#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	94577092	94577092	+	Silent	SNP	C	C	T	rs201725352		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:94577092C>T	ENST00000370225.3	-	3	290	c.204G>A	c.(202-204)ccG>ccA	p.P68P	ABCA4_ENST00000535735.1_Silent_p.P68P	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	68			P -> L (in STGD1). {ECO:0000269|PubMed:10958763}.|P -> R (in STGD1).		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CCTGGAGCCACGGCAGCATTC	0.493																																					p.P68P		.											.	ABCA4	162	0			c.G204A						.						72.0	71.0	71.0					1																	94577092		2203	4300	6503	SO:0001819	synonymous_variant	24	exon3			GAGCCACGGCAGC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.204G>A	1.37:g.94577092C>T		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	44.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																			C|0.999;T|0.001		0.493	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
ACAT2	39	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160189612	160189612	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr6:160189612T>A	ENST00000367048.4	+	4	2202	c.442T>A	c.(442-444)Tgt>Agt	p.C148S	ACAT2_ENST00000541436.1_Missense_Mutation_p.C177S	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	148					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CAGTATACTCTGTGATGGTCT	0.398																																					p.C148S		.											.	ACAT2	91	0			c.T442A						.						175.0	157.0	163.0					6																	160189612		2203	4300	6503	SO:0001583	missense	39	exon4			ATACTCTGTGATG	AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.442T>A	6.37:g.160189612T>A	ENSP00000356015:p.Cys148Ser	Somatic	206.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	22.0	NM_005891	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Missense_Mutation	SNP	ENST00000367048.4	37	CCDS5268.1	.	.	.	.	.	.	.	.	.	.	T	7.104	0.574716	0.13623	.	.	ENSG00000120437	ENST00000367048;ENST00000541436	T;T	0.39997	1.05;1.05	5.64	1.86	0.25419	Thiolase, N-terminal (1);Thiolase-like (1);	0.498856	0.25689	N	0.028959	T	0.05364	0.0142	N	0.02111	-0.68	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.40553	-0.9557	10	0.30854	T	0.27	3.015	8.632	0.33926	0.0:0.3997:0.0:0.6003	.	177;148	B7Z233;Q9BWD1	.;THIC_HUMAN	S	148;177	ENSP00000356015:C148S;ENSP00000437850:C177S	ENSP00000356015:C148S	C	+	1	0	ACAT2	160109602	0.000000	0.05858	0.025000	0.17156	0.782000	0.44232	0.371000	0.20450	0.171000	0.19730	0.528000	0.53228	TGT	.		0.398	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042912.1	NM_005891	
AKAP9	10142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91694746	91694746	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:91694746A>G	ENST00000359028.2	+	26	6440	c.6215A>G	c.(6214-6216)aAg>aGg	p.K2072R	AKAP9_ENST00000491695.1_3'UTR|AKAP9_ENST00000356239.3_Missense_Mutation_p.K2060R|AKAP9_ENST00000358100.2_Missense_Mutation_p.K2072R			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2072	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.K2072R(1)|p.K2060R(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GCATTGGAAAAGCAGTTAGAA	0.318			T	BRAF	papillary thyroid																																p.K2060R		.		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	AKAP9_ENST00000356239,NS,other,0	AKAP9	755	2	Substitution - Missense(2)	ovary(2)	c.A6179G						.						40.0	40.0	40.0					7																	91694746		2203	4298	6501	SO:0001583	missense	10142	exon25			TGGAAAAGCAGTT	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.6215A>G	7.37:g.91694746A>G	ENSP00000351922:p.Lys2072Arg	Somatic	100.0	1.0		WXS	Illumina HiSeq	Phase_I	50.0	23.0	NM_005751	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	A	19.13	3.768538	0.69878	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000265737	T;T;T	0.12465	2.7;2.71;2.68	5.62	5.62	0.85841	.	0.000000	0.43747	D	0.000529	T	0.40815	0.1132	M	0.80422	2.495	0.54753	D	0.999988	D;D;D	0.89917	0.997;0.998;1.0	D;D;D	0.87578	0.985;0.994;0.998	T	0.24440	-1.0160	10	0.46703	T	0.11	.	16.1177	0.81321	1.0:0.0:0.0:0.0	.	2072;2060;2060	Q99996;Q99996-2;Q99996-3	AKAP9_HUMAN;.;.	R	2060;2072;2072;2072;275	ENSP00000348573:K2060R;ENSP00000351922:K2072R;ENSP00000350813:K2072R	ENSP00000265737:K275R	K	+	2	0	AKAP9	91532682	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.269000	0.89878	2.267000	0.75376	0.528000	0.53228	AAG	.		0.318	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
ALB	213	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74283835	74283835	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:74283835T>G	ENST00000503124.1	+	10	1216	c.1009T>G	c.(1009-1011)Ttg>Gtg	p.L337V	ALB_ENST00000295897.4_Missense_Mutation_p.L487V|ALB_ENST00000509063.1_Missense_Mutation_p.L487V|ALB_ENST00000415165.2_Missense_Mutation_p.L295V|ALB_ENST00000401494.3_Missense_Mutation_p.L372V|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTTATGTGTGTTGCATGAGAA	0.428																																					p.L487V		.											.	ALB	96	0			c.T1459G						.						87.0	82.0	84.0					4																	74283835		2203	4300	6503	SO:0001583	missense	213	exon12			TGTGTGTTGCATG	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1009T>G	4.37:g.74283835T>G	ENSP00000421027:p.Leu337Val	Somatic	141.0	1.0		WXS	Illumina HiSeq	Phase_I	53.0	16.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.953|4.953	0.177026|0.177026	0.09443|0.09443	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202|ENST00000511370	T;T;T;T;T|T	0.71934|0.71817	-0.61;-0.61;-0.61;-0.61;-0.61|-0.6	5.79|5.79	-5.98|-5.98	0.02220|0.02220	Serum albumin-like (1);Serum albumin, N-terminal (3);|.	1.215720|.	0.06269|.	N|.	0.695355|.	T|T	0.64136|0.64136	0.2571|0.2571	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	P;B;B;B;B|.	0.52463|.	0.953;0.029;0.063;0.104;0.013|.	D;B;B;B;B|.	0.74348|.	0.983;0.06;0.088;0.05;0.025|.	T|T	0.61657|0.61657	-0.7018|-0.7018	10|7	0.87932|0.72032	D|D	0|0.01	-2.5016|-2.5016	3.7748|3.7748	0.08656|0.08656	0.3316:0.4905:0.0859:0.0919|0.3316:0.4905:0.0859:0.0919	.|.	372;295;337;487;487|.	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768|.	.;.;.;.;ALBU_HUMAN|.	V|G	487;295;274;337;487;372;496|331	ENSP00000295897:L487V;ENSP00000401820:L295V;ENSP00000421027:L337V;ENSP00000422784:L487V;ENSP00000384695:L372V|ENSP00000426179:V331G	ENSP00000295897:L487V|ENSP00000426179:V331G	L|V	+|+	1|2	2|0	ALB|ALB	74502699|74502699	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.113000|0.113000	0.19764|0.19764	-0.728000|-0.728000	0.04925|0.04925	-1.630000|-1.630000	0.01545|0.01545	-2.060000|-2.060000	0.00399|0.00399	TTG|GTT	.		0.428	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ALG12	79087	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	22	50303561	50303561	+	Silent	SNP	C	C	T	rs12167668	byFrequency	TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr22:50303561C>T	ENST00000330817.6	-	5	918	c.645G>A	c.(643-645)ccG>ccA	p.P215P		NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	215					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		GGATCCCTGCCGGGACGGCGT	0.527													T|||	25	0.00499201	0.0174	0.0029	5008	,	,		17390	0.0		0.0	False		,,,				2504	0.0				p.P215P		.											.	ALG12	90	0			c.G645A						.	T		91,4315	817.0+/-416.3	3,85,2115	68.0	69.0	69.0		645	-8.9	0.0	22	dbSNP_120	69	2,8598	818.5+/-406.9	0,2,4298	no	coding-synonymous	ALG12	NM_024105.3		3,87,6413	TT,TC,CC		0.0233,2.0654,0.7151		215/489	50303561	93,12913	2203	4300	6503	SO:0001819	synonymous_variant	79087	exon5			CCCTGCCGGGACG	AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.645G>A	22.37:g.50303561C>T		Somatic	263.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	9.0	NM_024105	A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Silent	SNP	ENST00000330817.6	37	CCDS14081.1																																																																																			C|0.993;T|0.007		0.527	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317405.2	NM_024105	
ANKRD17	26057	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74008379	74008379	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:74008379delG	ENST00000358602.4	-	12	2179	c.2063delC	c.(2062-2064)gcafs	p.A688fs	ANKRD17_ENST00000509867.2_Frame_Shift_Del_p.A575fs|ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000330838.6_Frame_Shift_Del_p.A688fs	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	688					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGTAGGATCTGCCCCATGAGC	0.413																																					p.A688fs		.											.	ANKRD17	234	0			c.2063delC						.						130.0	122.0	125.0					4																	74008379		2203	4300	6503	SO:0001589	frameshift_variant	26057	exon12			GGATCTGCCCCAT	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.2063delC	4.37:g.74008379delG	ENSP00000351416:p.Ala688fs	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	19.0	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Frame_Shift_Del	DEL	ENST00000358602.4	37	CCDS34004.1																																																																																			.		0.413	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
ANKRD17	26057	hgsc.bcm.edu;bcgsc.ca	37	4	74008384	74008384	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:74008384A>C	ENST00000358602.4	-	12	2174	c.2058T>G	c.(2056-2058)caT>caG	p.H686Q	ANKRD17_ENST00000509867.2_Missense_Mutation_p.H573Q|ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000330838.6_Missense_Mutation_p.H686Q	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	686					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GATCTGCCCCATGAGCCAAAA	0.428																																					p.H686Q		.											.	ANKRD17	234	0			c.T2058G						.						129.0	121.0	124.0					4																	74008384		2203	4300	6503	SO:0001583	missense	26057	exon12			TGCCCCATGAGCC	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.2058T>G	4.37:g.74008384A>C	ENSP00000351416:p.His686Gln	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	20.0	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.352546	0.61293	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.64803	-0.12;-0.12;-0.12	5.94	-0.537	0.11872	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000001	T	0.62877	0.2464	L	0.41824	1.3	0.27141	N	0.961652	D;B;P;P;P	0.65815	0.995;0.298;0.936;0.558;0.596	D;B;P;B;B	0.79784	0.993;0.234;0.698;0.444;0.316	T	0.58989	-0.7538	10	0.07325	T	0.83	.	11.5297	0.50601	0.6329:0.0:0.3671:0.0	.	207;686;686;686;573	B4DR08;O75179-2;G5E964;O75179;E7EUV3	.;.;.;ANR17_HUMAN;.	Q	686;686;686;573;686	ENSP00000351416:H686Q;ENSP00000332265:H686Q;ENSP00000427151:H573Q	ENSP00000332265:H686Q	H	-	3	2	ANKRD17	74227248	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	0.772000	0.26647	-0.064000	0.13043	-0.287000	0.09952	CAT	.		0.428	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
APPBP2	10513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	58571884	58571884	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:58571884T>C	ENST00000083182.3	-	3	609	c.322A>G	c.(322-324)Ata>Gta	p.I108V		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	108					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			GATTCTGCTATATAAGAGCAC	0.403																																					p.I108V		.											.	APPBP2	226	0			c.A322G						.						97.0	95.0	96.0					17																	58571884		2203	4300	6503	SO:0001583	missense	10513	exon3			CTGCTATATAAGA	AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.322A>G	17.37:g.58571884T>C	ENSP00000083182:p.Ile108Val	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	44.0	NM_006380	A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	ENST00000083182.3	37	CCDS32699.1	.	.	.	.	.	.	.	.	.	.	T	10.14	1.267404	0.23136	.	.	ENSG00000062725	ENST00000083182	D	0.81908	-1.55	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.78227	0.4250	L	0.36672	1.1	0.80722	D	1	B	0.22003	0.063	B	0.32090	0.14	T	0.72178	-0.4369	10	0.13853	T	0.58	0.0157	16.2762	0.82644	0.0:0.0:0.0:1.0	.	108	Q92624	APBP2_HUMAN	V	108	ENSP00000083182:I108V	ENSP00000083182:I108V	I	-	1	0	APPBP2	55926666	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	7.665000	0.83852	2.243000	0.73865	0.482000	0.46254	ATA	.		0.403	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449465.1	NM_006380	
ARHGEF10L	55160	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	17948399	17948422	+	In_Frame_Del	DEL	AAGGCAGCTACGTGGAGTCTCTGA	AAGGCAGCTACGTGGAGTCTCTGA	-	rs376652146|rs146595527		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	AAGGCAGCTACGTGGAGTCTCTGA	AAGGCAGCTACGTGGAGTCTCTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:17948399_17948422delAAGGCAGCTACGTGGAGTCTCTGA	ENST00000361221.3	+	11	1142_1165	c.983_1006delAAGGCAGCTACGTGGAGTCTCTGA	c.(982-1008)gaaggcagctacgtggagtctctgaag>gag	p.GSYVESLK329del	ARHGEF10L_ENST00000452522.1_In_Frame_Del_p.GSYVESLK290del|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000375420.3_In_Frame_Del_p.GSYVESLK87del|ARHGEF10L_ENST00000434513.1_In_Frame_Del_p.GSYVESLK329del|ARHGEF10L_ENST00000167825.4_In_Frame_Del_p.GSYVESLK107del|ARHGEF10L_ENST00000375415.1_In_Frame_Del_p.GSYVESLK290del|ARHGEF10L_ENST00000375408.3_In_Frame_Del_p.GSYVESLK107del	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	329	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V332L(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GTGCAGAGCGAAGGCAGCTACGTGGAGTCTCTGAAGCGGATACT	0.594																																					p.328_336del		.											.	ARHGEF10L	292	1	Substitution - Missense(1)	NS(1)	c.983_1006del						.																																			SO:0001651	inframe_deletion	55160	exon11			AGAGCGAAGGCAG	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.983_1006delAAGGCAGCTACGTGGAGTCTCTGA	1.37:g.17948399_17948422delAAGGCAGCTACGTGGAGTCTCTGA	ENSP00000355060:p.Gly329_Lys336del	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	11.0	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	In_Frame_Del	DEL	ENST00000361221.3	37	CCDS182.1																																																																																			.		0.594	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
ATAD2	29028	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	124408568	124408568	+	Silent	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr8:124408568C>T	ENST00000287394.5	-	1	137	c.30G>A	c.(28-30)ctG>ctA	p.L10L	ATAD2_ENST00000521903.1_Intron	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	10					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			AGTGGTTGTGCAGCTCCAAGC	0.682																																					p.L10L		.											.	ATAD2	92	0			c.G30A						.						21.0	28.0	26.0					8																	124408568		2203	4300	6503	SO:0001819	synonymous_variant	29028	exon1			GTTGTGCAGCTCC	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.30G>A	8.37:g.124408568C>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	5.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	ENST00000287394.5	37	CCDS6343.1																																																																																			.		0.682	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
ATP5A1	498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	43667458	43667458	+	Splice_Site	SNP	T	T	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr18:43667458T>A	ENST00000398752.6	-	7	921	c.800A>T	c.(799-801)gAt>gTt	p.D267V	ATP5A1_ENST00000282050.2_Splice_Site_p.D267V|ATP5A1_ENST00000590665.1_Splice_Site_p.D245V|ATP5A1_ENST00000593152.2_Splice_Site_p.D217V	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	267					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						CTTCATGGCATCTGAGAAAAT	0.383																																					p.D267V		.											.	ATP5A1	90	0			c.A800T						.						36.0	38.0	37.0					18																	43667458		2203	4300	6503	SO:0001630	splice_region_variant	498	exon7			ATGGCATCTGAGA	D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.800-1A>T	18.37:g.43667458T>A		Somatic	256.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	21.0	NM_004046	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	ENST00000398752.6	37	CCDS11927.1	.	.	.	.	.	.	.	.	.	.	T	19.11	3.764856	0.69878	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	D;D	0.82344	-1.6;-1.6	4.47	4.47	0.54385	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.91005	0.7171	M	0.91717	3.235	0.80722	D	1	P	0.40834	0.73	P	0.53722	0.733	D	0.92741	0.6208	10	0.87932	D	0	.	13.7747	0.63046	0.0:0.0:0.0:1.0	.	267	P25705	ATPA_HUMAN	V	267;267;217	ENSP00000282050:D267V;ENSP00000381736:D267V	ENSP00000282050:D267V	D	-	2	0	ATP5A1	41921456	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	7.953000	0.87836	1.655000	0.50712	0.460000	0.39030	GAT	.		0.383	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255884.1	NM_004046	Missense_Mutation
BCLAF1	9774	hgsc.bcm.edu;bcgsc.ca	37	6	136599396	136599396	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr6:136599396G>T	ENST00000531224.1	-	4	875	c.623C>A	c.(622-624)aCa>aAa	p.T208K	BCLAF1_ENST00000527759.1_Missense_Mutation_p.T206K|BCLAF1_ENST00000392348.2_Missense_Mutation_p.T206K|BCLAF1_ENST00000530767.1_Missense_Mutation_p.T208K|BCLAF1_ENST00000527536.1_Missense_Mutation_p.T208K|BCLAF1_ENST00000353331.4_Missense_Mutation_p.T206K	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	208					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		ATCACCGGATGTGGCTGATGA	0.423																																					p.T208K	Colon(142;1534 1789 5427 7063 28491)	.											.	BCLAF1	228	0			c.C623A						.						269.0	258.0	262.0					6																	136599396		2203	4300	6503	SO:0001583	missense	9774	exon4			CCGGATGTGGCTG	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.623C>A	6.37:g.136599396G>T	ENSP00000435210:p.Thr208Lys	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	10.0	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.	.	.	.	.	.	.	.	.	.	G	6.607	0.480474	0.12581	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.13657	2.99;2.99;2.99;2.57;2.99;2.99;2.8	5.97	5.97	0.96955	.	0.170223	0.41194	D	0.000925	T	0.03871	0.0109	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.21905	0.018;0.062;0.018;0.018	B;B;B;B	0.14023	0.01;0.01;0.01;0.01	T	0.37686	-0.9695	10	0.32370	T	0.25	-6.4124	13.6035	0.62033	0.0707:0.0:0.9293:0.0	.	206;206;208;208	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	K	208;206;208;208;206;206;208	ENSP00000435210:T208K;ENSP00000229446:T206K;ENSP00000435441:T208K;ENSP00000436501:T208K;ENSP00000434826:T206K;ENSP00000376159:T206K;ENSP00000431734:T208K	ENSP00000229446:T206K	T	-	2	0	BCLAF1	136641089	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.800000	0.55537	2.834000	0.97654	0.650000	0.86243	ACA	.		0.423	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
BLNK	29760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	97956734	97956734	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr10:97956734T>C	ENST00000224337.5	-	16	1322	c.1181A>G	c.(1180-1182)tAt>tGt	p.Y394C	BLNK_ENST00000413476.2_Intron|BLNK_ENST00000371176.2_Missense_Mutation_p.Y371C|BLNK_ENST00000427367.2_Intron	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	394	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		AGGAATATTATATACTCGCTT	0.318																																					p.Y394C		.											.	BLNK	92	0			c.A1181G						.						92.0	95.0	94.0					10																	97956734		2203	4299	6502	SO:0001583	missense	29760	exon16			ATATTATATACTC	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.1181A>G	10.37:g.97956734T>C	ENSP00000224337:p.Tyr394Cys	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	7.0	NM_013314	O75498|O75499|Q2MD49	Missense_Mutation	SNP	ENST00000224337.5	37	CCDS7446.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.0|20.0	3.929819|3.929819	0.73327|0.73327	.|.	.|.	ENSG00000095585|ENSG00000095585	ENST00000393889|ENST00000224337;ENST00000371176	.|D;D	.|0.88509	.|-2.39;-2.39	5.06|5.06	5.06|5.06	0.68205|0.68205	.|SH2 motif (4);	.|0.062767	.|0.64402	.|D	.|0.000003	D|D	0.94424|0.94424	0.8206|0.8206	M|M	0.83483|0.83483	2.645|2.645	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.95153|0.95153	0.8274|0.8274	6|10	0.26408|0.87932	T|D	0.33|0	-15.7777|-15.7777	14.0992|14.0992	0.65044|0.65044	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|371;371;394	.|Q8WV28-2;Q2MD52;Q8WV28	.|.;.;BLNK_HUMAN	V|C	120|394;371	.|ENSP00000224337:Y394C;ENSP00000360218:Y371C	ENSP00000377467:I120V|ENSP00000224337:Y394C	I|Y	-|-	1|2	0|0	BLNK|BLNK	97946724|97946724	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	6.911000|6.911000	0.75746|0.75746	2.021000|2.021000	0.59480|0.59480	0.533000|0.533000	0.62120|0.62120	ATA|TAT	.		0.318	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049593.1	NM_013314	
C1QTNF1	114897	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	77042704	77042704	+	Missense_Mutation	SNP	C	C	T	rs148895244		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:77042704C>T	ENST00000339142.2	+	4	778	c.223C>T	c.(223-225)Cgc>Tgc	p.R75C	C1QTNF1_ENST00000579760.1_Missense_Mutation_p.R75C|C1QTNF1_ENST00000578229.1_5'UTR|C1QTNF1_ENST00000580474.1_Missense_Mutation_p.R75C|C1QTNF1_ENST00000392445.2_Missense_Mutation_p.R75C|C1QTNF1_ENST00000311661.4_5'UTR|C1QTNF1_ENST00000354124.3_Missense_Mutation_p.R85C|C1QTNF1_ENST00000583904.1_Missense_Mutation_p.R75C|C1QTNF1_ENST00000581774.1_Missense_Mutation_p.R75C|C1QTNF1_ENST00000580454.1_Missense_Mutation_p.R75C	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	75					negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			CCGGTGCTTGCGCTGCTGTGA	0.557											OREG0024791	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R75C		.											.	C1QTNF1	91	0			c.C223T						.		CYS/ARG,CYS/ARG,	0,4406		0,0,2203	82.0	81.0	81.0		223,223,	4.2	0.9	17	dbSNP_134	81	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,utr-5	C1QTNF1	NM_030968.2,NM_198593.2,NM_198594.1	180,180,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,	75/282,75/282,	77042704	2,13004	2203	4300	6503	SO:0001583	missense	114897	exon3			TGCTTGCGCTGCT	AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.223C>T	17.37:g.77042704C>T	ENSP00000340864:p.Arg75Cys	Somatic	246.0	1.0	1172	WXS	Illumina HiSeq	Phase_I	126.0	29.0	NM_030968	Q6ZMH6|Q96NF2|Q9GZR4	Missense_Mutation	SNP	ENST00000339142.2	37	CCDS11761.1	.	.	.	.	.	.	.	.	.	.	c	16.49	3.138171	0.56936	0.0	2.33E-4	ENSG00000173918	ENST00000339142;ENST00000354124;ENST00000392444;ENST00000392445	T;T	0.80123	-1.3;-1.34	4.21	4.21	0.49690	.	0.091882	0.45126	D	0.000386	D	0.83986	0.5373	L	0.34521	1.04	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.985;0.972;0.972	D	0.86223	0.1632	10	0.87932	D	0	.	15.2695	0.73689	0.0:1.0:0.0:0.0	.	85;85;75	A8K7L9;Q6ZMH6;Q9BXJ1	.;.;C1QT1_HUMAN	C	75;85;75;85	ENSP00000340864:R75C;ENSP00000343230:R85C	ENSP00000340864:R75C	R	+	1	0	C1QTNF1	74554299	0.998000	0.40836	0.903000	0.35520	0.063000	0.16089	4.086000	0.57664	2.312000	0.78011	0.556000	0.70494	CGC	C|1.000;T|0.000		0.557	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437388.2	NM_030968	
CACNA1E	777	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	181700363	181700363	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:181700363C>A	ENST00000367573.2	+	19	2293	c.2293C>A	c.(2293-2295)Cac>Aac	p.H765N	CACNA1E_ENST00000367570.1_Missense_Mutation_p.H765N|CACNA1E_ENST00000357570.5_Missense_Mutation_p.H716N|CACNA1E_ENST00000358338.5_Intron|CACNA1E_ENST00000367567.4_Missense_Mutation_p.H372N|CACNA1E_ENST00000360108.3_Intron|CACNA1E_ENST00000526775.1_Intron	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	765					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACGCAGCAGCCACCTGTATGT	0.517																																					p.H765N		.											.	CACNA1E	95	0			c.C2293A						.						171.0	191.0	184.0					1																	181700363		2179	4257	6436	SO:0001583	missense	777	exon19			AGCAGCCACCTGT	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2293C>A	1.37:g.181700363C>A	ENSP00000356545:p.His765Asn	Somatic	260.0	2.0		WXS	Illumina HiSeq	Phase_I	123.0	34.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.868737	0.32977	.	.	ENSG00000198216	ENST00000367570;ENST00000357570;ENST00000367567;ENST00000367573	D;D;D;D	0.96073	-3.82;-3.81;-3.9;-3.82	5.23	5.23	0.72850	.	7.143020	0.00166	N	0.000003	D	0.90611	0.7056	N	0.08118	0	0.49213	D	0.999762	B	0.02656	0.0	B	0.04013	0.001	T	0.61212	-0.7108	10	0.13108	T	0.6	.	14.1852	0.65601	0.1503:0.8497:0.0:0.0	.	765	Q15878-3	.	N	765;716;372;765	ENSP00000356542:H765N;ENSP00000350183:H716N;ENSP00000356539:H372N;ENSP00000356545:H765N	ENSP00000350183:H716N	H	+	1	0	CACNA1E	179966986	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.693000	0.47027	2.417000	0.82017	0.650000	0.86243	CAC	.		0.517	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CCDC129	223075	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	31682701	31682701	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:31682701G>A	ENST00000407970.3	+	11	1755	c.1717G>A	c.(1717-1719)Gtc>Atc	p.V573I	CCDC129_ENST00000451887.2_Missense_Mutation_p.V599I|CCDC129_ENST00000409210.1_Missense_Mutation_p.V481I|CCDC129_ENST00000319386.3_Missense_Mutation_p.V425I	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	573										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						GGTAACCCACGTCACAGAAAT	0.502																																					p.V599I		.											.	.	.	0			c.G1795A						.						178.0	176.0	176.0					7																	31682701		2203	4300	6503	SO:0001583	missense	223075	exon11			ACCCACGTCACAG	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1717G>A	7.37:g.31682701G>A	ENSP00000384416:p.Val573Ile	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	30.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	37	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	G	0.442	-0.898031	0.02472	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.18502	2.21;2.48;2.47;2.22	5.6	-2.59	0.06209	.	1.100120	0.06868	N	0.800402	T	0.03095	0.0091	N	0.00621	-1.32	0.09310	N	1	B;B;B;B	0.09022	0.002;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.001;0.001;0.001	T	0.40553	-0.9557	10	0.05721	T	0.95	-20.0766	1.6112	0.02694	0.4822:0.1344:0.2529:0.1305	.	599;583;573;425	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	I	425;573;599;583;481	ENSP00000313062:V425I;ENSP00000384416:V573I;ENSP00000395835:V599I;ENSP00000387214:V481I	ENSP00000313062:V425I	V	+	1	0	CCDC129	31649226	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.044000	0.12023	-0.065000	0.13021	-1.160000	0.01791	GTC	.		0.502	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
CCDC138	165055	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	109405347	109405347	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:109405347C>A	ENST00000295124.4	+	3	251	c.191C>A	c.(190-192)tCg>tAg	p.S64*	CCDC138_ENST00000412964.2_Nonsense_Mutation_p.S64*|CCDC138_ENST00000470608.1_3'UTR	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	64										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						GTTGGTTCATCGTTAAAATAT	0.358																																					p.S64X		.											.	CCDC138	90	0			c.C191A						.						169.0	163.0	165.0					2																	109405347		2203	4300	6503	SO:0001587	stop_gained	165055	exon3			GTTCATCGTTAAA	AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.191C>A	2.37:g.109405347C>A	ENSP00000295124:p.Ser64*	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	14.0	NM_144978	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Nonsense_Mutation	SNP	ENST00000295124.4	37	CCDS2080.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.203203	0.38905	.	.	ENSG00000163006	ENST00000412964;ENST00000295124	.	.	.	4.03	2.23	0.28157	.	0.352458	0.20938	N	0.082970	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5115	6.3944	0.21605	0.0:0.7792:0.0:0.2208	.	.	.	.	X	64	.	ENSP00000295124:S64X	S	+	2	0	CCDC138	108771779	0.002000	0.14202	0.008000	0.14137	0.385000	0.30292	0.700000	0.25601	0.662000	0.31006	0.650000	0.86243	TCG	.		0.358	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253593.1	NM_144978	
Unknown	0	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	13	103392315	103392315	+	IGR	SNP	A	A	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr13:103392315A>T								CCDC168 (3156 upstream) : LINC00283 (3024 downstream)																							GATTTCTTCCATTTCGAAGTT	0.393																																					p.W3578R		.											.	.	.	0			c.T10732A						.						174.0	129.0	143.0					13																	103392315		692	1590	2282	SO:0001628	intergenic_variant	643677	exon4			TCTTCCATTTCGA																													13.37:g.103392315A>T		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	43.0	NM_001146197		Missense_Mutation	SNP		37																																																																																				.	0	0.393								
CD163	9332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7640068	7640068	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr12:7640068C>A	ENST00000359156.4	-	8	2139	c.1937G>T	c.(1936-1938)tGg>tTg	p.W646L	CD163_ENST00000539632.1_5'Flank|CD163_ENST00000432237.2_Missense_Mutation_p.W646L|CD163_ENST00000541972.1_Missense_Mutation_p.W634L|CD163_ENST00000396620.3_Missense_Mutation_p.W679L	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	646	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CATATGCCTCCAGATCTGACC	0.488																																					p.W646L		.											.	CD163	98	0			c.G1937T						.						151.0	135.0	141.0					12																	7640068		2203	4300	6503	SO:0001583	missense	9332	exon8			TGCCTCCAGATCT	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1937G>T	12.37:g.7640068C>A	ENSP00000352071:p.Trp646Leu	Somatic	334.0	1.0		WXS	Illumina HiSeq	Phase_I	149.0	58.0	NM_203416	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	ENST00000359156.4	37	CCDS8578.1	.	.	.	.	.	.	.	.	.	.	C	9.469	1.095028	0.20471	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.14	5.14	0.70334	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.177698	0.41712	N	0.000829	T	0.49236	0.1545	L	0.51422	1.61	0.47511	D	0.999446	D;D;D	0.89917	1.0;0.997;1.0	D;P;D	0.97110	1.0;0.844;1.0	T	0.26780	-1.0093	10	0.29301	T	0.29	.	16.4748	0.84129	0.0:1.0:0.0:0.0	.	679;646;646	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	L	646;634;679;646	ENSP00000352071:W646L;ENSP00000444071:W634L;ENSP00000379863:W679L;ENSP00000403885:W646L	ENSP00000352071:W646L	W	-	2	0	CD163	7531335	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	2.164000	0.42387	2.561000	0.86390	0.655000	0.94253	TGG	.		0.488	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
CHRM3	1131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	240072344	240072344	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:240072344G>C	ENST00000255380.4	+	5	2372	c.1593G>C	c.(1591-1593)tgG>tgC	p.W531C		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	531					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)	p.W531S(2)		breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TGGGCTACTGGCTGTGCTACA	0.483																																					p.W531C		.											.	CHRM3	95	2	Substitution - Missense(2)	lung(2)	c.G1593C						.						118.0	99.0	106.0					1																	240072344		2203	4300	6503	SO:0001583	missense	1131	exon5			CTACTGGCTGTGC	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1593G>C	1.37:g.240072344G>C	ENSP00000255380:p.Trp531Cys	Somatic	367.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	32.0	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529016	0.64860	.	.	ENSG00000133019	ENST00000255380	T	0.73789	-0.78	5.73	5.73	0.89815	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88477	0.6447	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89429	0.3715	10	0.87932	D	0	-8.1526	19.8984	0.96975	0.0:0.0:1.0:0.0	.	531	P20309	ACM3_HUMAN	C	531	ENSP00000255380:W531C	ENSP00000255380:W531C	W	+	3	0	CHRM3	238138967	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.713000	0.92767	0.655000	0.94253	TGG	.		0.483	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
CLIP4	79745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	29366660	29366660	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:29366660A>G	ENST00000320081.5	+	7	989	c.734A>G	c.(733-735)aAg>aGg	p.K245R	CLIP4_ENST00000401605.1_Missense_Mutation_p.K245R|CLIP4_ENST00000404424.1_Missense_Mutation_p.K245R|CLIP4_ENST00000401617.2_Missense_Mutation_p.K138R	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	245										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					GCCACTGCTAAGGAAATCAAG	0.463																																					p.K245R		.											.	CLIP4	91	0			c.A734G						.						138.0	128.0	131.0					2																	29366660		2203	4300	6503	SO:0001583	missense	79745	exon7			CTGCTAAGGAAAT	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.734A>G	2.37:g.29366660A>G	ENSP00000327009:p.Lys245Arg	Somatic	371.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	41.0	NM_024692	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Missense_Mutation	SNP	ENST00000320081.5	37	CCDS1770.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.182137	0.57800	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	T;T;T;T	0.76968	-1.06;-0.78;-0.73;-0.73	5.64	5.64	0.86602	.	0.103874	0.64402	D	0.000005	D	0.87509	0.6195	M	0.74258	2.255	0.45295	D	0.998295	D;D	0.71674	0.998;0.998	D;D	0.77557	0.989;0.99	D	0.88258	0.2921	10	0.54805	T	0.06	.	15.8444	0.78876	1.0:0.0:0.0:0.0	.	245;245	A8K6D0;Q8N3C7	.;CLIP4_HUMAN	R	245;138;245;245;245;246;227	ENSP00000384242:K245R;ENSP00000385148:K138R;ENSP00000385594:K245R;ENSP00000327009:K245R	ENSP00000327009:K245R	K	+	2	0	CLIP4	29220164	1.000000	0.71417	0.375000	0.26029	0.163000	0.22366	6.297000	0.72757	2.144000	0.66660	0.528000	0.53228	AAG	.		0.463	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
CPE	1363	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	166388853	166388853	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:166388853A>G	ENST00000402744.4	+	3	798	c.518A>G	c.(517-519)aAg>aGg	p.K173R		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	173					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGTGAACTCAAGGACTGGTTT	0.388																																					p.K173R		.											.	CPE	155	0			c.A518G						.						59.0	57.0	58.0					4																	166388853		2203	4300	6503	SO:0001583	missense	1363	exon3			AACTCAAGGACTG	X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.518A>G	4.37:g.166388853A>G	ENSP00000386104:p.Lys173Arg	Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	40.0	11.0	NM_001873	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Missense_Mutation	SNP	ENST00000402744.4	37	CCDS3810.1	.	.	.	.	.	.	.	.	.	.	A	12.43	1.936281	0.34189	.	.	ENSG00000109472	ENST00000513982;ENST00000402744;ENST00000261510;ENST00000431967;ENST00000511992	T;T;T;T	0.02032	4.49;4.49;4.49;4.49	5.34	5.34	0.76211	Peptidase M14, carboxypeptidase A (1);	0.047224	0.85682	D	0.000000	T	0.01765	0.0056	N	0.05351	-0.065	0.80722	D	1	B	0.23128	0.08	B	0.27887	0.084	T	0.61806	-0.6987	10	0.15066	T	0.55	-8.8429	15.3065	0.73995	1.0:0.0:0.0:0.0	.	173	P16870	CBPE_HUMAN	R	61;173;137;61;61	ENSP00000424830:K61R;ENSP00000386104:K173R;ENSP00000416601:K61R;ENSP00000423699:K61R	ENSP00000261510:K137R	K	+	2	0	CPE	166608303	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.822000	0.75277	2.016000	0.59253	0.528000	0.53228	AAG	.		0.388	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	NM_001873	
CR1L	1379	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	207872610	207872619	+	Splice_Site	DEL	GTGTGTGAAC	GTGTGTGAAC	-			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	GTGTGTGAAC	GTGTGTGAAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:207872610_207872619delGTGTGTGAAC	ENST00000508064.2	+	8	1279_1288	c.1219_1228delGTGTGTGAAC	c.(1219-1230)gtgtgtgaacgt>gt	p.VCER407fs	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	407	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CAGTGTTCCAGTGTGTGAACGTAAGTAATA	0.395																																					p.407_410del		.											.	CR1L	46	0			c.1219_1228del						.																																			SO:0001630	splice_region_variant	1379	exon8			GTTCCAGTGTGTG	AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1228+1GTGTGTGAAC>-	1.37:g.207872610_207872619delGTGTGTGAAC		Somatic	402.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	12.0	NM_175710	Q32MC9|Q8NEU7	Frame_Shift_Del	DEL	ENST00000508064.2	37	CCDS44310.1																																																																																			.		0.395	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390247.1	XM_114735	Frame_Shift_Del
CREBRF	153222	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	172517412	172517412	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr5:172517412T>G	ENST00000296953.2	+	4	549	c.230T>G	c.(229-231)gTc>gGc	p.V77G	CREBRF_ENST00000520420.1_Missense_Mutation_p.V77G|CREBRF_ENST00000522692.1_Missense_Mutation_p.V77G|CREBRF_ENST00000540014.1_Missense_Mutation_p.V77G	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	77					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTCACAGATGTCCTGGATAAT	0.418																																					p.V77G		.											.	.	.	0			c.T230G						.						92.0	89.0	90.0					5																	172517412		2203	4300	6503	SO:0001583	missense	153222	exon4			CAGATGTCCTGGA	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.230T>G	5.37:g.172517412T>G	ENSP00000296953:p.Val77Gly	Somatic	407.0	2.0		WXS	Illumina HiSeq	Phase_I	163.0	58.0	NM_153607	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	ENST00000296953.2	37	CCDS34293.1	.	.	.	.	.	.	.	.	.	.	T	17.46	3.395286	0.62066	.	.	ENSG00000164463	ENST00000522692;ENST00000296953;ENST00000540014;ENST00000520420;ENST00000538538;ENST00000393776	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.78	5.78	0.91487	.	0.189960	0.47455	D	0.000237	T	0.64294	0.2585	N	0.14661	0.345	0.58432	D	0.999999	P;P	0.45176	0.514;0.852	B;P	0.47705	0.267;0.555	T	0.70579	-0.4833	10	0.72032	D	0.01	.	16.3979	0.83621	0.0:0.0:0.0:1.0	.	77;77	Q8IUR6;Q8IUR6-2	CE041_HUMAN;.	G	77	ENSP00000431107:V77G;ENSP00000296953:V77G;ENSP00000440075:V77G;ENSP00000428290:V77G	ENSP00000296953:V77G	V	+	2	0	C5orf41	172450018	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.156000	0.77453	2.333000	0.79357	0.533000	0.62120	GTC	.		0.418	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372667.1	NM_153607	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41268760	41268760	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr3:41268760A>T	ENST00000349496.5	+	7	1278	c.998A>T	c.(997-999)tAc>tTc	p.Y333F	CTNNB1_ENST00000396183.3_Missense_Mutation_p.Y333F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.Y333F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.Y326F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.Y333F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	333					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACCTATACTTACGAAAAACTA	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.Y333F	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	24361	0			c.A998T						.						107.0	106.0	106.0					3																	41268760		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ATACTTACGAAAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.998A>T	3.37:g.41268760A>T	ENSP00000344456:p.Tyr333Phe	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	14.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.956688	0.92726	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81522	0.4840	M	0.89478	3.035	0.80722	D	1	D;D	0.63046	0.97;0.992	P;D	0.66716	0.903;0.946	D	0.84926	0.0857	10	0.59425	D	0.04	-21.1058	15.5934	0.76558	1.0:0.0:0.0:0.0	.	261;333	B4DSW9;P35222	.;CTNB1_HUMAN	F	333;333;333;326;333	ENSP00000385604:Y333F;ENSP00000379486:Y333F;ENSP00000344456:Y333F;ENSP00000411226:Y326F;ENSP00000379488:Y333F	ENSP00000344456:Y333F	Y	+	2	0	CTNNB1	41243764	1.000000	0.71417	0.957000	0.39632	0.948000	0.59901	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	TAC	.		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DAB2IP	153090	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	124535286	124535286	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr9:124535286T>G	ENST00000408936.3	+	12	2661	c.2479T>G	c.(2479-2481)Tcc>Gcc	p.S827A	DAB2IP_ENST00000309989.1_Missense_Mutation_p.S703A|DAB2IP_ENST00000259371.2_Missense_Mutation_p.S799A			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	827	Necessary for interaction with AKT1.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						GGCACCGCTCTCCTTCCAGAA	0.706																																					p.S799A		.											.	DAB2IP	91	0			c.T2395G						.						29.0	29.0	29.0					9																	124535286		2159	4216	6375	SO:0001583	missense	153090	exon12			CCGCTCTCCTTCC	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.2479T>G	9.37:g.124535286T>G	ENSP00000386183:p.Ser827Ala	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	11.0	NM_032552	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	ENST00000408936.3	37		.	.	.	.	.	.	.	.	.	.	T	22.4	4.288620	0.80914	.	.	ENSG00000136848	ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	M	0.81942	2.565	0.53688	D	0.999972	D;D	0.89917	0.979;1.0	D;D	0.91635	0.982;0.999	T	0.63862	-0.6541	10	0.87932	D	0	.	13.6154	0.62105	0.0:0.0:0.0:1.0	.	827;799	Q5VWQ8;G3XA90	DAB2P_HUMAN;.	A	799;827;736;703	ENSP00000259371:S799A;ENSP00000386183:S827A;ENSP00000362887:S736A;ENSP00000310827:S703A	ENSP00000259371:S799A	S	+	1	0	DAB2IP	123575107	1.000000	0.71417	0.993000	0.49108	0.957000	0.61999	5.825000	0.69286	1.878000	0.54408	0.379000	0.24179	TCC	.		0.706	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
DCC	1630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	50450198	50450198	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr18:50450198G>T	ENST00000442544.2	+	4	1435	c.819G>T	c.(817-819)tgG>tgT	p.W273C	DCC_ENST00000412726.1_Missense_Mutation_p.W121C	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	273	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GTTTTACCTGGTTACGAGGCG	0.378																																					p.W273C		.											.	DCC	225	0			c.G819T						.						135.0	111.0	119.0					18																	50450198		2203	4300	6503	SO:0001583	missense	1630	exon4			TACCTGGTTACGA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.819G>T	18.37:g.50450198G>T	ENSP00000389140:p.Trp273Cys	Somatic	264.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	36.0	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	37	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891849	0.33442	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	D;D	0.96300	-3.97;-3.97	5.74	5.74	0.90152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.155107	0.46442	D	0.000293	D	0.99029	0.9668	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99180	1.0867	10	0.87932	D	0	.	18.7545	0.91827	0.0:0.0:1.0:0.0	.	121;273	E7EQM8;P43146	.;DCC_HUMAN	C	273;206;121	ENSP00000389140:W273C;ENSP00000397322:W121C	ENSP00000304146:W206C	W	+	3	0	DCC	48704196	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.887000	0.75616	2.728000	0.93425	0.650000	0.86243	TGG	.		0.378	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
DDAH2	23564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31695402	31695402	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr6:31695402C>G	ENST00000375789.2	-	5	1289	c.659G>C	c.(658-660)tGt>tCt	p.C220S	DDAH2_ENST00000480913.1_5'UTR|DDAH2_ENST00000375787.2_Missense_Mutation_p.C220S|DDAH2_ENST00000375792.3_Missense_Mutation_p.C220S			O95865	DDAH2_HUMAN	dimethylarginine dimethylaminohydrolase 2	220					arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|negative regulation of apoptotic process (GO:0043066)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of nitric oxide biosynthetic process (GO:0045429)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)			endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	11					L-Citrulline(DB00155)	AAGAAAGAGACAGTCAGCAGC	0.582																																					p.C220S		.											.	DDAH2	90	0			c.G659C						.						185.0	159.0	168.0					6																	31695402		1511	2709	4220	SO:0001583	missense	23564	exon6			AAGAGACAGTCAG	AF070667	CCDS4718.1	6p21	2010-02-17			ENSG00000213722	ENSG00000213722	3.5.3.18		2716	protein-coding gene	gene with protein product		604744				10493931	Standard	XM_005248974		Approved		uc003nwq.3	O95865	OTTHUMG00000031212	ENST00000375789.2:c.659G>C	6.37:g.31695402C>G	ENSP00000364945:p.Cys220Ser	Somatic	253.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	21.0	NM_013974	A2BEZ7	Missense_Mutation	SNP	ENST00000375789.2	37	CCDS4718.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.773911	0.90108	.	.	ENSG00000213722	ENST00000437288;ENST00000375789;ENST00000375787;ENST00000375792;ENST00000416410;ENST00000436437	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.72977	0.3528	M	0.67625	2.065	0.58432	D	0.999996	D	0.65815	0.995	D	0.91635	0.999	T	0.74999	-0.3472	9	0.62326	D	0.03	-14.2334	15.8242	0.78686	0.0:1.0:0.0:0.0	.	220	O95865	DDAH2_HUMAN	S	109;220;220;220;220;220	.	ENSP00000364943:C220S	C	-	2	0	DDAH2	31803381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.424000	0.66464	2.586000	0.87340	0.655000	0.94253	TGT	.		0.582	DDAH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076432.2		
DLG5	9231	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	79577541	79577541	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr10:79577541G>C	ENST00000372391.2	-	18	3783	c.3778C>G	c.(3778-3780)Cgc>Ggc	p.R1260G	DLG5_ENST00000372388.2_Missense_Mutation_p.R920G|DLG5_ENST00000459739.1_5'UTR	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1260					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TTACCCAGGCGGGCGCTGGAG	0.617																																					p.R1260G		.											.	DLG5	98	0			c.C3778G						.						55.0	40.0	45.0					10																	79577541		2170	4243	6413	SO:0001583	missense	9231	exon18			CCAGGCGGGCGCT	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3778C>G	10.37:g.79577541G>C	ENSP00000361467:p.Arg1260Gly	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	29.0	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273675	0.40194	.	.	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.06687	3.27;3.32;3.49	5.8	3.86	0.44501	.	0.000000	0.39615	N	0.001314	T	0.15609	0.0376	L	0.46157	1.445	0.80722	D	1	D;D;B	0.76494	0.998;0.999;0.35	P;D;B	0.65233	0.899;0.933;0.203	T	0.12477	-1.0546	10	0.14656	T	0.56	.	9.247	0.37532	0.0775:0.0:0.7119:0.2107	.	1150;1260;920	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	G	1260;221;920	ENSP00000361467:R1260G;ENSP00000394797:R221G;ENSP00000361464:R920G	ENSP00000361464:R920G	R	-	1	0	DLG5	79247547	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	3.546000	0.53656	1.459000	0.47892	0.655000	0.94253	CGC	.		0.617	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
DNAH3	55567	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	21049196	21049196	+	Missense_Mutation	SNP	C	C	A	rs141984585	byFrequency	TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr16:21049196C>A	ENST00000261383.3	-	34	4836	c.4837G>T	c.(4837-4839)Gca>Tca	p.A1613S	DNAH3_ENST00000415178.1_Missense_Mutation_p.A1613S	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1613					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AGGTTTCCTGCGGCAGTAAGC	0.522													C|||	5	0.000998403	0.0	0.0	5008	,	,		22117	0.005		0.0	False		,,,				2504	0.0				p.A1613S		.											.	DNAH3	167	0			c.G4837T						.						127.0	101.0	110.0					16																	21049196		2201	4300	6501	SO:0001583	missense	55567	exon34			TTCCTGCGGCAGT	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4837G>T	16.37:g.21049196C>A	ENSP00000261383:p.Ala1613Ser	Somatic	443.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	65.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	35	5.505111	0.96371	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.49720	0.77;0.77	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.68622	0.3021	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76035	-0.3106	10	0.66056	D	0.02	.	19.9616	0.97254	0.0:1.0:0.0:0.0	.	1613	Q8TD57	DYH3_HUMAN	S	1613	ENSP00000261383:A1613S;ENSP00000394245:A1613S	ENSP00000261383:A1613S	A	-	1	0	DNAH3	20956697	1.000000	0.71417	0.989000	0.46669	0.989000	0.77384	7.764000	0.85297	2.724000	0.93272	0.561000	0.74099	GCA	C|0.998;A|0.002		0.522	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
DNAH9	1770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11573031	11573031	+	Silent	SNP	C	C	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:11573031C>G	ENST00000262442.4	+	17	3341	c.3273C>G	c.(3271-3273)ccC>ccG	p.P1091P	DNAH9_ENST00000454412.2_Silent_p.P1091P	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1091	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ATATTCGACCCTTTAAGGCAT	0.443																																					p.P1091P		.											.	DNAH9	168	0			c.C3273G						.						132.0	136.0	135.0					17																	11573031		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon17			TCGACCCTTTAAG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3273C>G	17.37:g.11573031C>G		Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	20.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																			.		0.443	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	116497381	116497381	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:116497381T>C	ENST00000410059.1	+	9	1244	c.764T>C	c.(763-765)aTg>aCg	p.M255T	DPP10_ENST00000409163.1_Missense_Mutation_p.M205T|DPP10_ENST00000393147.2_Missense_Mutation_p.M259T|DPP10_ENST00000310323.8_Missense_Mutation_p.M248T	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	255						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GCCTTCCTGATGATAAATGAC	0.448																																					p.M259T		.											.	DPP10	142	0			c.T776C						.						222.0	189.0	200.0					2																	116497381		2203	4299	6502	SO:0001583	missense	57628	exon9			TCCTGATGATAAA	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.764T>C	2.37:g.116497381T>C	ENSP00000386565:p.Met255Thr	Somatic	414.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	52.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	T	1.242	-0.621064	0.03636	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	4.95	4.95	0.65309	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.215284	0.50627	D	0.000117	T	0.06280	0.0162	N	0.00242	-1.785	0.39244	D	0.963915	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.002;0.002;0.002	T	0.32587	-0.9901	10	0.02654	T	1	-33.0772	8.5707	0.33567	0.0:0.0948:0.0:0.9052	.	248;259;251;255	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	T	255;205;251;259;248;205	ENSP00000386565:M255T;ENSP00000387038:M205T;ENSP00000376854:M251T;ENSP00000376855:M259T;ENSP00000309066:M248T	ENSP00000309066:M248T	M	+	2	0	DPP10	116213851	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.702000	0.47102	2.210000	0.71456	0.460000	0.39030	ATG	.		0.448	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
ECE2	9718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183995039	183995039	+	Splice_Site	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr3:183995039A>G	ENST00000402825.3	+	4	617	c.617A>G	c.(616-618)gAc>gGc	p.D206G	ECE2_ENST00000404464.3_Splice_Site_p.D88G|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000357474.5_Splice_Site_p.D134G|ECE2_ENST00000359140.4_Splice_Site_p.D59G	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	206	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCTACCACAGACCCATCCCAC	0.572																																					p.D206G		.											.	ECE2	94	0			c.A617G						.						67.0	65.0	66.0					3																	183995039		2203	4300	6503	SO:0001630	splice_region_variant	9718	exon4			CCACAGACCCATC	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.617-1A>G	3.37:g.183995039A>G		Somatic	269.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	20.0	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	A	14.47	2.544811	0.45280	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;D;D;D;T	0.82803	-1.44;-1.64;-1.65;-1.65;-1.37	5.91	2.11	0.27256	.	0.392722	0.28958	N	0.013600	T	0.72598	0.3480	L	0.46157	1.445	0.54753	D	0.999985	B;B;B;B;B;B	0.11235	0.0;0.004;0.0;0.001;0.0;0.0	B;B;B;B;B;B	0.12837	0.003;0.008;0.001;0.008;0.0;0.002	T	0.62886	-0.6759	10	0.23891	T	0.37	.	6.0857	0.19966	0.7331:0.0:0.1432:0.1237	.	59;134;88;134;59;206	B4DKF3;B7Z1P1;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;ECE2_HUMAN	G	206;59;88;134;80	ENSP00000384223:D206G;ENSP00000352052:D59G;ENSP00000385846:D88G;ENSP00000350066:D134G;ENSP00000398444:D80G	ENSP00000350066:D134G	D	+	2	0	ECE2	185477733	0.617000	0.27043	1.000000	0.80357	0.993000	0.82548	0.818000	0.27295	1.073000	0.40885	0.533000	0.62120	GAC	.		0.572	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	Missense_Mutation
ELMO1	9844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	36895340	36895340	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:36895340T>C	ENST00000310758.4	-	22	2647	c.2000A>G	c.(1999-2001)gAt>gGt	p.D667G	ELMO1_ENST00000442504.1_Missense_Mutation_p.D667G|ELMO1_ENST00000396045.3_Missense_Mutation_p.D187G|ELMO1_ENST00000448602.1_Missense_Mutation_p.D667G|ELMO1_ENST00000396040.2_Missense_Mutation_p.D187G|ELMO1_ENST00000341056.3_Missense_Mutation_p.D369G	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	667	PH.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						ATTCAGTCCATCCGTCCAGAT	0.498																																					p.D667G		.											.	ELMO1	96	0			c.A2000G						.						145.0	120.0	128.0					7																	36895340		2203	4300	6503	SO:0001583	missense	9844	exon22			AGTCCATCCGTCC	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.2000A>G	7.37:g.36895340T>C	ENSP00000312185:p.Asp667Gly	Somatic	312.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	38.0	NM_014800	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	ENST00000310758.4	37	CCDS5449.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.951224	0.73787	.	.	ENSG00000155849	ENST00000341056;ENST00000396045;ENST00000310758;ENST00000361912;ENST00000396040;ENST00000442504;ENST00000448602	T;T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52;0.52	4.88	4.88	0.63580	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.059525	0.64402	D	0.000004	T	0.77177	0.4092	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82818	-0.0269	10	0.87932	D	0	.	14.9719	0.71241	0.0:0.0:0.0:1.0	.	667	Q92556	ELMO1_HUMAN	G	369;187;667;571;187;667;667	ENSP00000342142:D369G;ENSP00000379360:D187G;ENSP00000312185:D667G;ENSP00000379355:D187G;ENSP00000406952:D667G;ENSP00000394458:D667G	ENSP00000312185:D667G	D	-	2	0	ELMO1	36861865	1.000000	0.71417	0.875000	0.34327	0.586000	0.36452	7.868000	0.87116	2.180000	0.69256	0.528000	0.53228	GAT	.		0.498	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219830.4	NM_130442	
ELTD1	64123	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	79403627	79403627	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:79403627C>T	ENST00000370742.3	-	6	688	c.625G>A	c.(625-627)Gtt>Att	p.V209I		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	209					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TTGTCCCAAACTACAAATGTA	0.333																																					p.V209I		.											.	ELTD1	24	0			c.G625A						.						147.0	134.0	138.0					1																	79403627		1840	4092	5932	SO:0001583	missense	64123	exon6			CCCAAACTACAAA	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.625G>A	1.37:g.79403627C>T	ENSP00000359778:p.Val209Ile	Somatic	153.0	1.0		WXS	Illumina HiSeq	Phase_I	80.0	33.0	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	C	9.180	1.023417	0.19433	.	.	ENSG00000162618	ENST00000370742	T	0.09723	2.95	5.57	2.5	0.30297	Domain of unknown function DUF3497 (1);	0.445151	0.26234	N	0.025559	T	0.01835	0.0058	N	0.17474	0.49	0.20764	N	0.999856	B	0.06786	0.001	B	0.08055	0.003	T	0.46898	-0.9158	9	.	.	.	.	9.3744	0.38275	0.0:0.6648:0.0:0.3352	.	209	Q9HBW9	ELTD1_HUMAN	I	209	ENSP00000359778:V209I	.	V	-	1	0	ELTD1	79176215	0.221000	0.23642	0.937000	0.37676	0.859000	0.49053	0.695000	0.25527	1.211000	0.43351	0.557000	0.71058	GTT	.		0.333	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
EMX1	2016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	73160942	73160942	+	Silent	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:73160942G>A	ENST00000258106.6	+	3	1110	c.732G>A	c.(730-732)agG>agA	p.R244R	EMX1_ENST00000394111.5_3'UTR	NM_004097.2	NP_004088.2	Q04741	EMX1_HUMAN	empty spiracles homeobox 1	211					brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|in utero embryonic development (GO:0001701)|neuron projection extension (GO:1990138)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(3)	6						AGAACCGGAGGACAAAGTACA	0.607																																					p.R244R		.											.	EMX1	90	0			c.G732A						.						61.0	69.0	66.0					2																	73160942		2062	4211	6273	SO:0001819	synonymous_variant	2016	exon3			CCGGAGGACAAAG	X68879	CCDS1921.2	2p13.2	2011-06-20	2007-02-15		ENSG00000135638	ENSG00000135638		"""Homeoboxes / ANTP class : NKL subclass"""	3340	protein-coding gene	gene with protein product		600034	"""empty spiracles homolog 1 (Drosophila)"""			7959790	Standard	XM_005264203		Approved		uc002sin.1	Q04741	OTTHUMG00000129778	ENST00000258106.6:c.732G>A	2.37:g.73160942G>A		Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	17.0	NM_004097	Q0D2P0|Q53T30|Q86XB0	Silent	SNP	ENST00000258106.6	37	CCDS1921.2	.	.	.	.	.	.	.	.	.	.	G	13.97	2.395636	0.42512	.	.	ENSG00000135638	ENST00000394111	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	T	0.76463	0.3991	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79754	-0.1670	5	0.87932	D	0	-29.4034	16.7711	0.85537	0.0:0.0:1.0:0.0	.	.	.	.	N	197	.	ENSP00000377670:D197N	D	+	1	0	EMX1	73014450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.808000	0.86044	2.635000	0.89317	0.484000	0.47621	GAC	.		0.607	EMX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251994.3		
EPHB1	2047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	134920510	134920510	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr3:134920510T>G	ENST00000398015.3	+	12	2695	c.2325T>G	c.(2323-2325)gaT>gaG	p.D775E	EPHB1_ENST00000493838.1_Missense_Mutation_p.D336E	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	775	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						ACACCTCAGATCCCACCTACA	0.537																																					p.D775E		.											.	EPHB1	1492	0			c.T2325G						.						87.0	87.0	87.0					3																	134920510		2176	4297	6473	SO:0001583	missense	2047	exon12			CTCAGATCCCACC	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2325T>G	3.37:g.134920510T>G	ENSP00000381097:p.Asp775Glu	Somatic	393.0	1.0		WXS	Illumina HiSeq	Phase_I	175.0	60.0	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	T	11.55	1.671933	0.29693	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	D;D	0.82893	-1.66;-1.66	5.44	2.68	0.31781	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66742	0.2820	N	0.05467	-0.045	0.54753	D	0.999989	P	0.46064	0.872	P	0.48227	0.571	T	0.65236	-0.6217	10	0.02654	T	1	.	9.1453	0.36928	0.0:0.6383:0.0:0.3617	.	775	P54762	EPHB1_HUMAN	E	775;336	ENSP00000381097:D775E;ENSP00000419574:D336E	ENSP00000381097:D775E	D	+	3	2	EPHB1	136403200	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.285000	0.33261	0.354000	0.24105	-0.468000	0.05107	GAT	.		0.537	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
FAM200B	285550	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	15689295	15689295	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:15689295G>A	ENST00000422728.2	+	2	1533	c.695G>A	c.(694-696)aGc>aAc	p.S232N	FAM200B_ENST00000504137.1_Intron	NM_001145191.1	NP_001138663.1	P0CF97	F200B_HUMAN	family with sequence similarity 200, member B	232							nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						cttgatgaaagcactgatatt	0.333																																					p.S232N		.											.	.	.	0			c.G695A						.						22.0	18.0	19.0					4																	15689295		692	1585	2277	SO:0001583	missense	285550	exon2			ATGAAAGCACTGA	BC048993	CCDS47028.1	4p15.32	2014-04-02			ENSG00000237765	ENSG00000237765			27740	protein-coding gene	gene with protein product	"""chromosome 4 open reading frame 53"""						Standard	NM_001145191		Approved	C4orf53	uc003gof.4	P0CF97	OTTHUMG00000160279	ENST00000422728.2:c.695G>A	4.37:g.15689295G>A	ENSP00000393017:p.Ser232Asn	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	5.0	NM_001145191		Missense_Mutation	SNP	ENST00000422728.2	37	CCDS47028.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626055	0.46840	.	.	ENSG00000237765	ENST00000422728	T	0.24350	1.86	3.11	2.22	0.28083	Ribonuclease H-like (1);	.	.	.	.	T	0.50171	0.1600	M	0.84773	2.715	0.20074	N	0.999934	D	0.89917	1.0	D	0.80764	0.994	T	0.26849	-1.0091	8	.	.	.	.	7.2923	0.26372	0.0:0.0:0.7373:0.2627	.	232	P0CF97	F200B_HUMAN	N	232	ENSP00000393017:S232N	.	S	+	2	0	FAM200B	15298393	0.042000	0.20092	0.962000	0.40283	0.904000	0.53231	0.146000	0.16180	0.819000	0.34492	0.650000	0.86243	AGC	.		0.333	FAM200B-005	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360100.1	NM_001145191	
GARS	2617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	30673470	30673470	+	Missense_Mutation	SNP	G	G	T	rs537365362		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:30673470G>T	ENST00000389266.3	+	17	2455	c.2214G>T	c.(2212-2214)gaG>gaT	p.E738D		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	738					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	AGACAATCGAGGAATGAGGAC	0.393																																					p.E738D		.											.	GARS	91	0			c.G2214T						.						95.0	87.0	89.0					7																	30673470		1877	4107	5984	SO:0001583	missense	2617	exon17			AATCGAGGAATGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.2214G>T	7.37:g.30673470G>T	ENSP00000373918:p.Glu738Asp	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	17.0	NM_002047	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125724	0.37533	.	.	ENSG00000106105	ENST00000389266	D	0.82344	-1.6	4.9	2.02	0.26589	.	.	.	.	.	T	0.76343	0.3974	L	0.53249	1.67	0.47819	D	0.999527	B	0.13594	0.008	B	0.10450	0.005	T	0.67031	-0.5773	9	0.36615	T	0.2	4.734	8.2635	0.31799	0.2789:0.0:0.7211:0.0	.	738	P41250	SYG_HUMAN	D	738	ENSP00000373918:E738D	ENSP00000373918:E738D	E	+	3	2	GARS	30639995	1.000000	0.71417	0.993000	0.49108	0.944000	0.59088	1.215000	0.32431	0.330000	0.23485	-0.145000	0.13849	GAG	.		0.393	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GCC1	79571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	127222282	127222282	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:127222282T>C	ENST00000321407.2	-	2	2538	c.2114A>G	c.(2113-2115)cAc>cGc	p.H705R	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	705					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CTTTTCGATGTGGCTCTGCAG	0.582																																					p.H705R		.											.	GCC1	92	0			c.A2114G						.						213.0	202.0	205.0					7																	127222282		2203	4300	6503	SO:0001583	missense	79571	exon2			TCGATGTGGCTCT	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.2114A>G	7.37:g.127222282T>C	ENSP00000318821:p.His705Arg	Somatic	620.0	1.0		WXS	Illumina HiSeq	Phase_I	225.0	62.0	NM_024523	Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	37	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	T	8.486	0.860825	0.17178	.	.	ENSG00000179562	ENST00000321407	T	0.11063	2.81	5.87	4.72	0.59763	.	0.199482	0.53938	N	0.000054	T	0.09818	0.0241	L	0.36672	1.1	0.33059	D	0.533798	B	0.06786	0.001	B	0.04013	0.001	T	0.04294	-1.0962	10	0.49607	T	0.09	-17.2003	10.4907	0.44750	0.0:0.0767:0.0:0.9233	.	705	Q96CN9	GCC1_HUMAN	R	705	ENSP00000318821:H705R	ENSP00000318821:H705R	H	-	2	0	GCC1	127009518	1.000000	0.71417	0.997000	0.53966	0.621000	0.37620	2.228000	0.42981	1.147000	0.42369	-0.290000	0.09829	CAC	.		0.582	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523	
GPRIN1	114787	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176024063	176024063	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr5:176024063A>G	ENST00000303991.4	-	2	2950	c.2773T>C	c.(2773-2775)Tac>Cac	p.Y925H		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	925	Interaction with GNAO1. {ECO:0000250}.				neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGGCGCCGTATACCTCCCAC	0.726																																					p.Y925H		.											.	GPRIN1	92	0			c.T2773C						.						50.0	52.0	52.0					5																	176024063		1732	3345	5077	SO:0001583	missense	114787	exon2			CGCCGTATACCTC	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.2773T>C	5.37:g.176024063A>G	ENSP00000305839:p.Tyr925His	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	8.0	NM_052899	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	ENST00000303991.4	37	CCDS4405.1	.	.	.	.	.	.	.	.	.	.	A	19.14	3.770534	0.69992	.	.	ENSG00000169258	ENST00000303991	T	0.55052	0.54	3.78	3.78	0.43462	.	.	.	.	.	T	0.64692	0.2621	L	0.48642	1.525	0.34637	D	0.720244	D	0.89917	1.0	D	0.87578	0.998	T	0.74487	-0.3649	9	0.66056	D	0.02	-2.8596	12.4842	0.55863	1.0:0.0:0.0:0.0	.	925	Q7Z2K8	GRIN1_HUMAN	H	925	ENSP00000305839:Y925H	ENSP00000305839:Y925H	Y	-	1	0	GPRIN1	175956669	1.000000	0.71417	0.998000	0.56505	0.853000	0.48598	8.446000	0.90329	1.338000	0.45544	0.260000	0.18958	TAC	.		0.726	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
GPRIN3	285513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	90171127	90171127	+	Silent	SNP	A	A	G	rs372513468	byFrequency	TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:90171127A>G	ENST00000609438.1	-	2	653	c.135T>C	c.(133-135)aaT>aaC	p.N45N	GPRIN3_ENST00000333209.4_Silent_p.N45N	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	45										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CTGAAAAGCCATTGGCATTCT	0.557													A|||	2	0.000399361	0.0	0.0029	5008	,	,		19140	0.0		0.0	False		,,,				2504	0.0				p.N45N		.											.	GPRIN3	71	0			c.T135C						.	A		1,4405	2.1+/-5.4	0,1,2202	62.0	64.0	63.0		135	2.8	1.0	4		63	0,8600		0,0,4300	no	coding-synonymous	GPRIN3	NM_198281.2		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		45/777	90171127	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	285513	exon2			AAAGCCATTGGCA	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.135T>C	4.37:g.90171127A>G		Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	23.0	NM_198281	Q8IVE4	Silent	SNP	ENST00000609438.1	37	CCDS34030.1																																																																																			.		0.557	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
GRIPAP1	56850	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48834814	48834814	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chrX:48834814G>A	ENST00000376441.1	-	22	1998	c.1964C>T	c.(1963-1965)tCa>tTa	p.S655L	GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.S610L|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.S624L|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.S576L	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	655						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						CCGGCTTGGTGAGTTCATCTC	0.597																																					p.S655L		.											.	GRIPAP1	227	0			c.C1964T						.						48.0	37.0	41.0					X																	48834814		2203	4300	6503	SO:0001583	missense	56850	exon22			CTTGGTGAGTTCA	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1964C>T	X.37:g.48834814G>A	ENSP00000365624:p.Ser655Leu	Somatic	62.0	2.0		WXS	Illumina HiSeq	Phase_I	21.0	20.0	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	37	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966868	0.53507	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T	0.56275	0.47	3.33	3.33	0.38152	.	0.865711	0.09908	U	0.740146	T	0.70360	0.3215	M	0.76328	2.33	0.33587	D	0.600621	B;D;B	0.61080	0.348;0.989;0.069	B;D;B	0.72625	0.22;0.978;0.05	T	0.71318	-0.4629	10	0.40728	T	0.16	-0.2967	11.0673	0.47982	0.0:0.0:1.0:0.0	.	576;545;655	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	L	624;610;655;624;576	ENSP00000365608:S624L	ENSP00000365606:S576L	S	-	2	0	GRIPAP1	48719758	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.828000	0.69307	1.522000	0.49001	0.462000	0.41574	TCA	.		0.597	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
HIST1H3D	8351	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26197153	26197153	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr6:26197153T>C	ENST00000356476.2	-	1	325	c.326A>G	c.(325-327)aAc>aGc	p.N109S	HIST1H3D_ENST00000377831.5_Missense_Mutation_p.N109S|HIST1H2BF_ENST00000359985.1_5'Flank			P68431	H31_HUMAN	histone cluster 1, H3d	109					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)	14		all_hematologic(11;0.196)				GGCGCATAGGTTGGTGTCCTC	0.582																																					p.N109S	GBM(108;3816 4467)	.											.	HIST1H3D	90	0			c.A326G						.						101.0	91.0	95.0					6																	26197153		2203	4300	6503	SO:0001583	missense	8351	exon2			CATAGGTTGGTGT	Z80784	CCDS4590.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197409	ENSG00000197409		"""Histones / Replication-dependent"""	4767	protein-coding gene	gene with protein product		602811	"""H3 histone family, member B"", ""histone 1, H3d"""	H3FB		9119399, 12408966	Standard	NM_003530		Approved	H3/b	uc003ngv.4	P68431	OTTHUMG00000014433	ENST00000356476.2:c.326A>G	6.37:g.26197153T>C	ENSP00000366999:p.Asn109Ser	Somatic	386.0	2.0		WXS	Illumina HiSeq	Phase_I	137.0	40.0	NM_003530	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000356476.2	37	CCDS4590.1	.	.	.	.	.	.	.	.	.	.	.	17.60	3.430534	0.62844	.	.	ENSG00000197409	ENST00000356476;ENST00000377831	T;T	0.67345	-0.26;-0.26	4.28	1.81	0.25067	.	.	.	.	.	T	0.50411	0.1614	.	.	.	0.29020	N	0.88636	.	.	.	.	.	.	T	0.48305	-0.9047	6	0.87932	D	0	.	7.935	0.29925	0.0:0.1749:0.0:0.8251	.	.	.	.	S	109	ENSP00000366999:N109S;ENSP00000367062:N109S	ENSP00000366999:N109S	N	-	2	0	HIST1H3D	26305132	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	3.946000	0.56644	0.150000	0.19136	0.533000	0.62120	AAC	.		0.582	HIST1H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040096.1	NM_003530	
HOXB5	3215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	46669637	46669637	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:46669637C>G	ENST00000239151.5	-	2	1022	c.744G>C	c.(742-744)aaG>aaC	p.K248N	HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB3_ENST00000472863.1_5'Flank|HOXB-AS3_ENST00000492897.3_RNA|HOXB3_ENST00000552000.2_Intron|HOXB3_ENST00000476342.1_5'Flank|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB3_ENST00000498678.1_5'Flank|HOXB3_ENST00000460160.1_5'Flank|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000476204.1_RNA	NM_002147.3	NP_002138.1	P09067	HXB5_HUMAN	homeobox B5	248					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell differentiation (GO:0045446)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			large_intestine(1)|lung(2)	3						CCTTCTTCCACTTCATGCGCC	0.622																																					p.K248N		.											.	HOXB5	90	0			c.G744C						.						102.0	106.0	105.0					17																	46669637		2203	4300	6503	SO:0001583	missense	3215	exon2			CTTCCACTTCATG		CCDS11530.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120075	ENSG00000120075		"""Homeoboxes / ANTP class : HOXL subclass"""	5116	protein-coding gene	gene with protein product		142960	"""homeo box B5"""	HOX2, HOX2A		1973146, 1358459	Standard	NM_002147		Approved		uc002inr.3	P09067	OTTHUMG00000159913	ENST00000239151.5:c.744G>C	17.37:g.46669637C>G	ENSP00000239151:p.Lys248Asn	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	48.0	NM_002147	B2RC69|P09069|Q17RP4	Missense_Mutation	SNP	ENST00000239151.5	37	CCDS11530.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811996	0.50527	.	.	ENSG00000120075	ENST00000239151	D	0.97994	-4.65	5.4	1.76	0.24704	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98858	0.9614	H	0.97659	4.05	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97566	1.0101	9	.	.	.	.	5.3792	0.16181	0.1447:0.5546:0.0:0.3006	.	248	P09067	HXB5_HUMAN	N	248	ENSP00000239151:K248N	.	K	-	3	2	HOXB5	44024636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.741000	0.26202	0.737000	0.32582	0.563000	0.77884	AAG	.		0.622	HOXB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358148.2		
HS2ST1	9653	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	87563541	87563541	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:87563541delA	ENST00000370550.5	+	5	972	c.609delA	c.(607-609)gcafs	p.A203fs	HS2ST1_ENST00000370551.4_Frame_Shift_Del_p.A203fs|HS2ST1_ENST00000356813.4_Frame_Shift_Del_p.A177fs|RP5-1052I5.2_ENST00000370548.2_Frame_Shift_Del_p.A177fs	NM_012262.3	NP_036394.1	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1	203					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)	9		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		AATGTGTAGCAGAAGGTGGCT	0.443																																					p.A203fs		.											.	HS2ST1	90	0			c.609delA						.						159.0	148.0	151.0					1																	87563541		2203	4300	6503	SO:0001589	frameshift_variant	9653	exon5			TGTAGCAGAAGGT	AB007917	CCDS711.1, CCDS44171.1	1p22.3	2008-02-05			ENSG00000153936	ENSG00000153936		"""Sulfotransferases, membrane-bound"""	5193	protein-coding gene	gene with protein product		604844				9455484	Standard	NM_012262		Approved	KIAA0448	uc010osk.2	Q7LGA3	OTTHUMG00000010255	ENST00000370550.5:c.609delA	1.37:g.87563541delA	ENSP00000359581:p.Ala203fs	Somatic	248.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	17.0	NM_012262	D3DT22|O75036|Q32NB5|Q8TAC5|Q9H441|Q9NUJ9	Frame_Shift_Del	DEL	ENST00000370550.5	37	CCDS711.1																																																																																			.		0.443	HS2ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028279.2	NM_012262	
HS2ST1	9653	hgsc.bcm.edu;bcgsc.ca	37	1	87563544	87563544	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:87563544A>C	ENST00000370550.5	+	5	975	c.612A>C	c.(610-612)gaA>gaC	p.E204D	HS2ST1_ENST00000370551.4_Missense_Mutation_p.E204D|HS2ST1_ENST00000356813.4_Missense_Mutation_p.E178D|RP5-1052I5.2_ENST00000370548.2_Missense_Mutation_p.E178D	NM_012262.3	NP_036394.1	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1	204					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)	9		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		GTGTAGCAGAAGGTGGCTCAG	0.448																																					p.E204D		.											.	HS2ST1	90	0			c.A612C						.						160.0	149.0	153.0					1																	87563544		2203	4300	6503	SO:0001583	missense	9653	exon5			AGCAGAAGGTGGC	AB007917	CCDS711.1, CCDS44171.1	1p22.3	2008-02-05			ENSG00000153936	ENSG00000153936		"""Sulfotransferases, membrane-bound"""	5193	protein-coding gene	gene with protein product		604844				9455484	Standard	NM_012262		Approved	KIAA0448	uc010osk.2	Q7LGA3	OTTHUMG00000010255	ENST00000370550.5:c.612A>C	1.37:g.87563544A>C	ENSP00000359581:p.Glu204Asp	Somatic	258.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	17.0	NM_012262	D3DT22|O75036|Q32NB5|Q8TAC5|Q9H441|Q9NUJ9	Missense_Mutation	SNP	ENST00000370550.5	37	CCDS711.1	.	.	.	.	.	.	.	.	.	.	A	13.40	2.225926	0.39300	.	.	ENSG00000153936	ENST00000370551;ENST00000370550;ENST00000370548;ENST00000356813	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.43	2.45	0.29901	.	0.049792	0.85682	D	0.000000	T	0.38852	0.1056	L	0.42744	1.35	0.26762	N	0.969977	B;B	0.21520	0.02;0.057	B;B	0.30943	0.079;0.122	T	0.32079	-0.9920	10	0.30078	T	0.28	-19.9645	4.9418	0.13969	0.2331:0.0:0.5359:0.231	.	204;178	Q7LGA3;Q7LGA3-2	HS2ST_HUMAN;.	D	204;204;178;178	ENSP00000359582:E204D;ENSP00000359581:E204D;ENSP00000359579:E178D;ENSP00000349268:E178D	ENSP00000349268:E178D	E	+	3	2	HS2ST1	87336132	0.998000	0.40836	1.000000	0.80357	0.990000	0.78478	0.460000	0.21924	0.352000	0.24053	-0.177000	0.13119	GAA	.		0.448	HS2ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028279.2	NM_012262	
IQGAP2	10788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	75888748	75888748	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr5:75888748A>G	ENST00000274364.6	+	9	1202	c.905A>G	c.(904-906)aAc>aGc	p.N302S	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	302					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AATAAAGTCAACAGTAAGTAA	0.353																																					p.N302S		.											.	IQGAP2	96	0			c.A905G						.						144.0	154.0	151.0					5																	75888748		2203	4300	6503	SO:0001583	missense	10788	exon9			AAGTCAACAGTAA	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.905A>G	5.37:g.75888748A>G	ENSP00000274364:p.Asn302Ser	Somatic	336.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	49.0	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403643	0.83230	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.48522	4.06;0.81;4.07	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.65760	0.2722	M	0.88570	2.965	0.80722	D	1	P	0.35714	0.517	P	0.45071	0.468	T	0.70880	-0.4752	10	0.66056	D	0.02	-21.7424	16.2537	0.82501	1.0:0.0:0.0:0.0	.	302	Q13576	IQGA2_HUMAN	S	302;275;252	ENSP00000274364:N302S;ENSP00000423672:N275S;ENSP00000421097:N252S	ENSP00000274364:N302S	N	+	2	0	IQGAP2	75924504	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.273000	0.95719	2.244000	0.73946	0.529000	0.55759	AAC	.		0.353	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
ITGA8	8516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	15559199	15559199	+	Silent	SNP	G	G	T	rs199977895	byFrequency	TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr10:15559199G>T	ENST00000378076.3	-	30	3503	c.3150C>A	c.(3148-3150)acC>acA	p.T1050T		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	1050					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						GTTCCCTGTCGGTCATGTCCT	0.448													G|||	14	0.00279553	0.0	0.0	5008	,	,		14194	0.0		0.0	False		,,,				2504	0.0143				p.T1050T		.											.	ITGA8	230	0			c.C3150A						.						85.0	82.0	83.0					10																	15559199		2203	4300	6503	SO:0001819	synonymous_variant	8516	exon30			CCTGTCGGTCATG	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.3150C>A	10.37:g.15559199G>T		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	18.0	NM_003638	B0YJ31|Q5VX94	Silent	SNP	ENST00000378076.3	37	CCDS31155.1																																																																																			G|0.999;T|0.001		0.448	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
KCNA5	3741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	5153808	5153808	+	Silent	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr12:5153808C>T	ENST00000252321.3	+	1	724	c.495C>T	c.(493-495)ttC>ttT	p.F165F		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	165					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	AGTACTTCTTCGACCGCAACC	0.667																																					p.F165F		.											.	KCNA5	715	0			c.C495T						.						38.0	41.0	40.0					12																	5153808		2203	4300	6503	SO:0001819	synonymous_variant	3741	exon1			CTTCTTCGACCGC	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.495C>T	12.37:g.5153808C>T		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	30.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	ENST00000252321.3	37	CCDS8536.1																																																																																			.		0.667	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
KIAA1683	80726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18368011	18368011	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr19:18368011G>T	ENST00000600328.3	-	4	3715	c.3522C>A	c.(3520-3522)caC>caA	p.H1174Q	KIAA1683_ENST00000392413.4_Missense_Mutation_p.H1361Q|PDE4C_ENST00000355502.3_5'Flank|PDE4C_ENST00000596647.1_5'Flank|KIAA1683_ENST00000600359.3_Missense_Mutation_p.H1128Q			Q9H0B3	K1683_HUMAN	KIAA1683	1174						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GCCAATGCATGTGCCGTGAGC	0.597																																					p.H1361Q		.											.	KIAA1683	92	0			c.C4083A						.						76.0	70.0	72.0					19																	18368011		2203	4300	6503	SO:0001583	missense	80726	exon4			ATGCATGTGCCGT	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3522C>A	19.37:g.18368011G>T	ENSP00000470780:p.His1174Gln	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	13.0	NM_001145304	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367347	0.24771	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000411671	T;T;T	0.03330	4.08;4.05;3.97	3.87	-0.861	0.10676	.	1.728120	0.03472	N	0.213781	T	0.07458	0.0188	L	0.34521	1.04	0.09310	N	1	D;D	0.67145	0.996;0.963	P;B	0.59115	0.852;0.444	T	0.24905	-1.0147	10	0.87932	D	0	-4.4094	2.5954	0.04853	0.3798:0.0:0.4046:0.2156	.	1361;1174	E9PDE0;Q9H0B3	.;K1683_HUMAN	Q	1361;1174;1128;438;788	ENSP00000376213:H1361Q;ENSP00000352774:H1174Q;ENSP00000404501:H1128Q	ENSP00000352774:H1174Q	H	-	3	2	KIAA1683	18229011	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.417000	0.21214	0.048000	0.15891	0.462000	0.41574	CAC	.		0.597	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
KLHDC4	54758	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	87741993	87741994	+	Frame_Shift_Del	DEL	GT	GT	-	rs371269644	byFrequency	TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr16:87741993_87741994delGT	ENST00000270583.5	-	11	1584_1585	c.1526_1527delAC	c.(1525-1527)gacfs	p.D509fs	FLJ00104_ENST00000446344.1_5'Flank|KLHDC4_ENST00000347925.5_Frame_Shift_Del_p.D478fs|KLHDC4_ENST00000353170.5_Frame_Shift_Del_p.D452fs|KLHDC4_ENST00000566349.1_5'UTR	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	509										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CGCTGTCTTCGTCGTCGACCCC	0.619																																					p.509_509del		.											.	KLHDC4	182	0			c.1526_1527del						.																																			SO:0001589	frameshift_variant	54758	exon11			GTCTTCGTCGTCG	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.1526_1527delAC	16.37:g.87741993_87741994delGT	ENSP00000270583:p.Asp509fs	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	10.0	NM_017566	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Frame_Shift_Del	DEL	ENST00000270583.5	37	CCDS10963.1																																																																																			.		0.619	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
KLHL1	57626	broad.mit.edu;ucsc.edu	37	13	70549804	70549804	+	Nonsense_Mutation	SNP	G	G	A	rs553340739		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr13:70549804G>A	ENST00000377844.4	-	2	1387	c.628C>T	c.(628-630)Caa>Taa	p.Q210*	KLHL1_ENST00000545028.1_Intron	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	210					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TCACAAAGTTGCTGCTGCTTC	0.403																																					p.Q210X		.											.	KLHL1	90	0			c.C628T						.						183.0	164.0	170.0					13																	70549804		2203	4300	6503	SO:0001587	stop_gained	57626	exon2			AAAGTTGCTGCTG	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.628C>T	13.37:g.70549804G>A	ENSP00000367075:p.Gln210*	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	5.0	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Nonsense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	G	45	11.982087	0.99623	.	.	ENSG00000150361	ENST00000377844	.	.	.	5.98	5.98	0.97165	.	0.176240	0.40144	N	0.001167	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	20.452	0.99131	0.0:0.0:1.0:0.0	.	.	.	.	X	210	.	ENSP00000367075:Q210X	Q	-	1	0	KLHL1	69447805	1.000000	0.71417	0.993000	0.49108	0.902000	0.53008	9.101000	0.94219	2.838000	0.97847	0.591000	0.81541	CAA	.		0.403	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
KRT23	25984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39084785	39084785	+	Silent	SNP	C	C	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:39084785C>G	ENST00000209718.3	-	5	1135	c.711G>C	c.(709-711)ctG>ctC	p.L237L	KRT23_ENST00000436344.3_Silent_p.L100L|AC004231.2_ENST00000418393.1_RNA	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	237	Linker 12.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				GGACCTTAATCAGATCTTCCC	0.383																																					p.L237L		.											.	KRT23	91	0			c.G711C						.						198.0	192.0	194.0					17																	39084785		2203	4300	6503	SO:0001819	synonymous_variant	25984	exon5			CTTAATCAGATCT	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.711G>C	17.37:g.39084785C>G		Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	18.0	NM_015515	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Silent	SNP	ENST00000209718.3	37	CCDS11380.1																																																																																			.		0.383	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1		
KRT39	390792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|ucsc.edu;bcgsc.ca	37	17	39118509	39118510	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:39118509_39118510TG>CT	ENST00000355612.2	-	5	935_936	c.900_901CA>AG	c.(898-903)acCAgc>acAGgc	p.S301G	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	301	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				TGTTGAGAGCTGGTCACCACTT	0.465																																					p.S301G|p.T300T		.											.	.	.	0			c.A901G|c.C900A						.																																			SO:0001583	missense	390792	exon5			GAGAGCTGGTCAC|AGAGCTGGTCACC	AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.900_901delinsCT	17.37:g.39118509_39118510delinsCT	ENSP00000347823:p.Ser301Gly	Somatic	132.0|129.0	0.0|2.0		WXS	Illumina HiSeq	Phase_I|.	76.0	32.0|33.0	NM_213656	B2RXK6|Q6IFU6	Missense_Mutation|Silent	SNP	ENST00000355612.2	37	CCDS11382.1																																																																																			.		0.465	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257287.1	NM_213656	
LRIG2	9860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	113635842	113635842	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:113635842A>G	ENST00000361127.5	+	3	518	c.320A>G	c.(319-321)aAt>aGt	p.N107S		NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	107					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		ATGAATTACAATGAACTAACA	0.303																																					p.N107S		.											.	LRIG2	229	0			c.A320G						.						49.0	50.0	49.0					1																	113635842		2200	4293	6493	SO:0001583	missense	9860	exon3			ATTACAATGAACT	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.320A>G	1.37:g.113635842A>G	ENSP00000355396:p.Asn107Ser	Somatic	245.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	26.0	NM_014813	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	37	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.371797	0.82573	.	.	ENSG00000198799	ENST00000361127	T	0.26373	1.74	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.53094	0.1775	M	0.93283	3.4	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.68172	-0.5479	10	0.87932	D	0	.	15.6116	0.76727	1.0:0.0:0.0:0.0	.	107	O94898	LRIG2_HUMAN	S	107	ENSP00000355396:N107S	ENSP00000355396:N107S	N	+	2	0	LRIG2	113437365	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.806000	0.91930	2.097000	0.63578	0.533000	0.62120	AAT	.		0.303	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
LRP1B	53353	broad.mit.edu;ucsc.edu	37	2	141122263	141122263	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:141122263C>A	ENST00000389484.3	-	72	12069	c.11098G>T	c.(11098-11100)Gga>Tga	p.G3700*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3700	LDL-receptor class A 30. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.G3700*(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAGTTGTCTCCACAGTCGTCC	0.408										TSP Lung(27;0.18)																											p.G3700X	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	1	Substitution - Nonsense(1)	lung(1)	c.G11098T						.						111.0	110.0	110.0					2																	141122263		2203	4299	6502	SO:0001587	stop_gained	53353	exon72			TGTCTCCACAGTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.11098G>T	2.37:g.141122263C>A	ENSP00000374135:p.Gly3700*	Somatic	208.0	2.0		WXS	Illumina HiSeq	Phase_I	163.0	48.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	57	27.545249	0.99971	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	19.9311	0.97118	0.0:1.0:0.0:0.0	.	.	.	.	X	3700;3638	.	ENSP00000374135:G3700X	G	-	1	0	LRP1B	140838733	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.407000	0.80029	2.782000	0.95742	0.655000	0.94253	GGA	.		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
MAEL	84944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	166990985	166990985	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:166990985A>G	ENST00000367872.4	+	12	1442	c.1198A>G	c.(1198-1200)Att>Gtt	p.I400V	MAEL_ENST00000491055.1_3'UTR|MAEL_ENST00000367870.2_Missense_Mutation_p.I369V	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	400					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						ACTAGAGAGCATTTCCAATTC	0.413																																					p.I400V		.											.	MAEL	91	0			c.A1198G						.						137.0	131.0	133.0					1																	166990985		2203	4300	6503	SO:0001583	missense	84944	exon12			GAGAGCATTTCCA	AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.1198A>G	1.37:g.166990985A>G	ENSP00000356846:p.Ile400Val	Somatic	395.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	44.0	NM_032858	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	ENST00000367872.4	37	CCDS1257.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.988643	0.35131	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000537744	T;T	0.46451	0.87;0.89	5.23	2.89	0.33648	.	0.191758	0.36234	N	0.002714	T	0.09158	0.0226	N	0.24115	0.695	0.26690	N	0.971377	B;B	0.17038	0.003;0.02	B;B	0.18561	0.007;0.022	T	0.31166	-0.9953	10	0.23302	T	0.38	.	5.354	0.16051	0.7329:0.1774:0.0897:0.0	.	369;400	E9JVC3;Q96JY0	.;MAEL_HUMAN	V	400;369;122	ENSP00000356846:I400V;ENSP00000356844:I369V	ENSP00000356844:I369V	I	+	1	0	MAEL	165257609	0.952000	0.32445	0.996000	0.52242	0.997000	0.91878	0.564000	0.23563	0.436000	0.26393	0.533000	0.62120	ATT	.		0.413	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083239.1	NM_032858	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	235964399	235964399	+	Splice_Site	SNP	T	T	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:235964399T>A	ENST00000389794.3	-	9	3887		c.e9-2		LYST_ENST00000389793.2_Splice_Site|LYST_ENST00000536965.1_Splice_Site			Q99698	LYST_HUMAN	lysosomal trafficking regulator						blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AGTCTACCCCTGAAAAGAGAA	0.343																																					.		.											.	LYST	143	0			c.3713-2A>T						.						66.0	69.0	68.0					1																	235964399		2202	4299	6501	SO:0001630	splice_region_variant	1130	exon10			TACCCCTGAAAAG	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.3713-2A>T	1.37:g.235964399T>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	7.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Splice_Site	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	12.15	1.852847	0.32699	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7694	0.69665	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LYST	234031022	1.000000	0.71417	0.265000	0.24526	0.153000	0.21895	5.169000	0.64984	2.284000	0.76573	0.528000	0.53228	.	.		0.343	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		Intron
MAVS	57506	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3845200	3845200	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr20:3845200T>C	ENST00000428216.2	+	6	1051	c.923T>C	c.(922-924)gTg>gCg	p.V308A	MAVS_ENST00000416600.2_Missense_Mutation_p.V167A|MAVS_ENST00000358134.6_3'UTR	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	308					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						GTGAACACAGTGGCCCTGAAA	0.587																																					p.V308A		.											.	MAVS	90	0			c.T923C						.						109.0	94.0	99.0					20																	3845200		2203	4300	6503	SO:0001583	missense	57506	exon6			ACACAGTGGCCCT	DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.923T>C	20.37:g.3845200T>C	ENSP00000401980:p.Val308Ala	Somatic	211.0	1.0		WXS	Illumina HiSeq	Phase_I	67.0	22.0	NM_020746	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	37	CCDS33437.1	.	.	.	.	.	.	.	.	.	.	T	2.622	-0.288283	0.05605	.	.	ENSG00000088888	ENST00000416600;ENST00000428216	T;T	0.34072	1.38;2.4	4.16	-0.0674	0.13760	.	2.549920	0.01510	N	0.017866	T	0.20740	0.0499	N	0.16656	0.425	0.09310	N	1	B	0.20052	0.041	B	0.16289	0.015	T	0.09335	-1.0679	10	0.15499	T	0.54	.	3.574	0.07927	0.0:0.2043:0.1956:0.6	.	308	Q7Z434	MAVS_HUMAN	A	167;308	ENSP00000413749:V167A;ENSP00000401980:V308A	ENSP00000413749:V167A	V	+	2	0	MAVS	3793200	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	0.022000	0.13511	0.203000	0.20529	0.402000	0.26972	GTG	.		0.587	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	NM_020746	
MGAM	8972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141763307	141763307	+	Silent	SNP	T	T	C	rs369807337		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:141763307T>C	ENST00000549489.2	+	36	4361	c.4266T>C	c.(4264-4266)aaT>aaC	p.N1422N	MGAM_ENST00000475668.2_Silent_p.N1422N	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1422	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGGATATGAATGAACCATCAA	0.463																																					p.N1422N		.											.	MGAM	70	0			c.T4266C						.	T		0,3838		0,0,1919	56.0	53.0	54.0		4266	3.0	1.0	7		54	1,8245		0,1,4122	no	coding-synonymous	MGAM	NM_004668.2		0,1,6041	CC,CT,TT		0.0121,0.0,0.0083		1422/1858	141763307	1,12083	1919	4123	6042	SO:0001819	synonymous_variant	8972	exon36			TATGAATGAACCA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4266T>C	7.37:g.141763307T>C		Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	21.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																			.		0.463	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
KMT2A	4297	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	118342446	118342446	+	Nonsense_Mutation	SNP	C	C	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr11:118342446C>G	ENST00000389506.5	+	3	572	c.572C>G	c.(571-573)tCa>tGa	p.S191*	KMT2A_ENST00000534358.1_Nonsense_Mutation_p.S191*|KMT2A_ENST00000354520.4_Nonsense_Mutation_p.S191*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	191					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GCTATCCTCTCAGATCCATCT	0.378																																					p.S191X		.											.	MLL	1255	0			c.C572G						.						53.0	55.0	54.0					11																	118342446		2200	4296	6496	SO:0001587	stop_gained	4297	exon3			TCCTCTCAGATCC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.572C>G	11.37:g.118342446C>G	ENSP00000374157:p.Ser191*	Somatic	143.0	1.0		WXS	Illumina HiSeq	Phase_I	37.0	15.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.642600	0.87859	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000328469	.	.	.	5.92	5.92	0.95590	.	0.226579	0.39274	N	0.001419	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	20.3172	0.98658	0.0:1.0:0.0:0.0	.	.	.	.	X	191;224;191;191;224	.	ENSP00000333556:S224X	S	+	2	0	MLL	117847656	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.736000	0.68597	2.801000	0.96364	0.650000	0.86243	TCA	.		0.378	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
MTOR	2475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	11317091	11317091	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:11317091T>C	ENST00000361445.4	-	4	479	c.403A>G	c.(403-405)Atg>Gtg	p.M135V		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	135	Interaction with NBN.		M -> T (in a metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TCCCCTGCCATGGCAAGACGG	0.562																																					p.M135V		.											MTOR,NS,malignant_melanoma,+1	MTOR	1439	0			c.A403G						.						81.0	67.0	71.0					1																	11317091		2203	4300	6503	SO:0001583	missense	2475	exon4			CTGCCATGGCAAG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.403A>G	1.37:g.11317091T>C	ENSP00000354558:p.Met135Val	Somatic	603.0	2.0		WXS	Illumina HiSeq	Phase_I	231.0	157.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	4.534	0.099148	0.08681	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.64260	-0.09	5.21	5.21	0.72293	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.48429	0.1499	N	0.20881	0.62	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.39251	-0.9623	10	0.26408	T	0.33	-1.4542	15.0763	0.72080	0.0:0.0:0.0:1.0	.	135	P42345	MTOR_HUMAN	V	135	ENSP00000354558:M135V	ENSP00000354558:M135V	M	-	1	0	MTOR	11239678	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	4.841000	0.62824	1.965000	0.57142	0.455000	0.32223	ATG	.		0.562	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
MYEF2	50804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48458174	48458174	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr15:48458174T>G	ENST00000324324.7	-	5	760	c.481A>C	c.(481-483)Atg>Ctg	p.M161L	MYEF2_ENST00000267836.6_Missense_Mutation_p.M161L	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	161	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		TATTTGTTCATAGTTTCTAGG	0.274																																					p.M161L		.											.	MYEF2	523	0			c.A481C						.						60.0	74.0	69.0					15																	48458174		2184	4247	6431	SO:0001583	missense	50804	exon5			TGTTCATAGTTTC	AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.481A>C	15.37:g.48458174T>G	ENSP00000316950:p.Met161Leu	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	17.0	NM_016132	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	ENST00000324324.7	37	CCDS32230.1	.	.	.	.	.	.	.	.	.	.	T	8.525	0.869597	0.17322	.	.	ENSG00000104177	ENST00000324324;ENST00000267836	T;T	0.69175	-0.38;-0.38	5.66	4.52	0.55395	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.44912	0.1316	N	0.05280	-0.08	0.80722	D	1	B;B	0.18741	0.003;0.03	B;B	0.23716	0.029;0.048	T	0.23940	-1.0174	10	0.19590	T	0.45	-9.65	12.8717	0.57968	0.0:0.0:0.1362:0.8638	.	161;161	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	L	161	ENSP00000316950:M161L;ENSP00000267836:M161L	ENSP00000267836:M161L	M	-	1	0	MYEF2	46245466	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	5.921000	0.70028	0.946000	0.37632	0.477000	0.44152	ATG	.		0.274	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132	
MYH7	4625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23902342	23902342	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr14:23902342G>A	ENST00000355349.3	-	4	458	c.296C>T	c.(295-297)cCc>cTc	p.P99L		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	99	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GAGCACCGCGGGCTCATGCAG	0.562																																					p.P99L		.											.	MYH7	94	0			c.C296T						.						267.0	183.0	212.0					14																	23902342		2203	4300	6503	SO:0001583	missense	4625	exon4			ACCGCGGGCTCAT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.296C>T	14.37:g.23902342G>A	ENSP00000347507:p.Pro99Leu	Somatic	413.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	66.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	g	18.59	3.656567	0.67586	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.95588	-3.75	3.76	3.76	0.43208	Myosin head, motor domain (2);	.	.	.	.	D	0.96234	0.8772	M	0.89658	3.05	0.80722	D	1	B	0.19817	0.039	B	0.29524	0.103	D	0.96486	0.9360	9	0.72032	D	0.01	.	16.1486	0.81594	0.0:0.0:1.0:0.0	.	99	P12883	MYH7_HUMAN	L	99	ENSP00000347507:P99L	ENSP00000347507:P99L	P	-	2	0	MYH7	22972182	1.000000	0.71417	0.906000	0.35671	0.991000	0.79684	9.552000	0.98115	2.095000	0.63458	0.455000	0.32223	CCC	.		0.562	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
MYO9B	4650	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17298831	17298831	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr19:17298831T>C	ENST00000594824.1	+	19	2812	c.2665T>C	c.(2665-2667)Tac>Cac	p.Y889H	MYO9B_ENST00000397274.2_Missense_Mutation_p.Y889H|MYO9B_ENST00000595618.1_Missense_Mutation_p.Y889H			Q13459	MYO9B_HUMAN	myosin IXB	889	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						GAGGTCAGGGTACAGCGCCAA	0.562																																					p.Y889H		.											.	MYO9B	67	0			c.T2665C						.						49.0	48.0	49.0					19																	17298831		2199	4295	6494	SO:0001583	missense	4650	exon19			TCAGGGTACAGCG		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2665T>C	19.37:g.17298831T>C	ENSP00000471367:p.Tyr889His	Somatic	384.0	2.0		WXS	Illumina HiSeq	.	152.0	47.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	T	18.41	3.616888	0.66672	.	.	ENSG00000099331	ENST00000397274	T	0.78003	-1.14	4.7	4.7	0.59300	Myosin head, motor domain (2);	0.000000	0.49916	D	0.000132	D	0.91586	0.7342	H	0.96970	3.915	0.49213	D	0.999762	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.93983	0.7260	10	0.87932	D	0	.	13.3719	0.60717	0.0:0.0:0.0:1.0	.	889;889;895	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	H	889	ENSP00000380444:Y889H	ENSP00000380444:Y889H	Y	+	1	0	MYO9B	17159831	1.000000	0.71417	0.999000	0.59377	0.286000	0.27126	7.931000	0.87625	1.760000	0.52011	0.418000	0.28097	TAC	.		0.562	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
NAA16	79612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	41905450	41905450	+	Silent	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr13:41905450T>C	ENST00000379406.3	+	8	1176	c.852T>C	c.(850-852)agT>agC	p.S284S	NAA16_ENST00000403412.3_Silent_p.S284S|NAA16_ENST00000379367.3_Silent_p.S284S	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	284					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						AAGAAATTAGTAAGCAGCACC	0.313																																					p.S284S		.											.	NAA16	90	0			c.T852C						.						81.0	89.0	86.0					13																	41905450		2203	4296	6499	SO:0001819	synonymous_variant	79612	exon8			AATTAGTAAGCAG	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.852T>C	13.37:g.41905450T>C		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	20.0	NM_001110798	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Silent	SNP	ENST00000379406.3	37	CCDS9379.1																																																																																			.		0.313	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
NAT8	9027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	73868277	73868277	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:73868277G>T	ENST00000272425.3	-	2	628	c.479C>A	c.(478-480)aCt>aAt	p.T160N		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)											breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						CTGGAGGACAGTCCTGACCAG	0.567																																					p.T160N		.											.	NAT8	91	0			c.C479A						.						75.0	77.0	76.0					2																	73868277		2203	4300	6503	SO:0001583	missense	9027	exon2			AGGACAGTCCTGA	AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.479C>A	2.37:g.73868277G>T	ENSP00000272425:p.Thr160Asn	Somatic	296.0	1.0		WXS	Illumina HiSeq	Phase_I	107.0	44.0	NM_003960		Missense_Mutation	SNP	ENST00000272425.3	37	CCDS1926.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.255987	0.59321	.	.	ENSG00000144035	ENST00000272425	T	0.22945	1.93	3.86	2.97	0.34412	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.256438	0.37178	N	0.002214	T	0.42988	0.1227	M	0.69523	2.12	0.41732	D	0.989565	D	0.89917	1.0	D	0.75484	0.986	T	0.28996	-1.0026	10	0.49607	T	0.09	-23.6027	5.6538	0.17631	0.109:0.0:0.6987:0.1923	.	160	Q9UHE5	NAT8_HUMAN	N	160	ENSP00000272425:T160N	ENSP00000272425:T160N	T	-	2	0	NAT8	73721785	1.000000	0.71417	0.950000	0.38849	0.713000	0.41058	5.277000	0.65586	0.911000	0.36747	0.644000	0.83932	ACT	.		0.567	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1	NM_003960	
NDN	4692	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	23931945	23931945	+	Silent	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr15:23931945G>T	ENST00000331837.4	-	1	505	c.420C>A	c.(418-420)ctC>ctA	p.L140L		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	140	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		TGGTGCGCCGGAGGATGCTCC	0.587									Prader-Willi syndrome																												p.L140L		.											.	NDN	90	0			c.C420A						.						59.0	58.0	58.0					15																	23931945		2203	4300	6503	SO:0001819	synonymous_variant	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	GCGCCGGAGGATG	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.420C>A	15.37:g.23931945G>T		Somatic	43.0	1.0		WXS	Illumina HiSeq	Phase_I	27.0	9.0	NM_002487	B2R6Z5	Silent	SNP	ENST00000331837.4	37	CCDS10014.1																																																																																			.		0.587	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
NDRG1	10397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	134270653	134270653	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr8:134270653C>T	ENST00000414097.2	-	7	1273	c.406G>A	c.(406-408)Ggc>Agc	p.G136S	NDRG1_ENST00000323851.7_Missense_Mutation_p.G136S|NDRG1_ENST00000354944.5_Intron|NDRG1_ENST00000518176.1_Intron|NDRG1_ENST00000537882.1_Missense_Mutation_p.G55S|NDRG1_ENST00000518066.1_Intron|NDRG1_ENST00000522476.1_Missense_Mutation_p.G70S	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	136					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)		NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GTTCCCATGCCAATAATGCTT	0.438			T	ERG	prostate																																p.G136S		.		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	.	NDRG1	230	0			c.G406A						.						63.0	57.0	59.0					8																	134270653		2203	4300	6503	SO:0001583	missense	10397	exon7			CCATGCCAATAAT	X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.406G>A	8.37:g.134270653C>T	ENSP00000404854:p.Gly136Ser	Somatic	270.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	65.0	NM_006096	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	ENST00000414097.2	37	CCDS34945.1	.	.	.	.	.	.	.	.	.	.	C	36	5.642439	0.96704	.	.	ENSG00000104419	ENST00000323851;ENST00000414097;ENST00000537882;ENST00000522476;ENST00000520230;ENST00000518480;ENST00000519228;ENST00000519580;ENST00000522890;ENST00000520943	T;T;T;T;T;T;T;T;T;T	0.29397	1.57;1.57;1.95;1.95;1.95;1.95;1.95;1.95;1.95;1.95	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.66567	0.2802	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74728	-0.3567	10	0.66056	D	0.02	-40.9453	18.1007	0.89505	0.0:1.0:0.0:0.0	.	136	Q92597	NDRG1_HUMAN	S	136;136;55;70;153;70;136;136;136;147	ENSP00000319977:G136S;ENSP00000404854:G136S;ENSP00000437443:G55S;ENSP00000427894:G70S;ENSP00000428345:G153S;ENSP00000428802:G70S;ENSP00000429994:G136S;ENSP00000429272:G136S;ENSP00000428384:G136S;ENSP00000429840:G147S	ENSP00000319977:G136S	G	-	1	0	NDRG1	134339835	1.000000	0.71417	0.979000	0.43373	0.957000	0.61999	7.187000	0.77730	2.599000	0.87857	0.555000	0.69702	GGC	.		0.438	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378805.1		
NOTCH2NL	388677	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	145281400	145281400	+	Silent	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:145281400G>T	ENST00000369340.3	+	5	774	c.330G>T	c.(328-330)ctG>ctT	p.L110L	NOTCH2NL_ENST00000362074.6_Silent_p.L110L|RP11-458D21.5_ENST00000468030.1_Silent_p.L110L|NOTCH2NL_ENST00000344859.3_Silent_p.L110L			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	110	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						ATGCCTGCCTGTCTCATCCCT	0.507																																					p.L110L		.											.	NOTCH2NL	211	0			c.G330T						.						363.0	367.0	366.0					1																	145281400		2203	4299	6502	SO:0001819	synonymous_variant	388677	exon4			CTGCCTGTCTCAT		CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.330G>T	1.37:g.145281400G>T		Somatic	2309.0	0.0		WXS	Illumina HiSeq	Phase_I	1094.0	78.0	NM_203458	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Silent	SNP	ENST00000369340.3	37	CCDS909.1																																																																																			.		0.507	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038546.1	NM_203458	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176562395	176562395	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr5:176562395T>G	ENST00000439151.2	+	2	336	c.291T>G	c.(289-291)ttT>ttG	p.F97L	NSD1_ENST00000511258.1_Intron|NSD1_ENST00000361032.4_Missense_Mutation_p.F97L|NSD1_ENST00000354179.4_Intron|NSD1_ENST00000347982.4_Intron	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	97					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CAGAATCCTTTCAAGACCCTG	0.443			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.F97L		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	188	0			c.T291G						.						83.0	81.0	81.0					5																	176562395		2203	4300	6503	SO:0001583	missense	64324	exon2	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	ATCCTTTCAAGAC	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.291T>G	5.37:g.176562395T>G	ENSP00000395929:p.Phe97Leu	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	16.0	NM_022455	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	T	8.137	0.784459	0.16189	.	.	ENSG00000165671	ENST00000439151;ENST00000361032	D;D	0.92149	-2.92;-2.98	5.23	4.07	0.47477	.	0.116384	0.39544	N	0.001335	T	0.79656	0.4483	N	0.08118	0	0.80722	D	1	B;B;B	0.11235	0.004;0.002;0.004	B;B;B	0.09377	0.004;0.002;0.003	T	0.69168	-0.5216	10	0.23302	T	0.38	.	5.3626	0.16095	0.0:0.0892:0.1775:0.7333	.	97;97;97	Q96L73-3;Q96L73;Q6PJ64	.;NSD1_HUMAN;.	L	97	ENSP00000395929:F97L;ENSP00000354310:F97L	ENSP00000354310:F97L	F	+	3	2	NSD1	176495001	1.000000	0.71417	1.000000	0.80357	0.144000	0.21451	1.836000	0.39191	1.008000	0.39264	0.454000	0.30748	TTT	.		0.443	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
OBSCN	84033	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228538636	228538636	+	Silent	SNP	G	G	A	rs372931114	byFrequency	TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:228538636G>A	ENST00000422127.1	+	77	18455	c.18411G>A	c.(18409-18411)ccG>ccA	p.P6137P	OBSCN_ENST00000570156.2_Silent_p.P7094P|OBSCN_ENST00000284548.11_Silent_p.P6137P|OBSCN_ENST00000366707.4_Silent_p.P3771P|OBSCN_ENST00000366709.4_Silent_p.P3256P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6137	Ig-like 53.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCCCGTACCCGCAGATCAGGT	0.682																																					p.P7094P		.											.	OBSCN	403	0			c.G21282A						.						28.0	31.0	30.0					1																	228538636		1927	4102	6029	SO:0001819	synonymous_variant	84033	exon88			GTACCCGCAGATC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18411G>A	1.37:g.228538636G>A		Somatic	224.0	2.0		WXS	Illumina HiSeq	.	142.0	50.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	7.205	0.594256	0.13875	.	.	ENSG00000154358	ENST00000441106	.	.	.	5.58	-9.21	0.00678	.	.	.	.	.	T	0.31670	0.0804	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43909	-0.9362	4	.	.	.	.	0.6445	0.00816	0.3075:0.2562:0.2407:0.1957	.	.	.	.	T	754	.	.	A	+	1	0	OBSCN	226605259	0.007000	0.16637	0.705000	0.30386	0.028000	0.11728	-1.636000	0.02016	-1.170000	0.02769	-2.589000	0.00165	GCA	.		0.682	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ODF2	4957	ucsc.edu;bcgsc.ca	37	9	131246268	131246268	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr9:131246268G>A	ENST00000434106.3	+	11	1402	c.1039G>A	c.(1039-1041)Ggg>Agg	p.G347R	ODF2_ENST00000444119.2_Missense_Mutation_p.G323R|ODF2_ENST00000535026.1_3'UTR|ODF2_ENST00000372807.5_Missense_Mutation_p.G342R|ODF2_ENST00000448249.3_Missense_Mutation_p.G266R|ODF2_ENST00000372791.3_Missense_Mutation_p.G328R|ODF2_ENST00000372814.3_Missense_Mutation_p.G391R|ODF2_ENST00000393533.2_Missense_Mutation_p.G347R|ODF2_ENST00000351030.3_Missense_Mutation_p.G342R|ODF2_ENST00000393527.3_Missense_Mutation_p.G323R|ODF2_ENST00000546203.1_Missense_Mutation_p.G328R|ODF2_ENST00000604420.1_Missense_Mutation_p.G347R	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	347					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						GTCCATGCGTGGGCATTTGCA	0.498																																					p.G411R		.											.	ODF2	69	0			c.G1231A						.						113.0	105.0	107.0					9																	131246268		2203	4300	6503	SO:0001583	missense	4957	exon11			ATGCGTGGGCATT	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.1039G>A	9.37:g.131246268G>A	ENSP00000403453:p.Gly347Arg	Somatic	106.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_153435	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729498	0.89390	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.96;1.02;1.02;1.02	5.8	4.87	0.63330	.	0.152291	0.56097	D	0.000032	T	0.49304	0.1549	L	0.34521	1.04	0.80722	D	1	D;D;D;P;D;D;D;D;D;P	0.76494	0.993;0.959;0.998;0.914;0.999;0.999;0.959;0.998;0.994;0.914	P;P;P;P;P;D;P;P;P;P	0.65010	0.808;0.662;0.862;0.581;0.901;0.931;0.662;0.808;0.901;0.581	T	0.20706	-1.0267	10	0.19590	T	0.45	-32.9424	15.7019	0.77549	0.0:0.1365:0.8635:0.0	.	328;342;266;281;347;391;342;328;347;323	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;.;ODFP2_HUMAN;.	R	347;391;342;347;323;266;328;328	ENSP00000377166:G347R;ENSP00000361901:G391R;ENSP00000342581:G342R;ENSP00000361882:G347R;ENSP00000307781:G323R;ENSP00000396687:G266R;ENSP00000437579:G328R;ENSP00000361877:G328R	ENSP00000307781:G323R	G	+	1	0	ODF2	130286089	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	6.277000	0.72608	2.749000	0.94314	0.655000	0.94253	GGG	.		0.498	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		
OR2M3	127062	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248367191	248367191	+	Silent	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:248367191G>T	ENST00000456743.1	+	1	860	c.822G>T	c.(820-822)gtG>gtT	p.V274V		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ACAAGATGGTGTCTGTATTCT	0.498																																					p.V274V		.											.	OR2M3	70	0			c.G822T						.						165.0	150.0	155.0					1																	248367191		2203	4300	6503	SO:0001819	synonymous_variant	127062	exon1			GATGGTGTCTGTA		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.822G>T	1.37:g.248367191G>T		Somatic	298.0	2.0		WXS	Illumina HiSeq	Phase_I	145.0	32.0	NM_001004689	B9EH06|Q6IEY0	Silent	SNP	ENST00000456743.1	37	CCDS31107.1																																																																																			.		0.498	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
PAQR9	344838	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	3	142682019	142682019	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr3:142682019A>C	ENST00000340634.3	-	1	159	c.160T>G	c.(160-162)Ttc>Gtc	p.F54V	RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	54						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						CACTCCACGAAGTCGTCGGGC	0.692																																					p.F54V		.											.	PAQR9	68	0			c.T160G						.						30.0	30.0	30.0					3																	142682019		2198	4296	6494	SO:0001583	missense	344838	exon1			CCACGAAGTCGTC	AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.160T>G	3.37:g.142682019A>C	ENSP00000341564:p.Phe54Val	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	19.0	NM_198504	Q147T6	Missense_Mutation	SNP	ENST00000340634.3	37	CCDS3128.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.381240	0.24944	.	.	ENSG00000188582	ENST00000340634	T	0.23950	1.88	4.25	4.25	0.50352	.	0.078533	0.51477	D	0.000085	T	0.28433	0.0703	M	0.61703	1.905	0.30608	N	0.759821	P	0.42483	0.781	B	0.40864	0.342	T	0.26643	-1.0097	10	0.34782	T	0.22	-20.6322	13.3044	0.60345	1.0:0.0:0.0:0.0	.	54	Q6ZVX9	PAQR9_HUMAN	V	54	ENSP00000341564:F54V	ENSP00000341564:F54V	F	-	1	0	PAQR9	144164709	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.922000	0.28734	1.681000	0.50988	0.421000	0.28195	TTC	.		0.692	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504	
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30726026	30726026	+	Missense_Mutation	SNP	G	G	T	rs370196952		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:30726026G>T	ENST00000361762.2	+	1	3990	c.2982G>T	c.(2980-2982)agG>agT	p.R994S	PCDH7_ENST00000543491.1_Missense_Mutation_p.R994S	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	994					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						ACCTGGCAAGGCATTACAAAT	0.522																																					p.R994S		.											.	PCDH7	229	0			c.G2982T						.	G	SER/ARG,SER/ARG,SER/ARG,SER/ARG	0,4406		0,0,2203	93.0	93.0	93.0		2982,2982,2982,2982	4.9	1.0	4		93	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	PCDH7	NM_001173523.1,NM_002589.2,NM_032456.2,NM_032457.3	110,110,110,110	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	994/1256,994/1070,994/1073,994/1248	30726026	1,13005	2203	4300	6503	SO:0001583	missense	5099	exon1			GGCAAGGCATTAC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2982G>T	4.37:g.30726026G>T	ENSP00000355243:p.Arg994Ser	Somatic	222.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	36.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.44|14.44	2.535280|2.535280	0.45176|0.45176	0.0|0.0	1.16E-4|1.16E-4	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.39056	.|1.1;1.1	4.93|4.93	4.93|4.93	0.64822|0.64822	.|Protocadherin (1);	.|.	.|.	.|.	.|.	T|T	0.61714|0.61714	0.2369|0.2369	M|M	0.75615|0.75615	2.305|2.305	0.46167|0.46167	D|D	0.998904|0.998904	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.99;0.999	T|T	0.64820|0.64820	-0.6317|-0.6317	5|9	.|0.87932	.|D	.|0	.|.	10.1696|10.1696	0.42902|0.42902	0.0769:0.1387:0.7844:0.0|0.0769:0.1387:0.7844:0.0	.|.	.|994;947;994	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	S|S	684|994;994;947	.|ENSP00000355243:R994S;ENSP00000441802:R994S	.|ENSP00000330302:R947S	A|R	+|+	1|3	0|2	PCDH7|PCDH7	30335124|30335124	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	2.256000|2.256000	0.43231|0.43231	2.567000|2.567000	0.86603|0.86603	0.561000|0.561000	0.74099|0.74099	GCA|AGG	.		0.522	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
PDS5A	23244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39902096	39902096	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:39902096T>C	ENST00000303538.8	-	14	2070	c.1531A>G	c.(1531-1533)Atg>Gtg	p.M511V	PDS5A_ENST00000503396.1_Missense_Mutation_p.M511V	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						CTCCGAAGCATGTTCTGACAC	0.358																																					p.M511V		.											.	.	.	0			c.A1531G						.						68.0	66.0	67.0					4																	39902096		1922	4130	6052	SO:0001583	missense	23244	exon14			GAAGCATGTTCTG	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1531A>G	4.37:g.39902096T>C	ENSP00000303427:p.Met511Val	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	16.0	NM_001100399		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	T	7.930	0.740385	0.15642	.	.	ENSG00000121892	ENST00000303538;ENST00000503396	T;T	0.66815	-0.06;-0.23	5.75	4.52	0.55395	Armadillo-like helical (1);Armadillo-type fold (1);	0.038952	0.85682	D	0.000000	T	0.61602	0.2360	L	0.35414	1.06	0.52501	D	0.999956	B;B	0.32302	0.003;0.363	B;B	0.42030	0.01;0.373	T	0.58691	-0.7592	9	.	.	.	-17.1339	14.1948	0.65662	0.0:0.0:0.1326:0.8674	.	511;511	Q29RF7-3;Q29RF7	.;PDS5A_HUMAN	V	511	ENSP00000303427:M511V;ENSP00000426749:M511V	.	M	-	1	0	PDS5A	39578491	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.196000	0.58407	2.196000	0.70406	0.402000	0.26972	ATG	.		0.358	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
PGM3	5238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	83881724	83881724	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr6:83881724T>G	ENST00000283977.4	-	10	1180	c.1054A>C	c.(1054-1056)Aag>Cag	p.K352Q	PGM3_ENST00000513973.1_Missense_Mutation_p.K433Q|PGM3_ENST00000512866.1_Missense_Mutation_p.K433Q|PGM3_ENST00000506587.1_Missense_Mutation_p.K461Q					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		GTCAAGCCCTTCAGAGCCAAG	0.408																																					p.K461Q		.											.	PGM3	90	0			c.A1381C						.						135.0	118.0	124.0					6																	83881724		2203	4300	6503	SO:0001583	missense	5238	exon12			AGCCCTTCAGAGC	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.1054A>C	6.37:g.83881724T>G	ENSP00000283977:p.Lys352Gln	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	9.0	NM_001199917		Missense_Mutation	SNP	ENST00000283977.4	37		.	.	.	.	.	.	.	.	.	.	T	25.3	4.625256	0.87560	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587;ENST00000509219	T;T;T;T;T	0.47528	0.86;0.86;0.88;0.86;0.84	5.93	5.93	0.95920	.	0.084314	0.85682	D	0.000000	T	0.34337	0.0894	M	0.67700	2.07	0.58432	D	0.999998	P;P;B	0.38048	0.616;0.485;0.301	B;B;B	0.34242	0.178;0.15;0.062	T	0.28038	-1.0056	10	0.37606	T	0.19	-12.8053	16.3839	0.83495	0.0:0.0:0.0:1.0	.	461;461;433	E9PF86;B4DX94;O95394	.;.;AGM1_HUMAN	Q	433;433;352;461;64	ENSP00000424874:K433Q;ENSP00000421565:K433Q;ENSP00000283977:K352Q;ENSP00000425809:K461Q;ENSP00000423389:K64Q	ENSP00000283977:K352Q	K	-	1	0	PGM3	83938443	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.698000	0.84413	2.258000	0.74832	0.533000	0.62120	AAG	.		0.408	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
PHF6	84295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	133527959	133527959	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chrX:133527959A>G	ENST00000332070.3	+	5	597	c.395A>G	c.(394-396)aAg>aGg	p.K132R	PHF6_ENST00000370803.3_Missense_Mutation_p.K132R|PHF6_ENST00000370800.4_Missense_Mutation_p.K132R|PHF6_ENST00000370799.1_Missense_Mutation_p.K132R|PHF6_ENST00000416404.2_Missense_Mutation_p.K98R|PHF6_ENST00000394292.1_Missense_Mutation_p.K132R	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	132					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					CGAAAACACAAGAAAACTGCA	0.313			"""F, N, Splice, Mis"""		ETP ALL																																p.K132R	Colon(100;666 1493 6344 21231 35807)	.		Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	.	PHF6	131	0			c.A395G						.						81.0	75.0	77.0					X																	133527959		2203	4300	6503	SO:0001583	missense	84295	exon5			AACACAAGAAAAC	AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.395A>G	X.37:g.133527959A>G	ENSP00000329097:p.Lys132Arg	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	27.0	NM_032335	A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	ENST00000332070.3	37	CCDS14639.1	.	.	.	.	.	.	.	.	.	.	A	11.79	1.743676	0.30865	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	4.92	4.92	0.64577	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);	0.090698	0.64402	D	0.000001	T	0.44307	0.1287	N	0.05306	-0.075	0.41815	D	0.989997	B;B;B;B;B	0.14438	0.002;0.007;0.004;0.004;0.01	B;B;B;B;B	0.16289	0.002;0.005;0.015;0.015;0.013	T	0.43669	-0.9377	10	0.02654	T	1	-12.1591	11.6282	0.51158	1.0:0.0:0.0:0.0	.	98;132;132;132;132	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	R	132;132;132;132;98;132	ENSP00000359839:K132R;ENSP00000329097:K132R;ENSP00000377831:K132R;ENSP00000359835:K132R;ENSP00000394480:K98R;ENSP00000359836:K132R	ENSP00000329097:K132R	K	+	2	0	PHF6	133355625	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.782000	0.62396	1.745000	0.51790	0.376000	0.23039	AAG	.		0.313	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058367.1	NM_032458	
PHRF1	57661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	587380	587380	+	Silent	SNP	C	C	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr11:587380C>A	ENST00000264555.5	+	4	464	c.336C>A	c.(334-336)ctC>ctA	p.L112L	PHRF1_ENST00000416188.2_Silent_p.L112L|PHRF1_ENST00000533464.1_Silent_p.L108L|PHRF1_ENST00000413872.2_Silent_p.L111L	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	112					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CAATCTGTCTCAACGCATTCA	0.557																																					p.L112L		.											.	PHRF1	22	0			c.C336A						.						109.0	116.0	114.0					11																	587380		2067	4194	6261	SO:0001819	synonymous_variant	57661	exon4			CTGTCTCAACGCA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.336C>A	11.37:g.587380C>A		Somatic	222.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	24.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	ENST00000264555.5	37																																																																																				.		0.557	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
PIKFYVE	200576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	209190271	209190271	+	Silent	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:209190271C>T	ENST00000264380.4	+	20	2894	c.2736C>T	c.(2734-2736)ccC>ccT	p.P912P		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	912					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GTTCCATCCCCTGGGATCCTG	0.507																																					p.P912P		.											.	PIKFYVE	583	0			c.C2736T						.						82.0	75.0	78.0					2																	209190271		2203	4300	6503	SO:0001819	synonymous_variant	200576	exon20			CATCCCCTGGGAT	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.2736C>T	2.37:g.209190271C>T		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	17.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	ENST00000264380.4	37	CCDS2382.1																																																																																			.		0.507	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
PLXNA4	91584	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	131910919	131910919	+	Splice_Site	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:131910919C>T	ENST00000359827.3	-	8	2945		c.e8+1		PLXNA4_ENST00000321063.4_Splice_Site			Q9HCM2	PLXA4_HUMAN	plexin A4						anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGGCCACTTACGAATTGTGGA	0.512																																					.		.											.	PLXNA4	91	0			c.1982+1G>A						.						127.0	127.0	127.0					7																	131910919		1968	4158	6126	SO:0001630	splice_region_variant	91584	exon9			CACTTACGAATTG	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1982+1G>A	7.37:g.131910919C>T		Somatic	203.0	1.0		WXS	Illumina HiSeq	Phase_I	78.0	34.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Splice_Site	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	33	5.241699	0.95272	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2008	0.93711	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXNA4	131561459	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.755000	0.85180	2.722000	0.93159	0.655000	0.94253	.	.		0.512	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	Intron
POMT2	29954	broad.mit.edu;ucsc.edu	37	14	77744797	77744797	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr14:77744797G>C	ENST00000261534.4	-	20	2289	c.2087C>G	c.(2086-2088)cCc>cGc	p.P696R		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	696						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CCTCGCCAGGGGCCATGAGGC	0.637																																					p.P696R		.											.	POMT2	91	0			c.C2087G						.						22.0	22.0	22.0					14																	77744797		2167	4235	6402	SO:0001583	missense	29954	exon20			GCCAGGGGCCATG	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.2087C>G	14.37:g.77744797G>C	ENSP00000261534:p.Pro696Arg	Somatic	71.0	2.0		WXS	Illumina HiSeq	Phase_I	24.0	7.0	NM_013382	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.555|2.555	-0.303179|-0.303179	0.05495|0.05495	.|.	.|.	ENSG00000009830|ENSG00000009830	ENST00000556394|ENST00000261534	D|T	0.89617|0.76316	-2.54|-1.01	5.09|5.09	-3.33|-3.33	0.04958|0.04958	.|.	1.385860|1.385860	0.04078|0.04078	N|N	0.309098|0.309098	T|T	0.54271|0.54271	0.1848|0.1848	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.34650|0.34650	-0.9820|-0.9820	7|10	.|0.12430	.|T	.|0.62	2.9342|2.9342	2.1581|2.1581	0.03818|0.03818	0.2824:0.3571:0.2483:0.1122|0.2824:0.3571:0.2483:0.1122	.|.	.|696	.|Q9UKY4	.|POMT2_HUMAN	A|R	48|696	ENSP00000451967:P48A|ENSP00000261534:P696R	.|ENSP00000261534:P696R	P|P	-|-	1|2	0|0	POMT2|POMT2	76814550|76814550	0.008000|0.008000	0.16893|0.16893	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	0.273000|0.273000	0.18662|0.18662	-0.667000|-0.667000	0.05303|0.05303	-0.211000|-0.211000	0.12701|0.12701	CCC|CCC	.		0.637	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
PRDM1	639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106554333	106554333	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr6:106554333C>T	ENST00000369096.4	+	6	2095	c.1861C>T	c.(1861-1863)Cac>Tac	p.H621Y	PRDM1_ENST00000369089.3_Missense_Mutation_p.H487Y|PRDM1_ENST00000369091.2_Missense_Mutation_p.H585Y	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	621					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CCTGCAGAAACACTACCTGGT	0.512			"""D, N, Mis, F, S"""		DLBCL																																p.H621Y		.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	862	0			c.C1861T						.						125.0	103.0	110.0					6																	106554333		2203	4300	6503	SO:0001583	missense	639	exon6			CAGAAACACTACC		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1861C>T	6.37:g.106554333C>T	ENSP00000358092:p.His621Tyr	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	36.0	NM_001198	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	C	32	5.118073	0.94385	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	D;D;D	0.86769	-2.17;-2.17;-2.17	5.44	5.44	0.79542	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.044901	0.85682	D	0.000000	D	0.95959	0.8684	H	0.97291	3.975	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.993;1.0	D	0.97286	0.9921	10	0.87932	D	0	-34.9218	18.0362	0.89303	0.0:1.0:0.0:0.0	.	487;621	Q86WM7;O75626	.;PRDM1_HUMAN	Y	585;621;584;487	ENSP00000358087:H585Y;ENSP00000358092:H621Y;ENSP00000358085:H487Y	ENSP00000358085:H487Y	H	+	1	0	PRDM1	106661026	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.692000	0.84203	2.569000	0.86673	0.655000	0.94253	CAC	.		0.512	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
PTK2	5747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	141874456	141874456	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr8:141874456G>C	ENST00000522684.1	-	5	634	c.405C>G	c.(403-405)aaC>aaG	p.N135K	PTK2_ENST00000395218.2_Missense_Mutation_p.N135K|PTK2_ENST00000535192.1_Missense_Mutation_p.N135K|PTK2_ENST00000519419.1_Missense_Mutation_p.N179K|PTK2_ENST00000340930.3_Missense_Mutation_p.N135K|PTK2_ENST00000521059.1_Missense_Mutation_p.N135K|PTK2_ENST00000517887.1_Missense_Mutation_p.N179K	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	135	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CAGTAAACTGGTTTAGAAATC	0.274																																					p.N157K		.											.	PTK2	1517	0			c.C471G						.						72.0	80.0	77.0					8																	141874456		2199	4291	6490	SO:0001583	missense	5747	exon5			AAACTGGTTTAGA	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.405C>G	8.37:g.141874456G>C	ENSP00000429911:p.Asn135Lys	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	32.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.87|12.87	2.066606|2.066606	0.36470|0.36470	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000340930;ENST00000519419;ENST00000520828;ENST00000520475|ENST00000519654	T;T;T;T;T;T;T;T;T|.	0.40476|.	1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03|.	5.27|5.27	4.39|4.39	0.52855|0.52855	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);|.	0.143624|.	0.64402|.	D|.	0.000009|.	T|T	0.42381|0.42381	0.1200|0.1200	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	B;P;B;B;B;B|.	0.35944|.	0.08;0.529;0.041;0.003;0.019;0.033|.	B;B;B;B;B;B|.	0.37422|.	0.051;0.249;0.051;0.026;0.036;0.043|.	T|T	0.22626|0.22626	-1.0211|-1.0211	10|5	0.56958|.	D|.	0.05|.	.|.	9.5112|9.5112	0.39078|0.39078	0.166:0.0:0.834:0.0|0.166:0.0:0.834:0.0	.|.	135;42;135;157;135;46|.	B4E2N6;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6|.	.;.;FAK1_HUMAN;.;.;.|.	K|A	135;135;179;135;45;135;42;135;179;34;135|146	ENSP00000429911:N135K;ENSP00000438009:N135K;ENSP00000429082:N179K;ENSP00000429474:N135K;ENSP00000378644:N135K;ENSP00000341189:N135K;ENSP00000429129:N179K;ENSP00000427762:N34K;ENSP00000428792:N135K|.	ENSP00000341189:N135K|.	N|P	-|-	3|1	2|0	PTK2|PTK2	141943638|141943638	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.013000|1.013000	0.29937|0.29937	1.207000|1.207000	0.43291|0.43291	0.313000|0.313000	0.20887|0.20887	AAC|CCA	.		0.274	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
PTPN13	5783	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	87655497	87655497	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr4:87655497A>G	ENST00000411767.2	+	13	1963	c.1900A>G	c.(1900-1902)Aaa>Gaa	p.K634E	PTPN13_ENST00000427191.2_Missense_Mutation_p.K634E|PTPN13_ENST00000316707.6_Missense_Mutation_p.K634E|PTPN13_ENST00000436978.1_Missense_Mutation_p.K634E|PTPN13_ENST00000511467.1_Missense_Mutation_p.K634E			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	634	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AAAATTAACCAAAGTGGCCCC	0.284																																					p.K634E		.											.	PTPN13	230	0			c.A1900G						.						51.0	49.0	49.0					4																	87655497		1788	4052	5840	SO:0001583	missense	5783	exon13			TTAACCAAAGTGG		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1900A>G	4.37:g.87655497A>G	ENSP00000407249:p.Lys634Glu	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	10.0	NM_006264	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.753677	0.89753	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99	5.99	5.99	0.97316	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.52532	D	0.000067	D	0.85600	0.5734	M	0.71296	2.17	0.80722	D	1	P;D;D;D	0.89917	0.675;1.0;1.0;1.0	P;D;D;D	0.91635	0.733;0.999;0.999;0.999	D	0.86184	0.1608	10	0.54805	T	0.06	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	634;634;634;634	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	E	634;634;634;634;634;602	ENSP00000408368:K634E;ENSP00000394794:K634E;ENSP00000322675:K634E;ENSP00000407249:K634E;ENSP00000426626:K634E	ENSP00000322675:K634E	K	+	1	0	PTPN13	87874521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.942000	0.92970	2.291000	0.77112	0.533000	0.62120	AAA	.		0.284	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
PTPRD	5789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	8504350	8504350	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr9:8504350T>C	ENST00000381196.4	-	20	2276	c.1733A>G	c.(1732-1734)aAc>aGc	p.N578S	PTPRD_ENST00000486161.1_Missense_Mutation_p.N578S|PTPRD_ENST00000358503.5_Missense_Mutation_p.N565S|PTPRD_ENST00000397606.3_Missense_Mutation_p.N568S|PTPRD_ENST00000540109.1_Missense_Mutation_p.N578S|PTPRD_ENST00000360074.4_Missense_Mutation_p.N565S|PTPRD_ENST00000537002.1_Missense_Mutation_p.N575S|PTPRD_ENST00000356435.5_Missense_Mutation_p.N578S|PTPRD_ENST00000355233.5_Missense_Mutation_p.N578S|PTPRD_ENST00000397611.3_Missense_Mutation_p.N575S|PTPRD_ENST00000397617.3_Missense_Mutation_p.N568S	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	578	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		GTATAAGCTGTTTGGTTTCAG	0.468										TSP Lung(15;0.13)																											p.N578S		.											.	PTPRD	912	0			c.A1733G						.						299.0	254.0	269.0					9																	8504350		2203	4300	6503	SO:0001583	missense	5789	exon12			AAGCTGTTTGGTT	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1733A>G	9.37:g.8504350T>C	ENSP00000370593:p.Asn578Ser	Somatic	348.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	41.0	NM_130392	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	37	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	T	13.13	2.144753	0.37825	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.53	5.53	0.82687	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.099895	0.64402	D	0.000002	T	0.52158	0.1717	L	0.35644	1.08	0.37285	D	0.908005	B;B;B;P;B;B;P;P;P	0.41265	0.361;0.361;0.018;0.542;0.003;0.312;0.744;0.744;0.613	B;B;B;B;B;B;P;P;P	0.47251	0.388;0.388;0.041;0.388;0.036;0.268;0.542;0.469;0.451	T	0.55617	-0.8113	9	.	.	.	.	15.6699	0.77264	0.0:0.0:0.0:1.0	.	568;572;578;578;575;575;565;578;578	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	S	578;578;565;565;578;568;575;575;578;578;578;568	ENSP00000370593:N578S;ENSP00000348812:N578S;ENSP00000353187:N565S;ENSP00000351293:N565S;ENSP00000347373:N578S;ENSP00000380741:N568S;ENSP00000380735:N575S;ENSP00000440515:N575S;ENSP00000438164:N578S;ENSP00000417093:N578S;ENSP00000380731:N568S	.	N	-	2	0	PTPRD	8494350	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.929000	0.63455	2.103000	0.63969	0.383000	0.25322	AAC	.		0.468	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
RBM39	9584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	34319990	34319990	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr20:34319990G>A	ENST00000253363.6	-	4	192	c.169C>T	c.(169-171)Cga>Tga	p.R57*	RBM39_ENST00000361162.6_Nonsense_Mutation_p.R57*|RBM39_ENST00000528062.3_Nonsense_Mutation_p.R57*|RBM39_ENST00000407261.4_5'UTR			Q14498	RBM39_HUMAN	RNA binding motif protein 39	57	Arg/Ser-rich (RS domain).				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TCTCTACTTCGCTTCCGTTCC	0.448																																					p.R57X		.											.	RBM39	91	0			c.C169T						.						196.0	169.0	178.0					20																	34319990		2203	4300	6503	SO:0001587	stop_gained	9584	exon4			TACTTCGCTTCCG	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.169C>T	20.37:g.34319990G>A	ENSP00000253363:p.Arg57*	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	18.0	NM_184234	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Nonsense_Mutation	SNP	ENST00000253363.6	37	CCDS13266.1	.	.	.	.	.	.	.	.	.	.	g	26.7	4.761005	0.89932	.	.	ENSG00000131051	ENST00000253363;ENST00000361162;ENST00000528062;ENST00000374038;ENST00000427743;ENST00000434927	.	.	.	5.9	2.63	0.31362	.	0.236945	0.40640	N	0.001049	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7554	0.69560	0.0:0.0:0.6008:0.3992	.	.	.	.	X	57	.	ENSP00000253363:R57X	R	-	1	2	RBM39	33783404	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.436000	0.52856	0.753000	0.32945	0.651000	0.88453	CGA	.		0.448	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2	NM_184237	
RPL23A	6147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	27049757	27049757	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:27049757A>G	ENST00000422514.2	+	3	839	c.226A>G	c.(226-228)Atc>Gtc	p.I76V	SNORD42A_ENST00000459584.1_RNA|RPL23A_ENST00000472628.1_5'UTR|SNORD42B_ENST00000458893.1_RNA|RPL23A_ENST00000394938.4_Missense_Mutation_p.I114V|AC010761.8_ENST00000582718.1_RNA|SNORD4B_ENST00000459083.1_RNA|RPL23A_ENST00000496182.1_5'UTR|SNORD4A_ENST00000459174.1_RNA	NM_000984.5	NP_000975.2	P62750	RL23A_HUMAN	ribosomal protein L23a	76					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(3)|ovary(1)	5	Lung NSC(42;0.00431)					CCACTATGCTATCATCAAGTT	0.502																																					p.I76V		.											.	RPL23A	91	0			c.A226G						.						67.0	67.0	67.0					17																	27049757		2203	4300	6503	SO:0001583	missense	6147	exon3			TATGCTATCATCA	U43701	CCDS11241.1	17q11.2	2011-04-06			ENSG00000198242	ENSG00000198242		"""L ribosomal proteins"""	10317	protein-coding gene	gene with protein product		602326				9417910	Standard	NM_000984		Approved	L23A	uc002hci.3	P62750	OTTHUMG00000132684	ENST00000422514.2:c.226A>G	17.37:g.27049757A>G	ENSP00000389103:p.Ile76Val	Somatic	351.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	84.0	NM_000984	B2R5B2|P29316|P39024|Q92774	Missense_Mutation	SNP	ENST00000422514.2	37	CCDS11241.1	.	.	.	.	.	.	.	.	.	.	A	19.23	3.787187	0.70337	.	.	ENSG00000198242	ENST00000422514;ENST00000394938;ENST00000394935	T;T	0.41400	1.0;1.0	5.17	5.17	0.71159	Ribosomal protein L23/L15e (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.36200	U	0.002730	T	0.37652	0.1011	L	0.28014	0.82	0.80722	D	1	B	0.24258	0.1	B	0.37387	0.248	T	0.21143	-1.0254	10	0.28530	T	0.3	2.3628	14.5334	0.67942	1.0:0.0:0.0:0.0	.	76	P62750	RL23A_HUMAN	V	76;114;78	ENSP00000389103:I76V;ENSP00000378396:I114V	ENSP00000378393:I78V	I	+	1	0	RPL23A	24073884	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.213000	0.95133	2.082000	0.62665	0.524000	0.50904	ATC	.		0.502	RPL23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255975.1	NM_000984	
RPTOR	57521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78857615	78857615	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:78857615G>A	ENST00000306801.3	+	16	2047	c.1685G>A	c.(1684-1686)tGc>tAc	p.C562Y	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Intron	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	562					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						ATTGCCATCTGCCTGGAGCAG	0.647																																					p.C562Y		.											.	RPTOR	847	0			c.G1685A						.						87.0	81.0	83.0					17																	78857615		2203	4300	6503	SO:0001583	missense	57521	exon16			CCATCTGCCTGGA		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.1685G>A	17.37:g.78857615G>A	ENSP00000307272:p.Cys562Tyr	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	17.0	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186631	0.78789	.	.	ENSG00000141564	ENST00000306801	T	0.35421	1.31	4.68	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.79339	-0.1844	10	0.87932	D	0	.	18.0063	0.89210	0.0:0.0:1.0:0.0	.	562	Q8N122	RPTOR_HUMAN	Y	562	ENSP00000307272:C562Y	ENSP00000307272:C562Y	C	+	2	0	RPTOR	76472210	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	9.159000	0.94728	2.322000	0.78497	0.558000	0.71614	TGC	.		0.647	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
SCNN1A	6337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6483876	6483876	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr12:6483876T>C	ENST00000228916.2	-	2	172	c.74A>G	c.(73-75)aAg>aGg	p.K25R	SCNN1A_ENST00000538979.1_Intron|SCNN1A_ENST00000396966.2_Missense_Mutation_p.K25R|SCNN1A_ENST00000358945.3_Missense_Mutation_p.K25R|LTBR_ENST00000539925.1_5'Flank|SCNN1A_ENST00000543768.1_Missense_Mutation_p.K48R|SCNN1A_ENST00000360168.3_Missense_Mutation_p.K84R	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	25					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	CTCCTCACGCTTGTTCCCCTT	0.657																																					p.K84R		.											.	SCNN1A	90	0			c.A251G						.						44.0	45.0	45.0					12																	6483876		2203	4300	6503	SO:0001583	missense	6337	exon1			TCACGCTTGTTCC	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.74A>G	12.37:g.6483876T>C	ENSP00000228916:p.Lys25Arg	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	16.0	NM_001159576	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	ENST00000228916.2	37	CCDS8543.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.906381	0.33628	.	.	ENSG00000111319	ENST00000360168;ENST00000358945;ENST00000228916;ENST00000396966;ENST00000543768;ENST00000536788	T;T;T;T;T;D	0.86432	-0.47;-0.52;-0.46;-0.14;-0.45;-2.12	4.95	3.8	0.43715	.	0.414043	0.23079	N	0.052175	T	0.81569	0.4850	M	0.64997	1.995	0.09310	N	1	P;B;B	0.35077	0.483;0.164;0.418	B;B;B	0.27887	0.084;0.06;0.083	T	0.72197	-0.4363	10	0.46703	T	0.11	-21.2032	7.4973	0.27496	0.0:0.0997:0.0:0.9003	.	48;25;84	B4E2Q5;P37088;P37088-2	.;SCNNA_HUMAN;.	R	84;25;25;25;48;46	ENSP00000353292:K84R;ENSP00000351825:K25R;ENSP00000228916:K25R;ENSP00000380166:K25R;ENSP00000438739:K48R;ENSP00000443434:K46R	ENSP00000228916:K25R	K	-	2	0	SCNN1A	6354137	0.008000	0.16893	0.005000	0.12908	0.111000	0.19643	1.341000	0.33907	0.739000	0.32628	0.482000	0.46254	AAG	.		0.657	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399055.1		
SHANK3	85358	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	51169547	51169547	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr22:51169547G>T	ENST00000414786.2	+	23	5215	c.4988G>T	c.(4987-4989)tGg>tTg	p.W1663L	SHANK3_ENST00000445220.2_Missense_Mutation_p.W1679L|SHANK3_ENST00000262795.3_Missense_Mutation_p.W1684L			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	1668					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CTGCAGCTCTGGAGCAAGTTC	0.736																																					p.W1654L		.											.	SHANK3	69	0			c.G4961T						.						3.0	4.0	4.0					22																	51169547		1427	2924	4351	SO:0001583	missense	85358	exon22			AGCTCTGGAGCAA	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.4988G>T	22.37:g.51169547G>T	ENSP00000464552:p.Trp1663Leu	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	5.0	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	37		.	.	.	.	.	.	.	.	.	.	G	25.5	4.641109	0.87859	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.74526	-0.85;-0.85	3.86	3.86	0.44501	.	0.135838	0.53938	D	0.000051	D	0.90648	0.7067	H	0.97852	4.09	0.37566	D	0.919243	D	0.76494	0.999	D	0.87578	0.998	D	0.94697	0.7879	10	0.87932	D	0	.	13.3157	0.60405	0.0:0.0:1.0:0.0	.	1684	F2Z3L0	.	L	1684;1679	ENSP00000442518:W1684L;ENSP00000446078:W1679L	ENSP00000442518:W1684L	W	+	2	0	SHANK3	49516413	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.985000	0.93487	1.986000	0.57962	0.305000	0.20034	TGG	.		0.736	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
SHISA6	388336	broad.mit.edu;ucsc.edu	37	17	11166793	11166793	+	Nonsense_Mutation	SNP	C	C	A	rs267604730		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:11166793C>A	ENST00000409168.3	+	2	749	c.749C>A	c.(748-750)tCg>tAg	p.S250*	SHISA6_ENST00000441885.3_Nonsense_Mutation_p.S250*|SHISA6_ENST00000432116.3_Nonsense_Mutation_p.S250*	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	250				S -> P (in Ref. 3; AAY68487). {ECO:0000305}.		alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						CCGGTCAGATCGTCCTCCAAA	0.507																																					p.S250X		.											.	SHISA6	67	0			c.C749A						.						196.0	158.0	169.0					17																	11166793		692	1591	2283	SO:0001587	stop_gained	388336	exon2			TCAGATCGTCCTC	AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.749C>A	17.37:g.11166793C>A	ENSP00000387157:p.Ser250*	Somatic	344.0	2.0		WXS	Illumina HiSeq	Phase_I	94.0	34.0	NM_207386	B3KXV5|Q4PL63	Nonsense_Mutation	SNP	ENST00000409168.3	37	CCDS54090.1	.	.	.	.	.	.	.	.	.	.	C	40	8.093127	0.98651	.	.	ENSG00000188803	ENST00000441885;ENST00000432116;ENST00000409168;ENST00000343478	.	.	.	5.86	5.86	0.93980	.	0.073236	0.53938	D	0.000060	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	16.0536	0.80779	0.0:1.0:0.0:0.0	.	.	.	.	X	250;250;250;148	.	ENSP00000340821:S148X	S	+	2	0	SHISA6	11107518	1.000000	0.71417	0.978000	0.43139	0.988000	0.76386	5.402000	0.66332	2.937000	0.99478	0.650000	0.86243	TCG	.		0.507	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000333970.2	NM_207386	
SLC13A4	26266	hgsc.bcm.edu;mdanderson.org	37	7	135412217	135412217	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:135412217C>T	ENST00000354042.4	-	1	717	c.28G>A	c.(28-30)Gtc>Atc	p.V10I	FAM180A_ENST00000435869.1_5'Flank	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	10					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						AGCTTCCGGACTCGGAGCAGG	0.701																																					p.V10I		.											.	SLC13A4	90	0			c.G28A						.						28.0	26.0	27.0					7																	135412217		1909	3624	5533	SO:0001583	missense	26266	exon1			TCCGGACTCGGAG	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.28G>A	7.37:g.135412217C>T	ENSP00000297282:p.Val10Ile	Somatic	8.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	11.0	NM_012450	A4D1Q4|Q8N631	Missense_Mutation	SNP	ENST00000354042.4	37	CCDS5840.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262391	0.59431	.	.	ENSG00000164707	ENST00000354042	T	0.68025	-0.3	5.67	4.78	0.61160	.	0.407167	0.26560	N	0.023688	T	0.45478	0.1344	N	0.08118	0	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.33317	-0.9873	10	0.34782	T	0.22	.	11.5152	0.50518	0.3258:0.6742:0.0:0.0	.	10	Q9UKG4	S13A4_HUMAN	I	10	ENSP00000297282:V10I	ENSP00000297282:V10I	V	-	1	0	SLC13A4	135062757	0.636000	0.27207	0.006000	0.13384	0.663000	0.39108	2.281000	0.43452	1.359000	0.45940	0.655000	0.94253	GTC	.		0.701	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
SLC24A2	25769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	19516230	19516230	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr9:19516230A>T	ENST00000341998.2	-	10	1968	c.1907T>A	c.(1906-1908)aTg>aAg	p.M636K	SLC24A2_ENST00000286344.3_Missense_Mutation_p.M619K	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	636					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GAGGCCAAACATGATGAAGCC	0.483																																					p.M636K		.											.	SLC24A2	517	0			c.T1907A						.						159.0	149.0	152.0					9																	19516230		2203	4300	6503	SO:0001583	missense	25769	exon10			CCAAACATGATGA	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1907T>A	9.37:g.19516230A>T	ENSP00000344801:p.Met636Lys	Somatic	267.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	34.0	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450050	0.84101	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.64991	-0.13;-0.13	5.21	5.21	0.72293	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.85427	0.5694	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90234	0.4281	9	.	.	.	.	15.1006	0.72273	1.0:0.0:0.0:0.0	.	619;636	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	K	636;619	ENSP00000344801:M636K;ENSP00000286344:M619K	.	M	-	2	0	SLC24A2	19506230	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.282000	0.95840	1.975000	0.57531	0.533000	0.62120	ATG	.		0.483	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
SLC7A9	11136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33324221	33324221	+	Silent	SNP	T	T	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr19:33324221T>A	ENST00000023064.4	-	12	1424	c.1233A>T	c.(1231-1233)gtA>gtT	p.V411V	SLC7A9_ENST00000587772.1_Silent_p.V411V|CTD-2085J24.3_ENST00000590069.1_RNA|SLC7A9_ENST00000590341.1_Silent_p.V411V	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	411					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	CGGGAATGACTACGGGCACCT	0.408																																					p.V411V	GBM(181;1335 2108 9644 44178 46689)	.											.	SLC7A9	91	0			c.A1233T						.						73.0	77.0	76.0					19																	33324221		2203	4300	6503	SO:0001819	synonymous_variant	11136	exon12			AATGACTACGGGC	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.1233A>T	19.37:g.33324221T>A		Somatic	430.0	1.0		WXS	Illumina HiSeq	Phase_I	152.0	45.0	NM_001243036	B2R9A6	Silent	SNP	ENST00000023064.4	37	CCDS12425.1																																																																																			.		0.408	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
SLC8A3	6547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	70634240	70634240	+	Silent	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr14:70634240G>A	ENST00000381269.2	-	2	1653	c.900C>T	c.(898-900)aaC>aaT	p.N300N	SLC8A3_ENST00000356921.2_Silent_p.N300N|SLC8A3_ENST00000528359.1_Silent_p.N300N|SLC8A3_ENST00000357887.3_Silent_p.N300N|SLC8A3_ENST00000534137.1_Silent_p.N300N	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	300					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GGGGCACCAGGTTCCCATCTA	0.483																																					p.N300N		.											.	SLC8A3	225	0			c.C900T						.						114.0	106.0	109.0					14																	70634240		2203	4300	6503	SO:0001819	synonymous_variant	6547	exon2			CACCAGGTTCCCA	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.900C>T	14.37:g.70634240G>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	7.0	NM_183002	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1																																																																																			.		0.483	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
SLITRK5	26050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	88330185	88330185	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr13:88330185G>A	ENST00000325089.6	+	2	2761	c.2542G>A	c.(2542-2544)Gtg>Atg	p.V848M	SLITRK5_ENST00000400028.3_Missense_Mutation_p.V607M	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	848					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GCTGTCGCCGGTGCAGGACGC	0.647																																					p.V848M		.											.	SLITRK5	94	0			c.G2542A						.						25.0	26.0	26.0					13																	88330185		2200	4300	6500	SO:0001583	missense	26050	exon2			TCGCCGGTGCAGG	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2542G>A	13.37:g.88330185G>A	ENSP00000366283:p.Val848Met	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	18.0	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	G	9.997	1.232443	0.22626	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.60040	0.22;0.56	5.57	4.54	0.55810	.	0.321942	0.27227	N	0.020325	T	0.47451	0.1446	L	0.44542	1.39	0.45806	D	0.998687	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.35351	-0.9792	9	.	.	.	-15.9477	12.5881	0.56428	0.0941:0.0:0.9059:0.0	.	607;848	B4DSH5;O94991	.;SLIK5_HUMAN	M	848;607	ENSP00000366283:V848M;ENSP00000442244:V607M	.	V	+	1	0	SLITRK5	87128186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.740000	0.55082	2.618000	0.88619	0.561000	0.74099	GTG	.		0.647	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
SOX9	6662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	70119055	70119055	+	Silent	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:70119055C>T	ENST00000245479.2	+	2	999	c.627C>T	c.(625-627)gcC>gcT	p.A209A		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	209					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			CGCTGCAGGCCGACTCGCCAC	0.687																																					p.A209A	Pancreas(42;83 1041 2320 35205 39456)	.											.	SOX9	514	0			c.C627T						.						65.0	71.0	69.0					17																	70119055		2203	4300	6503	SO:0001819	synonymous_variant	6662	exon2			GCAGGCCGACTCG	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.627C>T	17.37:g.70119055C>T		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	49.0	NM_000346	Q53Y80	Silent	SNP	ENST00000245479.2	37	CCDS11689.1																																																																																			.		0.687	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
SPG20	23111	bcgsc.ca;mdanderson.org	37	13	36939921	36939921	+	Intron	SNP	G	G	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr13:36939921G>C	ENST00000355182.4	-	1	92				SPG20OS_ENST00000379848.2_Missense_Mutation_p.G25R	NM_001142294.1	NP_001135766.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)						abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		gaatatttgtggaatgcatgG	0.443																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	100507135	.			ATTTGTGGAATGC	AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000355182.4:c.1+4304C>G	13.37:g.36939921G>C		Somatic	282.0	0.0		WXS	Illumina HiSeq	Phase_1	90.0	15.0	.	O60349|Q86Y67|Q9H1T2|Q9H1T3	RNA	SNP	ENST00000355182.4	37	CCDS9356.1	.	.	.	.	.	.	.	.	.	.	G	4.630	0.117046	0.08881	.	.	ENSG00000120664	ENST00000379848	.	.	.	3.03	-0.377	0.12501	.	.	.	.	.	T	0.34948	0.0915	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38134	-0.9675	5	0.87932	D	0	.	3.2232	0.06723	0.1444:0.0:0.3987:0.4569	.	.	.	.	R	25	.	ENSP00000369177:G25R	G	+	1	0	SPG20OS	35837921	0.070000	0.21116	0.002000	0.10522	0.004000	0.04260	1.129000	0.31381	0.097000	0.17492	0.460000	0.39030	GGA	.		0.443	SPG20-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044494.2		
SREBF2	6721	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	42271606	42271606	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr22:42271606G>A	ENST00000361204.4	+	7	1430	c.1264G>A	c.(1264-1266)Gag>Aag	p.E422K		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	422	Interaction with LMNA. {ECO:0000250}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CCTGAAGATCGAGGACTTTAA	0.517																																					p.E422K		.											.	SREBF2	154	0			c.G1264A						.						134.0	134.0	134.0					22																	42271606		2203	4300	6503	SO:0001583	missense	6721	exon7			AAGATCGAGGACT	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1264G>A	22.37:g.42271606G>A	ENSP00000354476:p.Glu422Lys	Somatic	253.0	1.0		WXS	Illumina HiSeq	Phase_I	88.0	13.0	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	37	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	G	16.81	3.224507	0.58668	.	.	ENSG00000198911	ENST00000361204;ENST00000444813;ENST00000457567	T	0.54866	0.55	5.95	5.95	0.96441	.	0.129181	0.64402	D	0.000001	T	0.48607	0.1509	L	0.39245	1.2	0.26705	N	0.971086	B	0.25105	0.118	B	0.11329	0.006	T	0.45818	-0.9235	10	0.59425	D	0.04	-9.3545	20.3854	0.98941	0.0:0.0:1.0:0.0	.	422	Q12772	SRBP2_HUMAN	K	422	ENSP00000354476:E422K	ENSP00000354476:E422K	E	+	1	0	SREBF2	40601552	1.000000	0.71417	0.965000	0.40720	0.988000	0.76386	3.913000	0.56394	2.825000	0.97269	0.655000	0.94253	GAG	.		0.517	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
SUMF2	25870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	56140741	56140741	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:56140741G>C	ENST00000413756.1	+	3	299	c.276G>C	c.(274-276)tgG>tgC	p.W92C	SUMF2_ENST00000437307.2_Missense_Mutation_p.W92C|SUMF2_ENST00000395435.2_Missense_Mutation_p.W111C|SUMF2_ENST00000395436.2_Missense_Mutation_p.W111C|SUMF2_ENST00000434526.2_Missense_Mutation_p.W111C|SUMF2_ENST00000342190.6_Missense_Mutation_p.W111C|SUMF2_ENST00000275607.9_Missense_Mutation_p.W4C			Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2	92					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	14	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGTTTGGATGGAGCTTTGTCT	0.483																																					p.W111C		.											.	SUMF2	92	0			c.G333C						.						139.0	138.0	138.0					7																	56140741		2203	4300	6503	SO:0001583	missense	25870	exon3			TGGATGGAGCTTT	AK075477	CCDS5524.2, CCDS43588.2, CCDS43589.2, CCDS47589.1, CCDS55111.1	7q11.1	2004-04-30			ENSG00000129103	ENSG00000129103			20415	protein-coding gene	gene with protein product		607940				12757706	Standard	NM_015411		Approved	DKFZp566I1024	uc003trv.3	Q8NBJ7	OTTHUMG00000129373	ENST00000413756.1:c.276G>C	7.37:g.56140741G>C	ENSP00000406445:p.Trp92Cys	Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	20.0	NM_015411	B4DU41|B4DWQ0|Q14DW5|Q53ZE3|Q96BH2|Q9BRN3|Q9BWI1|Q9Y405	Missense_Mutation	SNP	ENST00000413756.1	37		.	.	.	.	.	.	.	.	.	.	G	19.37	3.814731	0.70912	.	.	ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000275607;ENST00000395435;ENST00000413952;ENST00000342190;ENST00000437307;ENST00000413756;ENST00000451338	T;T;T;D;T;T;T;T;T	0.95035	0.97;0.97;0.97;-3.59;0.97;0.97;0.97;0.97;0.97	5.24	4.36	0.52297	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.051131	0.85682	D	0.000000	D	0.97604	0.9215	M	0.92833	3.35	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.988;1.0	D;D;D;D;P;D	0.85130	0.997;0.993;0.993;0.993;0.714;0.992	D	0.97665	1.0163	10	0.40728	T	0.16	-19.5055	13.8015	0.63204	0.075:0.0:0.925:0.0	.	92;111;114;92;111;114	Q8NBJ7-5;A8MXB9;E7EMF9;Q8NBJ7;F8WA42;C9JL30	.;.;.;SUMF2_HUMAN;.;.	C	111;111;4;111;114;111;92;92;89	ENSP00000378824:W111C;ENSP00000400922:W111C;ENSP00000275607:W4C;ENSP00000378823:W111C;ENSP00000414434:W114C;ENSP00000341938:W111C;ENSP00000415989:W92C;ENSP00000406445:W92C;ENSP00000410796:W89C	ENSP00000275607:W4C	W	+	3	0	SUMF2	56108235	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.312000	0.78968	1.531000	0.49152	0.655000	0.94253	TGG	.		0.483	SUMF2-013	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000341457.2	NM_015411	
SUPV3L1	6832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70955011	70955011	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr10:70955011A>T	ENST00000359655.4	+	7	981	c.921A>T	c.(919-921)agA>agT	p.R307S		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	307	Helicase ATP-binding.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCTGGACCAGAGCACTTCTAG	0.408																																					p.R307S		.											.	SUPV3L1	227	0			c.A921T						.						77.0	77.0	77.0					10																	70955011		2203	4300	6503	SO:0001583	missense	6832	exon7			GACCAGAGCACTT	AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.921A>T	10.37:g.70955011A>T	ENSP00000352678:p.Arg307Ser	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	20.0	NM_003171	A8K301|O43630	Missense_Mutation	SNP	ENST00000359655.4	37	CCDS7287.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.408968	0.83340	.	.	ENSG00000156502	ENST00000359655;ENST00000422378	T;T	0.33654	1.4;1.43	5.82	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.64638	0.2616	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69950	-0.5006	10	0.87932	D	0	-22.1198	10.4492	0.44511	0.8653:0.0:0.1347:0.0	.	307	Q8IYB8	SUV3_HUMAN	S	307;113	ENSP00000352678:R307S;ENSP00000409072:R113S	ENSP00000352678:R307S	R	+	3	2	SUPV3L1	70625017	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.559000	0.60796	1.043000	0.40175	0.528000	0.53228	AGA	.		0.408	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048396.2	NM_003171	
SYAP1	94056	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	16761852	16761852	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chrX:16761852C>A	ENST00000380155.3	+	5	557	c.464C>A	c.(463-465)cCg>cAg	p.P155Q		NM_032796.3	NP_116185.2	Q96A49	SYAP1_HUMAN	synapse associated protein 1	155						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				endometrium(3)|lung(4)|pancreas(1)|prostate(1)|skin(1)	10	Hepatocellular(33;0.0997)					CGTGACCCTCCGGCTGGCGTG	0.413																																					p.P155Q		.											.	SYAP1	131	0			c.C464A						.						154.0	148.0	150.0					X																	16761852		2203	4300	6503	SO:0001583	missense	94056	exon5			ACCCTCCGGCTGG	AF338728	CCDS14177.1	Xp22.31	2010-06-25	2010-06-25		ENSG00000169895	ENSG00000169895			16273	protein-coding gene	gene with protein product	"""SAP47 homolog (Drosophila)"""					11483580	Standard	NM_032796		Approved	FLJ14495, PRO3113	uc004cxp.3	Q96A49	OTTHUMG00000021192	ENST00000380155.3:c.464C>A	X.37:g.16761852C>A	ENSP00000369500:p.Pro155Gln	Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	23.0	15.0	NM_032796	Q68CP1|Q96C60|Q96JQ6|Q96T20	Missense_Mutation	SNP	ENST00000380155.3	37	CCDS14177.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879336	0.72294	.	.	ENSG00000169895	ENST00000380155	.	.	.	5.31	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.80319	0.4601	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82810	-0.0273	9	0.66056	D	0.02	.	13.3649	0.60678	0.0:0.9221:0.0:0.0779	.	121;155;155	B4E1C9;Q96A49;B2RBI2	.;SYAP1_HUMAN;.	Q	155	.	ENSP00000369500:P155Q	P	+	2	0	SYAP1	16671773	1.000000	0.71417	0.874000	0.34290	0.583000	0.36354	7.549000	0.82163	1.022000	0.39626	0.502000	0.49764	CCG	.		0.413	SYAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055904.1	NM_032796	
TC2N	123036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	92265340	92265340	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr14:92265340T>G	ENST00000435962.2	-	6	953	c.630A>C	c.(628-630)agA>agC	p.R210S	TC2N_ENST00000556018.1_Missense_Mutation_p.R210S|TC2N_ENST00000340892.5_Missense_Mutation_p.R210S|TC2N_ENST00000360594.5_Missense_Mutation_p.R210S	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	210					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		TACCCAGGCTTCTGTTACTCC	0.313																																					p.R210S		.											.	TC2N	69	0			c.A630C						.						45.0	48.0	47.0					14																	92265340		2203	4293	6496	SO:0001583	missense	123036	exon6			CAGGCTTCTGTTA	AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.630A>C	14.37:g.92265340T>G	ENSP00000387882:p.Arg210Ser	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	7.0	NM_001128596		Missense_Mutation	SNP	ENST00000435962.2	37	CCDS9897.1	.	.	.	.	.	.	.	.	.	.	T	12.36	1.913397	0.33815	.	.	ENSG00000165929	ENST00000435962;ENST00000340892;ENST00000360594;ENST00000556018;ENST00000556590	T;T;T;T;T	0.21734	3.37;3.37;3.37;2.26;1.99	5.13	1.45	0.22620	.	0.059245	0.64402	D	0.000002	T	0.24699	0.0599	L	0.27053	0.805	0.45733	D	0.998635	P;D	0.76494	0.948;0.999	P;D	0.80764	0.701;0.994	T	0.05733	-1.0867	10	0.17369	T	0.5	-20.5146	7.6139	0.28145	0.0:0.3795:0.0:0.6205	.	210;210	Q8N9U0-2;Q8N9U0	.;TAC2N_HUMAN	S	210;210;210;210;1	ENSP00000387882:R210S;ENSP00000343199:R210S;ENSP00000353802:R210S;ENSP00000451317:R210S;ENSP00000450922:R1S	ENSP00000343199:R210S	R	-	3	2	TC2N	91335093	1.000000	0.71417	1.000000	0.80357	0.002000	0.02628	1.163000	0.31798	0.267000	0.21916	-0.456000	0.05471	AGA	.		0.313	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411778.1	NM_152332	
TCEAL8	90843	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	102508744	102508744	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chrX:102508744T>C	ENST00000372685.3	-	3	400	c.164A>G	c.(163-165)aAt>aGt	p.N55S	TCEAL8_ENST00000360000.4_Missense_Mutation_p.N55S	NM_153333.2	NP_699164.1	Q8IYN2	TCAL8_HUMAN	transcription elongation factor A (SII)-like 8	55					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(2)|lung(1)|ovary(1)	4						GCCAGGCTGATTCGGCCCTCC	0.522																																					p.N55S		.											.	TCEAL8	131	0			c.A164G						.						166.0	143.0	151.0					X																	102508744		2203	4300	6503	SO:0001583	missense	90843	exon2			GGCTGATTCGGCC	AL833632	CCDS14504.1	Xq22.1	2014-03-21			ENSG00000180964	ENSG00000180964			28683	protein-coding gene	gene with protein product						16221301	Standard	NM_001006684		Approved	MGC45400, WEX3	uc004ejy.3	Q8IYN2	OTTHUMG00000022094	ENST00000372685.3:c.164A>G	X.37:g.102508744T>C	ENSP00000361770:p.Asn55Ser	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_001006684		Missense_Mutation	SNP	ENST00000372685.3	37	CCDS14504.1	.	.	.	.	.	.	.	.	.	.	T	0.045	-1.269034	0.01433	.	.	ENSG00000180964	ENST00000360000;ENST00000372685	T;T	0.09073	3.02;3.02	4.52	-3.78	0.04333	.	1.008970	0.07967	N	0.983309	T	0.03871	0.0109	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43782	-0.9370	10	0.37606	T	0.19	-0.0505	6.925	0.24410	0.616:0.0:0.2472:0.1367	.	55	Q8IYN2	TCAL8_HUMAN	S	55	ENSP00000353093:N55S;ENSP00000361770:N55S	ENSP00000353093:N55S	N	-	2	0	TCEAL8	102395400	0.002000	0.14202	0.000000	0.03702	0.063000	0.16089	-0.118000	0.10692	-1.214000	0.02614	-0.991000	0.02546	AAT	.		0.522	TCEAL8-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057698.1	NM_153333	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578513	7578513	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:7578513C>A	ENST00000269305.4	-	5	606	c.417G>T	c.(415-417)aaG>aaT	p.K139N	TP53_ENST00000455263.2_Missense_Mutation_p.K139N|TP53_ENST00000420246.2_Missense_Mutation_p.K139N|TP53_ENST00000413465.2_Missense_Mutation_p.K139N|TP53_ENST00000359597.4_Missense_Mutation_p.K139N|TP53_ENST00000445888.2_Missense_Mutation_p.K139N|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	139	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:14660794}.|K -> Q (in sporadic cancers; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K139N(9)|p.0?(8)|p.K139K(7)|p.A138_P142delAKTCP(4)|p.C135fs*9(3)|p.K139_T140delKT(3)|p.N131fs*27(2)|p.L137_W146del10(1)|p.K139fs*9(1)|p.K46_T47delKT(1)|p.F134_T140>S(1)|p.A45_P49delAKTCP(1)|p.K7_T8delKT(1)|p.C3fs*9(1)|p.A6_P10delAKTCP(1)|p.A138_V143delAKTCPV(1)|p.K139fs*10(1)|p.K139fs*4(1)|p.C42fs*9(1)|p.Q136_K139delQLAK(1)|p.K139_C141>N(1)|p.C135_T140delCQLAKT(1)|p.K139fs*29(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGGCAGGTCTTGGCCAGTT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.K139N	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,arm,other,-2	TP53	70225	52	Deletion - In frame(15)|Deletion - Frameshift(9)|Substitution - Missense(9)|Whole gene deletion(8)|Substitution - coding silent(7)|Complex - deletion inframe(2)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(10)|ovary(9)|urinary_tract(6)|NS(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|lung(3)|upper_aerodigestive_tract(2)|oesophagus(2)|stomach(1)|soft_tissue(1)|skin(1)	c.G417T						.						55.0	55.0	55.0					17																	7578513		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCAGGTCTTGGCC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.417G>T	17.37:g.7578513C>A	ENSP00000269305:p.Lys139Asn	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	24.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702835	0.48307	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99818	-6.92;-6.92;-6.92;-6.92;-6.92;-6.92;-6.92;-6.92;-6.92	5.39	3.4	0.38934	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99704	0.9887	M	0.77406	2.37	0.58432	D	0.999991	P;D;D;P;D;P;P	0.69078	0.852;0.957;0.997;0.669;0.966;0.7;0.685	B;P;D;B;D;P;B	0.71414	0.426;0.831;0.973;0.211;0.928;0.894;0.187	D	0.97999	1.0359	10	0.87932	D	0	-25.2607	10.6631	0.45714	0.0:0.8408:0.0:0.1592	.	100;139;139;46;139;139;139	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	139;139;139;139;139;139;128;46;7;46;7;139	ENSP00000410739:K139N;ENSP00000352610:K139N;ENSP00000269305:K139N;ENSP00000398846:K139N;ENSP00000391127:K139N;ENSP00000391478:K139N;ENSP00000425104:K7N;ENSP00000423862:K46N;ENSP00000424104:K139N	ENSP00000269305:K139N	K	-	3	2	TP53	7519238	0.972000	0.33761	0.996000	0.52242	0.061000	0.15899	0.226000	0.17776	0.766000	0.33244	-0.137000	0.14449	AAG	.		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TEX2	55852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	62230425	62230425	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:62230425T>A	ENST00000583097.1	-	10	3192	c.3020A>T	c.(3019-3021)gAg>gTg	p.E1007V	TEX2_ENST00000581812.1_5'UTR|TEX2_ENST00000584379.1_Missense_Mutation_p.E1007V|TEX2_ENST00000258991.3_Missense_Mutation_p.E1014V			Q8IWB9	TEX2_HUMAN	testis expressed 2	1007					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TTTAATAAACTCTGTCTCTGT	0.393																																					p.E1014V		.											.	TEX2	91	0			c.A3041T						.						154.0	148.0	150.0					17																	62230425		2203	4300	6503	SO:0001583	missense	55852	exon10			ATAAACTCTGTCT	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.3020A>T	17.37:g.62230425T>A	ENSP00000462665:p.Glu1007Val	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	28.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	37		.	.	.	.	.	.	.	.	.	.	T	15.46	2.840874	0.51057	.	.	ENSG00000136478	ENST00000258991	T	0.52295	0.67	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.68796	0.3040	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.986	T	0.71866	-0.4463	10	0.87932	D	0	-23.7859	16.5582	0.84512	0.0:0.0:0.0:1.0	.	1014;1007	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	V	1014	ENSP00000258991:E1014V	ENSP00000258991:E1014V	E	-	2	0	TEX2	59584157	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.698000	0.84413	2.308000	0.77769	0.533000	0.62120	GAG	.		0.393	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
TTI1	9675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36634716	36634716	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr20:36634716G>A	ENST00000373448.2	-	4	2624	c.2386C>T	c.(2386-2388)Cca>Tca	p.P796S	TTI1_ENST00000449821.1_Missense_Mutation_p.P796S|TTI1_ENST00000373447.3_Missense_Mutation_p.P796S	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	796					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						AGAGCTGCTGGTCTTTGGTTC	0.463																																					p.P796S		.											.	TTI1	94	0			c.C2386T						.						241.0	214.0	223.0					20																	36634716		2203	4300	6503	SO:0001583	missense	9675	exon4			CTGCTGGTCTTTG	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.2386C>T	20.37:g.36634716G>A	ENSP00000362547:p.Pro796Ser	Somatic	203.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	32.0	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	G	5.811	0.333841	0.11013	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.64991	-0.13;-0.13;-0.13	5.1	-3.88	0.04205	Armadillo-type fold (1);	0.741186	0.13471	N	0.385408	T	0.33177	0.0854	N	0.20401	0.57	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.26916	-1.0089	10	0.09084	T	0.74	1.5961	3.989	0.09529	0.1737:0.501:0.1975:0.1278	.	796	O43156	TTI1_HUMAN	S	796	ENSP00000362547:P796S;ENSP00000362546:P796S;ENSP00000407270:P796S	ENSP00000362546:P796S	P	-	1	0	TTI1	36068130	0.005000	0.15991	0.000000	0.03702	0.109000	0.19521	0.701000	0.25616	-0.498000	0.06632	0.557000	0.71058	CCA	.		0.463	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
TUBGCP5	114791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	22848249	22848249	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr15:22848249G>T	ENST00000283645.4	+	9	969	c.839G>T	c.(838-840)gGa>gTa	p.G280V	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.G280V	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	280					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		TTACTTTCAGGAGTGAAAAAG	0.284																																					p.G280V		.											.	TUBGCP5	91	0			c.G839T						.						78.0	88.0	85.0					15																	22848249		2203	4299	6502	SO:0001583	missense	114791	exon9			TTTCAGGAGTGAA	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.839G>T	15.37:g.22848249G>T	ENSP00000283645:p.Gly280Val	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	11.0	NM_052903	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	ENST00000283645.4	37	CCDS10008.1	.	.	.	.	.	.	.	.	.	.	.	18.35	3.605398	0.66445	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.60299	0.2;0.2	5.33	5.33	0.75918	.	0.058834	0.64402	D	0.000002	T	0.74061	0.3667	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73369	-0.4004	10	0.51188	T	0.08	-21.8386	19.2171	0.93782	0.0:0.0:1.0:0.0	.	280;280	Q96RT8;E9PB12	GCP5_HUMAN;.	V	280	ENSP00000283645:G280V;ENSP00000409217:G280V	ENSP00000283645:G280V	G	+	2	0	TUBGCP5	20399690	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.737000	0.74816	2.771000	0.95319	0.650000	0.86243	GGA	.		0.284	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250998.2	NM_052903	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19483269	19483269	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr1:19483269C>T	ENST00000375254.3	-	41	5938	c.5911G>A	c.(5911-5913)Ggg>Agg	p.G1971R	UBR4_ENST00000375267.2_Missense_Mutation_p.G1971R|UBR4_ENST00000375217.2_Missense_Mutation_p.G1971R|UBR4_ENST00000375226.2_Missense_Mutation_p.G1971R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1971					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACCTTTAGCCCACAAACCGCC	0.453																																					p.G1971R		.											.	UBR4	612	0			c.G5911A						.						90.0	92.0	91.0					1																	19483269		2203	4300	6503	SO:0001583	missense	23352	exon41			TTAGCCCACAAAC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.5911G>A	1.37:g.19483269C>T	ENSP00000364403:p.Gly1971Arg	Somatic	352.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	82.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996249	0.93167	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;3.05	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.53481	0.1799	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.57225	-0.7848	10	0.87932	D	0	.	19.8856	0.96911	0.0:1.0:0.0:0.0	.	1971	Q5T4S7	UBR4_HUMAN	R	1971;1971;1971;1971;681;1187	ENSP00000364403:G1971R;ENSP00000364416:G1971R;ENSP00000364365:G1971R;ENSP00000364374:G1971R;ENSP00000404897:G681R	ENSP00000364365:G1971R	G	-	1	0	UBR4	19355856	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.298000	0.78815	2.709000	0.92574	0.491000	0.48974	GGG	.		0.453	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
UNC45B	146862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33486394	33486394	+	Splice_Site	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr17:33486394A>G	ENST00000268876.5	+	8	906	c.809A>G	c.(808-810)gAc>gGc	p.D270G	UNC45B_ENST00000591048.1_Splice_Site_p.D270G|UNC45B_ENST00000433649.1_Splice_Site_p.D270G|UNC45B_ENST00000378449.1_Splice_Site_p.D270G|UNC45B_ENST00000394570.2_Splice_Site_p.D270G	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	270					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TTTTCTTCAGACACCAAGAAG	0.512																																					p.D270G		.											.	UNC45B	157	0			c.A809G						.						213.0	231.0	225.0					17																	33486394		2203	4300	6503	SO:0001630	splice_region_variant	146862	exon8			CTTCAGACACCAA	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.809-1A>G	17.37:g.33486394A>G		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	22.0	NM_001267052	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593830	0.86953	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.52983	0.64;3.16;0.64;3.15	5.87	5.87	0.94306	Armadillo-like helical (1);Armadillo-type fold (1);	0.096185	0.64402	D	0.000001	T	0.59432	0.2193	M	0.68952	2.095	0.80722	D	1	P;P;P	0.50156	0.845;0.932;0.897	P;P;P	0.52454	0.699;0.576;0.469	T	0.59413	-0.7459	9	.	.	.	.	15.7569	0.78037	1.0:0.0:0.0:0.0	.	270;270;270	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	G	270	ENSP00000378071:D270G;ENSP00000268876:D270G;ENSP00000412840:D270G;ENSP00000367710:D270G	.	D	+	2	0	UNC45B	30510507	1.000000	0.71417	0.723000	0.30687	0.971000	0.66376	8.948000	0.93006	2.371000	0.80710	0.533000	0.62120	GAC	.		0.512	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	Missense_Mutation
URGCP	55665	ucsc.edu;bcgsc.ca	37	7	43917614	43917614	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:43917614A>C	ENST00000453200.1	-	6	1941	c.1448T>G	c.(1447-1449)aTc>aGc	p.I483S	URGCP_ENST00000497914.1_5'UTR|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000447717.3_Missense_Mutation_p.I440S|URGCP_ENST00000443736.1_Missense_Mutation_p.I440S|URGCP_ENST00000223341.7_Missense_Mutation_p.I440S|URGCP_ENST00000402306.3_Missense_Mutation_p.I474S|URGCP_ENST00000336086.6_Missense_Mutation_p.I440S			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	483					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGAGTCTTTGATTTTCCTGGT	0.582																																					p.I483S		.											.	URGCP	94	0			c.T1448G						.						145.0	151.0	149.0					7																	43917614		2009	4159	6168	SO:0001583	missense	55665	exon6			TCTTTGATTTTCC		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1448T>G	7.37:g.43917614A>C	ENSP00000396918:p.Ile483Ser	Somatic	281.0	2.0		WXS	Illumina HiSeq	.	109.0	49.0	NM_001077663	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Missense_Mutation	SNP	ENST00000453200.1	37	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	A	12.16	1.853534	0.32791	.	.	ENSG00000106608	ENST00000223341;ENST00000336086;ENST00000402306;ENST00000443736;ENST00000453200;ENST00000447717	T;T;T;T;T;T	0.10960	2.83;2.83;2.82;2.83;2.82;2.83	5.79	1.95	0.26073	.	0.660669	0.15089	N	0.281183	T	0.09598	0.0236	L	0.52823	1.66	0.32948	D	0.519391	B;B	0.33940	0.433;0.433	B;B	0.30029	0.11;0.11	T	0.12734	-1.0536	10	0.51188	T	0.08	-35.1341	5.4013	0.16297	0.6905:0.149:0.1605:0.0	.	474;483	Q8TCY9-2;Q8TCY9	.;URGCP_HUMAN	S	440;440;474;440;483;440	ENSP00000223341:I440S;ENSP00000336872:I440S;ENSP00000384955:I474S;ENSP00000392136:I440S;ENSP00000396918:I483S;ENSP00000402803:I440S	ENSP00000223341:I440S	I	-	2	0	URGCP	43884139	0.998000	0.40836	0.270000	0.24601	0.971000	0.66376	2.908000	0.48750	0.464000	0.27142	0.533000	0.62120	ATC	.		0.582	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
USP40	55230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234438104	234438104	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:234438104G>T	ENST00000427112.2	-	11	1558	c.1523C>A	c.(1522-1524)gCa>gAa	p.A508E	USP40_ENST00000251722.6_Missense_Mutation_p.A508E|USP40_ENST00000450966.1_Missense_Mutation_p.A520E			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	508					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		AATGTTAGCTGCATCCATTTC	0.343																																					p.A520E		.											.	USP40	455	0			c.C1559A						.						73.0	68.0	70.0					2																	234438104		1835	4070	5905	SO:0001583	missense	55230	exon11			TTAGCTGCATCCA	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.1523C>A	2.37:g.234438104G>T	ENSP00000387898:p.Ala508Glu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	8.0	NM_018218	Q6NX38|Q70EL0	Missense_Mutation	SNP	ENST00000427112.2	37	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	G	7.098	0.573459	0.13623	.	.	ENSG00000085982	ENST00000450966;ENST00000251722;ENST00000427112	T;T;T	0.04454	3.62;3.62;3.62	5.76	2.81	0.32909	.	0.980252	0.08407	N	0.950515	T	0.05090	0.0136	L	0.38838	1.175	0.27224	N	0.959588	B;B	0.20780	0.028;0.048	B;B	0.14023	0.004;0.01	T	0.34625	-0.9821	10	0.25751	T	0.34	.	9.2049	0.37282	0.0667:0.0:0.5695:0.3639	.	508;520	Q9NVE5;Q9NVE5-3	UBP40_HUMAN;.	E	520;508;508	ENSP00000415434:A520E;ENSP00000251722:A508E;ENSP00000387898:A508E	ENSP00000251722:A508E	A	-	2	0	USP40	234102843	0.923000	0.31300	0.998000	0.56505	0.985000	0.73830	1.528000	0.35985	1.417000	0.47077	0.555000	0.69702	GCA	.		0.343	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
USP42	84132	ucsc.edu;bcgsc.ca	37	7	6183809	6183809	+	Silent	SNP	C	C	T	rs151011297		TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr7:6183809C>T	ENST00000306177.5	+	9	1130	c.972C>T	c.(970-972)acC>acT	p.T324T		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	324	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.T324T(1)|p.T452T(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CAAATTTTACCGGTGGAAAAA	0.368													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20668	0.0		0.0	False		,,,				2504	0.0				p.T324T		.											.	USP42	659	2	Substitution - coding silent(2)	lung(2)	c.C972T						.						98.0	92.0	94.0					7																	6183809		1831	4083	5914	SO:0001819	synonymous_variant	84132	exon9			TTTTACCGGTGGA	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.972C>T	7.37:g.6183809C>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	.	22.0	4.0	NM_032172	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	37	CCDS47535.1																																																																																			C|0.999;T|0.001		0.368	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
VPS39	23339	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	42476724	42476724	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr15:42476724delC	ENST00000348544.4	-	9	741	c.742delG	c.(742-744)gtgfs	p.V248fs	VPS39_ENST00000318006.5_Frame_Shift_Del_p.V237fs			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	248	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		CCCATGGCCACTGGTATGTCC	0.527																																					p.V237fs		.											.	VPS39	229	0			c.709delG						.						204.0	164.0	177.0					15																	42476724		2203	4299	6502	SO:0001589	frameshift_variant	23339	exon8			TGGCCACTGGTAT	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.742delG	15.37:g.42476724delC	ENSP00000335193:p.Val248fs	Somatic	265.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	41.0	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Frame_Shift_Del	DEL	ENST00000348544.4	37	CCDS10083.1																																																																																			.		0.527	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
XDH	7498	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	31609400	31609400	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:31609400T>C	ENST00000379416.3	-	9	721	c.673A>G	c.(673-675)Aag>Gag	p.K225E	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	225					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CGCAGCTGCTTCCGAGGAGTG	0.507																																					p.K225E	Colon(66;682 1445 30109 40147)	.											.	XDH	158	0			c.A673G						.						114.0	99.0	104.0					2																	31609400		2203	4300	6503	SO:0001583	missense	7498	exon9			GCTGCTTCCGAGG	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.673A>G	2.37:g.31609400T>C	ENSP00000368727:p.Lys225Glu	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	19.0	NM_000379	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.906243	0.33628	.	.	ENSG00000158125	ENST00000379416	T	0.21191	2.02	5.56	5.56	0.83823	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (1);Xanthine dehydrogenase, small subunit (1);	0.366510	0.34223	N	0.004158	T	0.18676	0.0448	L	0.39633	1.23	0.36141	D	0.846803	B	0.17268	0.021	B	0.20767	0.031	T	0.14559	-1.0468	10	0.14656	T	0.56	.	14.749	0.69511	0.0:0.0:0.0:1.0	.	225	P47989	XDH_HUMAN	E	225	ENSP00000368727:K225E	ENSP00000368727:K225E	K	-	1	0	XDH	31462904	0.999000	0.42202	0.563000	0.28383	0.864000	0.49448	3.110000	0.50352	2.130000	0.65690	0.444000	0.29173	AAG	.		0.507	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
XDH	7498	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	31609402	31609402	+	Missense_Mutation	SNP	C	C	G	rs112466737	byFrequency	TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr2:31609402C>G	ENST00000379416.3	-	9	719	c.671G>C	c.(670-672)cGg>cCg	p.R224P	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	224					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CAGCTGCTTCCGAGGAGTGTC	0.507																																					p.R224P	Colon(66;682 1445 30109 40147)	.											.	XDH	158	0			c.G671C						.						111.0	97.0	102.0					2																	31609402		2203	4300	6503	SO:0001583	missense	7498	exon9			TGCTTCCGAGGAG	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.671G>C	2.37:g.31609402C>G	ENSP00000368727:p.Arg224Pro	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	20.0	NM_000379	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	C	9.062	0.994856	0.19043	.	.	ENSG00000158125	ENST00000379416	T	0.21543	2.0	5.56	-3.95	0.04118	FAD-binding, type 2 (1);Xanthine dehydrogenase, small subunit (1);	0.732108	0.14037	N	0.345725	T	0.05868	0.0153	N	0.03224	-0.385	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.25152	-1.0140	10	0.25106	T	0.35	.	2.0551	0.03579	0.1047:0.2663:0.2113:0.4177	.	224	P47989	XDH_HUMAN	P	224	ENSP00000368727:R224P	ENSP00000368727:R224P	R	-	2	0	XDH	31462906	0.008000	0.16893	0.006000	0.13384	0.875000	0.50365	-1.636000	0.02016	-1.039000	0.03275	0.543000	0.68304	CGG	C|0.999;T|0.001		0.507	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
ZNF420	147923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37582003	37582003	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr19:37582003A>G	ENST00000337995.3	+	4	331	c.116A>G	c.(115-117)tAt>tGt	p.Y39C	CTD-2293H3.1_ENST00000588369.1_RNA|ZNF420_ENST00000304239.7_Missense_Mutation_p.Y39C	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	39	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTGGAGAACTATAGCAACTTG	0.413																																					p.Y39C		.											.	ZNF420	90	0			c.A116G						.						121.0	120.0	120.0					19																	37582003		2203	4300	6503	SO:0001583	missense	147923	exon4			AGAACTATAGCAA	AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.116A>G	19.37:g.37582003A>G	ENSP00000338770:p.Tyr39Cys	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	21.0	NM_144689	B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	37	CCDS12498.1	.	.	.	.	.	.	.	.	.	.	.	11.47	1.648878	0.29336	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	T;T	0.02525	4.26;4.26	4.36	2.2	0.27929	Krueppel-associated box (4);	.	.	.	.	T	0.06735	0.0172	M	0.89414	3.03	0.26380	N	0.976756	B	0.17852	0.024	B	0.18263	0.021	T	0.17930	-1.0353	9	0.66056	D	0.02	.	6.1975	0.20557	0.7891:0.0:0.2109:0.0	.	39	Q8TAQ5	ZN420_HUMAN	C	39	ENSP00000306102:Y39C;ENSP00000338770:Y39C	ENSP00000306102:Y39C	Y	+	2	0	ZNF420	42273843	0.993000	0.37304	0.916000	0.36221	0.816000	0.46133	4.273000	0.58914	0.197000	0.20387	0.482000	0.46254	TAT	.		0.413	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	NM_144689	
ZNF451	26036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	57011983	57011983	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr6:57011983G>T	ENST00000370706.4	+	10	1344	c.1100G>T	c.(1099-1101)tGc>tTc	p.C367F	RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000585792.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.C367F|ZNF451_ENST00000357489.3_Missense_Mutation_p.C367F|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TGTCCAGATTGCAATCAAGTC	0.408																																					p.C367F		.											.	ZNF451	93	0			c.G1100T						.						91.0	86.0	88.0					6																	57011983		2203	4300	6503	SO:0001583	missense	26036	exon10			CAGATTGCAATCA	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1100G>T	6.37:g.57011983G>T	ENSP00000359740:p.Cys367Phe	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	19.0	NM_001031623	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824012	0.71143	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.08008	3.14;3.14;3.14	5.6	5.6	0.85130	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.24699	0.0599	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.91635	0.999;0.998;0.999;0.998	T	0.01259	-1.1403	10	0.87932	D	0	-7.5559	19.6177	0.95640	0.0:0.0:1.0:0.0	.	367;367;367;367	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	F	367	ENSP00000359740:C367F;ENSP00000350083:C367F;ENSP00000421645:C367F	ENSP00000350083:C367F	C	+	2	0	ZNF451	57119942	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.321000	0.89997	2.632000	0.89209	0.650000	0.86243	TGC	.		0.408	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	
ZNF488	118738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48370889	48370889	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr10:48370889G>T	ENST00000395702.2	+	2	584	c.357G>T	c.(355-357)gaG>gaT	p.E119D	ZNF488_ENST00000586537.1_Missense_Mutation_p.E12D|ZNF488_ENST00000494156.1_3'UTR			Q96MN9	ZN488_HUMAN	zinc finger protein 488	119					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						AGGCCCAGGAGAGGGAGCACG	0.652																																					p.E119D		.											.	ZNF488	91	0			c.G357T						.						38.0	39.0	39.0					10																	48370889		2202	4300	6502	SO:0001583	missense	118738	exon2			CCAGGAGAGGGAG	AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.357G>T	10.37:g.48370889G>T	ENSP00000379054:p.Glu119Asp	Somatic	232.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	34.0	NM_153034	Q05CE0	Missense_Mutation	SNP	ENST00000395702.2	37	CCDS7217.1	.	.	.	.	.	.	.	.	.	.	g	12.50	1.957986	0.34565	.	.	ENSG00000165388	ENST00000395702;ENST00000444585;ENST00000425196	T;T;T	0.37915	1.8;1.17;1.2	5.13	-7.36	0.01417	.	0.762403	0.11504	U	0.557418	T	0.20577	0.0495	L	0.50333	1.59	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.24584	-1.0156	10	0.18710	T	0.47	.	3.2795	0.06909	0.4309:0.2614:0.2195:0.0882	.	119	Q96MN9	ZN488_HUMAN	D	119	ENSP00000379054:E119D;ENSP00000410326:E119D;ENSP00000412898:E119D	ENSP00000379054:E119D	E	+	3	2	ZNF488	47990895	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.017000	0.03630	-1.545000	0.01719	-0.376000	0.06991	GAG	.		0.652	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314632.1	NM_153034	
ZNF711	7552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	84526390	84526390	+	Silent	SNP	T	T	C			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chrX:84526390T>C	ENST00000373165.3	+	9	2148	c.1842T>C	c.(1840-1842)acT>acC	p.T614T	ZNF711_ENST00000276123.3_Silent_p.T614T|ZNF711_ENST00000395402.1_Silent_p.T622T|ZNF711_ENST00000542798.1_Silent_p.T456T|ZNF711_ENST00000360700.4_Silent_p.T660T	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	614					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						CTGTCCATACTAAGGATTTTC	0.408																																					p.T614T		.											.	ZNF711	134	0			c.T1842C						.						78.0	61.0	67.0					X																	84526390		2203	4300	6503	SO:0001819	synonymous_variant	7552	exon9			CCATACTAAGGAT	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.1842T>C	X.37:g.84526390T>C		Somatic	200.0	1.0		WXS	Illumina HiSeq	Phase_I	85.0	49.0	NM_021998	B4DSV4|Q6NX42|Q9Y4J6	Silent	SNP	ENST00000373165.3	37	CCDS35344.1																																																																																			.		0.408	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998	
ZPLD1	131368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	102175049	102175049	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr3:102175049C>T	ENST00000491959.1	+	11	1222	c.340C>T	c.(340-342)Cct>Tct	p.P114S	ZPLD1_ENST00000306176.1_Missense_Mutation_p.P130S|ZPLD1_ENST00000466937.1_Missense_Mutation_p.P114S			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	114	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						ATCCACAATTCCTGGAGTCAG	0.348																																					p.P130S		.											.	ZPLD1	72	0			c.C388T						.						122.0	119.0	120.0					3																	102175049		2203	4300	6503	SO:0001583	missense	131368	exon4			ACAATTCCTGGAG	AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.340C>T	3.37:g.102175049C>T	ENSP00000420265:p.Pro114Ser	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	23.0	NM_175056	Q49AS1|Q8WU36	Missense_Mutation	SNP	ENST00000491959.1	37		.	.	.	.	.	.	.	.	.	.	C	12.63	1.995193	0.35226	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.82167	-1.58;-1.58;-1.58	5.45	4.58	0.56647	Zona pellucida sperm-binding protein (3);	0.153821	0.64402	D	0.000013	T	0.73289	0.3568	L	0.34521	1.04	0.47949	D	0.999553	B;B	0.26547	0.152;0.137	B;B	0.27500	0.058;0.08	T	0.66563	-0.5892	10	0.08381	T	0.77	-8.7798	14.4134	0.67132	0.0:0.929:0.0:0.071	.	130;114	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	S	114;130;114	ENSP00000420265:P114S;ENSP00000307801:P130S;ENSP00000418253:P114S	ENSP00000307801:P130S	P	+	1	0	ZPLD1	103657739	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.996000	0.40776	1.315000	0.45114	-0.137000	0.14449	CCT	.		0.348	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353984.1	NM_175056	
ZNF790	388536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	37310028	37310029	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-G3-A5SJ-01A-11D-A27I-10	TCGA-G3-A5SJ-10A-01D-A27I-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	92f0cb64-0a29-4ca2-92d0-94d1f0cf050b	b8cc644d-6325-45dc-bc23-58f5e69f8242	g.chr19:37310028_37310029GC>AT	ENST00000356725.4	-	5	1337_1338	c.1217_1218GC>AT	c.(1216-1218)aGC>aAT	p.S406N	CTD-2162K18.5_ENST00000587278.1_RNA|CTD-2162K18.5_ENST00000588906.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CAAGGTGTGAGCTCCAAATATA	0.411																																					p.S406N		.											.	.	.	0			.						.																																			SO:0001583	missense	388536	.			GTGTGAGCTCCAA	BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.1217_1218delinsAT	19.37:g.37310028_37310029delinsAT	ENSP00000349161:p.Ser406Asn	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	12.0	.		Missense_Mutation	DNP	ENST00000356725.4	37	CCDS12496.1																																																																																			.		0.411	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385341.2	NM_206894	
