L669F		NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	669	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	GCCATCCTCCCAAACTGGTCT	0.448																																					p.L669F	NSCLC(143;340 1922 20892 22370 48145)	.											.	FGA	93	0			c.G2007T						.						63.0	63.0	63.0					4																	155505870		2203	4300	6503	SO:0001583	missense	2243	exon6			TCCTCCCAAACTG		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.2007G>T	4.37:g.155505870C>A	ENSP00000306361:p.Leu669Phe	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	7.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419173	0.83559	.	.	ENSG00000171560	ENST00000302053	D	0.97089	-4.24	5.61	5.61	0.85477	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.229367	0.46758	D	0.000280	D	0.98280	0.9430	M	0.69823	2.125	0.80722	D	1	D	0.54207	0.965	D	0.73380	0.98	D	0.98784	1.0733	10	0.59425	D	0.04	.	19.628	0.95687	0.0:1.0:0.0:0.0	.	669	P02671	FIBA_HUMAN	F	669	ENSP00000306361:L669F	ENSP00000306361:L669F	L	-	3	2	FGA	155725320	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.745000	0.68672	2.643000	0.89663	0.650000	0.86243	TTG	.		0.448	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
GALNT18	374378	ucsc.edu;bcgsc.ca	37	11	11348656	11348656	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:11348656T>C	ENST00000227756.4	-	9	1900	c.1489A>G	c.(1489-1491)Atc>Gtc	p.I497V		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	497	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.I497V(1)									CCATGGCAGATGTACATGATG	0.517																																					p.I497V		.											.	.	.	1	Substitution - Missense(1)	lung(1)	c.A1489G						.						133.0	114.0	121.0					11																	11348656		2201	4294	6495	SO:0001583	missense	374378	exon9			GGCAGATGTACAT	AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.1489A>G	11.37:g.11348656T>C	ENSP00000227756:p.Ile497Val	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_198516	O95903|Q8NDY9	Missense_Mutation	SNP	ENST00000227756.4	37	CCDS7807.1	.	.	.	.	.	.	.	.	.	.	T	9.549	1.115540	0.20795	.	.	ENSG00000110328	ENST00000227756	T	0.26067	1.76	5.78	3.14	0.36123	Ricin B-related lectin (1);Ricin B lectin (3);	0.502579	0.21309	N	0.076676	T	0.17959	0.0431	L	0.36672	1.1	0.30403	N	0.77981	B	0.19073	0.033	B	0.23018	0.043	T	0.14227	-1.0480	10	0.22109	T	0.4	.	7.7267	0.28763	0.1293:0.0:0.2368:0.6339	.	497	Q6P9A2	GLTL4_HUMAN	V	497	ENSP00000227756:I497V	ENSP00000227756:I497V	I	-	1	0	GALNTL4	11305232	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.557000	0.45871	0.978000	0.38470	0.460000	0.39030	ATC	.		0.517	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385848.1	NM_198516	
GH2	2689	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	61957781	61957781	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr17:61957781T>G	ENST00000423893.2	-	5	615	c.554A>C	c.(553-555)aAc>aCc	p.N185T	GH2_ENST00000332800.7_3'UTR|GH2_ENST00000456543.2_Missense_Mutation_p.T184P|GH2_ENST00000449787.2_Missense_Mutation_p.N170T			P01242	SOM2_HUMAN	growth hormone 2	185					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						CAGCCCGTAGTTCTTGAGCAG	0.557																																					p.N185T		.											.	GH2	93	0			c.A554C						.						199.0	163.0	176.0					17																	61957781		2203	4300	6503	SO:0001583	missense	2689	exon5			CCGTAGTTCTTGA	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.554A>C	17.37:g.61957781T>G	ENSP00000409294:p.Asn185Thr	Somatic	307.0	1.0		WXS	Illumina HiSeq	Phase_I	334.0	34.0	NM_002059	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	37	CCDS11647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	11.71|11.71	1.718645|1.718645	0.30503|0.30503	.|.	.|.	ENSG00000136487|ENSG00000136487	ENST00000423893;ENST00000449787|ENST00000456543	D;D|D	0.88277|0.88201	-2.36;-2.36|-2.35	2.74|2.74	2.74|2.74	0.32292|0.32292	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);|.	.|.	.|.	.|.	.|.	D|D	0.93083|0.93083	0.7798|0.7798	M|M	0.85859|0.85859	2.78|2.78	0.80722|0.80722	D|D	1|1	D;D|D	0.89917|0.76494	1.0;0.993|0.999	D;D|D	0.91635|0.69824	0.999;0.985|0.966	D|D	0.92039|0.92039	0.5639|0.5639	9|9	0.87932|0.87932	D|D	0|0	.|.	6.127|6.127	0.20184|0.20184	0.2271:0.0:0.0:0.7728|0.2271:0.0:0.0:0.7728	.|.	185;170|184	P01242;O14643|O14644	SOM2_HUMAN;.|.	T|P	185;170|184	ENSP00000409294:N185T;ENSP00000410618:N170T|ENSP00000394122:T184P	ENSP00000409294:N185T|ENSP00000394122:T184P	N|T	-|-	2|1	0|0	GH2|GH2	59311513|59311513	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.021000|0.021000	0.10359|0.10359	1.829000|1.829000	0.39121|0.39121	1.255000|1.255000	0.44051|0.44051	0.254000|0.254000	0.18369|0.18369	AAC|ACT	.		0.557	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
GPHN	10243	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	67382766	67382766	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr14:67382766G>C	ENST00000315266.5	+	6	1557	c.436G>C	c.(436-438)Ggt>Cgt	p.G146R	GPHN_ENST00000543237.1_Missense_Mutation_p.G159R|GPHN_ENST00000305960.9_Missense_Mutation_p.G115R|GPHN_ENST00000459628.1_Missense_Mutation_p.G128R|GPHN_ENST00000478722.1_Missense_Mutation_p.G146R|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	146	Interaction with GABARAP. {ECO:0000250}.|MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		TAACCTGCCAGGTAGCAAGAA	0.413			T	MLL	AL																																p.G146R		.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	228	0			c.G436C						.						124.0	116.0	119.0					14																	67382766		2203	4300	6503	SO:0001583	missense	10243	exon6			CTGCCAGGTAGCA	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.436G>C	14.37:g.67382766G>C	ENSP00000312771:p.Gly146Arg	Somatic	70.0	1.0		WXS	Illumina HiSeq	Phase_I	73.0	20.0	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	35	5.494678	0.96339	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000459628;ENST00000543237;ENST00000305960;ENST00000555456	D;D;D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34;-3.34;-3.34	5.95	5.95	0.96441	Molybdenum cofactor synthesis (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	D	0.98429	0.9477	H	0.98721	4.31	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;1.0	D	0.99023	1.0818	10	0.87932	D	0	-10.5401	20.3802	0.98930	0.0:0.0:1.0:0.0	.	115;159;146;146;128	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2;G3V582	.;.;GEPH_HUMAN;.;.	R	146;146;128;159;115;79	ENSP00000312771:G146R;ENSP00000417901:G146R;ENSP00000452220:G128R;ENSP00000438404:G159R;ENSP00000303019:G115R;ENSP00000450706:G79R	ENSP00000303019:G115R	G	+	1	0	GPHN	66452519	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.624000	0.98398	2.822000	0.97130	0.563000	0.77884	GGT	.		0.413	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
GPR34	2857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	41555141	41555141	+	Silent	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chrX:41555141A>G	ENST00000378142.4	+	3	539	c.255A>G	c.(253-255)aaA>aaG	p.K85K	GPR34_ENST00000378138.5_Silent_p.K85K|CASK_ENST00000378163.1_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000442742.2_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	85					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						TTCACCGTAAAAGAAATTCCA	0.388																																					p.K85K		.											.	GPR34	131	0			c.A255G						.						113.0	104.0	107.0					X																	41555141		2203	4300	6503	SO:0001819	synonymous_variant	2857	exon3			CCGTAAAAGAAAT	AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.255A>G	X.37:g.41555141A>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	50.0	NM_001097579	O95853	Silent	SNP	ENST00000378142.4	37	CCDS14258.1																																																																																			.		0.388	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056264.1	NM_005300	
GYLTL1B	120071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	45948313	45948313	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:45948313C>T	ENST00000531526.1	+	10	1327	c.1216C>T	c.(1216-1218)Cgg>Tgg	p.R406W	GYLTL1B_ENST00000389968.3_Missense_Mutation_p.R133W|GYLTL1B_ENST00000536139.1_Missense_Mutation_p.R375W|GYLTL1B_ENST00000529052.1_Missense_Mutation_p.R375W|GYLTL1B_ENST00000325468.5_Missense_Mutation_p.R406W|GYLTL1B_ENST00000401752.1_Missense_Mutation_p.R406W	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	406					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		CTTTGAGTTCCGGCAGCAGCA	0.627																																					p.R406W		.											.	GYLTL1B	92	0			c.C1216T						.						76.0	75.0	75.0					11																	45948313		2203	4299	6502	SO:0001583	missense	120071	exon10			GAGTTCCGGCAGC		CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	ENST00000531526.1:c.1216C>T	11.37:g.45948313C>T	ENSP00000432869:p.Arg406Trp	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	16.0	NM_152312	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Missense_Mutation	SNP	ENST00000531526.1	37	CCDS31473.1	.	.	.	.	.	.	.	.	.	.	C	32	5.145324	0.94603	.	.	ENSG00000165905	ENST00000529052;ENST00000531526;ENST00000401752;ENST00000389968;ENST00000325468;ENST00000536139;ENST00000534410	T;T;T;D;T;T	0.84070	0.82;0.81;0.81;-1.8;0.81;0.82	5.37	5.37	0.77165	.	0.054698	0.85682	D	0.000000	D	0.90817	0.7116	M	0.79805	2.47	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.998	P;P;P	0.61275	0.88;0.776;0.886	D	0.91802	0.5452	10	0.72032	D	0.01	-21.1699	19.1135	0.93328	0.0:1.0:0.0:0.0	.	375;375;406	B3KP69;E9PIZ2;Q8N3Y3	.;.;LARG2_HUMAN	W	375;406;406;133;406;375;67	ENSP00000431932:R375W;ENSP00000432869:R406W;ENSP00000385235:R406W;ENSP00000374618:R133W;ENSP00000324570:R406W;ENSP00000445044:R375W	ENSP00000324570:R406W	R	+	1	2	GYLTL1B	45904889	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.438000	0.80431	2.528000	0.85240	0.561000	0.74099	CGG	.		0.627	GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392572.1	NM_152312	
HDAC10	83933	ucsc.edu;bcgsc.ca	37	22	50686155	50686155	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr22:50686155A>G	ENST00000216271.5	-	14	1740	c.1388T>C	c.(1387-1389)cTc>cCc	p.L463P	HDAC10_ENST00000349505.4_Missense_Mutation_p.L443P|HDAC10_ENST00000448072.1_Missense_Mutation_p.L413P|HDAC10_ENST00000498366.1_5'UTR|TUBGCP6_ENST00000439308.2_5'Flank|MAPK12_ENST00000497036.1_5'UTR	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	463					chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GAGGTACAGGAGCTTCCCAAG	0.647																																					p.L463P		.											.	HDAC10	226	0			c.T1388C						.						115.0	91.0	99.0					22																	50686155		2203	4300	6503	SO:0001583	missense	83933	exon14			TACAGGAGCTTCC	AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.1388T>C	22.37:g.50686155A>G	ENSP00000216271:p.Leu463Pro	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_032019	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Missense_Mutation	SNP	ENST00000216271.5	37	CCDS14088.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.053513	0.55218	.	.	ENSG00000100429	ENST00000216271;ENST00000448072;ENST00000349505	T;T;T	0.30981	1.51;1.51;1.51	5.47	4.42	0.53409	.	0.825684	0.10686	N	0.645859	T	0.25082	0.0609	L	0.29908	0.895	0.80722	D	1	B;B;B;B	0.21821	0.034;0.02;0.061;0.02	B;B;B;B	0.20955	0.022;0.01;0.032;0.01	T	0.03086	-1.1074	10	0.72032	D	0.01	-8.9506	9.6546	0.39919	0.8252:0.1748:0.0:0.0	.	443;413;463;463	Q969S8-2;C9J8B8;Q969S8-4;Q969S8	.;.;.;HDA10_HUMAN	P	463;413;443	ENSP00000216271:L463P;ENSP00000397542:L413P;ENSP00000343540:L443P	ENSP00000216271:L463P	L	-	2	0	HDAC10	49028282	0.625000	0.27111	0.661000	0.29709	0.609000	0.37215	1.099000	0.31013	0.872000	0.35775	0.482000	0.46254	CTC	.		0.647	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104141.4	NM_032019	
HELZ2	85441	ucsc.edu;bcgsc.ca	37	20	62196247	62196247	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr20:62196247G>T	ENST00000467148.1	-	8	3997	c.3928C>A	c.(3928-3930)Ccg>Acg	p.P1310T	HELZ2_ENST00000427522.2_Missense_Mutation_p.P741T	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1310					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P1310S(1)									TGGTCCGACGGGGGCACCCTC	0.672																																					p.P1310T		.											.	.	.	1	Substitution - Missense(1)	skin(1)	c.C3928A						.						30.0	34.0	33.0					20																	62196247		2200	4299	6499	SO:0001583	missense	85441	exon9			CCGACGGGGGCAC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3928C>A	20.37:g.62196247G>T	ENSP00000417401:p.Pro1310Thr	Somatic	69.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.076525	0.00375	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.28454	1.61;1.61	4.66	-9.32	0.00643	.	3.096240	0.00797	N	0.001399	T	0.08133	0.0203	N	0.02011	-0.69	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.0;0.001	T	0.19192	-1.0313	10	0.12766	T	0.61	-0.3931	2.147	0.03790	0.14:0.1151:0.3249:0.42	.	1310;741	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	T	741;1310	ENSP00000393257:P741T;ENSP00000417401:P1310T	ENSP00000393257:P741T	P	-	1	0	RP4-697K14.7	61666691	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.453000	0.06778	-1.431000	0.01982	0.436000	0.28706	CCG	.		0.672	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	28465614	28465614	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:28465614G>T	ENST00000261609.7	-	37	5937	c.5829C>A	c.(5827-5829)gaC>gaA	p.D1943E		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CATCCTCTGTGTCCGAATCCT	0.572																																					p.D1943E		.											.	HERC2	234	0			c.C5829A						.						140.0	137.0	138.0					15																	28465614		2203	4300	6503	SO:0001583	missense	8924	exon37			CTCTGTGTCCGAA	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.5829C>A	15.37:g.28465614G>T	ENSP00000261609:p.Asp1943Glu	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	9.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892424	0.33442	.	.	ENSG00000128731	ENST00000261609	T	0.37235	1.21	4.64	3.69	0.42338	.	0.105688	0.64402	D	0.000008	T	0.40498	0.1119	L	0.28274	0.84	0.58432	D	0.999999	D	0.58970	0.984	D	0.68192	0.956	T	0.05209	-1.0899	10	0.11182	T	0.66	.	13.2565	0.60081	0.0788:0.0:0.9212:0.0	.	1943	O95714	HERC2_HUMAN	E	1943	ENSP00000261609:D1943E	ENSP00000261609:D1943E	D	-	3	2	HERC2	26139209	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	4.399000	0.59703	2.411000	0.81874	0.650000	0.86243	GAC	.		0.572	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HIST1H3B	8358	ucsc.edu;bcgsc.ca	37	6	26032260	26032260	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:26032260T>C	ENST00000244661.2	-	1	28	c.29A>G	c.(28-30)aAa>aGa	p.K10R		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	10					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						GCCGGTGGATTTCCGAGCTGT	0.562																																					p.K10R		.											.	HIST1H3B	92	0			c.A29G						.						81.0	94.0	89.0					6																	26032260		2084	4115	6199	SO:0001583	missense	8358	exon1			GTGGATTTCCGAG	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.29A>G	6.37:g.26032260T>C	ENSP00000244661:p.Lys10Arg	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_003537	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	37	CCDS4573.1	.	.	.	.	.	.	.	.	.	.	t	10.55	1.382917	0.25031	.	.	ENSG00000124693	ENST00000244661	T	0.47528	0.84	5.3	5.3	0.74995	.	.	.	.	.	T	0.54549	0.1865	.	.	.	0.38148	D	0.938665	.	.	.	.	.	.	T	0.62334	-0.6876	6	0.87932	D	0	.	14.727	0.69351	0.0:0.0:0.0:1.0	.	.	.	.	R	10	ENSP00000244661:K10R	ENSP00000244661:K10R	K	-	2	0	HIST1H3B	26140239	1.000000	0.71417	0.284000	0.24805	0.007000	0.05969	7.858000	0.86971	2.139000	0.66308	0.459000	0.35465	AAA	.		0.562	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537	
HUNK	30811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	33296847	33296847	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr21:33296847G>A	ENST00000270112.2	+	2	689	c.329G>A	c.(328-330)cGa>cAa	p.R110Q		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						AACCTGCGGCGAGAGGGTCAG	0.463																																					p.R110Q		.											.	HUNK	334	0			c.G329A						.						58.0	54.0	55.0					21																	33296847		2203	4300	6503	SO:0001583	missense	30811	exon2			TGCGGCGAGAGGG	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.329G>A	21.37:g.33296847G>A	ENSP00000270112:p.Arg110Gln	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	18.0	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573179	0.86542	.	.	ENSG00000142149	ENST00000270112	T	0.27890	1.64	4.86	4.86	0.63082	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067411	0.64402	D	0.000017	T	0.52773	0.1755	L	0.55017	1.72	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.55496	-0.8132	10	0.87932	D	0	-5.5714	18.1961	0.89822	0.0:0.0:1.0:0.0	.	110	P57058	HUNK_HUMAN	Q	110	ENSP00000270112:R110Q	ENSP00000270112:R110Q	R	+	2	0	HUNK	32218718	1.000000	0.71417	0.996000	0.52242	0.534000	0.34807	9.205000	0.95048	2.513000	0.84729	0.650000	0.86243	CGA	.		0.463	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
IKBKE	9641	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	206649567	206649567	+	Silent	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:206649567C>T	ENST00000367120.3	+	6	775	c.402C>T	c.(400-402)cgC>cgT	p.R134R	IKBKE_ENST00000537984.1_Silent_p.R49R	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.R134R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					TTGTGCATCGCGACATCAAGC	0.627																																					p.R134R		.											.	IKBKE	1061	1	Substitution - coding silent(1)	large_intestine(1)	c.C402T						.						97.0	82.0	87.0					1																	206649567		2203	4300	6503	SO:0001819	synonymous_variant	9641	exon6			GCATCGCGACATC	AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.402C>T	1.37:g.206649567C>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	38.0	NM_001193322	D3DT78|Q3B754|Q3KR43|Q5JTS6	Silent	SNP	ENST00000367120.3	37	CCDS30996.1																																																																																			.		0.627	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088484.1		
INTS10	55174	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	19682357	19682358	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr8:19682357_19682358insA	ENST00000397977.3	+	8	1278_1279	c.880_881insA	c.(880-882)tacfs	p.Y294fs		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	294					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		TCTCTGCAGATACATGAACAAC	0.371																																					p.Y294_M295delinsX		.											.	INTS10	91	0			c.880_881insA						.																																			SO:0001589	frameshift_variant	55174	exon8			TGCAGATACATGA	AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.881dupA	8.37:g.19682358_19682358dupA	ENSP00000381064:p.Tyr294fs	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	27.0	NM_018142	Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Nonsense_Mutation	INS	ENST00000397977.3	37	CCDS6011.2																																																																																			.		0.371	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253724.2	NM_018142	
IQUB	154865	ucsc.edu;bcgsc.ca	37	7	123101527	123101527	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr7:123101527G>T	ENST00000466202.1	-	11	2467	c.1891C>A	c.(1891-1893)Ctt>Att	p.L631I	IQUB_ENST00000324698.6_Missense_Mutation_p.L631I|RP11-332K15.1_ENST00000419832.1_RNA	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	631					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						TCATTCTGAAGGTTAATGCAG	0.373																																					p.L631I		.											.	IQUB	156	0			c.C1891A						.						105.0	99.0	101.0					7																	123101527		2203	4299	6502	SO:0001583	missense	154865	exon11			TCTGAAGGTTAAT	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1891C>A	7.37:g.123101527G>T	ENSP00000417769:p.Leu631Ile	Somatic	68.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_178827	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	ENST00000466202.1	37	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.014424	0.54468	.	.	ENSG00000164675	ENST00000466202;ENST00000324698	T;T	0.28255	1.62;1.62	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.55210	0.1906	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.56105	-0.8034	10	0.66056	D	0.02	.	13.5474	0.61713	0.0709:0.0:0.9291:0.0	.	631	Q8NA54	IQUB_HUMAN	I	631	ENSP00000417769:L631I;ENSP00000324882:L631I	ENSP00000324882:L631I	L	-	1	0	IQUB	122888763	1.000000	0.71417	0.978000	0.43139	0.296000	0.27459	4.342000	0.59341	2.817000	0.96982	0.643000	0.83706	CTT	.		0.373	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
ISLR	3671	ucsc.edu;bcgsc.ca	37	15	74468332	74468332	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:74468332C>A	ENST00000249842.3	+	2	1490	c.1133C>A	c.(1132-1134)cCa>cAa	p.P378Q	RP11-665J16.1_ENST00000561647.1_RNA|ISLR_ENST00000395118.1_Missense_Mutation_p.P378Q	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	378					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						GAGGTGCAGCCATCAGGGCCG	0.642																																					p.P378Q		.											.	ISLR	155	0			c.C1133A						.						92.0	73.0	79.0					15																	74468332		2198	4297	6495	SO:0001583	missense	3671	exon2			TGCAGCCATCAGG	AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.1133C>A	15.37:g.74468332C>A	ENSP00000249842:p.Pro378Gln	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_201526		Missense_Mutation	SNP	ENST00000249842.3	37	CCDS10260.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.959373	0.53400	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.68624	-0.34;-0.34	4.48	4.48	0.54585	.	0.000000	0.43579	U	0.000555	T	0.68421	0.2999	N	0.19112	0.55	0.34998	D	0.75571	D	0.69078	0.997	D	0.68353	0.957	T	0.78112	-0.2331	10	0.66056	D	0.02	.	13.0755	0.59085	0.1613:0.8387:0.0:0.0	.	378	O14498	ISLR_HUMAN	Q	378	ENSP00000249842:P378Q;ENSP00000378550:P378Q	ENSP00000249842:P378Q	P	+	2	0	ISLR	72255385	0.994000	0.37717	0.907000	0.35723	0.595000	0.36748	3.449000	0.52950	2.047000	0.60756	0.313000	0.20887	CCA	.		0.642	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269044.1	NM_005545	
ISYNA1	51477	ucsc.edu;bcgsc.ca	37	19	18545774	18545774	+	Silent	SNP	G	G	T	rs564672040		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:18545774G>T	ENST00000338128.8	-	11	1843	c.1626C>A	c.(1624-1626)acC>acA	p.T542T	ISYNA1_ENST00000317018.6_Silent_p.T340T|ISYNA1_ENST00000545187.1_Silent_p.T392T|ISYNA1_ENST00000578963.1_Silent_p.T414T|ISYNA1_ENST00000457269.4_Silent_p.T488T	NM_001170938.1|NM_016368.4	NP_001164409.1|NP_057452.1	Q9NPH2	INO1_HUMAN	inositol-3-phosphate synthase 1	542					inositol biosynthetic process (GO:0006021)|inositol phosphate metabolic process (GO:0043647)|phospholipid biosynthetic process (GO:0008654)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-3-phosphate synthase activity (GO:0004512)			breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	12						TGGCATCACCGGTGCAGCCAT	0.647																																					p.T542T		.											.	ISYNA1	92	0			c.C1626A						.						54.0	59.0	57.0					19																	18545774		2203	4300	6503	SO:0001819	synonymous_variant	51477	exon11			ATCACCGGTGCAG		CCDS12379.1, CCDS54234.1, CCDS62603.1	19p13.11	2014-09-04			ENSG00000105655	ENSG00000105655	5.5.1.4		29821	protein-coding gene	gene with protein product	"""myo-inositol 1-phosphate synthase"""	611670				15024000, 12941308	Standard	NM_016368		Approved	Ino1, INOS, IPS	uc002njd.2	Q9NPH2	OTTHUMG00000179027	ENST00000338128.8:c.1626C>A	19.37:g.18545774G>T		Somatic	116.0	0.0		WXS	Illumina HiSeq	.	71.0	8.0	NM_016368	B3KRT1|G5E9U0|Q6NXT5|Q7Z525|Q9BT65|Q9H2Y2|Q9NSU0|Q9NVW7	Silent	SNP	ENST00000338128.8	37	CCDS12379.1																																																																																			.		0.647	ISYNA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444469.2	NM_016368	
KIAA0930	23313	ucsc.edu;bcgsc.ca	37	22	45593691	45593691	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr22:45593691G>T	ENST00000336156.5	-	9	1219	c.1154C>A	c.(1153-1155)cCg>cAg	p.P385Q	KIAA0930_ENST00000443310.3_Missense_Mutation_p.P367Q|KIAA0930_ENST00000474515.1_5'UTR|KIAA0930_ENST00000251993.7_Missense_Mutation_p.P390Q|KIAA0930_ENST00000391627.2_Missense_Mutation_p.P351Q	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	385										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						CCGATGCAGCGGCAACGTGAC	0.572																																					p.P390Q		.											.	KIAA0930	90	0			c.C1169A						.						166.0	138.0	147.0					22																	45593691		2203	4300	6503	SO:0001583	missense	23313	exon9			TGCAGCGGCAACG	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.1154C>A	22.37:g.45593691G>T	ENSP00000336720:p.Pro385Gln	Somatic	71.0	0.0		WXS	Illumina HiSeq	.	51.0	5.0	NM_015264	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Missense_Mutation	SNP	ENST00000336156.5	37	CCDS33665.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851470	0.91355	.	.	ENSG00000100364	ENST00000336156;ENST00000423262;ENST00000251993;ENST00000391627;ENST00000443310	.	.	.	4.9	4.9	0.64082	.	0.054914	0.64402	D	0.000001	T	0.79179	0.4402	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.999;1.0;0.999	T	0.81897	-0.0722	9	0.87932	D	0	-31.5482	18.4444	0.90678	0.0:0.0:1.0:0.0	.	367;385;390;456	B0AZU2;Q6ICG6;Q6ICG6-2;Q8IUY4	.;K0930_HUMAN;.;.	Q	385;270;390;351;367	.	ENSP00000251993:P390Q	P	-	2	0	KIAA0930	43972355	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.078000	0.94023	2.420000	0.82092	0.561000	0.74099	CCG	.		0.572	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2	NM_001009880	
KIAA1549L	25758	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	33682506	33682506	+	Silent	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:33682506G>A	ENST00000321505.4	+	19	5394	c.5214G>A	c.(5212-5214)caG>caA	p.Q1738Q	KIAA1549L_ENST00000389726.3_Silent_p.Q1744Q			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1738						integral component of membrane (GO:0016021)											ATAGGAACCAGGCCTGGATGT	0.547																																					p.Q1738Q		.											.	.	.	0			c.G5214A						.						41.0	43.0	43.0					11																	33682506		1975	4149	6124	SO:0001819	synonymous_variant	25758	exon19			GAACCAGGCCTGG	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.5214G>A	11.37:g.33682506G>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	11.0	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	37	CCDS44565.2																																																																																			.		0.547	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
KLK11	11012	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51530742	51530742	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:51530742T>C	ENST00000594768.1	-	1	217	c.32A>G	c.(31-33)aAg>aGg	p.K11R	KLK11_ENST00000453757.3_5'Flank|KLK11_ENST00000594458.1_5'Flank|KLK11_ENST00000391804.3_Intron|KLK11_ENST00000319720.7_Intron|CTC-518B2.9_ENST00000594910.1_RNA|KLK11_ENST00000600362.1_5'Flank	NM_144947.1	NP_659196.1	Q9UBX7	KLK11_HUMAN	kallikrein-related peptidase 11	11						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		GCCCGATGACTTCCAGTCCCG	0.607																																					p.K11R		.											.	KLK11	650	0			c.A32G						.						91.0	92.0	92.0					19																	51530742		2203	4300	6503	SO:0001583	missense	11012	exon1			GATGACTTCCAGT	AB012917	CCDS12818.1, CCDS12819.1, CCDS54297.1	19q13.33	2011-09-07	2006-10-27			ENSG00000167757		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6359	protein-coding gene	gene with protein product		604434	"""kallikrein 11"""	PRSS20		9765601, 10662548, 16800724, 16800723	Standard	NM_006853		Approved	TLSP	uc002pvb.2	Q9UBX7		ENST00000594768.1:c.32A>G	19.37:g.51530742T>C	ENSP00000473047:p.Lys11Arg	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	14.0	NM_144947	O75837|Q0WXX5|Q8IXD7|Q9NS65	Missense_Mutation	SNP	ENST00000594768.1	37	CCDS12818.1	.	.	.	.	.	.	.	.	.	.	t	11.46	1.646536	0.29246	.	.	ENSG00000167757	ENST00000319756	D	0.87887	-2.31	2.76	2.76	0.32466	.	.	.	.	.	T	0.74313	0.3700	N	0.22421	0.69	0.22842	N	0.998667	P	0.37061	0.58	B	0.29176	0.099	T	0.64901	-0.6298	9	0.42905	T	0.14	.	7.392	0.26915	0.0:0.0:0.0:1.0	.	11	Q9UBX7	KLK11_HUMAN	R	11	ENSP00000324414:K11R	ENSP00000324414:K11R	K	-	2	0	KLK11	56222554	0.013000	0.17824	0.057000	0.19452	0.139000	0.21198	1.126000	0.31344	1.510000	0.48803	0.383000	0.25322	AAG	.		0.607	KLK11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464314.2	NM_006853	
KLKB1	3818	ucsc.edu;bcgsc.ca	37	4	187175845	187175845	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr4:187175845C>A	ENST00000264690.6	+	12	1604	c.1417C>A	c.(1417-1419)Caa>Aaa	p.Q473K	KLKB1_ENST00000513864.1_Missense_Mutation_p.Q473K	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	473	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		TATTATTCACCAAAACTATAA	0.373																																					p.Q473K		.											.	KLKB1	227	0			c.C1417A						.						77.0	80.0	79.0					4																	187175845		2203	4300	6503	SO:0001583	missense	3818	exon12			ATTCACCAAAACT	M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.1417C>A	4.37:g.187175845C>A	ENSP00000264690:p.Gln473Lys	Somatic	78.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_000892	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	ENST00000264690.6	37	CCDS34120.1	.	.	.	.	.	.	.	.	.	.	C	6.106	0.387748	0.11581	.	.	ENSG00000164344	ENST00000264690;ENST00000513864;ENST00000418715	D;D	0.92595	-3.07;-3.07	5.8	3.03	0.35002	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.127810	0.06493	N	0.735034	D	0.83243	0.5212	N	0.04746	-0.17	0.21652	N	0.999603	B;B;B	0.19817	0.039;0.02;0.039	B;B;B	0.23419	0.017;0.046;0.017	T	0.72168	-0.4372	10	0.40728	T	0.16	.	7.7315	0.28789	0.0:0.5943:0.2629:0.1428	.	435;473;473	E7EQA8;A8K9A9;P03952	.;.;KLKB1_HUMAN	K	473;473;435	ENSP00000264690:Q473K;ENSP00000424469:Q473K	ENSP00000264690:Q473K	Q	+	1	0	KLKB1	187412839	0.014000	0.17966	0.575000	0.28536	0.085000	0.17905	0.819000	0.27308	0.741000	0.32674	0.655000	0.94253	CAA	.		0.373	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892	
KRTAP10-12	386685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	46117591	46117591	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr21:46117591C>T	ENST00000400365.3	+	1	505	c.475C>T	c.(475-477)Ccc>Tcc	p.P159S	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	159	19 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						CTGCTGCAAGCCCATCTGCTG	0.622																																					p.P159S		.											.	KRTAP10-12	90	0			c.C475T						.						182.0	189.0	187.0					21																	46117591		2203	4300	6503	SO:0001583	missense	386685	exon1			TGCAAGCCCATCT	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.475C>T	21.37:g.46117591C>T	ENSP00000383216:p.Pro159Ser	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	37.0	NM_198699	B2RPA3	Missense_Mutation	SNP	ENST00000400365.3	37	CCDS42967.1	.	.	.	.	.	.	.	.	.	.	c	5.764	0.325382	0.10900	.	.	ENSG00000189169	ENST00000400365;ENST00000452870	T	0.01139	5.28	3.64	3.64	0.41730	.	.	.	.	.	T	0.03220	0.0094	L	0.46157	1.445	0.22866	N	0.99863	P	0.52316	0.952	P	0.57371	0.819	T	0.45673	-0.9245	9	0.49607	T	0.09	.	11.1263	0.48320	0.0:1.0:0.0:0.0	.	159	P60413	KR10C_HUMAN	S	159;67	ENSP00000383216:P159S	ENSP00000383216:P159S	P	+	1	0	KRTAP10-12	44942019	0.103000	0.21917	0.045000	0.18777	0.036000	0.12997	1.208000	0.32345	1.707000	0.51288	0.195000	0.17529	CCC	.		0.622	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
LMO4	8543	ucsc.edu;bcgsc.ca	37	1	87805235	87805235	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:87805235G>T	ENST00000370544.5	+	3	1033	c.253G>T	c.(253-255)Ggt>Tgt	p.G85C	LMO4_ENST00000489303.1_3'UTR|LMO4_ENST00000370542.1_Missense_Mutation_p.G85C	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4	85					negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		TGGAAATAGCGGTGCTTGCAG	0.443																																					p.G85C		.											.	LMO4	226	0			c.G253T						.						90.0	89.0	90.0					1																	87805235		2203	4300	6503	SO:0001583	missense	8543	exon3			AATAGCGGTGCTT	U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.253G>T	1.37:g.87805235G>T	ENSP00000359575:p.Gly85Cys	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	57.0	5.0	NM_006769	D3DT23|O00158|O88894	Missense_Mutation	SNP	ENST00000370544.5	37	CCDS713.1	.	.	.	.	.	.	.	.	.	.	G	34	5.318830	0.95682	.	.	ENSG00000143013	ENST00000370544;ENST00000370542	T;T	0.60920	0.15;0.15	5.93	5.93	0.95920	Zinc finger, LIM-type (2);	0.000000	0.85682	D	0.000000	D	0.82287	0.5004	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86094	0.1552	10	0.87932	D	0	.	20.3311	0.98718	0.0:0.0:1.0:0.0	.	85	P61968	LMO4_HUMAN	C	85	ENSP00000359575:G85C;ENSP00000359573:G85C	ENSP00000359573:G85C	G	+	1	0	LMO4	87577823	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.869000	0.99810	2.797000	0.96272	0.655000	0.94253	GGT	.		0.443	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028264.2	NM_006769	
LPIN3	64900	ucsc.edu;bcgsc.ca	37	20	39985684	39985684	+	Missense_Mutation	SNP	G	G	A	rs376739657		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr20:39985684G>A	ENST00000373257.3	+	15	1899	c.1808G>A	c.(1807-1809)cGc>cAc	p.R603H		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	603	C-LIP.				fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				CCTCAGCGGCGCCTGAACCTG	0.617																																					p.R603H		.											.	LPIN3	93	0			c.G1808A						.	G	HIS/ARG	0,4406		0,0,2203	73.0	62.0	65.0		1808	2.6	1.0	20		65	1,8599	1.2+/-3.3	0,1,4299	no	missense	LPIN3	NM_022896.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	603/852	39985684	1,13005	2203	4300	6503	SO:0001583	missense	64900	exon15			AGCGGCGCCTGAA	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.1808G>A	20.37:g.39985684G>A	ENSP00000362354:p.Arg603His	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	25.0	5.0	NM_022896	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	ENST00000373257.3	37	CCDS33469.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.44|15.44	2.835522|2.835522	0.50951|0.50951	0.0|0.0	1.16E-4|1.16E-4	ENSG00000132793|ENSG00000132793	ENST00000445975|ENST00000373257;ENST00000373259	.|T	.|0.80566	.|-1.39	4.93|4.93	2.58|2.58	0.30949|0.30949	.|.	.|0.823352	.|0.11063	.|N	.|0.603790	T|T	0.70988|0.70988	0.3287|0.3287	L|L	0.48642|0.48642	1.525|1.525	0.26624|0.26624	N|N	0.972607|0.972607	.|B;P	.|0.43024	.|0.013;0.798	.|B;B	.|0.32724	.|0.009;0.151	T|T	0.59841|0.59841	-0.7378|-0.7378	5|9	.|.	.|.	.|.	-0.9561|-0.9561	12.1684|12.1684	0.54144|0.54144	0.1669:0.0:0.8331:0.0|0.1669:0.0:0.8331:0.0	.|.	.|604;603	.|Q9BQK8-2;Q9BQK8	.|.;LPIN3_HUMAN	T|H	93|603;236	.|ENSP00000362354:R603H	.|.	A|R	+|+	1|2	0|0	LPIN3|LPIN3	39419098|39419098	0.904000|0.904000	0.30761|0.30761	0.965000|0.965000	0.40720|0.40720	0.865000|0.865000	0.49528|0.49528	4.452000|4.452000	0.60054|0.60054	1.068000|1.068000	0.40764|0.40764	0.462000|0.462000	0.41574|0.41574	GCC|CGC	.		0.617	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896	
LRIT3	345193	ucsc.edu;bcgsc.ca	37	4	110791566	110791566	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr4:110791566T>C	ENST00000594814.1	+	4	1661	c.1661T>C	c.(1660-1662)gTc>gCc	p.V554A	LRIT3_ENST00000379920.3_Missense_Mutation_p.V509A|LRIT3_ENST00000327908.3_Missense_Mutation_p.V371A|LRIT3_ENST00000409621.2_Missense_Mutation_p.V371A	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	554	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		ATGGCCTGTGTCTGTCCAAAA	0.493																																					p.V554A		.											.	LRIT3	90	0			c.T1661C						.						122.0	112.0	116.0					4																	110791566		2203	4300	6503	SO:0001583	missense	345193	exon4			CCTGTGTCTGTCC	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1661T>C	4.37:g.110791566T>C	ENSP00000469759:p.Val554Ala	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_198506	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	37	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	T	23.3	4.403306	0.83230	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.57436	0.4;0.4;0.4	5.16	5.16	0.70880	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.060357	0.64402	D	0.000004	T	0.64560	0.2609	M	0.76838	2.35	0.50467	D	0.999873	P;D	0.55385	0.952;0.971	B;P	0.50934	0.359;0.654	T	0.71321	-0.4628	10	0.72032	D	0.01	.	15.0075	0.71524	0.0:0.0:0.0:1.0	.	509;371	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	A	371;509;371	ENSP00000328222:V371A;ENSP00000369252:V509A;ENSP00000386734:V371A	ENSP00000328222:V371A	V	+	2	0	LRIT3	111011015	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.621000	0.83083	1.943000	0.56356	0.533000	0.62120	GTC	.		0.493	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506	
LRP6	4040	ucsc.edu;bcgsc.ca	37	12	12332824	12332824	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr12:12332824G>T	ENST00000261349.4	-	7	1541	c.1465C>A	c.(1465-1467)Ctt>Att	p.L489I	LRP6_ENST00000543091.1_Missense_Mutation_p.L489I	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	489	Beta-propeller 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GGCCAACCAAGAGAAGTGTTA	0.418																																					p.L489I		.											.	LRP6	661	0			c.C1465A						.						118.0	106.0	110.0					12																	12332824		2203	4300	6503	SO:0001583	missense	4040	exon7			AACCAAGAGAAGT	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1465C>A	12.37:g.12332824G>T	ENSP00000261349:p.Leu489Ile	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085437	0.94100	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.97575	-4.44;-4.44	5.82	5.82	0.92795	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.53938	D	0.000042	D	0.97492	0.9179	L	0.35793	1.09	0.80722	D	1	D;D	0.67145	0.996;0.971	D;D	0.75484	0.986;0.926	D	0.97421	1.0009	10	0.44086	T	0.13	.	20.1092	0.97906	0.0:0.0:1.0:0.0	.	489;489	F5H7J9;O75581	.;LRP6_HUMAN	I	489	ENSP00000261349:L489I;ENSP00000442472:L489I	ENSP00000261349:L489I	L	-	1	0	LRP6	12224091	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.013000	0.88655	2.745000	0.94114	0.655000	0.94253	CTT	.		0.418	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
LRRC16A	55604	broad.mit.edu;bcgsc.ca	37	6	25492251	25492251	+	Splice_Site	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:25492251C>A	ENST00000329474.6	+	15	1587	c.1219C>A	c.(1219-1221)Cgg>Agg	p.R407R		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	407					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CTTCTCTCACCGGTATAGATT	0.408																																					p.R407R		.											.	LRRC16A	137	0			c.C1219A						.						136.0	125.0	128.0					6																	25492251		1864	4110	5974	SO:0001630	splice_region_variant	55604	exon15			TCTCACCGGTATA	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1220+1C>A	6.37:g.25492251C>A		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	10.0	NM_001173977	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Silent	SNP	ENST00000329474.6	37	CCDS54973.1																																																																																			.		0.408	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	Silent
MAD2L1BP	9587	ucsc.edu;bcgsc.ca	37	6	43608100	43608100	+	Missense_Mutation	SNP	C	C	A	rs541861629		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:43608100C>A	ENST00000372171.4	+	3	712	c.655C>A	c.(655-657)Cgc>Agc	p.R219S	MAD2L1BP_ENST00000451025.2_Missense_Mutation_p.R251S	NM_014628.2	NP_055443.1	Q15013	MD2BP_HUMAN	MAD2L1 binding protein	219					mitotic cell cycle checkpoint (GO:0007093)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(3)	5	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000351)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			ACAGGGACACCGCAACTGTGG	0.557																																					p.R251S		.											.	MAD2L1BP	90	0			c.C751A						.						52.0	45.0	48.0					6																	43608100		2203	4300	6503	SO:0001583	missense	9587	exon4			GGACACCGCAACT	BC002904	CCDS4904.1, CCDS47431.1	6p21.1	2003-06-23			ENSG00000124688	ENSG00000124688			21059	protein-coding gene	gene with protein product						7788527, 12456649	Standard	NM_014628		Approved	CMT2, KIAA0110, dJ261G23.1	uc003ovu.3	Q15013	OTTHUMG00000014747	ENST00000372171.4:c.655C>A	6.37:g.43608100C>A	ENSP00000361244:p.Arg219Ser	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001003690	B4DLV3|E9PAT7|Q6IBB1	Missense_Mutation	SNP	ENST00000372171.4	37	CCDS4904.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050189	0.75846	.	.	ENSG00000124688	ENST00000451025;ENST00000372171	T	0.52526	0.66	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.52451	0.1735	L	0.36672	1.1	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.57711	-0.7764	10	0.72032	D	0.01	-7.2667	16.7113	0.85386	0.0:1.0:0.0:0.0	.	219;251	Q15013;E9PAT7	MD2BP_HUMAN;.	S	251;219	ENSP00000410818:R251S	ENSP00000361244:R219S	R	+	1	0	MAD2L1BP	43716078	1.000000	0.71417	0.938000	0.37757	0.990000	0.78478	4.028000	0.57246	2.365000	0.80145	0.555000	0.69702	CGC	.		0.557	MAD2L1BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040692.2	NM_014628	
MED12	9968	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	70338632	70338632	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chrX:70338632G>C	ENST00000374080.3	+	1	60	c.28G>C	c.(28-30)Gaa>Caa	p.E10Q	MED12_ENST00000374102.1_Missense_Mutation_p.E10Q|MED12_ENST00000333646.6_Missense_Mutation_p.E10Q			Q93074	MED12_HUMAN	mediator complex subunit 12	10					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CTTGAGCTACGAACACCGGCC	0.672			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.E10Q		.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	272	0			c.G28C						.						12.0	14.0	13.0					X																	70338632		1836	4059	5895	SO:0001583	missense	9968	exon1			AGCTACGAACACC	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.28G>C	X.37:g.70338632G>C	ENSP00000363193:p.Glu10Gln	Somatic	90.0	1.0		WXS	Illumina HiSeq	Phase_I	72.0	54.0	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	32	5.155285	0.94686	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080	T;T;T	0.66638	-0.22;-0.21;-0.21	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000003	T	0.77980	0.4212	L	0.53249	1.67	0.80722	D	1	P;D;P	0.89917	0.748;1.0;0.795	B;D;B	0.87578	0.424;0.998;0.323	T	0.79095	-0.1944	10	0.46703	T	0.11	-11.8338	16.5123	0.84289	0.0:0.0:1.0:0.0	.	10;10;10	F5H3Y1;Q93074-3;Q93074	.;.;MED12_HUMAN	Q	10	ENSP00000333125:E10Q;ENSP00000363215:E10Q;ENSP00000363193:E10Q	ENSP00000333125:E10Q	E	+	1	0	MED12	70255357	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.356000	0.90085	2.007000	0.58848	0.431000	0.28591	GAA	.		0.672	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
MED23	9439	ucsc.edu;bcgsc.ca	37	6	131917145	131917145	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:131917145C>A	ENST00000368068.3	-	22	3116	c.2937G>T	c.(2935-2937)ccG>ccT	p.P979P	MED23_ENST00000368060.3_Silent_p.P979P|MED23_ENST00000403834.3_Silent_p.P985P|MED23_ENST00000354577.4_Silent_p.P985P|MED23_ENST00000368058.1_Silent_p.P985P|MED23_ENST00000545957.1_Silent_p.P620P|MED23_ENST00000479213.1_5'UTR	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	979					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		ATTTGGATACCGGAAGCAACT	0.378																																					p.P985P		.											.	MED23	24	0			c.G2955T						.						91.0	98.0	95.0					6																	131917145		2203	4300	6503	SO:0001819	synonymous_variant	9439	exon23			GGATACCGGAAGC	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.2937G>T	6.37:g.131917145C>A		Somatic	37.0	0.0		WXS	Illumina HiSeq	.	36.0	5.0	NM_015979	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Silent	SNP	ENST00000368068.3	37	CCDS5147.1																																																																																			.		0.378	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
MEGF11	84465	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	66209210	66209210	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:66209210G>A	ENST00000409699.2	-	17	2343	c.2171C>T	c.(2170-2172)gCc>gTc	p.A724V	MEGF11_ENST00000478721.1_5'Flank|MEGF11_ENST00000395625.2_Missense_Mutation_p.A649V|MEGF11_ENST00000288745.3_Missense_Mutation_p.A649V|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000360698.4_Missense_Mutation_p.A724V|MEGF11_ENST00000422354.1_Missense_Mutation_p.A724V			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	724	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						GCAGTGGCAGGCCCCGTCCTC	0.667											OREG0023198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A724V		.											.	MEGF11	69	0			c.C2171T						.						20.0	19.0	19.0					15																	66209210		2200	4296	6496	SO:0001583	missense	84465	exon17			TGGCAGGCCCCGT	AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.2171C>T	15.37:g.66209210G>A	ENSP00000386908:p.Ala724Val	Somatic	44.0	0.0	1090	WXS	Illumina HiSeq	Phase_I	81.0	29.0	NM_032445	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	ENST00000409699.2	37	CCDS10213.2	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803260	0.70682	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	4.66	2.64	0.31445	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.471570	0.15637	U	0.252065	T	0.33498	0.0865	L	0.43598	1.365	0.28218	N	0.92667	P;P	0.48640	0.858;0.913	B;P	0.49528	0.434;0.614	T	0.09250	-1.0683	10	0.25106	T	0.35	.	6.0547	0.19804	0.0983:0.0:0.5198:0.3819	.	724;649	A6BM72;A6BM72-2	MEG11_HUMAN;.	V	724;649;724;649;724	ENSP00000386908:A724V;ENSP00000288745:A649V;ENSP00000414475:A724V;ENSP00000378987:A649V;ENSP00000353919:A724V	ENSP00000288745:A649V	A	-	2	0	MEGF11	63996264	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.543000	0.73874	0.971000	0.38288	0.485000	0.47835	GCC	.		0.667	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329307.2	NM_032445	
MGAT3	4248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	39883537	39883537	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr22:39883537C>A	ENST00000341184.6	+	2	400	c.185C>A	c.(184-186)cCc>cAc	p.P62H		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	62	Pro-rich.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					CAGGCCAGCCCCGAGCCAGGA	0.677																																					p.P62H		.											.	MGAT3	90	0			c.C185A						.						78.0	87.0	84.0					22																	39883537		2203	4300	6503	SO:0001583	missense	4248	exon2			CCAGCCCCGAGCC	D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.185C>A	22.37:g.39883537C>A	ENSP00000345270:p.Pro62His	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	18.0	NM_002409	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	ENST00000341184.6	37	CCDS13994.2	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069976	0.55539	.	.	ENSG00000128268	ENST00000341184;ENST00000429402;ENST00000418314	.	.	.	5.03	5.03	0.67393	.	0.583594	0.16049	N	0.232060	T	0.57169	0.2035	N	0.24115	0.695	0.42326	D	0.992278	D	0.54047	0.964	P	0.50791	0.65	T	0.63834	-0.6547	9	0.72032	D	0.01	.	18.3612	0.90375	0.0:1.0:0.0:0.0	.	62	Q09327	MGAT3_HUMAN	H	62;62;90	.	ENSP00000345270:P62H	P	+	2	0	MGAT3	38213483	0.991000	0.36638	0.976000	0.42696	0.934000	0.57294	4.146000	0.58072	2.338000	0.79540	0.467000	0.42956	CCC	.		0.677	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2	NM_002409	
MRPL11	65003	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	66204833	66204833	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:66204833delC	ENST00000310999.7	-	3	394	c.301delG	c.(301-303)gccfs	p.A101fs	MRPL11_ENST00000524576.1_5'UTR|MRPL11_ENST00000430466.2_Frame_Shift_Del_p.A75fs|MRPL11_ENST00000329819.4_Frame_Shift_Del_p.A101fs	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	101					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						GTTTGCCGGGCCCCCTTTTCA	0.507																																					p.A101fs		.											.	MRPL11	90	0			c.301delG						.						59.0	59.0	59.0					11																	66204833		2200	4295	6495	SO:0001589	frameshift_variant	65003	exon3			GCCGGGCCCCCTT	AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.301delG	11.37:g.66204833delC	ENSP00000308897:p.Ala101fs	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	12.0	NM_170739	A6NLT0|A8K219|Q32P46|Q96Q73	Frame_Shift_Del	DEL	ENST00000310999.7	37	CCDS8139.1																																																																																			.		0.507	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393098.2	NM_016050	
RPL3L	6123	ucsc.edu;bcgsc.ca	37	16	1991321	1991321	+	IGR	SNP	G	G	T	rs372966990		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr16:1991321G>T	ENST00000268661.7	-	0	2182				MSRB1_ENST00000489198.1_5'UTR|MSRB1_ENST00000564908.1_Silent_p.T47T|MSRB1_ENST00000361871.3_Silent_p.T47T|MSRB1_ENST00000399753.2_Silent_p.T47T	NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						GAATGGTCTCGGTGAACGCCG	0.617																																					.		.											.	.	.	0			.						.						51.0	53.0	52.0					16																	1991321		2053	4183	6236	SO:0001628	intergenic_variant	51734	.			GGTCTCGGTGAAC	U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685		16.37:g.1991321G>T		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	.		Missense_Mutation	SNP	ENST00000268661.7	37	CCDS10450.1																																																																																			.		0.617	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250582.2	NM_005061	
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9028261	9028261	+	Silent	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:9028261G>A	ENST00000397910.4	-	11	36734	c.36531C>T	c.(36529-36531)ggC>ggT	p.G12177G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12179	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGTGTAGGGGCCCAGCTCCT	0.567																																					p.G12177G		.											.	MUC16	566	0			c.C36531T						.						229.0	225.0	226.0					19																	9028261		2056	4195	6251	SO:0001819	synonymous_variant	94025	exon11			GTAGGGGCCCAGC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36531C>T	19.37:g.9028261G>A		Somatic	73.0	1.0		WXS	Illumina HiSeq	Phase_I	66.0	15.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.567	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYO10	4651	ucsc.edu;bcgsc.ca	37	5	16783575	16783575	+	Silent	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr5:16783575A>G	ENST00000513610.1	-	5	925	c.471T>C	c.(469-471)ggT>ggC	p.G157G		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	157	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CCCCACTTTCACCACTGAAAG	0.358																																					p.G157G		.											.	MYO10	3	0			c.T471C						.						60.0	53.0	55.0					5																	16783575		1850	4085	5935	SO:0001819	synonymous_variant	4651	exon5			ACTTTCACCACTG	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.471T>C	5.37:g.16783575A>G		Somatic	67.0	0.0		WXS	Illumina HiSeq	.	72.0	6.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	ENST00000513610.1	37	CCDS54834.1																																																																																			.		0.358	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
MYO9B	4650	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	17317927	17317927	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:17317927C>T	ENST00000594824.1	+	35	5645	c.5498C>T	c.(5497-5499)gCc>gTc	p.A1833V	MYO9B_ENST00000595618.1_Missense_Mutation_p.A1833V|CTD-3032J10.3_ENST00000601929.1_RNA|MYO9B_ENST00000397274.2_Missense_Mutation_p.A1833V			Q13459	MYO9B_HUMAN	myosin IXB	1833	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.|Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TGCAGGGTGGCCCTGCTCGAG	0.652																																					p.A1833V		.											.	MYO9B	67	0			c.C5498T						.						20.0	26.0	24.0					19																	17317927		2152	4259	6411	SO:0001583	missense	4650	exon35			GGGTGGCCCTGCT		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.5498C>T	19.37:g.17317927C>T	ENSP00000471367:p.Ala1833Val	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	16.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	c	19.18	3.777785	0.70107	.	.	ENSG00000099331	ENST00000397274;ENST00000319396	T	0.20881	2.04	3.9	3.9	0.45041	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.48767	D	0.000161	T	0.40448	0.1117	L	0.52905	1.665	0.39520	D	0.968495	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.997;0.997;0.998	T	0.27262	-1.0079	10	0.36615	T	0.2	.	15.2409	0.73468	0.0:1.0:0.0:0.0	.	1833;1833;1839	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	V	1833;178	ENSP00000380444:A1833V	ENSP00000314032:A178V	A	+	2	0	MYO9B	17178927	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	4.495000	0.60353	1.919000	0.55581	0.306000	0.20318	GCC	.		0.652	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
NAT14	57106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	55997777	55997777	+	Silent	SNP	C	C	T	rs201053971	byFrequency	TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:55997777C>T	ENST00000205194.4	+	3	378	c.75C>T	c.(73-75)gcC>gcT	p.A25A	SSC5D_ENST00000587166.1_5'Flank|SSC5D_ENST00000389623.6_5'Flank|NAT14_ENST00000592719.1_Intron|NAT14_ENST00000591590.1_3'UTR|NAT14_ENST00000587400.1_Intron	NM_020378.3	NP_065111.1	Q8WUY8	NAT14_HUMAN	N-acetyltransferase 14 (GCN5-related, putative)	25	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of transcription, DNA-templated (GO:0045893)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|N-acetyltransferase activity (GO:0008080)			central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0527)		GCCCACAGGCCGGCGTGAAGG	0.697													c|||	2	0.000399361	0.0	0.0	5008	,	,		14384	0.002		0.0	False		,,,				2504	0.0				p.A25A		.											.	NAT14	91	0			c.C75T						.						12.0	15.0	14.0					19																	55997777		2171	4272	6443	SO:0001819	synonymous_variant	57106	exon3			ACAGGCCGGCGTG	AB055059	CCDS12926.1	19q13.42	2011-11-25	2008-09-24		ENSG00000090971	ENSG00000090971			28918	protein-coding gene	gene with protein product	"""K562 cells-derived leucine zipper-like protein 1"""		"""N-acetyltransferase 14"""			10873651	Standard	NM_020378		Approved	KLP1	uc002qle.2	Q8WUY8		ENST00000205194.4:c.75C>T	19.37:g.55997777C>T		Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	11.0	NM_020378	Q8TDY7|Q9NS72	Silent	SNP	ENST00000205194.4	37	CCDS12926.1																																																																																			C|0.999;T|0.000		0.697	NAT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453339.1	NM_020378	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	35756573	35756573	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr13:35756573G>A	ENST00000400445.3	+	29	5273	c.4739G>A	c.(4738-4740)cGt>cAt	p.R1580H	NBEA_ENST00000540320.1_Missense_Mutation_p.R1580H|NBEA_ENST00000379939.2_Missense_Mutation_p.R1577H|NBEA_ENST00000310336.4_Missense_Mutation_p.R1580H	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1580					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.R1580H(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TCCAAGTATCGTGACATATTA	0.388																																					p.R1580H		.											.	NBEA	144	1	Substitution - Missense(1)	endometrium(1)	c.G4739A						.						133.0	122.0	126.0					13																	35756573		1833	4088	5921	SO:0001583	missense	26960	exon29			AGTATCGTGACAT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4739G>A	13.37:g.35756573G>A	ENSP00000383295:p.Arg1580His	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	62.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	35	5.424444	0.96111	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.69306	-0.39;-0.38;-0.39;-0.39	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.83248	0.5213	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.84686	0.0720	10	0.87932	D	0	.	19.6933	0.96010	0.0:0.0:1.0:0.0	.	1580;1577	Q8NFP9;Q5T321	NBEA_HUMAN;.	H	1580;1580;1577;1580;239	ENSP00000440951:R1580H;ENSP00000383295:R1580H;ENSP00000369271:R1577H;ENSP00000308534:R1580H	ENSP00000308534:R1580H	R	+	2	0	NBEA	34654573	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	9.869000	0.99810	2.651000	0.90000	0.467000	0.42956	CGT	.		0.388	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NMBR	4829	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	142409410	142409410	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:142409410A>C	ENST00000258042.1	-	1	526	c.386T>G	c.(385-387)gTt>gGt	p.V129G	RP11-137J7.2_ENST00000454401.1_RNA	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	129					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		GAACACGGAAACCCCCACGGA	0.582																																					p.V129G		.											.	NMBR	946	0			c.T386G						.						75.0	59.0	64.0					6																	142409410		2203	4300	6503	SO:0001583	missense	4829	exon1			ACGGAAACCCCCA		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.386T>G	6.37:g.142409410A>C	ENSP00000258042:p.Val129Gly	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	7.0	NM_002511	E9KL38|Q5VUK8	Missense_Mutation	SNP	ENST00000258042.1	37	CCDS5196.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.719464	0.89205	.	.	ENSG00000135577	ENST00000258042	T	0.21543	2.0	5.6	5.6	0.85130	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.39989	0.1099	M	0.74389	2.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.37430	-0.9706	10	0.87932	D	0	-18.3032	16.0816	0.81007	1.0:0.0:0.0:0.0	.	129	P28336	NMBR_HUMAN	G	129	ENSP00000258042:V129G	ENSP00000258042:V129G	V	-	2	0	NMBR	142451103	1.000000	0.71417	0.915000	0.36163	0.987000	0.75469	9.213000	0.95133	2.266000	0.75297	0.528000	0.53228	GTT	.		0.582	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
NOVA1	4857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	26917336	26917336	+	Silent	SNP	A	A	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr14:26917336A>T	ENST00000539517.2	-	5	1670	c.1353T>A	c.(1351-1353)acT>acA	p.T451T	NOVA1_ENST00000465357.2_Silent_p.T427T|NOVA1_ENST00000267422.7_Silent_p.T329T	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	454	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		TCCTTGCACCAGTCAACTCCT	0.453																																					p.T451T		.											.	NOVA1	229	0			c.T1353A						.						166.0	134.0	145.0					14																	26917336		2203	4300	6503	SO:0001819	synonymous_variant	4857	exon5			TGCACCAGTCAAC	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.1353T>A	14.37:g.26917336A>T		Somatic	232.0	0.0		WXS	Illumina HiSeq	Phase_I	263.0	96.0	NM_002515	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	ENST00000539517.2	37	CCDS32061.1																																																																																			.		0.453	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491	
NPC1L1	29881	ucsc.edu;bcgsc.ca	37	7	44575878	44575878	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr7:44575878A>G	ENST00000289547.4	-	4	1886	c.1831T>C	c.(1831-1833)Ttc>Ctc	p.F611L	NPC1L1_ENST00000381160.3_Missense_Mutation_p.F611L|NPC1L1_ENST00000546276.1_Missense_Mutation_p.F611L|NPC1L1_ENST00000423141.1_Missense_Mutation_p.F611L	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	611					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GTGACCTGGAACATGCCAGCC	0.637																																					p.F611L		.											.	NPC1L1	94	0			c.T1831C						.						79.0	76.0	77.0					7																	44575878		2203	4300	6503	SO:0001583	missense	29881	exon4			CCTGGAACATGCC		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1831T>C	7.37:g.44575878A>G	ENSP00000289547:p.Phe611Leu	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	a	0.379	-0.929489	0.02359	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	D;D;D;D	0.91464	-2.85;-2.85;-2.85;-1.66	4.11	2.95	0.34219	.	0.124862	0.53938	D	0.000046	T	0.73621	0.3610	N	0.05124	-0.11	0.40901	D	0.984154	B;B;B;B	0.27559	0.002;0.181;0.001;0.141	B;B;B;B	0.30943	0.006;0.122;0.002;0.05	T	0.68179	-0.5477	10	0.02654	T	1	-29.7878	5.4549	0.16584	0.8702:0.0:0.1298:0.0	.	611;611;611;611	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	L	611	ENSP00000289547:F611L;ENSP00000370552:F611L;ENSP00000438033:F611L;ENSP00000404670:F611L	ENSP00000289547:F611L	F	-	1	0	NPC1L1	44542403	0.978000	0.34361	0.772000	0.31596	0.248000	0.25809	2.304000	0.43655	1.478000	0.48253	0.248000	0.18094	TTC	.		0.637	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
NRAP	4892	ucsc.edu;bcgsc.ca	37	10	115385895	115385895	+	Silent	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:115385895G>T	ENST00000359988.3	-	21	2399	c.2155C>A	c.(2155-2157)Cgg>Agg	p.R719R	NRAP_ENST00000360478.3_Silent_p.R684R|NRAP_ENST00000369358.4_Silent_p.R727R|NRAP_ENST00000369360.3_Silent_p.R692R	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		ACCCTCTGCCGGTAGTTTTTC	0.562																																					p.R719R		.											.	NRAP	522	0			c.C2155A						.						69.0	58.0	62.0					10																	115385895		2203	4300	6503	SO:0001819	synonymous_variant	4892	exon21			TCTGCCGGTAGTT		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.2155C>A	10.37:g.115385895G>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001261463		Silent	SNP	ENST00000359988.3	37	CCDS7579.1	.	.	.	.	.	.	.	.	.	.	G	5.231	0.228150	0.09916	.	.	ENSG00000197893	ENST00000369343	.	.	.	5.99	2.66	0.31614	.	.	.	.	.	T	0.73001	0.3531	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73905	-0.3835	5	0.49607	T	0.09	.	15.9974	0.80262	0.0:0.0:0.5655:0.4345	.	.	.	.	Q	391	.	ENSP00000358349:P391Q	P	-	2	0	NRAP	115375885	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	1.221000	0.32503	0.266000	0.21894	-0.127000	0.14921	CCG	.		0.562	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
OCRL	4952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	128722192	128722192	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chrX:128722192C>T	ENST00000371113.4	+	21	2458	c.2293C>T	c.(2293-2295)Ctc>Ttc	p.L765F	OCRL_ENST00000357121.5_Missense_Mutation_p.L757F	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	765	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						GCAGGAAGAGCTCCAGCAGAT	0.463																																					p.L765F		.											.	OCRL	206	0			c.C2293T						.						96.0	85.0	89.0					X																	128722192		2203	4300	6503	SO:0001583	missense	4952	exon21			GAAGAGCTCCAGC	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.2293C>T	X.37:g.128722192C>T	ENSP00000360154:p.Leu765Phe	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	28.0	NM_000276	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	C	6.013	0.370877	0.11409	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	T;T	0.20200	2.09;2.09	5.52	3.16	0.36331	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.070421	0.56097	D	0.000035	T	0.24005	0.0581	L	0.28504	0.86	0.53688	D	0.999978	D;B	0.63046	0.992;0.044	P;B	0.62813	0.907;0.04	T	0.09862	-1.0655	10	0.12430	T	0.62	.	7.4919	0.27466	0.0:0.2692:0.0:0.7308	.	757;765	Q01968-2;Q01968	.;OCRL_HUMAN	F	765;757	ENSP00000360154:L765F;ENSP00000349635:L757F	ENSP00000349635:L757F	L	+	1	0	OCRL	128549873	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	0.664000	0.25068	0.252000	0.21531	-0.340000	0.08031	CTC	.		0.463	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
OR4C3	256144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	48347263	48347263	+	Silent	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:48347263G>A	ENST00000319856.4	+	1	792	c.771G>A	c.(769-771)ggG>ggA	p.G257G		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						GTGCAGATGGGAGATGCAAAG	0.473																																					p.G257G		.											.	OR4C3	69	0			c.G771A						.						261.0	208.0	226.0					11																	48347263		2201	4298	6499	SO:0001819	synonymous_variant	256144	exon1			AGATGGGAGATGC	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.771G>A	11.37:g.48347263G>A		Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	21.0	NM_001004702	B2RNF2|Q6IFB3	Silent	SNP	ENST00000319856.4	37	CCDS31489.1																																																																																			.		0.473	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702	
OR5I1	10798	bcgsc.ca;mdanderson.org	37	11	55703216	55703216	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:55703216A>G	ENST00000301532.3	-	1	660	c.661T>C	c.(661-663)Ttt>Ctt	p.F221L		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	221					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						AGAATGAAAAAGTAGGAGATG	0.428																																					p.F221L		.											.	OR5I1	69	0			c.T661C						.						45.0	47.0	46.0					11																	55703216		2201	4295	6496	SO:0001583	missense	10798	exon1			TGAAAAAGTAGGA	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.661T>C	11.37:g.55703216A>G	ENSP00000301532:p.Phe221Leu	Somatic	48.0	2.0		WXS	Illumina HiSeq	Phase_1	52.0	26.0	NM_006637	Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	37	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	A	0.959	-0.703875	0.03255	.	.	ENSG00000167825	ENST00000301532	T	0.00044	8.83	5.16	-0.149	0.13420	GPCR, rhodopsin-like superfamily (1);	0.627808	0.14174	N	0.336498	T	0.00039	0.0001	N	0.01529	-0.815	0.09310	N	1	B	0.16802	0.019	B	0.22152	0.038	T	0.32161	-0.9917	10	0.02654	T	1	.	3.2437	0.06789	0.338:0.4379:0.0826:0.1415	.	221	Q13606	OR5I1_HUMAN	L	221	ENSP00000301532:F221L	ENSP00000301532:F221L	F	-	1	0	OR5I1	55459792	0.000000	0.05858	0.069000	0.20011	0.805000	0.45488	-0.742000	0.04850	0.004000	0.14682	0.523000	0.50628	TTT	.		0.428	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637	
OSBPL2	9885	ucsc.edu;bcgsc.ca	37	20	60847187	60847187	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr20:60847187T>C	ENST00000313733.3	+	5	467	c.265T>C	c.(265-267)Tcc>Ccc	p.S89P	OSBPL2_ENST00000439951.2_5'UTR|OSBPL2_ENST00000358053.2_Missense_Mutation_p.S77P	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	89					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			CCAGGAGCTGTCCAAGATCAC	0.592																																					p.S89P		.											.	OSBPL2	69	0			c.T265C						.						117.0	86.0	97.0					20																	60847187		2203	4300	6503	SO:0001583	missense	9885	exon5			GAGCTGTCCAAGA	AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.265T>C	20.37:g.60847187T>C	ENSP00000316649:p.Ser89Pro	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_144498	A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Missense_Mutation	SNP	ENST00000313733.3	37	CCDS13495.1	.	.	.	.	.	.	.	.	.	.	T	19.76	3.887965	0.72410	.	.	ENSG00000130703	ENST00000358053;ENST00000313733	T;T	0.47528	0.84;0.84	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.80433	0.4622	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87931	0.2710	10	0.87932	D	0	-15.4884	15.2959	0.73906	0.0:0.0:0.0:1.0	.	77;89	Q9H1P3-2;Q9H1P3	.;OSBL2_HUMAN	P	77;89	ENSP00000350755:S77P;ENSP00000316649:S89P	ENSP00000316649:S89P	S	+	1	0	OSBPL2	60280582	1.000000	0.71417	0.998000	0.56505	0.247000	0.25773	7.813000	0.86123	2.148000	0.66965	0.459000	0.35465	TCC	.		0.592	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835	
OTX1	5013	ucsc.edu;bcgsc.ca	37	2	63281316	63281316	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:63281316C>T	ENST00000282549.2	+	4	508	c.232C>T	c.(232-234)Ccg>Tcg	p.P78S	OTX1_ENST00000366671.3_Missense_Mutation_p.P78S	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	78					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					GATCAACCTGCCGGAGTCTAG	0.617																																					p.P78S		.											.	OTX1	70	0			c.C232T						.						82.0	80.0	81.0					2																	63281316		2203	4300	6503	SO:0001583	missense	5013	exon4			AACCTGCCGGAGT		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.232C>T	2.37:g.63281316C>T	ENSP00000282549:p.Pro78Ser	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_014562	A6NHA2|B3KTJ4|Q53TG6	Missense_Mutation	SNP	ENST00000282549.2	37	CCDS1873.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485230	0.84854	.	.	ENSG00000115507	ENST00000366671;ENST00000282549	D;D	0.95171	-3.63;-3.63	5.09	5.09	0.68999	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94417	0.8204	N	0.16368	0.405	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	D	0.95432	0.8517	10	0.66056	D	0.02	.	17.4242	0.87522	0.0:1.0:0.0:0.0	.	78	P32242	OTX1_HUMAN	S	78	ENSP00000355631:P78S;ENSP00000282549:P78S	ENSP00000282549:P78S	P	+	1	0	OTX1	63134820	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	4.803000	0.62546	2.638000	0.89438	0.655000	0.94253	CCG	.		0.617	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
PCDHB16	57717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140563257	140563257	+	Missense_Mutation	SNP	T	T	A	rs377277959		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr5:140563257T>A	ENST00000361016.2	+	1	2278	c.1123T>A	c.(1123-1125)Tcc>Acc	p.S375T		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	375	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGATCCTGACTCCGGAAACAA	0.493																																					p.S375T		.											.	PCDHB16	92	0			c.T1123A						.	T	THR/SER	1,4405	2.1+/-5.4	0,1,2202	83.0	86.0	85.0		1123	3.3	0.1	5		85	0,8600		0,0,4300	no	missense	PCDHB16	NM_020957.1	58	0,1,6502	AA,AT,TT		0.0,0.0227,0.0077	possibly-damaging	375/777	140563257	1,13005	2203	4300	6503	SO:0001583	missense	57717	exon1			CCTGACTCCGGAA	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1123T>A	5.37:g.140563257T>A	ENSP00000354293:p.Ser375Thr	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	26.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	T	17.71	3.455974	0.63401	2.27E-4	0.0	ENSG00000196963	ENST00000361016	T	0.01787	4.64	4.47	3.28	0.37604	Cadherin (4);Cadherin-like (1);	0.000000	0.33834	N	0.004517	T	0.06735	0.0172	M	0.89904	3.07	0.27337	N	0.956618	P;P	0.39424	0.532;0.673	B;P	0.44696	0.158;0.458	T	0.02144	-1.1206	10	0.72032	D	0.01	.	11.0225	0.47726	0.0:0.0:0.1566:0.8434	.	65;375	O15199;Q9NRJ7	.;PCDBG_HUMAN	T	375	ENSP00000354293:S375T	ENSP00000354293:S375T	S	+	1	0	PCDHB16	140543441	0.256000	0.24012	0.086000	0.20670	0.949000	0.60115	1.614000	0.36911	0.549000	0.28973	0.482000	0.46254	TCC	.		0.493	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCSK2	5126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	17208109	17208109	+	Silent	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr20:17208109C>T	ENST00000262545.2	+	1	474	c.159C>T	c.(157-159)caC>caT	p.H53H	PCSK2_ENST00000536609.1_Silent_p.H53H|PCSK2_ENST00000377899.1_Silent_p.H34H	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	53					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.H53H(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAGCAGAACACGGCTTTGGAG	0.522																																					p.H53H		.											.	PCSK2	157	1	Substitution - coding silent(1)	lung(1)	c.C159T						.						69.0	59.0	63.0					20																	17208109		2203	4300	6503	SO:0001819	synonymous_variant	5126	exon1			AGAACACGGCTTT	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.159C>T	20.37:g.17208109C>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	33.0	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Silent	SNP	ENST00000262545.2	37	CCDS13125.1																																																																																			.		0.522	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
PGBD1	84547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28269056	28269056	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:28269056G>T	ENST00000405948.2	+	7	1845	c.1425G>T	c.(1423-1425)agG>agT	p.R475S	PGBD1_ENST00000259883.3_Missense_Mutation_p.R475S	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	475						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						ATCCTAGAAGGGAAATGTATT	0.418																																					p.R475S		.											.	PGBD1	94	0			c.G1425T						.						158.0	156.0	156.0					6																	28269056		2203	4300	6503	SO:0001583	missense	84547	exon7			TAGAAGGGAAATG	D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1425G>T	6.37:g.28269056G>T	ENSP00000385213:p.Arg475Ser	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	54.0	NM_001184743	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432087	0.25813	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.17854	2.25;2.25	4.66	0.887	0.19200	.	0.140189	0.33253	N	0.005116	T	0.05914	0.0154	L	0.60455	1.87	0.23809	N	0.996784	B	0.22146	0.065	B	0.32211	0.142	T	0.39901	-0.9591	10	0.22109	T	0.4	-6.7987	6.3282	0.21255	0.414:0.0:0.586:0.0	.	475	Q96JS3	PGBD1_HUMAN	S	475	ENSP00000385213:R475S;ENSP00000259883:R475S	ENSP00000259883:R475S	R	+	3	2	PGBD1	28377035	0.860000	0.29831	0.970000	0.41538	0.987000	0.75469	0.262000	0.18460	0.292000	0.22492	0.655000	0.94253	AGG	.		0.418	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		
PIK3C2B	5287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	204438107	204438107	+	Missense_Mutation	SNP	G	G	A	rs375951229		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:204438107G>A	ENST00000367187.3	-	3	1380	c.824C>T	c.(823-825)gCc>gTc	p.A275V	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.A275V	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	275	Interaction with GRB2.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CTTGCTCCTGGCCACGGGTTT	0.622																																					p.A275V		.											.	PIK3C2B	1310	0			c.C824T						.	G	VAL/ALA	0,4406		0,0,2203	78.0	87.0	84.0		824	5.3	1.0	1		84	1,8599	1.2+/-3.3	0,1,4299	no	missense	PIK3C2B	NM_002646.3	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	275/1635	204438107	1,13005	2203	4300	6503	SO:0001583	missense	5287	exon3			CTCCTGGCCACGG	Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.824C>T	1.37:g.204438107G>A	ENSP00000356155:p.Ala275Val	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	22.0	NM_002646	O95666|Q5SW99	Missense_Mutation	SNP	ENST00000367187.3	37	CCDS1446.1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.503912	0.64410	0.0	1.16E-4	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.69040	-0.27;-0.37	5.31	5.31	0.75309	.	0.000000	0.56097	D	0.000038	T	0.61739	0.2371	L	0.47716	1.5	0.38246	D	0.941472	B;B	0.23316	0.043;0.083	B;B	0.24541	0.054;0.039	T	0.60480	-0.7255	10	0.31617	T	0.26	.	16.8301	0.85942	0.0:0.0:1.0:0.0	.	275;275	F5GWN5;O00750	.;P3C2B_HUMAN	V	275	ENSP00000356155:A275V;ENSP00000400561:A275V	ENSP00000356155:A275V	A	-	2	0	PIK3C2B	202704730	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	8.776000	0.91776	2.491000	0.84063	0.456000	0.33151	GCC	.		0.622	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087965.1	NM_002646	
PLA2G6	8398	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	38528998	38528998	+	Missense_Mutation	SNP	C	C	T	rs374007706		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr22:38528998C>T	ENST00000332509.3	-	7	1100	c.917G>A	c.(916-918)cGg>cAg	p.R306Q	PLA2G6_ENST00000335539.3_Missense_Mutation_p.R306Q|PLA2G6_ENST00000402064.1_Missense_Mutation_p.R306Q	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	306					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	GTTGCAGCCCCGTTTCAGCAG	0.667																																					p.R306Q		.											.	PLA2G6	91	0			c.G917A						.	C	GLN/ARG,GLN/ARG,GLN/ARG	1,4387		0,1,2193	47.0	31.0	37.0		917,917,917	4.6	1.0	22		37	1,8579		0,1,4289	no	missense,missense,missense	PLA2G6	NM_001004426.1,NM_001199562.1,NM_003560.2	43,43,43	0,2,6482	TT,TC,CC		0.0117,0.0228,0.0154	probably-damaging,probably-damaging,probably-damaging	306/753,306/753,306/807	38528998	2,12966	2194	4290	6484	SO:0001583	missense	8398	exon7			CAGCCCCGTTTCA	AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.917G>A	22.37:g.38528998C>T	ENSP00000333142:p.Arg306Gln	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	17.0	NM_003560	A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	ENST00000332509.3	37	CCDS13967.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.985681|3.985681	0.74589|0.74589	2.28E-4|2.28E-4	1.17E-4|1.17E-4	ENSG00000184381|ENSG00000184381	ENST00000427114;ENST00000427453;ENST00000452542|ENST00000332509;ENST00000419848;ENST00000335539;ENST00000402064;ENST00000335538;ENST00000396860;ENST00000451461	.|T;T;T	.|0.65549	.|-0.16;-0.16;-0.16	5.56|5.56	4.55|4.55	0.56014|0.56014	.|Ankyrin repeat-containing domain (3);	.|0.312733	.|0.32204	.|N	.|0.006425	T|T	0.65575|0.65575	0.2704|0.2704	L|L	0.45352|0.45352	1.415|1.415	0.09310|0.09310	N|N	1|1	.|D;P;D	.|0.89917	.|1.0;0.942;0.959	.|D;P;B	.|0.65684	.|0.937;0.455;0.347	T|T	0.54827|0.54827	-0.8235|-0.8235	5|10	.|0.22109	.|T	.|0.4	-24.7838|-24.7838	8.5236|8.5236	0.33291|0.33291	0.0:0.8263:0.0:0.1737|0.0:0.8263:0.0:0.1737	.|.	.|271;306;306	.|B7Z6K3;O60733-2;O60733	.|.;.;PA2G6_HUMAN	R|Q	111;58;137|306;167;306;306;234;306;271	.|ENSP00000333142:R306Q;ENSP00000335149:R306Q;ENSP00000386100:R306Q	.|ENSP00000333142:R306Q	G|R	-|-	1|2	0|0	PLA2G6|PLA2G6	36858944|36858944	0.051000|0.051000	0.20477|0.20477	0.998000|0.998000	0.56505|0.56505	0.987000|0.987000	0.75469|0.75469	1.277000|1.277000	0.33167|0.33167	2.620000|2.620000	0.88729|0.88729	0.650000|0.650000	0.86243|0.86243	GGG|CGG	.		0.667	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321860.1	NM_001004426	
PLEKHG3	26030	ucsc.edu;bcgsc.ca	37	14	65208684	65208684	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr14:65208684A>G	ENST00000394691.1	+	16	2596	c.2449A>G	c.(2449-2451)Atc>Gtc	p.I817V	PLEKHG3_ENST00000484731.2_Missense_Mutation_p.I322V|PLEKHG3_ENST00000492928.1_Intron|PLEKHG3_ENST00000247226.7_Missense_Mutation_p.I761V|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.I350V			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	817							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		AATTGTGAAGATCTGGGAGGG	0.597																																					p.I761V		.											.	PLEKHG3	91	0			c.A2281G						.						55.0	63.0	60.0					14																	65208684		2203	4300	6503	SO:0001583	missense	26030	exon14			GTGAAGATCTGGG	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.2449A>G	14.37:g.65208684A>G	ENSP00000378183:p.Ile817Val	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_015549	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	ENST00000394691.1	37		.	.	.	.	.	.	.	.	.	.	A	4.361	0.066551	0.08388	.	.	ENSG00000126822	ENST00000247226;ENST00000394691;ENST00000471182;ENST00000484731	T;T;T;T	0.54279	1.02;0.58;1.84;1.81	5.97	0.491	0.16867	.	0.759418	0.12726	N	0.444255	T	0.38719	0.1051	L	0.38953	1.18	0.30780	N	0.742041	B;B;B;B	0.28850	0.225;0.225;0.004;0.02	B;B;B;B	0.29716	0.106;0.074;0.013;0.03	T	0.35126	-0.9801	10	0.30854	T	0.27	.	7.7834	0.29078	0.3307:0.5429:0.1264:0.0	.	350;322;817;761	A1L390-2;G3V311;A1L390;A1L390-3	.;.;PKHG3_HUMAN;.	V	761;817;350;322	ENSP00000247226:I761V;ENSP00000378183:I817V;ENSP00000450945:I350V;ENSP00000450973:I322V	ENSP00000247226:I761V	I	+	1	0	PLEKHG3	64278437	0.996000	0.38824	0.993000	0.49108	0.861000	0.49209	0.247000	0.18179	-0.134000	0.11516	0.533000	0.62120	ATC	.		0.597	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
POLR2B	5431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57860856	57860856	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr4:57860856A>G	ENST00000381227.1	+	6	813	c.400A>G	c.(400-402)Aaa>Gaa	p.K134E	POLR2B_ENST00000314595.5_Missense_Mutation_p.K134E|POLR2B_ENST00000431623.2_Missense_Mutation_p.K59E|snoU13_ENST00000459266.1_RNA|POLR2B_ENST00000441246.2_Missense_Mutation_p.K127E			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	134					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					AACAGTCATTAAAGAAGGTGA	0.338																																					p.K134E		.											.	POLR2B	92	0			c.A400G						.						56.0	58.0	57.0					4																	57860856		2201	4299	6500	SO:0001583	missense	5431	exon5			GTCATTAAAGAAG		CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.400A>G	4.37:g.57860856A>G	ENSP00000370625:p.Lys134Glu	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	29.0	NM_000938	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	A	13.43	2.233700	0.39498	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	5.77	5.77	0.91146	RNA polymerase, beta subunit, protrusion (1);	0.000000	0.85682	D	0.000000	T	0.46833	0.1413	N	0.20483	0.58	0.58432	D	0.999995	B;B	0.12630	0.001;0.006	B;B	0.15870	0.014;0.014	T	0.41360	-0.9513	10	0.12103	T	0.63	.	16.0891	0.81080	1.0:0.0:0.0:0.0	.	59;134	C9J4M6;P30876	.;RPB2_HUMAN	E	134;59;127;134	ENSP00000370625:K134E;ENSP00000391096:K59E;ENSP00000391452:K127E;ENSP00000312735:K134E	ENSP00000312735:K134E	K	+	1	0	POLR2B	57555613	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.268000	0.72552	2.208000	0.71279	0.455000	0.32223	AAA	.		0.338	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
POMP	51371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	29242666	29242666	+	Silent	SNP	A	A	G	rs560145213		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr13:29242666A>G	ENST00000380842.4	+	4	300	c.219A>G	c.(217-219)ctA>ctG	p.L73L	POMP_ENST00000460403.1_3'UTR	NM_015932.5	NP_057016.1	Q9Y244	POMP_HUMAN	proteasome maturation protein	73					proteasome assembly (GO:0043248)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(1)	4		Lung SC(185;0.0367)		all cancers(112;0.141)|OV - Ovarian serous cystadenocarcinoma(117;0.216)		TTCAGGGTCTATTTGCTCCGC	0.373													A|||	1	0.000199681	0.0008	0.0	5008	,	,		17728	0.0		0.0	False		,,,				2504	0.0				p.L73L		.											.	POMP	90	0			c.A219G						.						116.0	110.0	112.0					13																	29242666		2203	4300	6503	SO:0001819	synonymous_variant	51371	exon4			GGGTCTATTTGCT	AF077200	CCDS9331.1	13q12.13	2013-11-11	2006-07-04	2006-07-04	ENSG00000132963	ENSG00000132963			20330	protein-coding gene	gene with protein product	"""proteassemblin"""	613386	"""chromosome 13 open reading frame 12"""	C13orf12		11042152	Standard	NM_015932		Approved	HSPC014, UMP1	uc001usf.3	Q9Y244	OTTHUMG00000016652	ENST00000380842.4:c.219A>G	13.37:g.29242666A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	19.0	NM_015932	A5HKJ2|D6MXU3|Q9HB69	Silent	SNP	ENST00000380842.4	37	CCDS9331.1																																																																																			.		0.373	POMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044327.1	NM_015932	
PPARA	5465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	46615711	46615711	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr22:46615711A>C	ENST00000396000.2	+	6	776	c.511A>C	c.(511-513)Att>Ctt	p.I171L	PPARA_ENST00000402126.1_Missense_Mutation_p.I171L|PPARA_ENST00000434345.2_Intron|PPARA_ENST00000262735.5_Missense_Mutation_p.I171L|PPARA_ENST00000407236.1_Missense_Mutation_p.I171L			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	171					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	AACCCTAGCGATTCGTTTTGG	0.488																																					p.I171L		.											.	PPARA	611	0			c.A511C						.						69.0	64.0	66.0					22																	46615711		2203	4300	6503	SO:0001583	missense	5465	exon6			CTAGCGATTCGTT	L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.511A>C	22.37:g.46615711A>C	ENSP00000379322:p.Ile171Leu	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	22.0	NM_001001928	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Missense_Mutation	SNP	ENST00000396000.2	37	CCDS33669.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313025	0.60414	.	.	ENSG00000186951	ENST00000396000;ENST00000262735;ENST00000407236;ENST00000402126	D;D;D;D	0.96200	-3.94;-3.94;-3.94;-3.94	5.51	5.51	0.81932	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (1);	0.000000	0.85682	D	0.000000	D	0.95981	0.8691	M	0.84773	2.715	0.80722	D	1	B;B	0.21905	0.062;0.062	B;B	0.32211	0.142;0.142	D	0.94764	0.7939	10	0.87932	D	0	.	14.8173	0.70045	1.0:0.0:0.0:0.0	.	171;171	F1D8S4;Q07869	.;PPARA_HUMAN	L	171	ENSP00000379322:I171L;ENSP00000262735:I171L;ENSP00000385523:I171L;ENSP00000385246:I171L	ENSP00000262735:I171L	I	+	1	0	PPARA	44994375	1.000000	0.71417	0.928000	0.36995	0.339000	0.28857	9.101000	0.94219	2.082000	0.62665	0.454000	0.30748	ATT	.		0.488	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318129.3	NM_001001928	
PPL	5493	ucsc.edu;bcgsc.ca	37	16	4943555	4943555	+	Silent	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr16:4943555G>T	ENST00000345988.2	-	13	1568	c.1479C>A	c.(1477-1479)acC>acA	p.T493T	PPL_ENST00000590782.2_Silent_p.T491T	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	493					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CGGGATTCTCGGTCTTCAGCA	0.662																																					p.T493T		.											.	PPL	95	0			c.C1479A						.						42.0	42.0	42.0					16																	4943555		2196	4300	6496	SO:0001819	synonymous_variant	5493	exon13			ATTCTCGGTCTTC	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1479C>A	16.37:g.4943555G>T		Somatic	70.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_002705	O60314|O60454|Q14C98	Silent	SNP	ENST00000345988.2	37	CCDS10526.1																																																																																			.		0.662	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
PSRC1	84722	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	109824628	109824628	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:109824628C>A	ENST00000438534.2	-	4	270	c.132G>T	c.(130-132)cgG>cgT	p.R44R	PSRC1_ENST00000369909.2_Silent_p.R44R|PSRC1_ENST00000369904.3_Silent_p.R44R|PSRC1_ENST00000409267.1_Silent_p.R44R|PSRC1_ENST00000409138.2_Silent_p.R44R|PSRC1_ENST00000369907.3_Silent_p.R44R|PSRC1_ENST00000369903.2_Silent_p.R44R	NM_001005290.3	NP_001005290.1	Q6PGN9	PSRC1_HUMAN	proline/serine-rich coiled-coil 1	44					microtubule bundle formation (GO:0001578)|mitotic metaphase plate congression (GO:0007080)|negative regulation of cell growth (GO:0030308)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mitotic spindle organization (GO:0060236)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	microtubule binding (GO:0008017)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	7		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0286)|Lung(183;0.0658)|COAD - Colon adenocarcinoma(174;0.112)|Epithelial(280;0.188)|all cancers(265;0.213)		GGGAGAGGCCCCGTCGAAGTG	0.582																																					p.R44R		.											.	PSRC1	90	0			c.G132T						.						15.0	14.0	14.0					1																	109824628		2181	4262	6443	SO:0001819	synonymous_variant	84722	exon4			GAGGCCCCGTCGA		CCDS797.1, CCDS30791.1	1p13.3	2008-02-05			ENSG00000134222	ENSG00000134222			24472	protein-coding gene	gene with protein product	"""differential display and activated by p53"""	613126				12427559, 10618717	Standard	NM_001032291		Approved	DDA3	uc001dxd.3	Q6PGN9	OTTHUMG00000012000	ENST00000438534.2:c.132G>T	1.37:g.109824628C>A		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	8.0	NM_001032291	Q5T2Z3|Q6ZTI8|Q71MG3|Q9BV77	Silent	SNP	ENST00000438534.2	37																																																																																				.		0.582	PSRC1-202	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000335567.3	NM_032636	
PTPN3	5774	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	112145782	112145782	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr9:112145782delC	ENST00000374541.2	-	23	2407	c.2303delG	c.(2302-2304)ggcfs	p.G769fs	PTPN3_ENST00000262539.3_Frame_Shift_Del_p.G615fs|PTPN3_ENST00000394827.3_Frame_Shift_Del_p.G237fs|PTPN3_ENST00000446349.1_Frame_Shift_Del_p.G593fs|PTPN3_ENST00000412145.1_Frame_Shift_Del_p.G638fs	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	769	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GTGAAAGCCGCCGTGGTTCAT	0.587																																					p.G768fs		.											.	PTPN3	229	0			c.2303delG						.						132.0	123.0	126.0					9																	112145782		2203	4300	6503	SO:0001589	frameshift_variant	5774	exon23			AAGCCGCCGTGGT		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.2303delG	9.37:g.112145782delC	ENSP00000363667:p.Gly769fs	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	18.0	NM_002829	A0AUW9|E7EN99|E9PGU7	Frame_Shift_Del	DEL	ENST00000374541.2	37	CCDS6776.1																																																																																			.		0.587	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
PTPRE	5791	broad.mit.edu;bcgsc.ca	37	10	129871633	129871633	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:129871633C>A	ENST00000254667.3	+	17	1776	c.1497C>A	c.(1495-1497)acC>acA	p.T499T	PTPRE_ENST00000306042.5_Silent_p.T441T|PTPRE_ENST00000419012.2_Silent_p.T499T	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	499	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	TCATCGCCACCCAGGGGCCAC	0.547																																					p.T499T	Colon(52;977 1184 20575 41685)	.											.	PTPRE	227	0			c.C1497A						.						124.0	112.0	116.0					10																	129871633		2203	4300	6503	SO:0001819	synonymous_variant	5791	exon17			CGCCACCCAGGGG	AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.1497C>A	10.37:g.129871633C>A		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	6.0	NM_006504	Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Silent	SNP	ENST00000254667.3	37	CCDS7657.1																																																																																			.		0.547	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050990.1		
RALGPS2	55103	broad.mit.edu;bcgsc.ca	37	1	178866879	178866879	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:178866879C>A	ENST00000367635.3	+	17	1850	c.1512C>A	c.(1510-1512)acC>acA	p.T504T	RALGPS2_ENST00000367634.2_Silent_p.T478T	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	504	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Required for stimulation of nucleotide exchange by RALA. {ECO:0000250}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						TAAAGGCTACCGAAAGAAAAC	0.398																																					p.T504T		.											.	RALGPS2	226	0			c.C1512A						.						114.0	111.0	112.0					1																	178866879		2203	4300	6503	SO:0001819	synonymous_variant	55103	exon17			GGCTACCGAAAGA	AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.1512C>A	1.37:g.178866879C>A		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	10.0	NM_152663	B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Silent	SNP	ENST00000367635.3	37	CCDS1325.1	.	.	.	.	.	.	.	.	.	.	C	7.697	0.692234	0.15039	.	.	ENSG00000116191	ENST00000367632	.	.	.	5.69	-2.52	0.06346	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30534	-0.9975	4	.	.	.	.	1.7172	0.02904	0.4198:0.2241:0.2483:0.1078	.	.	.	.	Q	95	.	.	P	+	2	0	RALGPS2	177133502	0.890000	0.30428	0.991000	0.47740	0.905000	0.53344	0.109000	0.15417	-0.408000	0.07565	-1.008000	0.02478	CCG	.		0.398	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084926.2	NM_152663	
RBM20	282996	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	112572161	112572161	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:112572161G>A	ENST00000369519.3	+	9	2064	c.2006G>A	c.(2005-2007)tGg>tAg	p.W669*		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	669					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CGGGCTGACTGGGGCAATGGC	0.672																																					p.W669X		.											.	.	.	0			c.G2006A						.						17.0	23.0	21.0					10																	112572161		692	1591	2283	SO:0001587	stop_gained	282996	exon9			CTGACTGGGGCAA	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.2006G>A	10.37:g.112572161G>A	ENSP00000358532:p.Trp669*	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	5.0	NM_001134363	A6NIP5|B5A868|Q5JVI1	Nonsense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	G	40	8.138338	0.98672	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	.	.	.	5.79	5.79	0.91817	.	0.168635	0.41294	D	0.000915	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4719	20.0207	0.97499	0.0:0.0:1.0:0.0	.	.	.	.	X	669	.	ENSP00000358532:W669X	W	+	2	0	RBM20	112562151	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.179000	0.94861	2.739000	0.93911	0.563000	0.77884	TGG	.		0.672	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
RBM22	55696	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150072842	150072842	+	Silent	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr5:150072842T>C	ENST00000199814.4	-	9	1060	c.939A>G	c.(937-939)aaA>aaG	p.K313K	RBM22_ENST00000447771.2_Silent_p.K264K|RBM22_ENST00000540000.1_Silent_p.K264K	NM_018047.2	NP_060517.1	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	313					cellular response to drug (GO:0035690)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of RNA splicing (GO:0033120)|protein import into nucleus, translocation (GO:0000060)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|snRNA binding (GO:0017069)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(1)	17		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CATCTTTCTCTTTTTCTTTTC	0.498																																					p.K313K		.											.	RBM22	226	0			c.A939G						.						102.0	97.0	99.0					5																	150072842		2203	4300	6503	SO:0001819	synonymous_variant	55696	exon9			TTTCTCTTTTTCT	AL136933	CCDS34278.1	5q33.1	2013-02-12			ENSG00000086589	ENSG00000086589		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	25503	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 47"""	612430				20013661, 19133299	Standard	NM_018047		Approved	FLJ10290, ZC3H16, fSAP47, Cwc2	uc031slu.1	Q9NW64	OTTHUMG00000163589	ENST00000199814.4:c.939A>G	5.37:g.150072842T>C		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	6.0	NM_018047	A6NDM5|B4DLI9|O95607	Silent	SNP	ENST00000199814.4	37	CCDS34278.1																																																																																			.		0.498	RBM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374431.2	NM_018047	
RCN2	5955	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	77241537	77241537	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:77241537G>T	ENST00000394885.3	+	7	1151	c.928G>T	c.(928-930)Gac>Tac	p.D310Y	RCN2_ENST00000320963.5_Missense_Mutation_p.D328Y|RCN2_ENST00000394883.3_Missense_Mutation_p.D209Y	NM_002902.2	NP_002893.1	Q14257	RCN2_HUMAN	reticulocalbin 2, EF-hand calcium binding domain	310						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(2)|large_intestine(2)|lung(1)	7						GCTCCATGATGACTATTTCTA	0.388																																					p.D328Y		.											.	RCN2	90	0			c.G982T						.						101.0	102.0	102.0					15																	77241537		2196	4294	6490	SO:0001583	missense	5955	exon8			CATGATGACTATT	X78669	CCDS10291.1, CCDS61719.1	15q22.33-q24.1	2013-01-10			ENSG00000117906	ENSG00000117906		"""EF-hand domain containing"""	9935	protein-coding gene	gene with protein product	"""Reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD)"""	602584				9533013, 7624774	Standard	NM_002902		Approved	ERC-55, E6BP, ERC55, TCBP49	uc002bcd.3	Q14257	OTTHUMG00000143730	ENST00000394885.3:c.928G>T	15.37:g.77241537G>T	ENSP00000378349:p.Asp310Tyr	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	9.0	NM_001271837	A8MTG6|F8WCY5|Q53XN8	Missense_Mutation	SNP	ENST00000394885.3	37	CCDS10291.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673307	0.47781	.	.	ENSG00000117906	ENST00000394885;ENST00000320963;ENST00000394883	T;T;T	0.76316	-1.01;-0.05;0.73	5.91	4.02	0.46733	.	0.316616	0.39834	N	0.001243	T	0.62696	0.2449	N	0.12182	0.205	0.38267	D	0.942036	P;P;P	0.52842	0.956;0.904;0.828	P;P;B	0.44811	0.459;0.461;0.34	T	0.70417	-0.4877	10	0.87932	D	0	-16.8327	10.2245	0.43216	0.1882:0.0:0.8118:0.0	.	209;328;310	A8MXP8;F8WCY5;Q14257	.;.;RCN2_HUMAN	Y	310;328;209	ENSP00000378349:D310Y;ENSP00000319739:D328Y;ENSP00000378347:D209Y	ENSP00000319739:D328Y	D	+	1	0	RCN2	75028592	0.997000	0.39634	0.999000	0.59377	0.998000	0.95712	2.133000	0.42093	2.809000	0.96659	0.555000	0.69702	GAC	.		0.388	RCN2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289795.1	NM_002902	
ROBO2	6092	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	77626718	77626718	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:77626718G>T	ENST00000461745.1	+	15	3181	c.2281G>T	c.(2281-2283)Gat>Tat	p.D761Y	ROBO2_ENST00000332191.8_Missense_Mutation_p.D761Y|ROBO2_ENST00000487694.3_Missense_Mutation_p.D777Y	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	761	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TGTTTCCTGGGATCCTCCTCC	0.463																																					p.D761Y		.											.	ROBO2	328	0			c.G2281T						.						87.0	89.0	88.0					3																	77626718		1903	4117	6020	SO:0001583	missense	6092	exon15			TCCTGGGATCCTC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2281G>T	3.37:g.77626718G>T	ENSP00000417164:p.Asp761Tyr	Somatic	84.0	1.0		WXS	Illumina HiSeq	Phase_I	133.0	47.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.862766	0.91511	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.58358	0.34;0.34;0.34	5.66	5.66	0.87406	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.47093	D	0.000245	T	0.74749	0.3757	M	0.77486	2.375	0.43885	D	0.996508	D;D;D	0.76494	0.999;0.997;0.997	D;D;D	0.72075	0.972;0.976;0.972	T	0.76570	-0.2911	9	0.66056	D	0.02	.	19.7501	0.96265	0.0:0.0:1.0:0.0	.	777;761;761	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	Y	777;777;781;761;761;482	ENSP00000417335:D777Y;ENSP00000417164:D761Y;ENSP00000327536:D761Y	ENSP00000327536:D761Y	D	+	1	0	ROBO2	77709408	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.667000	0.90743	0.491000	0.48974	GAT	.		0.463	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
RP1L1	94137	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	10470139	10470139	+	Missense_Mutation	SNP	C	C	A	rs578108515		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr8:10470139C>A	ENST00000382483.3	-	4	1692	c.1469G>T	c.(1468-1470)gGg>gTg	p.G490V		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	490					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCGCTCAGCCCCTATCTGGGC	0.711																																					p.G490V		.											.	RP1L1	139	0			c.G1469T						.						27.0	31.0	29.0					8																	10470139		1911	4119	6030	SO:0001583	missense	94137	exon4			TCAGCCCCTATCT	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1469G>T	8.37:g.10470139C>A	ENSP00000371923:p.Gly490Val	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	11.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822299	0.32237	.	.	ENSG00000183638	ENST00000382483	T	0.04015	3.73	4.41	-2.38	0.06622	.	1.713650	0.04054	U	0.305219	T	0.04003	0.0112	L	0.27053	0.805	0.09310	N	1	P	0.38827	0.649	B	0.36186	0.219	T	0.37033	-0.9723	10	0.72032	D	0.01	2.6844	5.0251	0.14381	0.1409:0.4006:0.0:0.4585	.	490	A6NKC6	.	V	490	ENSP00000371923:G490V	ENSP00000371923:G490V	G	-	2	0	RP1L1	10507549	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.099000	0.15210	-0.466000	0.06943	0.561000	0.74099	GGG	.		0.711	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RTN4	57142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55254616	55254616	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:55254616T>C	ENST00000337526.6	-	3	862	c.619A>G	c.(619-621)Atg>Gtg	p.M207V	RTN4_ENST00000404909.1_Start_Codon_SNP_p.M1V|RTN4_ENST00000354474.6_Intron|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Start_Codon_SNP_p.M1V|RTN4_ENST00000394611.2_Start_Codon_SNP_p.M1V|RTN4_ENST00000405240.1_Start_Codon_SNP_p.M1V|RTN4_ENST00000357732.4_Intron	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	207					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TTCAAGTCCATATTTTCTGTG	0.428																																					p.M207V		.											.	RTN4	155	0			c.A619G						.						72.0	64.0	67.0					2																	55254616		2203	4300	6503	SO:0001583	missense	57142	exon3			AGTCCATATTTTC	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.619A>G	2.37:g.55254616T>C	ENSP00000337838:p.Met207Val	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	16.0	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	T	9.944	1.218355	0.22373	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000427710	T;T;T;T;T	0.22743	1.94;1.94;2.35;1.94;1.94	5.8	3.46	0.39613	.	2.597800	0.00924	N	0.002621	T	0.21550	0.0519	L	0.55834	1.745	0.80722	D	1	B	0.23128	0.08	B	0.16289	0.015	T	0.35525	-0.9785	10	0.20519	T	0.43	-18.1312	4.5817	0.12262	0.0:0.4456:0.0:0.5544	.	207	Q9NQC3	RTN4_HUMAN	V	1;1;207;1;1;1	ENSP00000384471:M1V;ENSP00000349944:M1V;ENSP00000337838:M207V;ENSP00000378109:M1V;ENSP00000385650:M1V	ENSP00000337838:M207V	M	-	1	0	RTN4	55108120	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	1.077000	0.30741	1.022000	0.39626	0.455000	0.32223	ATG	.		0.428	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
RTN4	57142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55254618	55254618	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:55254618T>G	ENST00000337526.6	-	3	860	c.617A>C	c.(616-618)aAt>aCt	p.N206T	RTN4_ENST00000404909.1_5'UTR|RTN4_ENST00000354474.6_Intron|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_5'UTR|RTN4_ENST00000394611.2_5'UTR|RTN4_ENST00000405240.1_5'UTR|RTN4_ENST00000357732.4_Intron	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	206					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						CAAGTCCATATTTTCTGTGAC	0.418																																					p.N206T		.											.	RTN4	155	0			c.A617C						.						72.0	64.0	66.0					2																	55254618		2203	4300	6503	SO:0001583	missense	57142	exon3			TCCATATTTTCTG	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.617A>C	2.37:g.55254618T>G	ENSP00000337838:p.Asn206Thr	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	17.0	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.316775	0.40996	.	.	ENSG00000115310	ENST00000337526	T	0.16457	2.34	5.8	5.8	0.92144	.	1.351150	0.04498	N	0.380799	T	0.14874	0.0359	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09997	-1.0649	10	0.87932	D	0	0.4404	16.1372	0.81494	0.0:0.0:0.0:1.0	.	206	Q9NQC3	RTN4_HUMAN	T	206	ENSP00000337838:N206T	ENSP00000337838:N206T	N	-	2	0	RTN4	55108122	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.925000	0.48884	2.207000	0.71202	0.455000	0.32223	AAT	.		0.418	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
SEPT4	5414	broad.mit.edu;bcgsc.ca	37	17	56599413	56599413	+	Silent	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr17:56599413G>T	ENST00000317268.3	-	6	888	c.712C>A	c.(712-714)Cga>Aga	p.R238R	RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000317256.6_Silent_p.R219R|SEPT4_ENST00000426861.1_Silent_p.R219R|SEPT4_ENST00000393086.1_Silent_p.R219R|SEPT4_ENST00000412945.3_Silent_p.R230R|SEPT4_ENST00000583114.1_Silent_p.R91R|SEPT4_ENST00000457347.2_Silent_p.R253R|SEPT4_ENST00000580809.1_Silent_p.R120R|SEPT4_ENST00000579371.1_Silent_p.R139R|SEPT4_ENST00000580844.1_Silent_p.R139R	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	238	Septin-type G.				apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTCTCGTCTCGGAAATACTGC	0.537																																					p.R253R		.											.	SEPT4	68	0			c.C757A						.						159.0	132.0	141.0					17																	56599413		2203	4300	6503	SO:0001819	synonymous_variant	5414	exon7			CGTCTCGGAAATA	AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.712C>A	17.37:g.56599413G>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	9.0	NM_001256782	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Silent	SNP	ENST00000317268.3	37	CCDS11610.1																																																																																			.		0.537	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417	
SIN3A	25942	ucsc.edu;bcgsc.ca	37	15	75694204	75694204	+	Silent	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:75694204A>G	ENST00000394947.3	-	10	1829	c.1515T>C	c.(1513-1515)tcT>tcC	p.S505S	SIN3A_ENST00000360439.4_Silent_p.S505S|SIN3A_ENST00000394949.4_Silent_p.S505S	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						CCAGGAAAGGAGAGACTAGTT	0.448																																					p.S505S		.											.	SIN3A	230	0			c.T1515C						.						85.0	78.0	80.0					15																	75694204		2197	4294	6491	SO:0001819	synonymous_variant	25942	exon10			GAAAGGAGAGACT	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.1515T>C	15.37:g.75694204A>G		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_001145358		Silent	SNP	ENST00000394947.3	37	CCDS10279.1																																																																																			.		0.448	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
SLC10A1	6554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	70252897	70252897	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr14:70252897A>G	ENST00000216540.4	-	2	617	c.484T>C	c.(484-486)Tca>Cca	p.S162P		NM_003049.3	NP_003040.1	Q14973	NTCP_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 1	162					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)	14				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)	Bumetanide(DB00887)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Ethinyl Estradiol(DB00977)|Indomethacin(DB00328)|Liothyronine(DB00279)|Liotrix(DB01583)|Pitavastatin(DB08860)|Probenecid(DB01032)|Progesterone(DB00396)|Testosterone(DB00624)|Ursodeoxycholic acid(DB01586)	AGGACCAGTGATATCACGATG	0.517																																					p.S162P		.											.	SLC10A1	91	0			c.T484C						.						236.0	194.0	208.0					14																	70252897		2203	4300	6503	SO:0001583	missense	6554	exon2			CCAGTGATATCAC	L21893	CCDS9797.1	14q24.2	2013-07-18	2013-07-18		ENSG00000100652	ENSG00000100652		"""Solute carriers"""	10905	protein-coding gene	gene with protein product		182396				8132774	Standard	NM_003049		Approved	NTCP	uc001xlr.2	Q14973	OTTHUMG00000171236	ENST00000216540.4:c.484T>C	14.37:g.70252897A>G	ENSP00000216540:p.Ser162Pro	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	36.0	NM_003049	B9EGB6|Q2TU29	Missense_Mutation	SNP	ENST00000216540.4	37	CCDS9797.1	.	.	.	.	.	.	.	.	.	.	A	11.60	1.687662	0.29962	.	.	ENSG00000100652	ENST00000216540	T	0.12147	2.71	5.01	5.01	0.66863	.	0.203863	0.42821	D	0.000647	T	0.40297	0.1111	M	0.89353	3.025	0.29023	N	0.88618	D	0.89917	1.0	D	0.76071	0.987	T	0.43909	-0.9362	10	0.48119	T	0.1	-11.5151	10.1438	0.42751	0.8509:0.0:0.0:0.1491	.	162	Q14973	NTCP_HUMAN	P	162	ENSP00000216540:S162P	ENSP00000216540:S162P	S	-	1	0	SLC10A1	69322650	0.465000	0.25815	0.222000	0.23844	0.004000	0.04260	1.097000	0.30988	2.227000	0.72691	0.459000	0.35465	TCA	.		0.517	SLC10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412464.1		
SLC12A1	6557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48595052	48595052	+	Silent	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:48595052T>C	ENST00000558405.1	+	26	3284	c.3270T>C	c.(3268-3270)aaT>aaC	p.N1090N	SLC12A1_ENST00000396577.3_Silent_p.N1090N|SLC12A1_ENST00000380993.3_Silent_p.N1090N			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	1090					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TTAGAGGAAATCACAAAAATG	0.343																																					p.N1090N		.											.	SLC12A1	24	0			c.T3270C						.						86.0	88.0	87.0					15																	48595052		2198	4297	6495	SO:0001819	synonymous_variant	6557	exon27			AGGAAATCACAAA		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.3270T>C	15.37:g.48595052T>C		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	31.0	NM_001184832	A8JYA2|E9PDW4	Silent	SNP	ENST00000558405.1	37	CCDS10129.2																																																																																			.		0.343	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		
SLC19A3	80704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228563990	228563990	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:228563990C>A	ENST00000258403.3	-	3	512	c.441G>T	c.(439-441)acG>acT	p.T147T	SLC19A3_ENST00000541617.1_Silent_p.T143T|SLC19A3_ENST00000409287.1_Intron	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	147					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)			breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	AGGCGGCCAGCGTGACGCTCC	0.592																																					p.T147T		.											.	SLC19A3	92	0			c.G441T						.						85.0	87.0	86.0					2																	228563990		2203	4300	6503	SO:0001819	synonymous_variant	80704	exon3			GGCCAGCGTGACG	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.441G>T	2.37:g.228563990C>A		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	9.0	NM_025243		Silent	SNP	ENST00000258403.3	37	CCDS2468.1																																																																																			.		0.592	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
SLC30A9	10463	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	42065035	42065035	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr4:42065035C>T	ENST00000264451.7	+	11	1109	c.929C>T	c.(928-930)tCg>tTg	p.S310L		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	310					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TATATTTCTTCGCTAATTAGT	0.348																																					p.S310L		.											.	SLC30A9	91	0			c.C929T						.						206.0	198.0	201.0					4																	42065035		2203	4300	6503	SO:0001583	missense	10463	exon11			TTTCTTCGCTAAT	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.929C>T	4.37:g.42065035C>T	ENSP00000264451:p.Ser310Leu	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	411.0	17.0	NM_006345	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	ENST00000264451.7	37	CCDS3465.1	.	.	.	.	.	.	.	.	.	.	C	33	5.250466	0.95305	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.64618	-0.11	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.86381	0.5919	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89697	0.3902	10	0.87932	D	0	-11.8218	19.9859	0.97351	0.0:1.0:0.0:0.0	.	310	Q6PML9	ZNT9_HUMAN	L	310;138	ENSP00000264451:S310L	ENSP00000264451:S310L	S	+	2	0	SLC30A9	41759792	1.000000	0.71417	0.992000	0.48379	0.805000	0.45488	7.818000	0.86416	2.729000	0.93468	0.655000	0.94253	TCG	.		0.348	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3		
SLC35A4	113829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139947621	139947621	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr5:139947621C>A	ENST00000514199.1	+	2	2553	c.867C>A	c.(865-867)gtC>gtA	p.V289V	APBB3_ENST00000507279.1_Intron|SLC35A4_ENST00000323146.3_Silent_p.V289V			Q96G79	S35A4_HUMAN	solute carrier family 35, member A4	289	Leu-rich.					Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTGGTGGTCAACGCCGTGC	0.587																																					p.V289V		.											.	SLC35A4	90	0			c.C867A						.						72.0	53.0	59.0					5																	139947621		2203	4300	6503	SO:0001819	synonymous_variant	113829	exon3			GGTGGTCAACGCC	AJ420598	CCDS4231.1	5q31.3	2013-05-22			ENSG00000176087	ENSG00000176087		"""Solute carriers"""	20753	protein-coding gene	gene with protein product							Standard	NM_080670		Approved		uc003lgg.1	Q96G79	OTTHUMG00000129495	ENST00000514199.1:c.867C>A	5.37:g.139947621C>A		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	23.0	NM_080670	A8K013	Silent	SNP	ENST00000514199.1	37	CCDS4231.1	.	.	.	.	.	.	.	.	.	.	C	6.521	0.464336	0.12402	.	.	ENSG00000176087	ENST00000432254	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	T	0.58148	0.2102	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55560	-0.8122	4	.	.	.	-7.7688	7.9223	0.29854	0.1616:0.757:0.0:0.0813	.	.	.	.	K	110	.	.	Q	+	1	0	SLC35A4	139927805	0.986000	0.35501	1.000000	0.80357	0.963000	0.63663	0.186000	0.16978	2.674000	0.91012	0.555000	0.69702	CAA	.		0.587	SLC35A4-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372815.1	NM_080670	
SLC35G5	83650	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	11189305	11189305	+	Silent	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr8:11189305G>A	ENST00000382435.4	+	1	909	c.690G>A	c.(688-690)ggG>ggA	p.G230G		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	230						integral component of membrane (GO:0016021)											GCTTGGTGGGGCTGCTGGGCT	0.632																																					p.G230G		.											.	.	.	0			c.G690A						.						31.0	48.0	42.0					8																	11189305		2196	4287	6483	SO:0001819	synonymous_variant	83650	exon1			GGTGGGGCTGCTG	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.690G>A	8.37:g.11189305G>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	22.0	NM_054028	A2RRL6	Silent	SNP	ENST00000382435.4	37	CCDS5980.1																																																																																			.		0.632	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207313.2	NM_054028	
SLC39A10	57181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	196593015	196593015	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:196593015C>A	ENST00000409086.3	+	9	2554	c.2279C>A	c.(2278-2280)aCa>aAa	p.T760K	SLC39A10_ENST00000359634.5_Missense_Mutation_p.T760K|SLC39A10_ENST00000541054.1_Missense_Mutation_p.T310K	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	760					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			AATAACATCACACTTTGGATC	0.408																																					p.T760K		.											.	SLC39A10	92	0			c.C2279A						.						253.0	216.0	229.0					2																	196593015		2203	4300	6503	SO:0001583	missense	57181	exon9			ACATCACACTTTG		CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.2279C>A	2.37:g.196593015C>A	ENSP00000386766:p.Thr760Lys	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	315.0	151.0	NM_020342	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	ENST00000409086.3	37	CCDS33353.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480599	0.84747	.	.	ENSG00000196950	ENST00000409086;ENST00000359634;ENST00000541054	T;T;T	0.50548	0.74;0.74;0.74	5.4	4.53	0.55603	.	0.045219	0.85682	D	0.000000	T	0.63343	0.2503	L	0.59967	1.855	0.80722	D	1	D	0.67145	0.996	D	0.72338	0.977	T	0.64158	-0.6473	10	0.45353	T	0.12	.	14.1635	0.65461	0.0:0.9285:0.0:0.0715	.	760	Q9ULF5	S39AA_HUMAN	K	760;760;310	ENSP00000386766:T760K;ENSP00000352655:T760K;ENSP00000437787:T310K	ENSP00000352655:T760K	T	+	2	0	SLC39A10	196301260	1.000000	0.71417	0.981000	0.43875	0.992000	0.81027	7.604000	0.82830	1.527000	0.49086	0.655000	0.94253	ACA	.		0.408	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335186.1	XM_047707	
STAB1	23166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52549455	52549455	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:52549455G>T	ENST00000321725.6	+	37	3957	c.3881G>T	c.(3880-3882)aGc>aTc	p.S1294I		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1294					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCCAGGAAGAGCTGTGTCTAC	0.607																																					p.S1294I		.											.	STAB1	139	0			c.G3881T						.						76.0	71.0	73.0					3																	52549455		2202	4300	6502	SO:0001583	missense	23166	exon37			GGAAGAGCTGTGT	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3881G>T	3.37:g.52549455G>T	ENSP00000312946:p.Ser1294Ile	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	16.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281890	0.59758	.	.	ENSG00000010327	ENST00000321725	T	0.03152	4.03	4.71	3.83	0.44106	.	0.269718	0.34879	N	0.003614	T	0.05593	0.0147	N	0.17474	0.49	0.39755	D	0.971946	D	0.69078	0.997	P	0.62014	0.897	T	0.56890	-0.7904	10	0.20046	T	0.44	-28.4682	8.8676	0.35296	0.1024:0.0:0.8976:0.0	.	1294	Q9NY15	STAB1_HUMAN	I	1294	ENSP00000312946:S1294I	ENSP00000312946:S1294I	S	+	2	0	STAB1	52524495	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	3.320000	0.51991	1.327000	0.45338	0.563000	0.77884	AGC	.		0.607	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
STIL	6491	ucsc.edu;bcgsc.ca	37	1	47748108	47748108	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:47748108C>A	ENST00000360380.3	-	12	1520	c.1157G>T	c.(1156-1158)gGg>gTg	p.G386V	STIL_ENST00000243182.6_Missense_Mutation_p.G386V|STIL_ENST00000371877.3_Missense_Mutation_p.G386V|STIL_ENST00000337817.5_Missense_Mutation_p.G386V|STIL_ENST00000396221.2_Missense_Mutation_p.G386V	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	386					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TGGCATCTTCCCAGAAGATAA	0.403																																					p.G386V		.											.	STIL	659	0			c.G1157T						.						100.0	102.0	101.0					1																	47748108		2203	4300	6503	SO:0001583	missense	6491	exon11			ATCTTCCCAGAAG	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1157G>T	1.37:g.47748108C>A	ENSP00000353544:p.Gly386Val	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	40.0	6.0	NM_003035	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945360	0.34377	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03	5.74	4.75	0.60458	.	0.334237	0.37623	N	0.002005	T	0.41073	0.1143	L	0.57536	1.79	0.33214	D	0.553859	P;B;P;P;P	0.42620	0.501;0.116;0.501;0.785;0.785	B;B;B;B;B	0.43575	0.402;0.099;0.402;0.424;0.424	T	0.58713	-0.7588	10	0.62326	D	0.03	-4.3735	8.1775	0.31292	0.1447:0.7147:0.0:0.1406	.	386;339;386;386;386	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	V	386;386;386;386;386;339	ENSP00000353544:G386V;ENSP00000337367:G386V;ENSP00000360944:G386V;ENSP00000379523:G386V;ENSP00000243182:G386V;ENSP00000411664:G339V	ENSP00000243182:G386V	G	-	2	0	STIL	47520695	0.088000	0.21588	0.999000	0.59377	0.121000	0.20230	0.633000	0.24598	2.710000	0.92621	0.561000	0.74099	GGG	.		0.403	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
SUN1	23353	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	909049	909049	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr7:909049C>T	ENST00000405266.1	+	18	2179	c.2155C>T	c.(2155-2157)Ctc>Ttc	p.L719F	SUN1_ENST00000425407.2_Missense_Mutation_p.L599F|SUN1_ENST00000456758.2_Missense_Mutation_p.L871F|SUN1_ENST00000389574.3_Missense_Mutation_p.L599F|SUN1_ENST00000401592.1_Missense_Mutation_p.L682F|SUN1_ENST00000413514.2_Missense_Mutation_p.L480F|SUN1_ENST00000452783.2_Missense_Mutation_p.L579F			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	709	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGTGGTGAGGCTCTCCATGAT	0.572																																					p.L682F		.											.	SUN1	90	0			c.C2044T						.						112.0	120.0	117.0					7																	909049		2021	4200	6221	SO:0001583	missense	23353	exon17			GTGAGGCTCTCCA	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.2155C>T	7.37:g.909049C>T	ENSP00000384116:p.Leu719Phe	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	6.0	NM_001130965	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	ENST00000405266.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.50|14.50	2.554803|2.554803	0.45487|0.45487	.|.	.|.	ENSG00000164828|ENSG00000164828	ENST00000433212|ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514	.|T;T;T;T;T;T;T;T	.|0.69926	.|-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44	5.54|5.54	2.69|2.69	0.31865|0.31865	.|Sad1/UNC-like, C-terminal (2);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.83161|0.83161	0.5194|0.5194	M|M	0.90870|0.90870	3.155|3.155	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0;1.0	D|D	0.84657|0.84657	0.0704|0.0704	5|10	.|0.87932	.|D	.|0	-22.0517|-22.0517	10.5775|10.5775	0.45235|0.45235	0.0:0.7836:0.0:0.2164|0.0:0.7836:0.0:0.2164	.|.	.|480;579;682;871;709;599	.|E7EP45;E9PDU4;E9PF23;A4D2Q0;O94901;O94901-5	.|.;.;.;.;SUN1_HUMAN;.	V|F	530|871;599;579;719;682;709;599;607;480	.|ENSP00000388743:L871F;ENSP00000374225:L599F;ENSP00000413439:L579F;ENSP00000384116:L719F;ENSP00000384015:L682F;ENSP00000392309:L599F;ENSP00000409909:L607F;ENSP00000389313:L480F	.|ENSP00000297445:L709F	A|L	+|+	2|1	0|0	SUN1|SUN1	875575|875575	0.992000|0.992000	0.36948|0.36948	0.978000|0.978000	0.43139|0.43139	0.889000|0.889000	0.51656|0.51656	2.014000|2.014000	0.40951|0.40951	0.671000|0.671000	0.31185|0.31185	0.655000|0.655000	0.94253|0.94253	GCT|CTC	.		0.572	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154	
SUPT6H	6830	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	27027520	27027520	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr17:27027520G>A	ENST00000314616.6	+	35	5079	c.4796G>A	c.(4795-4797)aGt>aAt	p.S1599N	SUPT6H_ENST00000347486.4_Missense_Mutation_p.S1599N	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1599					chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGCGGCAGCAGTGCTTACCAC	0.632																																					p.S1599N		.											.	SUPT6H	93	0			c.G4796A						.						59.0	62.0	61.0					17																	27027520		2203	4300	6503	SO:0001583	missense	6830	exon35			GCAGCAGTGCTTA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4796G>A	17.37:g.27027520G>A	ENSP00000319104:p.Ser1599Asn	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	5.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	16.37	3.102960	0.56183	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.07	5.07	0.68467	.	0.098827	0.64402	D	0.000003	T	0.50429	0.1615	L	0.43152	1.355	0.80722	D	1	P	0.42827	0.791	B	0.38020	0.263	T	0.49312	-0.8953	9	0.25751	T	0.34	-12.4324	18.4501	0.90700	0.0:0.0:1.0:0.0	.	1599	Q7KZ85	SPT6H_HUMAN	N	1599	.	ENSP00000319104:S1599N	S	+	2	0	SUPT6H	24051647	1.000000	0.71417	0.989000	0.46669	0.761000	0.43186	9.121000	0.94375	2.364000	0.80123	0.650000	0.86243	AGT	.		0.632	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
TATDN2	9797	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10290922	10290922	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr3:10290922G>T	ENST00000287652.4	+	2	1089	c.38G>T	c.(37-39)aGc>aTc	p.S13I	TATDN2_ENST00000448281.2_Missense_Mutation_p.S13I|RP11-438J1.1_ENST00000450534.1_5'Flank	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	13					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						CACAACTGGAGCAGCACGTCG	0.672																																					p.S13I		.											.	TATDN2	92	0			c.G38T						.						48.0	49.0	49.0					3																	10290922		2202	4298	6500	SO:0001583	missense	9797	exon2			ACTGGAGCAGCAC	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.38G>T	3.37:g.10290922G>T	ENSP00000287652:p.Ser13Ile	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	13.0	NM_014760	Q3MIL9|Q5BKU0	Missense_Mutation	SNP	ENST00000287652.4	37	CCDS33698.1	.	.	.	.	.	.	.	.	.	.	G	19.16	3.773612	0.69992	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.26518	1.73;1.73	3.77	0.848	0.18966	.	.	.	.	.	T	0.18593	0.0446	L	0.51422	1.61	0.24734	N	0.993078	B	0.30068	0.267	B	0.21151	0.033	T	0.24799	-1.0150	9	0.87932	D	0	-3.0134	3.1275	0.06412	0.2332:0.0:0.5569:0.2099	.	13	Q93075	TATD2_HUMAN	I	13	ENSP00000287652:S13I;ENSP00000408736:S13I	ENSP00000287652:S13I	S	+	2	0	TATDN2	10265922	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	0.970000	0.29383	0.048000	0.15891	0.563000	0.77884	AGC	.		0.672	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203	
TBC1D8	11138	ucsc.edu;bcgsc.ca	37	2	101624722	101624722	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:101624722T>C	ENST00000376840.4	-	20	2983	c.2984A>G	c.(2983-2985)cAg>cGg	p.Q995R	TBC1D8_ENST00000409318.1_Missense_Mutation_p.Q1010R|RPL31_ENST00000409028.4_Intron|RPL31_ENST00000409650.1_Intron|RPL31_ENST00000409038.1_Intron			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	995					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TTTACAGAACTGGATAAATTC	0.398																																					p.Q995R		.											.	TBC1D8	25	0			c.A2984G						.						25.0	28.0	27.0					2																	101624722		1953	4167	6120	SO:0001583	missense	11138	exon20			CAGAACTGGATAA	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.2984A>G	2.37:g.101624722T>C	ENSP00000366036:p.Gln995Arg	Somatic	23.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001102426	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	ENST00000376840.4	37	CCDS46375.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.147871	0.78001	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.03717	3.83;3.84	5.47	5.47	0.80525	EF-hand-like domain (1);	0.232784	0.30949	N	0.008551	T	0.13030	0.0316	M	0.74647	2.275	0.39218	D	0.963446	D	0.56287	0.975	P	0.57468	0.821	T	0.29058	-1.0024	10	0.15952	T	0.53	-15.4963	15.6039	0.76646	0.0:0.0:0.0:1.0	.	995	O95759	TBCD8_HUMAN	R	995;1010	ENSP00000366036:Q995R;ENSP00000386856:Q1010R	ENSP00000366036:Q995R	Q	-	2	0	TBC1D8	100991154	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.899000	0.87370	2.069000	0.61940	0.529000	0.55759	CAG	.		0.398	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
TET1	80312	ucsc.edu;bcgsc.ca	37	10	70333688	70333688	+	Silent	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:70333688C>A	ENST00000373644.4	+	2	1802	c.1593C>A	c.(1591-1593)gcC>gcA	p.A531A		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	531	Sufficient for binding to genomic CpG islands.				chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TGGGTATAGCCCAACTCTCTC	0.507																																					p.A531A		.											.	TET1	663	0			c.C1593A						.						78.0	69.0	72.0					10																	70333688		2203	4300	6503	SO:0001819	synonymous_variant	80312	exon2			TATAGCCCAACTC	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1593C>A	10.37:g.70333688C>A		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1																																																																																			.		0.507	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
TMEM174	134288	ucsc.edu;bcgsc.ca	37	5	72469916	72469916	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr5:72469916A>G	ENST00000296776.5	+	2	705	c.656A>G	c.(655-657)gAg>gGg	p.E219G	TMEM174_ENST00000511737.1_Intron	NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	219						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		CAGCTAGAAGAGACACAGCTG	0.478																																					p.E219G		.											.	TMEM174	91	0			c.A656G						.						111.0	106.0	108.0					5																	72469916		2203	4300	6503	SO:0001583	missense	134288	exon2			TAGAAGAGACACA	BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.656A>G	5.37:g.72469916A>G	ENSP00000296776:p.Glu219Gly	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_153217	B2RDA0|Q96N81	Missense_Mutation	SNP	ENST00000296776.5	37	CCDS4018.1	.	.	.	.	.	.	.	.	.	.	A	10.79	1.450984	0.26074	.	.	ENSG00000164325	ENST00000296776	.	.	.	5.24	-0.0947	0.13643	.	0.602223	0.16352	N	0.218154	T	0.27765	0.0683	L	0.38838	1.175	0.20821	N	0.999843	B	0.06786	0.001	B	0.09377	0.004	T	0.15407	-1.0438	9	0.45353	T	0.12	-20.8575	5.9533	0.19259	0.4262:0.4162:0.1576:0.0	.	219	Q8WUU8	TM174_HUMAN	G	219	.	ENSP00000296776:E219G	E	+	2	0	TMEM174	72505672	0.959000	0.32827	0.023000	0.16930	0.015000	0.08874	0.773000	0.26661	-0.138000	0.11434	0.533000	0.62120	GAG	.		0.478	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254036.1	NM_153217	
TNFAIP2	7127	ucsc.edu;bcgsc.ca	37	14	103600074	103600074	+	Missense_Mutation	SNP	G	G	A	rs201264217		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr14:103600074G>A	ENST00000560869.1	+	11	2396	c.1757G>A	c.(1756-1758)cGc>cAc	p.R586H	TNFAIP2_ENST00000451723.2_Missense_Mutation_p.R255H|TNFAIP2_ENST00000538222.1_Missense_Mutation_p.R69H|TNFAIP2_ENST00000333007.1_Missense_Mutation_p.R586H			Q03169	TNAP2_HUMAN	tumor necrosis factor, alpha-induced protein 2	586					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|exocytosis (GO:0006887)	exocyst (GO:0000145)|extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	11		Melanoma(154;0.155)	Epithelial(46;0.191)			GAGATCATTCGCCTGCAGGAC	0.637																																					p.R586H		.											.	TNFAIP2	90	0			c.G1757A						.	G	HIS/ARG	0,4402		0,0,2201	59.0	47.0	51.0		1757	2.7	1.0	14		51	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TNFAIP2	NM_006291.2	29	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	586/655	103600074	1,13001	2201	4300	6501	SO:0001583	missense	7127	exon10			TCATTCGCCTGCA		CCDS9979.1	14q32	2011-01-31				ENSG00000185215			11895	protein-coding gene	gene with protein product	"""exocyst complex component 3-like 3"""	603300				1374453	Standard	NM_006291		Approved	B94, EXOC3L3	uc001ymm.1	Q03169		ENST00000560869.1:c.1757G>A	14.37:g.103600074G>A	ENSP00000452634:p.Arg586His	Somatic	18.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_006291	Q86VI0	Missense_Mutation	SNP	ENST00000560869.1	37	CCDS9979.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592795	0.66219	0.0	1.16E-4	ENSG00000185215	ENST00000333007;ENST00000451723;ENST00000538222	T;T;T	0.06849	3.25;3.25;3.25	4.6	2.72	0.32119	.	0.061944	0.64402	D	0.000009	T	0.15565	0.0375	M	0.66939	2.045	0.39304	D	0.964956	P;P;D	0.61697	0.838;0.919;0.99	B;B;P	0.52424	0.248;0.417;0.698	T	0.02098	-1.1214	10	0.87932	D	0	-17.3628	7.7822	0.29072	0.2049:0.0:0.7951:0.0	.	69;363;586	F6RNL3;A1A584;Q03169	.;.;TNAP2_HUMAN	H	586;255;69	ENSP00000332326:R586H;ENSP00000393256:R255H;ENSP00000446171:R69H	ENSP00000332326:R586H	R	+	2	0	TNFAIP2	102669827	0.330000	0.24705	0.996000	0.52242	0.795000	0.44927	1.061000	0.30542	0.916000	0.36871	0.561000	0.74099	CGC	.		0.637	TNFAIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415674.1	NM_006291	
TNFAIP8L3	388121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	51397266	51397266	+	Silent	SNP	C	C	T	rs267604247		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr15:51397266C>T	ENST00000327536.5	-	1	207	c.108G>A	c.(106-108)agG>agA	p.R36R	RP11-108K3.1_ENST00000559909.1_lincRNA	NM_207381.2	NP_997264.2	Q5GJ75	TP8L3_HUMAN	tumor necrosis factor, alpha-induced protein 8-like 3	36										endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	11				all cancers(107;0.000389)|GBM - Glioblastoma multiforme(94;0.00338)		ACGTGGCATCCCTTGTGCCTT	0.522																																					p.R36R		.											.	TNFAIP8L3	90	0			c.G108A						.						277.0	218.0	238.0					15																	51397266		2196	4293	6489	SO:0001819	synonymous_variant	388121	exon1			GGCATCCCTTGTG	AK123281	CCDS32241.1	15q21.2	2005-08-09				ENSG00000183578			20620	protein-coding gene	gene with protein product							Standard	XM_005254367		Approved	FLJ41287	uc001zyy.3	Q5GJ75		ENST00000327536.5:c.108G>A	15.37:g.51397266C>T		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	37.0	NM_207381	Q6ZWD1	Silent	SNP	ENST00000327536.5	37	CCDS32241.1																																																																																			.		0.522	TNFAIP8L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418661.1	NM_207381	
TNN	63923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175048705	175048705	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:175048705G>A	ENST00000239462.4	+	3	759	c.646G>A	c.(646-648)Gtg>Atg	p.V216M		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	216	EGF-like 2.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CGTGCGCGGCGTGTGCCAGTG	0.687																																					p.V216M		.											.	TNN	138	0			c.G646A						.						17.0	14.0	15.0					1																	175048705		2191	4281	6472	SO:0001583	missense	63923	exon3			CGCGGCGTGTGCC	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.646G>A	1.37:g.175048705G>A	ENSP00000239462:p.Val216Met	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	26.0	NM_022093	B9EGP3|Q5R360	Missense_Mutation	SNP	ENST00000239462.4	37	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	8.785	0.929247	0.18131	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.11277	2.79	4.7	2.79	0.32731	EGF, extracellular (1);	0.547782	0.19947	N	0.102520	T	0.18087	0.0434	M	0.70275	2.135	0.09310	N	1	D;P	0.54964	0.969;0.677	P;B	0.48840	0.592;0.266	T	0.05835	-1.0861	10	0.49607	T	0.09	.	9.8927	0.41300	0.0782:0.1397:0.782:0.0	.	216;216	B3KXB6;Q9UQP3	.;TENN_HUMAN	M	216	ENSP00000239462:V216M	ENSP00000239462:V216M	V	+	1	0	TNN	173315328	0.000000	0.05858	0.030000	0.17652	0.271000	0.26615	0.219000	0.17641	0.497000	0.27926	0.491000	0.48974	GTG	.		0.687	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TOR2A	27433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130494466	130494466	+	Silent	SNP	G	G	A	rs370306195		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr9:130494466G>A	ENST00000373284.5	-	5	859	c.813C>T	c.(811-813)tgC>tgT	p.C271C	TOR2A_ENST00000373281.5_3'UTR|TOR2A_ENST00000336067.6_Missense_Mutation_p.R229C|TOR2A_ENST00000472723.1_5'UTR|TOR2A_ENST00000458505.3_3'UTR	NM_001085347.2	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A	271					chaperone mediated protein folding requiring cofactor (GO:0051085)|protein homooligomerization (GO:0051260)	endoplasmic reticulum lumen (GO:0005788)	ATP binding (GO:0005524)			NS(1)|endometrium(2)	3						CGTTGAGCACGCAGTGCCGGA	0.627													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19478	0.0		0.0	False		,,,				2504	0.0				p.R229C		.											.	TOR2A	90	0			c.C685T						.						59.0	64.0	62.0					9																	130494466		2049	4185	6234	SO:0001819	synonymous_variant	27433	exon4			GAGCACGCAGTGC	AA873275	CCDS6876.1, CCDS43879.1, CCDS48024.1	9q34.11	2010-08-20			ENSG00000160404	ENSG00000160404			11996	protein-coding gene	gene with protein product		608052				10644435	Standard	NM_001085347		Approved	FLJ14771, TORP1	uc004brs.4	Q5JU69	OTTHUMG00000020706	ENST00000373284.5:c.813C>T	9.37:g.130494466G>A		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	19.0	NM_001134430	A4FU12|A4FU13|Q3ZCN9|Q3ZCP0|Q5JU68|Q66K87|Q6UXW6|Q8NAN5|Q96SL7	Missense_Mutation	SNP	ENST00000373284.5	37	CCDS43879.1	.	.	.	.	.	.	.	.	.	.	G	7.531	0.658710	0.14645	.	.	ENSG00000160404	ENST00000336067	T	0.65732	-0.17	5.63	-11.3	0.00108	.	.	.	.	.	T	0.52158	0.1717	.	.	.	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.47761	-0.9092	8	0.46703	T	0.11	-20.6337	22.6592	0.99974	0.7529:0.0:0.2471:0.0	.	229	Q8N2E6	TOR2X_HUMAN	C	229	ENSP00000338317:R229C	ENSP00000338317:R229C	R	-	1	0	TOR2A	129534287	0.396000	0.25262	0.101000	0.21167	0.359000	0.29487	-0.256000	0.08757	-2.876000	0.00321	-2.075000	0.00382	CGT	.		0.627	TOR2A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054205.1	NM_130459	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000445888.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.H193R	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,0	TP53	70225	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	c.A578G	GRCh37	CM083194|CM951225	TP53	M		.						97.0	87.0	90.0					17																	7578271		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATAAGATGCTGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	17.37:g.7578271T>C	ENSP00000269305:p.His193Arg	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	35.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRAF6	7189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	36516546	36516546	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:36516546T>C	ENST00000526995.1	-	5	904	c.658A>G	c.(658-660)Act>Gct	p.T220A	TRAF6_ENST00000529150.1_5'UTR|TRAF6_ENST00000348124.5_Missense_Mutation_p.T220A	NM_004620.3	NP_004611.1	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6, E3 ubiquitin protein ligase	220	Interaction with TAX1BP1.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of protein kinase activity (GO:0032147)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic signaling pathway (GO:0097190)|bone resorption (GO:0045453)|cell development (GO:0048468)|cellular response to lipopolysaccharide (GO:0071222)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein autoubiquitination (GO:0051865)|protein complex assembly (GO:0006461)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of immunoglobulin secretion (GO:0051023)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	histone deacetylase binding (GO:0042826)|ligase activity (GO:0016874)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)	27	all_lung(20;0.211)	all_hematologic(20;0.107)				ATGAGTATAGTATTGCAGTAT	0.259																																					p.T220A		.											.	TRAF6	660	0			c.A658G						.						59.0	65.0	63.0					11																	36516546		2201	4283	6484	SO:0001583	missense	7189	exon5			GTATAGTATTGCA		CCDS7901.1	11p12	2013-01-09	2012-02-23		ENSG00000175104	ENSG00000175104		"""RING-type (C3HC4) zinc fingers"""	12036	protein-coding gene	gene with protein product		602355	"""TNF receptor-associated factor 6"""			8837778	Standard	NM_004620		Approved	RNF85	uc001mws.2	Q9Y4K3	OTTHUMG00000166391	ENST00000526995.1:c.658A>G	11.37:g.36516546T>C	ENSP00000433623:p.Thr220Ala	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	354.0	123.0	NM_004620	A6NKI7|A8KAB3|D3DR16|Q8NEH5	Missense_Mutation	SNP	ENST00000526995.1	37	CCDS7901.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.956005	0.34471	.	.	ENSG00000175104	ENST00000526995;ENST00000348124	T;T	0.25414	1.8;1.8	5.6	5.6	0.85130	Zinc finger, TRAF-type (1);TRAF-like (1);	0.086607	0.85682	D	0.000000	T	0.22126	0.0533	L	0.46947	1.48	0.40062	D	0.97591	B	0.32128	0.357	B	0.30316	0.114	T	0.04635	-1.0937	10	0.08179	T	0.78	-13.8274	15.7861	0.78304	0.0:0.0:0.0:1.0	.	220	Q9Y4K3	TRAF6_HUMAN	A	220	ENSP00000433623:T220A;ENSP00000337853:T220A	ENSP00000337853:T220A	T	-	1	0	TRAF6	36473122	1.000000	0.71417	0.974000	0.42286	0.983000	0.72400	3.311000	0.51919	2.129000	0.65627	0.528000	0.53228	ACT	.		0.259	TRAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389530.1	NM_145803	
TRPM3	80036	ucsc.edu;bcgsc.ca	37	9	73254017	73254017	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr9:73254017G>T	ENST00000377111.2	-	11	1783	c.1540C>A	c.(1540-1542)Cgt>Agt	p.R514S	TRPM3_ENST00000377110.3_Missense_Mutation_p.R514S|TRPM3_ENST00000357533.2_Missense_Mutation_p.R516S|TRPM3_ENST00000360823.2_Missense_Mutation_p.R386S|TRPM3_ENST00000377105.1_Missense_Mutation_p.R361S|TRPM3_ENST00000396292.4_Missense_Mutation_p.R386S|TRPM3_ENST00000408909.2_Missense_Mutation_p.R361S|TRPM3_ENST00000423814.3_Missense_Mutation_p.R541S|TRPM3_ENST00000396280.5_Missense_Mutation_p.R361S|TRPM3_ENST00000358082.3_Missense_Mutation_p.R386S|TRPM3_ENST00000377106.1_Missense_Mutation_p.R386S|TRPM3_ENST00000396285.1_Missense_Mutation_p.R361S	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	539					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GTGAGAAAACGGTGCATGCTT	0.413																																					p.R514S		.											.	TRPM3	521	0			c.C1540A						.						149.0	140.0	143.0					9																	73254017		2203	4300	6503	SO:0001583	missense	80036	exon11			GAAAACGGTGCAT	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1540C>A	9.37:g.73254017G>T	ENSP00000366315:p.Arg514Ser	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.096388|4.096388	0.76870|0.76870	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000396280|ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	.|T;T;T;T;T;T;T;T;T;T;T	.|0.35236	.|1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32;1.32	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.56746|0.56746	0.2006|0.2006	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999996|0.999996	.|B;D;B;D;P;D;D;P	.|0.63880	.|0.426;0.987;0.42;0.988;0.751;0.977;0.993;0.471	.|B;P;B;D;B;P;P;B	.|0.65874	.|0.131;0.906;0.191;0.939;0.429;0.753;0.828;0.097	T|T	0.52109|0.52109	-0.8619|-0.8619	5|10	.|0.49607	.|T	.|0.09	-10.1428|-10.1428	19.9522|19.9522	0.97203|0.97203	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|539;514;514;514;516;386;361;361	.|Q9HCF6;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;A2A3F3	.|TRPM3_HUMAN;.;.;.;.;.;.;.	Q|S	360|514;514;386;386;361;516;361;361;386;386;541	.|ENSP00000366315:R514S;ENSP00000366314:R514S;ENSP00000366310:R386S;ENSP00000354066:R386S;ENSP00000366309:R361S;ENSP00000350140:R516S;ENSP00000386127:R361S;ENSP00000379581:R361S;ENSP00000379587:R386S;ENSP00000350791:R386S;ENSP00000389542:R541S	.|ENSP00000350140:R516S	P|R	-|-	2|1	0|0	TRPM3|TRPM3	72443837|72443837	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.863000|7.863000	0.87023|0.87023	2.725000|2.725000	0.93324|0.93324	0.655000|0.655000	0.94253|0.94253	CCG|CGT	.		0.413	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
TSSC4	10078	ucsc.edu;bcgsc.ca	37	11	2426267	2426267	+	IGR	SNP	T	T	C	rs370180629		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:2426267T>C	ENST00000333256.6	+	0	1686				TRPM5_ENST00000528453.1_Missense_Mutation_p.Q1134R|AC124057.5_ENST00000433035.1_RNA|TRPM5_ENST00000452833.1_Missense_Mutation_p.Q1135R|TRPM5_ENST00000533060.1_Missense_Mutation_p.Q1141R|TRPM5_ENST00000155858.6_Missense_Mutation_p.Q1133R			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4											endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCACAGTGCTGAGAGCCTGC	0.662																																					p.Q1133R		.											.	TRPM5	137	0			c.A3398G						.	T	ARG/GLN	0,4402		0,0,2201	28.0	29.0	29.0		3398	-3.5	0.0	11		29	1,8591	1.2+/-3.3	0,1,4295	no	missense	TRPM5	NM_014555.3	43	0,1,6496	CC,CT,TT		0.0116,0.0,0.0077	benign	1133/1166	2426267	1,12993	2201	4296	6497	SO:0001628	intergenic_variant	29850	exon24			CAGTGCTGAGAGC	AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895		11.37:g.2426267T>C		Somatic	46.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_014555	C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	ENST00000333256.6	37	CCDS7735.1	.	.	.	.	.	.	.	.	.	.	T	2.372	-0.344162	0.05208	0.0	1.16E-4	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453	T;T;T;T;T	0.60299	0.36;0.3;0.3;0.2;0.3	2.3	-3.53	0.04667	.	3.744610	0.01544	N	0.019356	T	0.40546	0.1121	N	0.25647	0.755	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.15009	-1.0452	10	0.14252	T	0.57	-0.1024	7.1757	0.25742	0.0:0.4318:0.0:0.5682	.	1141;1135;1133	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	R	1127;1133;1135;1141;1134	ENSP00000434383:Q1127R;ENSP00000155858:Q1133R;ENSP00000387965:Q1135R;ENSP00000434121:Q1141R;ENSP00000436809:Q1134R	ENSP00000155858:Q1133R	Q	-	2	0	TRPM5	2382843	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.814000	0.01723	-0.864000	0.04078	-1.260000	0.01463	CAG	.		0.662	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027369.3	NM_005706	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179648462	179648462	+	Silent	SNP	T	T	C			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:179648462T>C	ENST00000591111.1	-	17	3050	c.2826A>G	c.(2824-2826)ccA>ccG	p.P942P	TTN_ENST00000359218.5_Silent_p.P896P|TTN_ENST00000342992.6_Silent_p.P942P|TTN_ENST00000589042.1_Silent_p.P942P|TTN_ENST00000460472.2_Silent_p.P896P|TTN_ENST00000360870.5_Silent_p.P942P|TTN_ENST00000342175.6_Silent_p.P896P			Q8WZ42	TITIN_HUMAN	titin	33644					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAAAGTTGGTGGAGTAACAG	0.348																																					p.P942P		.											.	TTN	636	0			c.A2826G						.						88.0	90.0	89.0					2																	179648462		2203	4300	6503	SO:0001819	synonymous_variant	7273	exon17			AGTTGGTGGAGTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2826A>G	2.37:g.179648462T>C		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	76.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.348	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBAP2L	9898	hgsc.bcm.edu;bcgsc.ca	37	1	154221748	154221748	+	Missense_Mutation	SNP	G	G	T	rs200980910		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr1:154221748G>T	ENST00000361546.2	+	11	1090	c.1048G>T	c.(1048-1050)Ggt>Tgt	p.G350C	UBAP2L_ENST00000343815.6_Missense_Mutation_p.G350C|UBAP2L_ENST00000271877.7_Missense_Mutation_p.G361C|UBAP2L_ENST00000428931.1_Missense_Mutation_p.G350C			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	350					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGGTGATGTCGGTGAAGCTAA	0.488																																					p.G350C		.											.	UBAP2L	91	0			c.G1048T						.						151.0	144.0	146.0					1																	154221748		2203	4300	6503	SO:0001583	missense	9898	exon12			GATGTCGGTGAAG	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1048G>T	1.37:g.154221748G>T	ENSP00000355343:p.Gly350Cys	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	13.0	NM_001127320	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.743326	0.49151	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000271877;ENST00000361546	T;T;T;T	0.14391	2.51;2.51;2.53;2.51	5.36	3.5	0.40072	.	0.167732	0.53938	D	0.000055	T	0.20047	0.0482	M	0.62723	1.935	0.58432	D	0.999994	P;D;D;D;D	0.89917	0.945;1.0;1.0;1.0;0.984	P;D;D;D;P	0.79784	0.599;0.993;0.954;0.954;0.79	T	0.01127	-1.1443	10	0.72032	D	0.01	0.1059	9.6731	0.40023	0.1592:0.0:0.8408:0.0	.	264;361;343;350;350	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	C	350;350;361;350	ENSP00000345308:G350C;ENSP00000389445:G350C;ENSP00000271877:G361C;ENSP00000355343:G350C	ENSP00000271877:G361C	G	+	1	0	UBAP2L	152488372	1.000000	0.71417	0.559000	0.28332	0.867000	0.49689	3.240000	0.51368	0.828000	0.34709	-0.140000	0.14226	GGT	G|0.999;A|0.000		0.488	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
UBE3C	9690	ucsc.edu;bcgsc.ca	37	7	157046656	157046656	+	Silent	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr7:157046656A>G	ENST00000348165.5	+	20	3063	c.2703A>G	c.(2701-2703)gaA>gaG	p.E901E		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	901	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGGTAGTTGAACTAAAATTCG	0.428																																					p.E901E		.											.	UBE3C	704	0			c.A2703G						.						47.0	51.0	50.0					7																	157046656		2203	4300	6503	SO:0001819	synonymous_variant	9690	exon20			AGTTGAACTAAAA	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2703A>G	7.37:g.157046656A>G		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Silent	SNP	ENST00000348165.5	37	CCDS34789.1																																																																																			.		0.428	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
USH1C	10083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	17530990	17530990	+	Intron	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr11:17530990A>G	ENST00000318024.4	-	16	1393				USH1C_ENST00000529563.1_Intron|USH1C_ENST00000527020.1_Intron|USH1C_ENST00000527720.1_Intron|USH1C_ENST00000005226.7_Silent_p.N642N	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CCTCCACTGGATTGCCTGTGT	0.607																																					p.N642N		.											.	USH1C	91	0			c.T1926C						.						86.0	76.0	79.0					11																	17530990		2200	4293	6493	SO:0001627	intron_variant	10083	exon18			CACTGGATTGCCT	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1285-7463T>C	11.37:g.17530990A>G		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	21.0	NM_153676	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	ENST00000318024.4	37	CCDS31438.1																																																																																			.		0.607	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
USP6NL	9712	ucsc.edu;bcgsc.ca	37	10	11543112	11543112	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:11543112C>A	ENST00000609104.1	-	7	766	c.372G>T	c.(370-372)agG>agT	p.R124S	USP6NL_ENST00000379237.2_Missense_Mutation_p.R147S|USP6NL_ENST00000277575.5_Missense_Mutation_p.R141S	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	124	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						TATACAGGTCCCTTGTTTCTT	0.353																																					p.R141S		.											.	USP6NL	628	0			c.G423T						.						58.0	53.0	55.0					10																	11543112		1815	4068	5883	SO:0001583	missense	9712	exon6			CAGGTCCCTTGTT	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.372G>T	10.37:g.11543112C>A	ENSP00000476462:p.Arg124Ser	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_001080491	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	ENST00000609104.1	37	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	c	10.50	1.366708	0.24771	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.28454	1.61;1.61	5.25	-0.562	0.11781	Rab-GAP/TBC domain (4);	0.153285	0.64402	D	0.000015	T	0.16342	0.0393	N	0.25957	0.775	0.42452	D	0.992751	B;B	0.16603	0.012;0.018	B;B	0.18263	0.021;0.012	T	0.10337	-1.0634	10	0.19590	T	0.45	.	7.3819	0.26859	0.1114:0.1431:0.0:0.7454	.	124;141	Q92738;Q92738-2	US6NL_HUMAN;.	S	124;141;124	ENSP00000277575:R141S;ENSP00000368539:R124S	ENSP00000277575:R141S	R	-	3	2	USP6NL	11583118	0.989000	0.36119	0.993000	0.49108	0.867000	0.49689	0.264000	0.18497	0.071000	0.16664	-1.380000	0.01176	AGG	.		0.353	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688	
WWP2	11060	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	69965734	69965734	+	Silent	SNP	C	C	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr16:69965734C>T	ENST00000359154.2	+	16	1724	c.1623C>T	c.(1621-1623)cgC>cgT	p.R541R	WWP2_ENST00000542271.1_Silent_p.R425R|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000356003.2_Silent_p.R541R|MIR140_ENST00000385282.1_RNA|WWP2_ENST00000568684.1_Silent_p.R102R|WWP2_ENST00000448661.1_Silent_p.R541R	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	541	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ATGACCTGCGCCGCCGGCTCT	0.642																																					p.R541R		.											.	WWP2	658	0			c.C1623T						.						104.0	112.0	109.0					16																	69965734		2198	4300	6498	SO:0001819	synonymous_variant	11060	exon16			CCTGCGCCGCCGG	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1623C>T	16.37:g.69965734C>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	13.0	NM_001270454	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Silent	SNP	ENST00000359154.2	37	CCDS10885.1																																																																																			.		0.642	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014	
YES1	7525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	745776	745776	+	Missense_Mutation	SNP	T	T	C	rs557201481		TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr18:745776T>C	ENST00000584307.1	-	6	826	c.656A>G	c.(655-657)aAt>aGt	p.N219S	YES1_ENST00000314574.4_Missense_Mutation_p.N219S|YES1_ENST00000577961.1_Missense_Mutation_p.N224S			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	219	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	GTATCCACCATTGTCAAGTTT	0.348													T|||	1	0.000199681	0.0	0.0	5008	,	,		17674	0.0		0.0	False		,,,				2504	0.001				p.N219S		.											.	YES1	547	0			c.A656G						.						163.0	147.0	152.0					18																	745776		2203	4299	6502	SO:0001583	missense	7525	exon6			CCACCATTGTCAA	M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.656A>G	18.37:g.745776T>C	ENSP00000462468:p.Asn219Ser	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	62.0	NM_005433	A6NLB3|D3DUH1	Missense_Mutation	SNP	ENST00000584307.1	37	CCDS11824.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.344976	0.24426	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	T	0.26373	1.74	5.7	5.7	0.88788	SH2 motif (4);	0.082383	0.85682	D	0.000000	T	0.20659	0.0497	L	0.31120	0.905	0.49299	D	0.999772	B	0.02656	0.0	B	0.01281	0.0	T	0.04440	-1.0951	10	0.22109	T	0.4	.	15.9666	0.79979	0.0:0.0:0.0:1.0	.	219	P07947	YES_HUMAN	S	219	ENSP00000324740:N219S	ENSP00000324740:N219S	N	-	2	0	YES1	735776	0.969000	0.33509	1.000000	0.80357	0.995000	0.86356	0.517000	0.22832	2.174000	0.68829	0.482000	0.46254	AAT	.		0.348	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440827.2	NM_005433	
ZAK	51776	broad.mit.edu;bcgsc.ca	37	2	173955772	173955772	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr2:173955772G>T	ENST00000375213.3	+	2	91	c.13G>T	c.(13-15)Ggt>Tgt	p.G5C	MLTK_ENST00000431503.2_Intron|MLTK_ENST00000409176.2_Missense_Mutation_p.G5C|MLTK_ENST00000539448.1_Missense_Mutation_p.G5C|MLTK_ENST00000338983.3_Missense_Mutation_p.G5C	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		5					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										GTCGTCTCTCGGTGCCTCCTT	0.358																																					p.G5C		.											.	ZAK	522	0			c.G13T						.						85.0	86.0	86.0					2																	173955772		2203	4300	6503	SO:0001583	missense	0	exon2			TCTCTCGGTGCCT																												ENST00000375213.3:c.13G>T	2.37:g.173955772G>T	ENSP00000364361:p.Gly5Cys	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	11.0	NM_133646	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	ENST00000375213.3	37	CCDS42777.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056368	0.76074	.	.	ENSG00000091436	ENST00000539448;ENST00000409176;ENST00000338983;ENST00000375213;ENST00000422149	T;T;T;T;T	0.79845	-1.05;-1.02;-1.05;-1.02;-1.31	5.66	5.66	0.87406	Protein kinase-like domain (1);	0.177192	0.64402	D	0.000015	T	0.81781	0.4895	L	0.45352	1.415	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.996;0.998	P;P;P;P	0.60415	0.874;0.869;0.752;0.874	T	0.81897	-0.0722	10	0.56958	D	0.05	.	7.4065	0.26993	0.1989:0.0:0.8011:0.0	.	5;5;5;5	Q9NYL2-2;Q9NYL2;D4Q8H0;Q9NYL2-3	.;MLTK_HUMAN;.;.	C	5	ENSP00000439414:G5C;ENSP00000387259:G5C;ENSP00000340257:G5C;ENSP00000364361:G5C;ENSP00000411923:G5C	ENSP00000340257:G5C	G	+	1	0	AC013461.1	173664018	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.362000	0.52314	2.675000	0.91044	0.655000	0.94253	GGT	.		0.358	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255401.1		
ZFHX4	79776	ucsc.edu;bcgsc.ca	37	8	77766028	77766028	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr8:77766028A>G	ENST00000521891.2	+	10	7319	c.6871A>G	c.(6871-6873)Aca>Gca	p.T2291A	ZFHX4_ENST00000050961.6_Missense_Mutation_p.T2246A|ZFHX4_ENST00000455469.2_Missense_Mutation_p.T2246A|ZFHX4_ENST00000518282.1_Missense_Mutation_p.T2265A	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCAAGCAGAAACAAAAGATAA	0.408										HNSCC(33;0.089)																											p.T2291A		.											.	ZFHX4	98	0			c.A6871G						.						83.0	80.0	81.0					8																	77766028		1905	4120	6025	SO:0001583	missense	79776	exon10			GCAGAAACAAAAG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6871A>G	8.37:g.77766028A>G	ENSP00000430497:p.Thr2291Ala	Somatic	39.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	7.147	0.582946	0.13749	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.48201	0.82;0.88;0.84;0.84	4.34	0.312	0.15837	Homeodomain-related (1);Homeodomain-like (1);	0.147738	0.30771	N	0.008905	T	0.25232	0.0613	N	0.17082	0.46	0.24449	N	0.994492	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.16070	-1.0415	10	0.20046	T	0.44	.	8.0353	0.30488	0.6232:0.0:0.3768:0.0	.	2246;2246;2291	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	A	2291;2275;2246;2246;2265	ENSP00000430497:T2291A;ENSP00000399605:T2246A;ENSP00000050961:T2246A;ENSP00000430848:T2265A	ENSP00000050961:T2246A	T	+	1	0	ZFHX4	77928583	0.354000	0.24912	0.078000	0.20375	0.861000	0.49209	0.983000	0.29552	-0.019000	0.14055	0.528000	0.53228	ACA	.		0.408	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZNF10	7556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133733009	133733009	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr12:133733009A>G	ENST00000248211.6	+	5	1399	c.1177A>G	c.(1177-1179)Att>Gtt	p.I393V	ZNF268_ENST00000416488.1_Intron|CTD-2140B24.4_ENST00000540096.2_Intron|ZNF10_ENST00000402932.2_Missense_Mutation_p.I259V|ZNF10_ENST00000426665.2_Missense_Mutation_p.I393V	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CACACATCTCATTCTGCATCA	0.438																																					p.I393V		.											.	ZNF10	154	0			c.A1177G						.						161.0	162.0	162.0					12																	133733009		2203	4300	6503	SO:0001583	missense	7556	exon5			CATCTCATTCTGC	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.1177A>G	12.37:g.133733009A>G	ENSP00000248211:p.Ile393Val	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	25.0	NM_015394	B2RBS1|Q8TC91	Missense_Mutation	SNP	ENST00000248211.6	37	CCDS9283.1	.	.	.	.	.	.	.	.	.	.	A	1.364	-0.588059	0.03799	.	.	ENSG00000256223	ENST00000248211;ENST00000426665;ENST00000402932	T;T;T	0.15017	2.46;2.46;2.46	3.73	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.021450	0.07856	N	0.965538	T	0.10165	0.0249	N	0.21282	0.65	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40608	-0.9554	9	.	.	.	.	4.1126	0.10065	0.6048:0.1785:0.2168:0.0	.	393	P21506	ZNF10_HUMAN	V	393;393;259	ENSP00000248211:I393V;ENSP00000393814:I393V;ENSP00000384893:I259V	.	I	+	1	0	ZNF10	132243082	0.000000	0.05858	0.992000	0.48379	0.994000	0.84299	-0.455000	0.06762	0.109000	0.17891	0.533000	0.62120	ATT	.		0.438	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
ZNF248	57209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	38121994	38121994	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr10:38121994C>G	ENST00000395867.3	-	6	839	c.289G>C	c.(289-291)Gat>Cat	p.D97H	ZNF248_ENST00000374648.3_Missense_Mutation_p.D97H|AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000357328.4_Missense_Mutation_p.D97H|ZNF248_ENST00000494133.1_5'UTR	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						AAATGGTCATCTTCATTTTCC	0.368																																					p.D97H		.											.	ZNF248	91	0			c.G289C						.						81.0	76.0	78.0					10																	38121994		2203	4299	6502	SO:0001583	missense	57209	exon4			GGTCATCTTCATT	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.289G>C	10.37:g.38121994C>G	ENSP00000379208:p.Asp97His	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	26.0	NM_001267606	Q8NDV8|Q9UMP3	Missense_Mutation	SNP	ENST00000395867.3	37	CCDS7194.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.527193	0.27299	.	.	ENSG00000198105	ENST00000395867;ENST00000374648;ENST00000357328;ENST00000395873	T;T;T;T	0.05649	3.41;5.71;3.41;5.64	4.86	3.95	0.45737	.	0.279280	0.25875	N	0.027726	T	0.13970	0.0338	L	0.55834	1.745	0.35022	D	0.757947	P;D	0.65815	0.855;0.995	B;P	0.57371	0.365;0.819	T	0.11494	-1.0585	10	0.54805	T	0.06	.	9.1437	0.36919	0.0:0.9007:0.0:0.0993	.	97;97	Q8NDW4;Q8NDV8	ZN248_HUMAN;.	H	97	ENSP00000379208:D97H;ENSP00000363778:D97H;ENSP00000349882:D97H;ENSP00000379214:D97H	ENSP00000349882:D97H	D	-	1	0	ZNF248	38162000	0.002000	0.14202	1.000000	0.80357	0.105000	0.19272	1.045000	0.30341	1.413000	0.46997	0.563000	0.77884	GAT	.		0.368	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1	NM_021045	
ZNF268	10795	broad.mit.edu;bcgsc.ca	37	12	133768159	133768159	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr12:133768159A>G	ENST00000536435.2	+	4	649	c.319A>G	c.(319-321)Agg>Ggg	p.R107G	ZNF268_ENST00000539248.2_Intron|ZNF268_ENST00000416488.1_Missense_Mutation_p.R272G|ZNF268_ENST00000541211.2_Intron|ZNF268_ENST00000592241.1_Missense_Mutation_p.R40G|ZNF268_ENST00000542711.2_Intron|CTD-2140B24.4_ENST00000540096.2_Missense_Mutation_p.R272G|ZNF268_ENST00000536899.2_Intron|ZNF268_ENST00000537565.1_Intron|ZNF268_ENST00000542986.2_Missense_Mutation_p.R92G|ZNF268_ENST00000228289.5_Missense_Mutation_p.R107G|ZNF268_ENST00000541009.2_Missense_Mutation_p.R107G	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	107	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GTGCCTGTACAGGAGTGTGAT	0.507																																					p.R107G		.											.	ZNF268	23	0			c.A319G						.						92.0	104.0	100.0					12																	133768159		2175	4290	6465	SO:0001583	missense	10795	exon4			CTGTACAGGAGTG	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.319A>G	12.37:g.133768159A>G	ENSP00000444412:p.Arg107Gly	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	8.0	NM_152943	Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	ENST00000536435.2	37	CCDS45012.1	.	.	.	.	.	.	.	.	.	.	A	12.47	1.948548	0.34377	.	.	ENSG00000090612	ENST00000416488;ENST00000541009;ENST00000542986;ENST00000228289;ENST00000541975	T;T;T	0.02656	4.21;4.21;4.21	3.53	-0.634	0.11516	Krueppel-associated box (4);	.	.	.	.	T	0.05686	0.0149	M	0.91872	3.25	0.09310	N	1	B	0.26445	0.149	B	0.25987	0.065	T	0.38564	-0.9655	8	.	.	.	.	0.7873	0.01051	0.478:0.2041:0.12:0.198	.	107	Q14587	ZN268_HUMAN	G	272;107;40;107;92	ENSP00000409295:R272G;ENSP00000439539:R107G;ENSP00000228289:R107G	.	R	+	1	2	ZNF268	132278232	0.036000	0.19791	0.220000	0.23810	0.990000	0.78478	-0.605000	0.05661	0.042000	0.15717	0.528000	0.53228	AGG	.		0.507	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397191.2	NM_152943	
ZNF318	24149	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43323547	43323547	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr6:43323547G>A	ENST00000361428.2	-	4	1602	c.1525C>T	c.(1525-1527)Cgc>Tgc	p.R509C	ZNF318_ENST00000318149.3_Missense_Mutation_p.R509C	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	509					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTCAGAATGCGGGAAAAACCA	0.493																																					p.R509C		.											.	ZNF318	157	0			c.C1525T						.						192.0	197.0	195.0					6																	43323547		2203	4300	6503	SO:0001583	missense	24149	exon4			GAATGCGGGAAAA	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.1525C>T	6.37:g.43323547G>A	ENSP00000354964:p.Arg509Cys	Somatic	64.0	1.0		WXS	Illumina HiSeq	Phase_I	104.0	40.0	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	37	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	G	16.66	3.184575	0.57909	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.03580	3.88;3.88	6.17	5.29	0.74685	.	0.206696	0.43416	N	0.000578	T	0.01454	0.0047	L	0.27053	0.805	0.52501	D	0.999956	B	0.23316	0.083	B	0.16289	0.015	T	0.49341	-0.8950	10	0.52906	T	0.07	-2.4481	12.6535	0.56774	0.0774:0.0:0.9226:0.0	.	509	Q5VUA4	ZN318_HUMAN	C	509	ENSP00000323032:R509C;ENSP00000354964:R509C	ENSP00000323032:R509C	R	-	1	0	ZNF318	43431525	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.529000	0.45632	1.585000	0.49928	0.655000	0.94253	CGC	.		0.493	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
ZNF91	7644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23545393	23545393	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25Z-01A-11D-A16V-10	TCGA-G3-A25Z-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3fd6af37-1d08-48ee-ab7f-162bb2005b98	543bf78c-8771-4841-84c6-cee5677bb250	g.chr19:23545393C>A	ENST00000300619.7	-	4	593	c.388G>T	c.(388-390)Gat>Tat	p.D130Y	ZNF91_ENST00000397082.2_Missense_Mutation_p.D98Y|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	130					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTACACTCATCCACACTTTTA	0.338																																					p.D130Y		.											.	ZNF91	90	0			c.G388T						.						76.0	81.0	80.0					19																	23545393		2157	4280	6437	SO:0001583	missense	7644	exon4			ACTCATCCACACT	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.388G>T	19.37:g.23545393C>A	ENSP00000300619:p.Asp130Tyr	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	37.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	2.880	-0.232000	0.05983	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.05996	3.36;3.36	0.987	-0.984	0.10259	.	.	.	.	.	T	0.15522	0.0374	L	0.61387	1.9	0.09310	N	1	B;D	0.89917	0.291;1.0	B;D	0.74674	0.093;0.984	T	0.12451	-1.0547	9	0.66056	D	0.02	.	3.7254	0.08473	0.0:0.661:0.0:0.339	.	98;130	Q05481-2;Q05481	.;ZNF91_HUMAN	Y	130;98	ENSP00000300619:D130Y;ENSP00000380272:D98Y	ENSP00000300619:D130Y	D	-	1	0	ZNF91	23337233	0.000000	0.05858	0.007000	0.13788	0.322000	0.28314	-0.648000	0.05391	-0.453000	0.07076	0.174000	0.16983	GAT	.		0.338	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
