#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AASDH	132949	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	57215517	57215517	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr4:57215517G>T	ENST00000205214.6	-	11	2580	c.2400C>A	c.(2398-2400)taC>taA	p.Y800*	AASDH_ENST00000451613.1_Nonsense_Mutation_p.Y800*|AASDH_ENST00000502617.1_Nonsense_Mutation_p.Y800*|AASDH_ENST00000602986.1_Nonsense_Mutation_p.Y647*|AASDH_ENST00000513376.1_Nonsense_Mutation_p.Y700*|AASDH_ENST00000434343.2_Nonsense_Mutation_p.Y315*	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	800					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CCTTCCCAGAGTAAAAGTCAA	0.393																																					p.Y800X		.											.	AASDH	94	0			c.C2400A						.						103.0	102.0	102.0					4																	57215517		2203	4300	6503	SO:0001587	stop_gained	132949	exon11			CCCAGAGTAAAAG	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.2400C>A	4.37:g.57215517G>T	ENSP00000205214:p.Tyr800*	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	50.0	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Nonsense_Mutation	SNP	ENST00000205214.6	37	CCDS3504.1	.	.	.	.	.	.	.	.	.	.	G	38	7.197478	0.98129	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000434343;ENST00000451613;ENST00000503808;ENST00000502617	.	.	.	6.16	1.91	0.25777	.	1.198180	0.05383	N	0.537553	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.7041	3.703	0.08390	0.5412:0.0:0.2721:0.1867	.	.	.	.	X	800;700;315;800;647;800	.	ENSP00000205214:Y800X	Y	-	3	2	AASDH	56910274	0.138000	0.22547	0.971000	0.41717	0.542000	0.35054	0.526000	0.22971	0.439000	0.26476	-0.142000	0.14014	TAC	.		0.393	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
ALMS1	7840	hgsc.bcm.edu;broad.mit.edu	37	2	73680580	73680580	+	Missense_Mutation	SNP	C	C	T	rs147001219		TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr2:73680580C>T	ENST00000264448.6	+	8	7034	c.6923C>T	c.(6922-6924)aCg>aTg	p.T2308M	ALMS1_ENST00000377715.1_Missense_Mutation_p.T2308M|ALMS1_ENST00000409009.1_Missense_Mutation_p.T2266M	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2308					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CCCTCTTCCACGGGTGTATCT	0.438																																					p.T2308M		.											.	ALMS1	142	0			c.C6923T						.	C	MET/THR	0,3740		0,0,1870	82.0	79.0	80.0		6923	3.5	0.2	2	dbSNP_134	80	1,8185		0,1,4092	no	missense	ALMS1	NM_015120.4	81	0,1,5962	TT,TC,CC		0.0122,0.0,0.0084	probably-damaging	2308/4168	73680580	1,11925	1870	4093	5963	SO:0001583	missense	7840	exon8			CTTCCACGGGTGT	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.6923C>T	2.37:g.73680580C>T	ENSP00000264448:p.Thr2308Met	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	4.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	8.660	0.900410	0.17686	0.0	1.22E-4	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.16196	3.24;3.24;2.36	5.36	3.46	0.39613	.	0.670158	0.13854	N	0.358137	T	0.22742	0.0549	L	0.34521	1.04	0.09310	N	1	D;D;D	0.71674	0.998;0.995;0.995	P;P;P	0.58130	0.833;0.799;0.799	T	0.05053	-1.0909	10	0.72032	D	0.01	.	7.2001	0.25877	0.1686:0.7397:0.0:0.0917	.	2308;2266;2308	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	M	2266;2308;2308	ENSP00000386627:T2266M;ENSP00000264448:T2308M;ENSP00000366944:T2308M	ENSP00000264448:T2308M	T	+	2	0	ALMS1	73534088	0.003000	0.15002	0.199000	0.23439	0.014000	0.08584	0.426000	0.21363	1.397000	0.46682	0.655000	0.94253	ACG	C|0.999;T|0.000		0.438	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ANXA6	309	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	150483246	150483246	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr5:150483246delC	ENST00000354546.5	-	25	2074	c.1847delG	c.(1846-1848)ggcfs	p.G616fs	ANXA6_ENST00000523714.1_Frame_Shift_Del_p.G584fs|ANXA6_ENST00000521512.1_Frame_Shift_Del_p.G403fs|ANXA6_ENST00000356496.5_Frame_Shift_Del_p.G610fs|ANXA6_ENST00000377751.5_Frame_Shift_Del_p.G273fs	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	616					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCATCTGTGCCAGCACCCTG	0.532																																					p.G616fs		.											.	ANXA6	22	0			c.1847delG						.						30.0	31.0	31.0					5																	150483246		2102	4229	6331	SO:0001589	frameshift_variant	309	exon25			TCTGTGCCAGCAC	J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.1847delG	5.37:g.150483246delC	ENSP00000346550:p.Gly616fs	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	22.0	NM_001155	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Frame_Shift_Del	DEL	ENST00000354546.5	37	CCDS47315.1																																																																																			.		0.532	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377668.2	NM_001155	
APEH	327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49719195	49719195	+	Silent	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr3:49719195C>T	ENST00000296456.5	+	16	1879	c.1479C>T	c.(1477-1479)agC>agT	p.S493S	AC099668.5_ENST00000563780.1_RNA|APEH_ENST00000438011.1_Silent_p.S493S	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	493					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGCCTGGCAGCCCTCCAGATA	0.622																																					p.S493S		.											.	APEH	91	0			c.C1479T						.						80.0	63.0	69.0					3																	49719195		2203	4300	6503	SO:0001819	synonymous_variant	327	exon16			TGGCAGCCCTCCA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.1479C>T	3.37:g.49719195C>T		Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	21.0	NM_001640	Q9BQ33|Q9P0Y2	Silent	SNP	ENST00000296456.5	37	CCDS2801.1																																																																																			.		0.622	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
C19orf43	79002	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	12845284	12845284	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr19:12845284C>T	ENST00000242784.4	-	1	305	c.188G>A	c.(187-189)gGc>gAc	p.G63D	C19orf43_ENST00000588213.1_Missense_Mutation_p.G63D|ASNA1_ENST00000591090.1_5'Flank|C19orf43_ENST00000592273.1_Missense_Mutation_p.G63D	NM_024038.2	NP_076943.1	Q9BQ61	CS043_HUMAN	chromosome 19 open reading frame 43	63										endometrium(2)|large_intestine(2)	4						CAGGAAGCTGCCGTCGTTGGC	0.721																																					p.G63D		.											.	C19orf43	90	0			c.G188A						.						8.0	6.0	7.0					19																	12845284		1936	3760	5696	SO:0001583	missense	79002	exon1			AAGCTGCCGTCGT	AK027588	CCDS12279.1	19p13.2	2011-11-24			ENSG00000123144	ENSG00000123144			28424	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 18"""					12477932	Standard	NM_024038		Approved	MGC2803, fSAP18	uc002muu.3	Q9BQ61		ENST00000242784.4:c.188G>A	19.37:g.12845284C>T	ENSP00000242784:p.Gly63Asp	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	5.0	NM_024038		Missense_Mutation	SNP	ENST00000242784.4	37	CCDS12279.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246052	0.80024	.	.	ENSG00000123144	ENST00000242784	.	.	.	4.41	4.41	0.53225	.	0.058840	0.64402	N	0.000002	T	0.62588	0.2440	L	0.31476	0.935	0.80722	D	1	D	0.67145	0.996	P	0.60345	0.873	T	0.67837	-0.5567	9	0.87932	D	0	-2.9497	16.3008	0.82811	0.0:1.0:0.0:0.0	.	63	Q9BQ61	CS043_HUMAN	D	63	.	ENSP00000242784:G63D	G	-	2	0	C19orf43	12706284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.228000	0.72288	2.443000	0.82685	0.591000	0.81541	GGC	.		0.721	C19orf43-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450856.1	NM_024038	
CACNA1H	8912	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	1263800	1263800	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr16:1263800T>C	ENST00000348261.5	+	27	5046	c.4798T>C	c.(4798-4800)Tat>Cat	p.Y1600H	CACNA1H_ENST00000565831.1_Missense_Mutation_p.Y1594H|CACNA1H_ENST00000358590.4_Missense_Mutation_p.Y1594H	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1600					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CCGGCCCTACTATGCCGACTA	0.652																																					p.Y1600H		.											.	CACNA1H	67	0			c.T4798C						.						50.0	48.0	49.0					16																	1263800		1999	4145	6144	SO:0001583	missense	8912	exon27			CCCTACTATGCCG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.4798T>C	16.37:g.1263800T>C	ENSP00000334198:p.Tyr1600His	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	5.0	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	37	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.228032	0.79576	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97066	-4.23;-4.15	3.85	3.85	0.44370	.	0.141910	0.49305	D	0.000153	D	0.98333	0.9447	M	0.87456	2.885	0.48341	D	0.999633	D;D;D;P;D	0.89917	1.0;0.997;1.0;0.864;0.995	D;D;D;P;D	0.83275	0.996;0.96;0.971;0.671;0.929	D	0.99013	1.0815	10	0.87932	D	0	.	12.247	0.54576	0.0:0.0:0.0:1.0	.	346;335;341;1594;1600	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	H	1600;1594	ENSP00000334198:Y1600H;ENSP00000351401:Y1594H	ENSP00000334198:Y1600H	Y	+	1	0	CACNA1H	1203801	1.000000	0.71417	0.991000	0.47740	0.739000	0.42172	7.245000	0.78237	1.752000	0.51891	0.402000	0.26972	TAT	.		0.652	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
CATSPER1	117144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	65788038	65788038	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr11:65788038A>G	ENST00000312106.5	-	7	2125	c.1988T>C	c.(1987-1989)cTc>cCc	p.L663P		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	663					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TCCTCACTTGAGGAAGATGAA	0.592																																					p.L663P		.											.	CATSPER1	92	0			c.T1988C						.						94.0	97.0	96.0					11																	65788038		2201	4296	6497	SO:0001583	missense	117144	exon7			CACTTGAGGAAGA	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1988T>C	11.37:g.65788038A>G	ENSP00000309052:p.Leu663Pro	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	42.0	NM_053054	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	37	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	A	19.36	3.813138	0.70912	.	.	ENSG00000175294	ENST00000312106	D	0.99042	-5.36	5.23	5.23	0.72850	Ion transport (1);	0.000000	0.29616	U	0.011646	D	0.99230	0.9732	M	0.94101	3.495	0.58432	D	0.999999	P	0.49862	0.929	P	0.55965	0.788	D	0.99218	1.0878	10	0.87932	D	0	.	11.5111	0.50494	1.0:0.0:0.0:0.0	.	663	Q8NEC5	CTSR1_HUMAN	P	663	ENSP00000309052:L663P	ENSP00000309052:L663P	L	-	2	0	CATSPER1	65544614	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.564000	0.67359	1.974000	0.57490	0.459000	0.35465	CTC	.		0.592	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
CEP135	9662	hgsc.bcm.edu;broad.mit.edu	37	4	56835289	56835289	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr4:56835289C>T	ENST00000257287.4	+	9	1229	c.1105C>T	c.(1105-1107)Cag>Tag	p.Q369*		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	369					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GGCAAAACTTCAGCTGGTAAG	0.368																																					p.Q369X		.											.	CEP135	94	0			c.C1105T						.						70.0	72.0	71.0					4																	56835289		2203	4300	6503	SO:0001587	stop_gained	9662	exon9			AAACTTCAGCTGG	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.1105C>T	4.37:g.56835289C>T	ENSP00000257287:p.Gln369*	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	5.0	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Nonsense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901430	0.92035	.	.	ENSG00000174799	ENST00000257287	.	.	.	5.44	2.25	0.28309	.	0.260739	0.43260	D	0.000595	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	7.5616	0.27855	0.5176:0.3617:0.1207:0.0	.	.	.	.	X	369	.	ENSP00000257287:Q369X	Q	+	1	0	CEP135	56530046	1.000000	0.71417	0.929000	0.37066	0.201000	0.24016	2.151000	0.42263	0.585000	0.29608	0.563000	0.77884	CAG	.		0.368	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
CERS4	79603	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	8321909	8321909	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr19:8321909G>A	ENST00000251363.5	+	9	989	c.689G>A	c.(688-690)cGc>cAc	p.R230H	CERS4_ENST00000559450.1_Missense_Mutation_p.R230H|CERS4_ENST00000558331.1_Missense_Mutation_p.R179H|CERS4_ENST00000595722.1_3'UTR|CERS4_ENST00000559336.1_Missense_Mutation_p.R230H	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	230	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AACCTGCTGCGCATTGGCTCT	0.582																																					p.R230H		.											.	.	.	0			c.G689A						.						257.0	242.0	247.0					19																	8321909		2203	4300	6503	SO:0001583	missense	79603	exon9			TGCTGCGCATTGG		CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.689G>A	19.37:g.8321909G>A	ENSP00000251363:p.Arg230His	Somatic	215.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	17.0	NM_024552	D6W665	Missense_Mutation	SNP	ENST00000251363.5	37	CCDS12197.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.608073	0.87258	.	.	ENSG00000090661	ENST00000251363	D	0.86097	-2.07	4.92	4.92	0.64577	TRAM/LAG1/CLN8 homology domain (3);	0.000000	0.85682	D	0.000000	D	0.90528	0.7032	M	0.77103	2.36	0.80722	D	1	D;P	0.69078	0.997;0.931	P;P	0.57846	0.828;0.48	D	0.91585	0.5282	10	0.59425	D	0.04	-32.2793	15.5984	0.76606	0.0:0.0:1.0:0.0	.	230;230	Q53HF9;Q9HA82	.;CERS4_HUMAN	H	230	ENSP00000251363:R230H	ENSP00000251363:R230H	R	+	2	0	CERS4	8227909	1.000000	0.71417	1.000000	0.80357	0.477000	0.33069	8.383000	0.90157	2.271000	0.75665	0.561000	0.74099	CGC	.		0.582	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419200.1	NM_024552	
CKB	1152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	103986257	103986257	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr14:103986257C>T	ENST00000348956.2	-	8	1447	c.1090G>A	c.(1090-1092)Gag>Aag	p.E364K		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	364	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	AGCCGCTGCTCCATCTCGATG	0.637																																					p.E364K	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB	115	0			c.G1090A						.						46.0	42.0	44.0					14																	103986257		2202	4300	6502	SO:0001583	missense	1152	exon8			GCTGCTCCATCTC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.1090G>A	14.37:g.103986257C>T	ENSP00000299198:p.Glu364Lys	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	16.0	NM_001823	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Missense_Mutation	SNP	ENST00000348956.2	37	CCDS9981.1	.	.	.	.	.	.	.	.	.	.	C	36	5.724393	0.96847	.	.	ENSG00000166165	ENST00000348956;ENST00000428256;ENST00000553610	T;T	0.38240	1.15;1.15	4.95	4.95	0.65309	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73806	0.3634	H	0.97587	4.035	0.80722	D	1	D	0.69078	0.997	D	0.68483	0.958	D	0.84963	0.0878	10	0.87932	D	0	-15.8628	18.1883	0.89799	0.0:1.0:0.0:0.0	.	364	P12277	KCRB_HUMAN	K	364;329;162	ENSP00000299198:E364K;ENSP00000451426:E162K	ENSP00000299198:E364K	E	-	1	0	CKB	103056010	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.679000	0.84048	2.286000	0.76751	0.462000	0.41574	GAG	.		0.637	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
CLOCK	9575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	56345032	56345032	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr4:56345032T>A	ENST00000309964.4	-	5	456	c.206A>T	c.(205-207)gAc>gTc	p.D69V	CLOCK_ENST00000513440.1_Missense_Mutation_p.D69V|CLOCK_ENST00000506923.1_5'UTR|CLOCK_ENST00000381322.1_Missense_Mutation_p.D69V	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	69	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			agtagatttgtccatctttct	0.323																																					p.D69V		.											.	CLOCK	515	0			c.A206T						.						66.0	67.0	67.0					4																	56345032		2202	4299	6501	SO:0001583	missense	9575	exon6			GATTTGTCCATCT	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.206A>T	4.37:g.56345032T>A	ENSP00000308741:p.Asp69Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	43.0	NM_004898	A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	ENST00000309964.4	37	CCDS3500.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.673872	0.88445	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	D;D;D	0.98044	-4.68;-4.68;-4.68	6.07	6.07	0.98685	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98349	0.9452	M	0.84326	2.69	0.80722	D	1	P	0.45768	0.866	P	0.53988	0.739	D	0.99063	1.0831	10	0.72032	D	0.01	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	69	O15516	CLOCK_HUMAN	V	69	ENSP00000308741:D69V;ENSP00000370723:D69V;ENSP00000426983:D69V	ENSP00000308741:D69V	D	-	2	0	CLOCK	56039789	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.157000	0.77461	2.326000	0.78906	0.533000	0.62120	GAC	.		0.323	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898	
CWC22	57703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	180815590	180815590	+	Silent	SNP	G	G	A			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr2:180815590G>A	ENST00000410053.3	-	18	2180	c.1881C>T	c.(1879-1881)gcC>gcT	p.A627A	CWC22_ENST00000295749.6_Silent_p.A627A	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	627					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						AGAAGTTGATGGCAAACCGAG	0.318																																					p.A627A		.											.	CWC22	90	0			c.C1881T						.						53.0	52.0	53.0					2																	180815590		1805	4077	5882	SO:0001819	synonymous_variant	57703	exon18			GTTGATGGCAAAC		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.1881C>T	2.37:g.180815590G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	18.0	NM_020943	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Silent	SNP	ENST00000410053.3	37	CCDS46465.1																																																																																			.		0.318	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334537.1	NM_020943	
DEK	7913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	18249918	18249918	+	Silent	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr6:18249918C>T	ENST00000397239.3	-	7	1173	c.726G>A	c.(724-726)gaG>gaA	p.E242E	DEK_ENST00000244776.7_Silent_p.E208E	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	242	Asp/Glu-rich (acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			CATCTGAAGACTCTTCCTTGT	0.338			T	NUP214	AML																																p.E242E		.		Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	.	DEK	658	0			c.G726A						.						89.0	81.0	84.0					6																	18249918		2203	4299	6502	SO:0001819	synonymous_variant	7913	exon7			TGAAGACTCTTCC	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.726G>A	6.37:g.18249918C>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	8.0	NM_003472	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Silent	SNP	ENST00000397239.3	37	CCDS34344.1																																																																																			.		0.338	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4		
DTNA	1837	hgsc.bcm.edu;bcgsc.ca	37	18	32418068	32418068	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr18:32418068delA	ENST00000399113.3	+	11	1105	c.1105delA	c.(1105-1107)aagfs	p.K369fs	DTNA_ENST00000601125.1_Intron|DTNA_ENST00000599844.1_Intron|DTNA_ENST00000597599.1_Intron|DTNA_ENST00000348997.5_Frame_Shift_Del_p.K366fs|DTNA_ENST00000591182.1_Frame_Shift_Del_p.K48fs|DTNA_ENST00000595022.1_Intron|DTNA_ENST00000597674.1_Intron|DTNA_ENST00000269191.6_Frame_Shift_Del_p.K369fs|DTNA_ENST00000444659.1_Frame_Shift_Del_p.K369fs|DTNA_ENST00000598142.1_Intron|DTNA_ENST00000269190.7_Frame_Shift_Del_p.K370fs|DTNA_ENST00000283365.9_Intron|DTNA_ENST00000399121.5_Intron|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000399097.3_Frame_Shift_Del_p.K48fs|DTNA_ENST00000598774.1_Intron|DTNA_ENST00000269192.7_Frame_Shift_Del_p.K78fs|DTNA_ENST00000556414.3_Intron|DTNA_ENST00000598334.1_Intron			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	369					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						CTCTCCTCCCAAGGACAGTGA	0.483																																					p.K369fs		.											.	DTNA	153	0			c.1105delA						.						97.0	81.0	86.0					18																	32418068		2203	4300	6503	SO:0001589	frameshift_variant	1837	exon11			CCTCCCAAGGACA	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1105delA	18.37:g.32418068delA	ENSP00000382064:p.Lys369fs	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	25.0	NM_001390	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Frame_Shift_Del	DEL	ENST00000399113.3	37	CCDS59311.1																																																																																			.		0.483	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
GLI3	2737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	42116418	42116418	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr7:42116418G>T	ENST00000395925.3	-	4	490	c.406C>A	c.(406-408)Cca>Aca	p.P136T	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	136					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCATCAATTGGTACAGGAGGA	0.413									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.P136T		.											.	GLI3	1149	0			c.C406A						.						149.0	127.0	134.0					7																	42116418		2203	4300	6503	SO:0001583	missense	2737	exon4	Familial Cancer Database	;	CAATTGGTACAGG		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.406C>A	7.37:g.42116418G>T	ENSP00000379258:p.Pro136Thr	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	33.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555198	0.86231	.	.	ENSG00000106571	ENST00000395925;ENST00000448703	T;T	0.76186	-1.0;-1.0	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.86091	0.5850	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86392	0.1736	10	0.87932	D	0	.	20.0781	0.97751	0.0:0.0:1.0:0.0	.	136	P10071	GLI3_HUMAN	T	136	ENSP00000379258:P136T;ENSP00000406135:P136T	ENSP00000379258:P136T	P	-	1	0	GLI3	42082943	1.000000	0.71417	0.724000	0.30704	0.987000	0.75469	9.174000	0.94824	2.817000	0.96982	0.563000	0.77884	CCA	.		0.413	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
GPR84	53831	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	54756722	54756722	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr12:54756722C>T	ENST00000551809.1	-	1	1549	c.914G>A	c.(913-915)aGa>aAa	p.R305K	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Missense_Mutation_p.R305K			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						CGGAGCTCTTCTGGCTCCTTT	0.507																																					p.R305K		.											.	GPR84	523	0			c.G914A						.						122.0	127.0	125.0					12																	54756722		2203	4300	6503	SO:0001583	missense	53831	exon2			GCTCTTCTGGCTC	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.914G>A	12.37:g.54756722C>T	ENSP00000450310:p.Arg305Lys	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	9.0	NM_020370	B6V9G7	Missense_Mutation	SNP	ENST00000551809.1	37	CCDS8878.1	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.153377	0.00325	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.37058	1.22;1.22	4.08	-6.13	0.02118	GPCR, rhodopsin-like superfamily (1);	2.058800	0.02794	N	0.122402	T	0.21468	0.0517	L	0.34521	1.04	0.09310	N	1	B	0.11235	0.004	B	0.14023	0.01	T	0.24728	-1.0152	10	0.07325	T	0.83	0.6568	6.2275	0.20716	0.0:0.2146:0.2622:0.5232	.	305	Q9NQS5	GPR84_HUMAN	K	305	ENSP00000267015:R305K;ENSP00000450310:R305K	ENSP00000267015:R305K	R	-	2	0	GPR84	53042989	0.000000	0.05858	0.011000	0.14972	0.110000	0.19582	-2.779000	0.00774	-1.350000	0.02199	-0.974000	0.02594	AGA	.		0.507	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
IGDCC4	57722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65680865	65680865	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr15:65680865T>A	ENST00000352385.2	-	16	2976	c.2767A>T	c.(2767-2769)Atg>Ttg	p.M923L	IGDCC4_ENST00000558048.1_5'Flank	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	923	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						CGCGCCCCCATCTTGAAGAAG	0.617																																					p.M923L		.											.	IGDCC4	93	0			c.A2767T						.						108.0	101.0	103.0					15																	65680865		2201	4299	6500	SO:0001583	missense	57722	exon16			CCCCCATCTTGAA		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.2767A>T	15.37:g.65680865T>A	ENSP00000319623:p.Met923Leu	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	30.0	NM_020962	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.954123	0.53293	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	T	0.53423	0.62	5.16	5.16	0.70880	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.052891	0.85682	D	0.000000	T	0.35393	0.0930	N	0.16903	0.455	0.36920	D	0.89135	B	0.29955	0.263	B	0.31946	0.138	T	0.43475	-0.9389	10	0.48119	T	0.1	-32.3218	14.9867	0.71353	0.0:0.0:0.0:1.0	.	923	Q8TDY8	IGDC4_HUMAN	L	923;652	ENSP00000319623:M923L	ENSP00000319623:M923L	M	-	1	0	IGDCC4	63467918	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.518000	0.45537	1.946000	0.56461	0.459000	0.35465	ATG	.		0.617	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
KCNQ3	3786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133141974	133141974	+	Silent	SNP	C	C	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr8:133141974C>G	ENST00000388996.4	-	15	2574	c.2154G>C	c.(2152-2154)gtG>gtC	p.V718V	KCNQ3_ENST00000519445.1_Silent_p.V706V|KCNQ3_ENST00000521134.1_Silent_p.V598V	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	718					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GGGGCAGGTTCACAGGGTCAT	0.562																																					p.V718V		.											.	KCNQ3	138	0			c.G2154C						.						44.0	44.0	44.0					8																	133141974		2203	4300	6503	SO:0001819	synonymous_variant	3786	exon15			CAGGTTCACAGGG	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2154G>C	8.37:g.133141974C>G		Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	304.0	89.0	NM_004519	A2VCT8|B4DJY4|E7EQ89	Silent	SNP	ENST00000388996.4	37	CCDS34943.1																																																																																			.		0.562	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
KHNYN	23351	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24901509	24901509	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr14:24901509C>A	ENST00000251343.5	+	3	1181	c.1042C>A	c.(1042-1044)Cac>Aac	p.H348N	CBLN3_ENST00000555436.1_5'Flank|CBLN3_ENST00000267406.6_5'Flank|KHNYN_ENST00000556842.1_Missense_Mutation_p.H348N|KHNYN_ENST00000554268.1_5'Flank|KHNYN_ENST00000553935.1_Missense_Mutation_p.H348N			O15037	KHNYN_HUMAN	KH and NYN domain containing	348							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						CCAGCGGCTCCACAATGGGAA	0.682											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H348N		.											.	KHNYN	93	0			c.C1042A						.						49.0	55.0	53.0					14																	24901509		2203	4300	6503	SO:0001583	missense	23351	exon3			CGGCTCCACAATG	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.1042C>A	14.37:g.24901509C>A	ENSP00000251343:p.His348Asn	Somatic	174.0	0.0	774	WXS	Illumina HiSeq	Phase_I	150.0	8.0	NM_015299	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	ENST00000251343.5	37	CCDS32058.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246982	0.39697	.	.	ENSG00000100441	ENST00000251343;ENST00000556842;ENST00000553935	T;T;T	0.23552	1.9;1.9;1.9	5.27	4.29	0.51040	.	0.861964	0.10600	N	0.655769	T	0.18257	0.0438	L	0.27053	0.805	0.38383	D	0.94518	B;B	0.15141	0.012;0.005	B;B	0.09377	0.004;0.002	T	0.05801	-1.0863	10	0.15952	T	0.53	.	11.8273	0.52275	0.1868:0.8131:0.0:0.0	.	389;348	D3DS77;O15037	.;KHNYN_HUMAN	N	348	ENSP00000251343:H348N;ENSP00000451106:H348N;ENSP00000450799:H348N	ENSP00000251343:H348N	H	+	1	0	KHNYN	23971349	0.826000	0.29277	1.000000	0.80357	0.896000	0.52359	3.323000	0.52014	2.462000	0.83206	0.462000	0.41574	CAC	.		0.682	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1		
LRP12	29967	broad.mit.edu;bcgsc.ca	37	8	105502999	105502999	+	Missense_Mutation	SNP	G	G	A	rs138849088		TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr8:105502999G>A	ENST00000276654.5	-	7	2590	c.2482C>T	c.(2482-2484)Cgc>Tgc	p.R828C	LRP12_ENST00000424843.2_Missense_Mutation_p.R809C|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	828					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.R828C(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATACCACAGCGCTCACAGGGG	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		18899	0.0		0.001	False		,,,				2504	0.0				p.R828C		.											.	LRP12	90	1	Substitution - Missense(1)	large_intestine(1)	c.C2482T						.	G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	177.0	140.0	153.0		2425,2482	4.9	1.0	8	dbSNP_134	153	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	LRP12	NM_001135703.2,NM_013437.4	180,180	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	benign,benign	809/841,828/860	105502999	3,13003	2203	4300	6503	SO:0001583	missense	29967	exon7			CACAGCGCTCACA	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.2482C>T	8.37:g.105502999G>A	ENSP00000276654:p.Arg828Cys	Somatic	281.0	1.0		WXS	Illumina HiSeq	Phase_I	393.0	26.0	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.72	1.721910	0.30503	2.27E-4	2.33E-4	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000520873	D;D	0.84370	-1.84;-1.77	5.81	4.94	0.65067	.	0.304630	0.41712	D	0.000824	T	0.68897	0.3051	N	0.08118	0	0.47994	D	0.999564	B;B	0.13145	0.007;0.0	B;B	0.08055	0.003;0.0	T	0.64300	-0.6440	10	0.49607	T	0.09	-6.1784	7.1612	0.25664	0.1446:0.0:0.7081:0.1473	.	809;828	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	C	809;828;193	ENSP00000399148:R809C;ENSP00000276654:R828C	ENSP00000276654:R828C	R	-	1	0	LRP12	105572175	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.047000	0.64232	1.457000	0.47850	0.650000	0.86243	CGC	G|1.000;A|0.000		0.448	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
MAATS1	89876	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	119425666	119425666	+	Silent	SNP	T	T	C			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr3:119425666T>C	ENST00000273390.5	+	2	212	c.135T>C	c.(133-135)ttT>ttC	p.F45F	MAATS1_ENST00000463700.1_Silent_p.F45F	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	45						mitochondrion (GO:0005739)											ATCCATTGTTTATTGTGTCAA	0.388																																					p.F45F		.											.	.	.	0			c.T135C						.						153.0	141.0	145.0					3																	119425666		2203	4300	6503	SO:0001819	synonymous_variant	89876	exon2			ATTGTTTATTGTG	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.135T>C	3.37:g.119425666T>C		Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	90.0	28.0	NM_033364	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Silent	SNP	ENST00000273390.5	37	CCDS2994.1																																																																																			.		0.388	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364	
MYOM2	9172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	1998979	1998979	+	Silent	SNP	G	G	A	rs112978000		TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr8:1998979G>A	ENST00000262113.4	+	2	240	c.99G>A	c.(97-99)gcG>gcA	p.A33A	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	33					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ACGAATATGCGTCAAAAAAGT	0.488													g|||	1	0.000199681	0.0	0.0	5008	,	,		22276	0.0		0.0	False		,,,				2504	0.001				p.A33A		.											.	MYOM2	95	0			c.G99A						.	A		2,4404	825.9+/-416.6	0,2,2201	98.0	75.0	83.0		99	-8.2	0.0	8	dbSNP_132	83	1,8599	818.9+/-406.8	0,1,4299	no	coding-synonymous	MYOM2	NM_003970.2		0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231		33/1466	1998979	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	9172	exon2			ATATGCGTCAAAA		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.99G>A	8.37:g.1998979G>A		Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	41.0	NM_003970	Q7Z3Y2	Silent	SNP	ENST00000262113.4	37	CCDS5957.1																																																																																			A|0.001;C|0.000;G|0.999		0.488	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
OGN	4969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	95152228	95152228	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr9:95152228G>C	ENST00000262551.4	-	5	958	c.538C>G	c.(538-540)Cta>Gta	p.L180V	OGN_ENST00000468743.1_5'UTR|CENPP_ENST00000375587.3_Intron|OGN_ENST00000375561.5_Missense_Mutation_p.L180V	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	180					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						GGAAGTTTTAGTAGTTGATTT	0.318																																					p.L180V		.											.	OGN	492	0			c.C538G						.						119.0	122.0	121.0					9																	95152228		2202	4299	6501	SO:0001583	missense	4969	exon5			GTTTTAGTAGTTG	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.538C>G	9.37:g.95152228G>C	ENSP00000262551:p.Leu180Val	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	14.0	NM_033014	Q6FIB0|Q9UF90|Q9UNK5	Missense_Mutation	SNP	ENST00000262551.4	37	CCDS6695.1	.	.	.	.	.	.	.	.	.	.	G	10.54	1.377437	0.24944	.	.	ENSG00000106809	ENST00000262551;ENST00000375561;ENST00000447356	D;D;D	0.83335	-1.71;-1.71;-1.71	5.27	-3.56	0.04626	.	0.417501	0.25854	N	0.027879	T	0.49541	0.1563	N	0.02539	-0.55	0.24841	N	0.99247	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.43637	-0.9379	10	0.26408	T	0.33	.	1.1245	0.01732	0.407:0.2378:0.1821:0.1731	.	238;180	B4DI63;P20774	.;MIME_HUMAN	V	180;180;238	ENSP00000262551:L180V;ENSP00000364711:L180V;ENSP00000396709:L238V	ENSP00000262551:L180V	L	-	1	2	OGN	94192049	0.000000	0.05858	0.982000	0.44146	0.998000	0.95712	-1.084000	0.03393	-0.304000	0.08843	0.655000	0.94253	CTA	.		0.318	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416	
PCBP3	54039	broad.mit.edu;ucsc.edu;mdanderson.org	37	21	47330914	47330914	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr21:47330914C>A	ENST00000400314.1	+	9	908	c.570C>A	c.(568-570)tgC>tgA	p.C190*	PCBP3_ENST00000400309.1_Nonsense_Mutation_p.C190*|PCBP3_ENST00000400304.1_Nonsense_Mutation_p.C158*|PCBP3_ENST00000400310.1_Nonsense_Mutation_p.C190*|PCBP3_ENST00000400308.1_Nonsense_Mutation_p.C190*|PCBP3_ENST00000449640.1_Nonsense_Mutation_p.C190*			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	190					mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		TCATCCAGTGCGTCAAGCAGA	0.642																																					p.C190X		.											.	PCBP3	227	0			c.C570A						.						89.0	96.0	94.0					21																	47330914		2184	4283	6467	SO:0001587	stop_gained	54039	exon7			CCAGTGCGTCAAG	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.570C>A	21.37:g.47330914C>A	ENSP00000383168:p.Cys190*	Somatic	93.0	1.0		WXS	Illumina HiSeq	Phase_I	76.0	29.0	NM_001130141	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Nonsense_Mutation	SNP	ENST00000400314.1	37	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	C	39	7.434604	0.98282	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000400308;ENST00000449640;ENST00000346743;ENST00000400305;ENST00000400304	.	.	.	5.74	-9.14	0.00701	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.4133	19.3746	0.94503	0.0:0.6273:0.0:0.3727	.	.	.	.	X	190;190;190;190;190;190;166;158	.	ENSP00000330225:C190X	C	+	3	2	PCBP3	46155342	0.992000	0.36948	0.730000	0.30809	0.986000	0.74619	0.187000	0.16998	-1.689000	0.01434	-1.148000	0.01847	TGC	.		0.642	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
PCDH11Y	83259	hgsc.bcm.edu;broad.mit.edu	37	Y	5605945	5605945	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chrY:5605945A>T	ENST00000215473.6	+	6	3985	c.3985A>T	c.(3985-3987)Aga>Tga	p.R1329*				Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	1329					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						CAGACCGTCCAGAGGTGATTC	0.378																																					p.R1329X		.											.	.	.	0			c.A3985T						.																																			SO:0001587	stop_gained	83259	exon5			CCGTCCAGAGGTG	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000215473.6:c.3985A>T	Y.37:g.5605945A>T	ENSP00000215473:p.Arg1329*	Somatic	241.0	1.0		WXS	Illumina HiSeq	Phase_I	242.0	220.0	NM_032973	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Nonsense_Mutation	SNP	ENST00000215473.6	37																																																																																				.		0.378	PCDH11Y-201	KNOWN	basic	protein_coding	protein_coding		NM_032973	
PTPN13	5783	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	87622910	87622910	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr4:87622910G>T	ENST00000411767.2	+	7	1214	c.1151G>T	c.(1150-1152)aGa>aTa	p.R384I	PTPN13_ENST00000436978.1_Missense_Mutation_p.R384I|PTPN13_ENST00000427191.2_Missense_Mutation_p.R384I|PTPN13_ENST00000316707.6_Missense_Mutation_p.R384I|PTPN13_ENST00000511467.1_Missense_Mutation_p.R384I			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	384					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ATCCGAGAGAGACAAAAGAAA	0.383																																					p.R384I		.											.	PTPN13	230	0			c.G1151T						.						47.0	45.0	45.0					4																	87622910		1846	4101	5947	SO:0001583	missense	5783	exon7			GAGAGAGACAAAA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1151G>T	4.37:g.87622910G>T	ENSP00000407249:p.Arg384Ile	Somatic	119.0	1.0		WXS	Illumina HiSeq	Phase_I	64.0	8.0	NM_006264	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206294	0.79127	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.57595	0.4;0.42;0.51;0.39;0.42	6.03	6.03	0.97812	.	0.000000	0.56097	D	0.000028	T	0.67887	0.2941	M	0.65975	2.015	0.58432	D	0.999997	P;D;D;D	0.69078	0.894;0.997;0.994;0.997	P;D;P;D	0.66351	0.532;0.918;0.878;0.943	T	0.65170	-0.6233	10	0.38643	T	0.18	.	13.7134	0.62682	0.0699:0.0:0.9301:0.0	.	384;384;384;384	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	I	384;384;384;384;384;352	ENSP00000408368:R384I;ENSP00000394794:R384I;ENSP00000322675:R384I;ENSP00000407249:R384I;ENSP00000426626:R384I	ENSP00000322675:R384I	R	+	2	0	PTPN13	87841934	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.133000	0.64764	2.861000	0.98227	0.655000	0.94253	AGA	.		0.383	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	40730794	40730795	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr20:40730794_40730795insGA	ENST00000373187.1	-	26	3682_3683	c.3683_3684insTC	c.(3682-3684)tccfs	p.S1228fs	PTPRT_ENST00000356100.2_Frame_Shift_Ins_p.S1237fs|PTPRT_ENST00000373201.1_Frame_Shift_Ins_p.S1218fs|PTPRT_ENST00000373198.4_Frame_Shift_Ins_p.S1247fs|PTPRT_ENST00000373193.3_Frame_Shift_Ins_p.S1231fs|PTPRT_ENST00000373190.1_Frame_Shift_Ins_p.S1227fs|PTPRT_ENST00000373184.1_Frame_Shift_Ins_p.S1238fs			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1228	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TGTAATTGCTGGATTCTCCGTC	0.545																																					p.S1247fs		.											.	PTPRT	664	0			c.3741_3742insTC						.																																			SO:0001589	frameshift_variant	11122	exon27			ATTGCTGGATTCT	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3682_3683dupTC	20.37:g.40730795_40730796dupGA	ENSP00000362283:p.Ser1228fs	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	62.0	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Frame_Shift_Ins	INS	ENST00000373187.1	37	CCDS42874.1																																																																																			.		0.545	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
RB1	5925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	48953741	48953742	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr13:48953741_48953742insG	ENST00000267163.4	+	14	1482_1483	c.1344_1345insG	c.(1345-1347)ggafs	p.G449fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	449	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.G449R(1)|p.L448L(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GATACAAACTTGGAGTTCGCTT	0.347		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.L448fs		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	3784	25	Whole gene deletion(15)|Unknown(8)|Substitution - Missense(1)|Substitution - coding silent(1)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|large_intestine(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	c.1344_1345insG	GRCh37	CS071257	RB1	S		.																																			SO:0001589	frameshift_variant	5925	exon14	Familial Cancer Database		CAAACTTGGAGTT	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1346dupG	13.37:g.48953743_48953743dupG	ENSP00000267163:p.Gly449fs	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	19.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Ins	INS	ENST00000267163.4	37	CCDS31973.1																																																																																			.		0.347	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
SKIV2L2	23517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	54624616	54624616	+	Silent	SNP	A	A	C			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr5:54624616A>C	ENST00000230640.5	+	5	746	c.492A>C	c.(490-492)tcA>tcC	p.S164S	SKIV2L2_ENST00000545714.1_Silent_p.S63S	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	164	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				CACATACCTCAGCGGGAAAAA	0.363																																					p.S164S	Melanoma(2;92 134 23744 29976 33782)	.											.	SKIV2L2	92	0			c.A492C						.						152.0	145.0	148.0					5																	54624616		2203	4300	6503	SO:0001819	synonymous_variant	23517	exon5			TACCTCAGCGGGA	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.492A>C	5.37:g.54624616A>C		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	27.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	ENST00000230640.5	37	CCDS3967.1																																																																																			.		0.363	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
SLC25A37	51312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	23429092	23429092	+	Silent	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr8:23429092C>T	ENST00000519973.1	+	4	939	c.741C>T	c.(739-741)ctC>ctT	p.L247L	FP15737_ENST00000399967.3_5'Flank	NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	247					iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CCGGGGCCCTCGCCGCGGCCG	0.657																																					p.L247L		.											.	SLC25A37	90	0			c.C741T						.						22.0	27.0	25.0					8																	23429092		1906	4104	6010	SO:0001819	synonymous_variant	51312	exon4			GGCCCTCGCCGCG	AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.741C>T	8.37:g.23429092C>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	16.0	NM_016612	A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Silent	SNP	ENST00000519973.1	37	CCDS47828.1																																																																																			.		0.657	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612	
SMG6	23293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2203672	2203672	+	Silent	SNP	A	A	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr17:2203672A>G	ENST00000263073.6	-	2	425	c.375T>C	c.(373-375)gcT>gcC	p.A125A	SMG6_ENST00000544865.1_Silent_p.A94A	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	125	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCTCTTGTCCAGCAGTCCTAG	0.438																																					p.A125A	Melanoma(59;28 1088 11621 25887 46638 50814)	.											.	SMG6	228	0			c.T375C						.						147.0	156.0	153.0					17																	2203672		2203	4300	6503	SO:0001819	synonymous_variant	23293	exon2			TTGTCCAGCAGTC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.375T>C	17.37:g.2203672A>G		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	15.0	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Silent	SNP	ENST00000263073.6	37	CCDS11016.1																																																																																			.		0.438	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
STC1	6781	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	23709890	23709890	+	Silent	SNP	C	C	A			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr8:23709890C>A	ENST00000290271.2	-	2	409	c.126G>T	c.(124-126)gtG>gtT	p.V42V	STC1_ENST00000524323.1_5'UTR	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	42					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		GGCAACGAACCACTTCAGCTG	0.498																																					p.V42V		.											.	STC1	94	0			c.G126T						.						95.0	86.0	89.0					8																	23709890		2203	4300	6503	SO:0001819	synonymous_variant	6781	exon2			ACGAACCACTTCA		CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.126G>T	8.37:g.23709890C>A		Somatic	127.0	1.0		WXS	Illumina HiSeq	Phase_I	115.0	44.0	NM_003155	B4DN22|Q71UE5	Silent	SNP	ENST00000290271.2	37	CCDS6043.1																																																																																			.		0.498	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215143.1		
TAS2R3	50831	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	141464093	141464093	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr7:141464093C>G	ENST00000247879.2	+	1	197	c.135C>G	c.(133-135)gaC>gaG	p.D45E	SSBP1_ENST00000465582.1_Intron	NM_016943.2	NP_058639.1	Q9NYW6	TA2R3_HUMAN	taste receptor, type 2, member 3	45					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)	14	Melanoma(164;0.0171)					CTTTGTCTGACTTCATCATCA	0.418																																					p.D45E		.											.	TAS2R3	90	0			c.C135G						.						265.0	254.0	258.0					7																	141464093		2203	4300	6503	SO:0001583	missense	50831	exon1			GTCTGACTTCATC	AF227130	CCDS5867.1	7q31.3-q32	2012-08-22			ENSG00000127362	ENSG00000127362		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14910	protein-coding gene	gene with protein product		604868					Standard	NM_016943		Approved	T2R3	uc003vwp.1	Q9NYW6	OTTHUMG00000157637	ENST00000247879.2:c.135C>G	7.37:g.141464093C>G	ENSP00000247879:p.Asp45Glu	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	6.0	NM_016943	A4D1U2|Q645W2|Q75MV6	Missense_Mutation	SNP	ENST00000247879.2	37	CCDS5867.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026387	0.75390	.	.	ENSG00000127362	ENST00000247879	T	0.01139	5.28	6.17	3.31	0.37934	.	0.123149	0.51477	D	0.000084	T	0.07234	0.0183	M	0.91510	3.215	0.25960	N	0.982637	D	0.71674	0.998	D	0.69142	0.962	T	0.04855	-1.0922	10	0.87932	D	0	.	7.956	0.30042	0.1298:0.7287:0.0:0.1416	.	45	Q9NYW6	TA2R3_HUMAN	E	45	ENSP00000247879:D45E	ENSP00000247879:D45E	D	+	3	2	TAS2R3	141110562	0.231000	0.23751	1.000000	0.80357	0.928000	0.56348	0.019000	0.13444	0.924000	0.37069	-0.150000	0.13652	GAC	.		0.418	TAS2R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349288.1		
TCHH	7062	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152081138	152081138	+	Missense_Mutation	SNP	C	C	G	rs189687085	byFrequency	TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr1:152081138C>G	ENST00000368804.1	-	2	4554	c.4555G>C	c.(4555-4557)Gag>Cag	p.E1519Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1519	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.E1519Q(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTTCCTCCTCGAGGAATTTT	0.587																																					p.E1519Q		.											.	TCHH	72	1	Substitution - Missense(1)	lung(1)	c.G4555C						.						53.0	55.0	54.0					1																	152081138		1885	4114	5999	SO:0001583	missense	7062	exon3			CCTCCTCGAGGAA	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.4555G>C	1.37:g.152081138C>G	ENSP00000357794:p.Glu1519Gln	Somatic	73.0	1.0		WXS	Illumina HiSeq	Phase_I	120.0	24.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	-	1.898	-0.453708	0.04540	.	.	ENSG00000159450	ENST00000368804	T	0.05382	3.45	0.113	0.113	0.14631	.	.	.	.	.	T	0.03739	0.0106	M	0.66939	2.045	0.09310	N	1	P	0.44281	0.831	P	0.47786	0.557	T	0.38802	-0.9644	8	0.23302	T	0.38	.	.	.	.	.	1519	Q07283	TRHY_HUMAN	Q	1519	ENSP00000357794:E1519Q	ENSP00000357794:E1519Q	E	-	1	0	TCHH	150347762	0.000000	0.05858	0.001000	0.08648	0.038000	0.13279	-0.405000	0.07196	0.183000	0.20059	0.186000	0.17326	GAG	C|0.999;T|0.000		0.587	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TDO2	6999	ucsc.edu;bcgsc.ca	37	4	156826233	156826233	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr4:156826233G>T	ENST00000536354.2	+	3	220	c.156G>T	c.(154-156)ttG>ttT	p.L52F		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase											breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		AAAAAGTTTTGAATGCACAAG	0.303																																					p.L52F	Colon(57;928 1036 2595 6946 26094)	.											.	TDO2	514	0			c.G156T						.						55.0	54.0	54.0					4																	156826233		2202	4295	6497	SO:0001583	missense	6999	exon3			AGTTTTGAATGCA		CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.156G>T	4.37:g.156826233G>T	ENSP00000444788:p.Leu52Phe	Somatic	100.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_005651		Missense_Mutation	SNP	ENST00000536354.2	37	CCDS34086.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909431	0.72868	.	.	ENSG00000151790	ENST00000536354	.	.	.	5.83	4.98	0.66077	.	0.131843	0.52532	D	0.000076	D	0.85919	0.5809	H	0.95504	3.68	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.88990	0.3414	9	0.87932	D	0	-20.3796	12.572	0.56342	0.1306:0.0:0.8694:0.0	.	52	P48775	T23O_HUMAN	F	52	.	ENSP00000281525:L52F	L	+	3	2	TDO2	157045683	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.634000	0.46528	2.755000	0.94549	0.650000	0.86243	TTG	.		0.303	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366209.3	NM_005651	
TMEM161A	54929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19245614	19245614	+	Missense_Mutation	SNP	C	C	G	rs143085909		TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr19:19245614C>G	ENST00000162044.9	-	2	150	c.86G>C	c.(85-87)cGc>cCc	p.R29P	TMEM161A_ENST00000587583.2_Missense_Mutation_p.R29P|TMEM161A_ENST00000450333.2_Missense_Mutation_p.R29P|TMEM161A_ENST00000592147.1_Intron	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	29					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			GAGCAGCCAGCGCGCGAAGGA	0.706																																					p.R29P		.											.	TMEM161A	154	0			c.G86C						.						15.0	13.0	14.0					19																	19245614		2190	4284	6474	SO:0001583	missense	54929	exon2			AGCCAGCGCGCGA	BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.86G>C	19.37:g.19245614C>G	ENSP00000162044:p.Arg29Pro	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	27.0	NM_001256766	B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	ENST00000162044.9	37	CCDS12393.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869176	0.72065	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	4.63	4.63	0.57726	.	0.053328	0.64402	D	0.000001	T	0.78323	0.4265	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.81466	-0.0920	9	0.72032	D	0.01	-6.0409	14.9691	0.71220	0.0:1.0:0.0:0.0	.	29;29;29	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	P	29	.	ENSP00000162044:R29P	R	-	2	0	TMEM161A	19106614	1.000000	0.71417	0.911000	0.35937	0.238000	0.25445	7.131000	0.77243	2.142000	0.66516	0.313000	0.20887	CGC	C|1.000;A|0.000		0.706	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460089.2	NM_017814	
TPX2	22974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	30365347	30365347	+	Missense_Mutation	SNP	G	G	T	rs527354467		TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr20:30365347G>T	ENST00000300403.6	+	9	1316	c.788G>T	c.(787-789)cGc>cTc	p.R263L	TPX2_ENST00000340513.4_Missense_Mutation_p.R263L	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	263					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			TTCCACTTCCGCACAGATGAG	0.413																																					p.R263L		.											.	TPX2	290	0			c.G788T						.						139.0	118.0	125.0					20																	30365347		2203	4300	6503	SO:0001583	missense	22974	exon9			ACTTCCGCACAGA	AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.788G>T	20.37:g.30365347G>T	ENSP00000300403:p.Arg263Leu	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	68.0	NM_012112	Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	ENST00000300403.6	37	CCDS13190.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010178	0.35415	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.31510	1.49	5.36	-0.241	0.13043	.	0.826995	0.11539	N	0.553910	T	0.14917	0.0360	N	0.17082	0.46	0.28927	N	0.89182	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.25641	-1.0126	10	0.26408	T	0.33	5.0037	4.403	0.11395	0.2803:0.0:0.465:0.2547	.	263;263	Q96RR5;Q9ULW0	.;TPX2_HUMAN	L	263	ENSP00000341145:R263L	ENSP00000300403:R263L	R	+	2	0	TPX2	29829008	1.000000	0.71417	0.780000	0.31762	0.816000	0.46133	0.984000	0.29565	0.040000	0.15660	-0.140000	0.14226	CGC	.		0.413	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078569.2		
UGT2B4	7363	hgsc.bcm.edu;bcgsc.ca	37	4	70361558	70361580	+	Start_Codon_Del	DEL	CTGAAGTCCATTTCATAGACATC	CTGAAGTCCATTTCATAGACATC	-	rs113676396|rs370125678|rs185779213|rs182850682	byFrequency	TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	CTGAAGTCCATTTCATAGACATC	CTGAAGTCCATTTCATAGACATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr4:70361558_70361580delCTGAAGTCCATTTCATAGACATC	ENST00000305107.6	-	0	46_68				UGT2B4_ENST00000381096.3_Intron|UGT2B4_ENST00000506580.1_5'UTR|UGT2B4_ENST00000512583.1_Start_Codon_Del	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4						cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.M3L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	AGCAGAAGAGCTGAAGTCCATTTCATAGACATCCTGATGCAAT	0.422																																							.											.	UGT2B4	92	1	Substitution - Missense(1)	lung(1)							.																																			SO:0001582	initiator_codon_variant	7363	wholegene			GAAGAGCTGAAGT	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133			4.37:g.70361558_70361580delCTGAAGTCCATTTCATAGACATC		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	5.0	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Frame_Shift_Del	DEL	ENST00000305107.6	37	CCDS43234.1																																																																																			.		0.422	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
USE1	55850	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	17330476	17330476	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr19:17330476C>G	ENST00000263897.5	+	8	681	c.634C>G	c.(634-636)Ctg>Gtg	p.L212V	USE1_ENST00000379776.4_3'UTR|USE1_ENST00000445667.2_Missense_Mutation_p.L212V|USE1_ENST00000596136.1_3'UTR	NM_018467.3	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog (S. cerevisiae)	212					endoplasmic reticulum tubular network organization (GO:0071786)|lysosomal transport (GO:0007041)|protein catabolic process (GO:0030163)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|secretion by cell (GO:0032940)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|lung(3)	6						GGACCAGAACCTGGAGAAACT	0.547																																					p.L212V		.											.	.	.	0			c.C634G						.						78.0	84.0	82.0					19																	17330476		2203	4298	6501	SO:0001583	missense	55850	exon8			CAGAACCTGGAGA	AF220052	CCDS46011.1	19p13.11	2007-08-20				ENSG00000053501			30882	protein-coding gene	gene with protein product	"""Q-SNARE"", ""SNARE-like tail-anchored protein 1 homolog (S. cerevisiae)"""	610675				16354670, 15029241	Standard	NM_018467		Approved	p31, SLT1, MDS032	uc002nfo.2	Q9NZ43		ENST00000263897.5:c.634C>G	19.37:g.17330476C>G	ENSP00000263897:p.Leu212Val	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	10.0	NM_018467	Q8NCK1|Q9BRT4	Missense_Mutation	SNP	ENST00000263897.5	37	CCDS46011.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837606	0.50951	.	.	ENSG00000053501	ENST00000263897;ENST00000445667	T;T	0.54866	0.55;0.55	4.73	3.62	0.41486	.	0.111954	0.64402	D	0.000011	T	0.37100	0.0991	L	0.48642	1.525	0.80722	D	1	P	0.45044	0.849	B	0.40982	0.345	T	0.17930	-1.0353	10	0.15952	T	0.53	-15.0778	3.424	0.07403	0.0:0.6206:0.0:0.3794	.	212	Q9NZ43	USE1_HUMAN	V	212	ENSP00000263897:L212V;ENSP00000390287:L212V	ENSP00000263897:L212V	L	+	1	2	USE1	17191476	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.963000	0.63694	2.193000	0.70182	0.491000	0.48974	CTG	.		0.547	USE1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463295.1	NM_018467	
WDFY4	57705	broad.mit.edu;ucsc.edu	37	10	50108278	50108278	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr10:50108278G>T	ENST00000325239.5	+	45	7477	c.7450G>T	c.(7450-7452)Gag>Tag	p.E2484*	RP11-523O18.7_ENST00000430438.1_RNA|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2484						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CATCGCCCTGGAGATCTTCTT	0.453																																					p.E2484X		.											.	WDFY4	22	0			c.G7450T						.						157.0	133.0	140.0					10																	50108278		692	1591	2283	SO:0001587	stop_gained	57705	exon46			GCCCTGGAGATCT	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7450G>T	10.37:g.50108278G>T	ENSP00000320563:p.Glu2484*	Somatic	167.0	1.0		WXS	Illumina HiSeq	Phase_I	136.0	63.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Nonsense_Mutation	SNP	ENST00000325239.5	37	CCDS44385.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	49|49|49	15.048678|15.048678|15.048678	0.99820|0.99820|0.99820	.|.|.	.|.|.	ENSG00000128815|ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002|ENST00000265453	.|.|.	.|.|.	.|.|.	5.15|5.15|5.15	5.15|5.15|5.15	0.70609|0.70609|0.70609	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	.|T|T	.|0.70622|0.70622	.|0.3245|0.3245	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.69161|0.69161	.|-0.5218|-0.5218	.|4|4	.|.|.	.|.|.	.|.|.	.|.|.	14.5016|14.5016|14.5016	0.67724|0.67724|0.67724	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|V|C	2484|1574|570	.|.|.	.|.|.	E|G|W	+|+|+	1|2|3	0|0|0	WDFY4|WDFY4|WDFY4	49778284|49778284|49778284	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.891000|0.891000|0.891000	0.51852|0.51852|0.51852	5.290000|5.290000|5.290000	0.65661|0.65661|0.65661	2.550000|2.550000|2.550000	0.86006|0.86006|0.86006	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAG|GGA|TGG	.		0.453	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
WT1	7490	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	32414248	32414248	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr11:32414248A>G	ENST00000379079.2	-	8	940	c.667T>C	c.(667-669)Tca>Cca	p.S223P	WT1_ENST00000448076.3_Missense_Mutation_p.S435P|WT1_ENST00000332351.3_Missense_Mutation_p.S435P|WT1_ENST00000530998.1_Missense_Mutation_p.S206P	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	367			S -> N (in WT1). {ECO:0000269|PubMed:9529364}.		adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			AGCTGGTCTGAACGAGAAAAC	0.443			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.S435P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1	6891	0			c.T1303C						.						188.0	158.0	168.0					11																	32414248		2202	4299	6501	SO:0001583	missense	7490	exon8	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	GGTCTGAACGAGA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.667T>C	11.37:g.32414248A>G	ENSP00000368370:p.Ser223Pro	Somatic	260.0	0.0		WXS	Illumina HiSeq	Phase_I	243.0	101.0	NM_024424	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	CCDS55751.1	.	.	.	.	.	.	.	.	.	.	A	32	5.106549	0.94292	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	5.73	5.73	0.89815	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000015	T	0.53738	0.1815	L	0.45228	1.405	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.997;0.998;0.998;0.998	D;D;D;D;D	0.91635	0.998;0.997;0.999;0.995;0.998	T	0.55062	-0.8199	10	0.72032	D	0.01	.	16.3143	0.82909	1.0:0.0:0.0:0.0	.	423;367;440;206;223	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	P	223;435;206;418;435	ENSP00000368370:S223P;ENSP00000331327:S435P;ENSP00000435307:S206P;ENSP00000415516:S418P;ENSP00000413452:S435P	ENSP00000331327:S435P	S	-	1	0	WT1	32370824	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.284000	0.95882	2.313000	0.78055	0.454000	0.30748	TCA	.		0.443	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
ZCWPW1	55063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100004329	100004329	+	Silent	SNP	C	C	T			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr7:100004329C>T	ENST00000398027.2	-	12	1405	c.1158G>A	c.(1156-1158)gaG>gaA	p.E386E	ZCWPW1_ENST00000360951.4_Silent_p.E387E|ZCWPW1_ENST00000490721.1_Silent_p.E266E|ZCWPW1_ENST00000324725.6_Silent_p.E266E	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	386							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGACTGATAGCTCCAGGGACA	0.428																																					p.E387E		.											.	ZCWPW1	90	0			c.G1161A						.						122.0	126.0	124.0					7																	100004329		1914	4126	6040	SO:0001819	synonymous_variant	55063	exon12			TGATAGCTCCAGG	AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.1158G>A	7.37:g.100004329C>T		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	8.0	NM_001258008	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Silent	SNP	ENST00000398027.2	37	CCDS43623.1																																																																																			.		0.428	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356083.1	NM_017984	
ZNF263	10127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3335687	3335687	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SI-01A-31D-A27I-10	TCGA-G3-A5SI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93545962-11bc-4519-a539-fc6651d02b31	f7b392f4-f65f-496b-abcc-8b81bb38e24f	g.chr16:3335687C>G	ENST00000219069.5	+	3	1451	c.575C>G	c.(574-576)tCt>tGt	p.S192C	ZNF263_ENST00000573578.1_Missense_Mutation_p.L132V|ZNF263_ENST00000538765.1_Intron|ZNF263_ENST00000574253.1_Intron	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	192					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						TCAGCATTATCTGCTCCCTGG	0.473																																					p.S192C		.											.	ZNF263	94	0			c.C575G						.						119.0	106.0	111.0					16																	3335687		2197	4300	6497	SO:0001583	missense	10127	exon3			CATTATCTGCTCC	AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.575C>G	16.37:g.3335687C>G	ENSP00000219069:p.Ser192Cys	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	27.0	NM_005741	B2R634|O43387|Q96H95	Missense_Mutation	SNP	ENST00000219069.5	37	CCDS10499.1	.	.	.	.	.	.	.	.	.	.	C	7.950	0.744671	0.15710	.	.	ENSG00000006194	ENST00000219069	T	0.05717	3.4	5.07	4.12	0.48240	.	0.407567	0.21597	N	0.072001	T	0.03651	0.0104	N	0.08118	0	0.80722	D	1	P	0.40000	0.698	B	0.38954	0.286	T	0.57888	-0.7733	10	0.30854	T	0.27	.	9.286	0.37758	0.0:0.9032:0.0:0.0968	.	192	O14978	ZN263_HUMAN	C	192	ENSP00000219069:S192C	ENSP00000219069:S192C	S	+	2	0	ZNF263	3275688	1.000000	0.71417	0.999000	0.59377	0.937000	0.57800	4.414000	0.59802	1.359000	0.45940	-0.136000	0.14681	TCT	.		0.473	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251463.2		
