#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACPP	55	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132050504	132050504	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr3:132050504A>T	ENST00000336375.5	+	3	320	c.230A>T	c.(229-231)cAg>cTg	p.Q77L	ACPP_ENST00000475741.1_Missense_Mutation_p.Q77L|ACPP_ENST00000351273.7_Missense_Mutation_p.Q77L|ACPP_ENST00000489084.1_3'UTR	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	77					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						GGCATGGAGCAGCATTATGAA	0.323																																					p.Q77L		.											.	ACPP	91	0			c.A230T						.						45.0	49.0	48.0					3																	132050504		2198	4298	6496	SO:0001583	missense	55	exon3			TGGAGCAGCATTA		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.230A>T	3.37:g.132050504A>T	ENSP00000337471:p.Gln77Leu	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	27.0	NM_001099	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	ENST00000336375.5	37	CCDS3073.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.344978	0.82022	.	.	ENSG00000014257	ENST00000336375;ENST00000475741;ENST00000351273	T;T;T	0.26223	1.75;1.75;1.75	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000008	T	0.57315	0.2045	M	0.88241	2.94	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74023	0.966;0.942;0.982	T	0.66288	-0.5961	10	0.87932	D	0	.	14.7386	0.69437	1.0:0.0:0.0:0.0	.	77;77;77	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	L	77	ENSP00000337471:Q77L;ENSP00000417744:Q77L;ENSP00000323036:Q77L	ENSP00000337471:Q77L	Q	+	2	0	ACPP	133533194	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.411000	0.66386	2.131000	0.65755	0.533000	0.62120	CAG	.		0.323	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	
ADAM29	11086	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	175897719	175897719	+	Missense_Mutation	SNP	G	G	A	rs201308805		TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr4:175897719G>A	ENST00000359240.3	+	5	1713	c.1043G>A	c.(1042-1044)cGt>cAt	p.R348H	ADAM29_ENST00000445694.1_Missense_Mutation_p.R348H|ADAM29_ENST00000514159.1_Missense_Mutation_p.R348H|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Missense_Mutation_p.R348H	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	348	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GATACATGTCGTTGTTCACAA	0.373																																					p.R348H	Ovarian(140;1727 1835 21805 25838 41440)	.											.	ADAM29	729	0			c.G1043A						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	145.0	140.0	141.0		1043,1043,1043,1043	-7.2	0.0	4		141	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense	ADAM29	NM_001130703.1,NM_001130704.1,NM_001130705.1,NM_014269.4	29,29,29,29	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging	348/821,348/821,348/821,348/821	175897719	3,13003	2203	4300	6503	SO:0001583	missense	11086	exon4			CATGTCGTTGTTC	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1043G>A	4.37:g.175897719G>A	ENSP00000352177:p.Arg348His	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	12.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	G	10.29	1.308218	0.23821	2.27E-4	2.33E-4	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	3.6	-7.2	0.01495	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	4.010880	0.01831	U	0.034703	T	0.10594	0.0259	N	0.13168	0.305	0.09310	N	1	D	0.71674	0.998	P	0.61592	0.891	T	0.34129	-0.9841	9	.	.	.	.	1.6479	0.02766	0.1398:0.387:0.177:0.2961	.	348	Q9UKF5	ADA29_HUMAN	H	348	ENSP00000352177:R348H;ENSP00000414544:R348H;ENSP00000384229:R348H;ENSP00000423517:R348H	.	R	+	2	0	ADAM29	176134294	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.801000	0.00761	-2.197000	0.00750	-0.496000	0.04628	CGT	.		0.373	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ADAM29	11086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	175898784	175898784	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr4:175898784C>G	ENST00000359240.3	+	5	2778	c.2108C>G	c.(2107-2109)cCa>cGa	p.P703R	ADAM29_ENST00000445694.1_Missense_Mutation_p.P703R|ADAM29_ENST00000514159.1_Missense_Mutation_p.P703R|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Missense_Mutation_p.P703R	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	703					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AAAAGTAAACCAATAAAAAAG	0.338																																					p.P703R	Ovarian(140;1727 1835 21805 25838 41440)	.											.	ADAM29	729	0			c.C2108G						.						42.0	45.0	44.0					4																	175898784		2203	4300	6503	SO:0001583	missense	11086	exon4			GTAAACCAATAAA	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2108C>G	4.37:g.175898784C>G	ENSP00000352177:p.Pro703Arg	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	17.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	37	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	C	3.684	-0.064885	0.07273	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.01871	4.59;4.59;4.59;4.59	2.63	-0.82	0.10826	.	.	.	.	.	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.49062	-0.8978	8	.	.	.	.	4.8219	0.13394	0.5584:0.2749:0.1667:0.0	.	703	Q9UKF5	ADA29_HUMAN	R	703	ENSP00000352177:P703R;ENSP00000414544:P703R;ENSP00000384229:P703R;ENSP00000423517:P703R	.	P	+	2	0	ADAM29	176135359	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.361000	0.00498	-0.227000	0.09884	0.643000	0.83706	CCA	.		0.338	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ADAMTS14	140766	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	72503886	72503886	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr10:72503886G>T	ENST00000373207.1	+	14	2123	c.2123G>T	c.(2122-2124)gGt>gTt	p.G708V	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.G711V	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	708	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GTCTGCGGGGGTGACAACTCC	0.657																																					p.G711V		.											.	ADAMTS14	232	0			c.G2132T						.						38.0	33.0	35.0					10																	72503886		2186	4283	6469	SO:0001583	missense	140766	exon14			GCGGGGGTGACAA	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2123G>T	10.37:g.72503886G>T	ENSP00000362303:p.Gly708Val	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	10.0	NM_139155	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	37	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.893188	0.91889	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.73363	-0.74;-0.74	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.92054	0.7482	H	0.98370	4.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.94881	0.8039	10	0.87932	D	0	.	18.4832	0.90819	0.0:0.0:1.0:0.0	.	641;708;711	Q8WXS8-2;Q8WXS8;Q5T4G1	.;ATS14_HUMAN;.	V	711;708	ENSP00000362304:G711V;ENSP00000362303:G708V	ENSP00000362303:G708V	G	+	2	0	ADAMTS14	72173892	1.000000	0.71417	0.828000	0.32881	0.995000	0.86356	9.125000	0.94402	2.688000	0.91661	0.591000	0.81541	GGT	.		0.657	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
ADCY3	109	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	25059801	25059801	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:25059801C>A	ENST00000260600.5	-	8	2498	c.1647G>T	c.(1645-1647)gaG>gaT	p.E549D	ADCY3_ENST00000405392.1_Missense_Mutation_p.E182D	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	549					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CATCCTGCTCCTCGGGCTTCT	0.637																																					p.E549D		.											.	ADCY3	94	0			c.G1647T						.						51.0	48.0	49.0					2																	25059801		2203	4300	6503	SO:0001583	missense	109	exon8			CTGCTCCTCGGGC	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1647G>T	2.37:g.25059801C>A	ENSP00000260600:p.Glu549Asp	Somatic	109.0	1.0		WXS	Illumina HiSeq	Phase_I	181.0	57.0	NM_004036	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	37	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	C	4.899	0.167019	0.09339	.	.	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879;ENST00000454027	T;T;T	0.80994	0.87;0.87;-1.44	5.34	2.55	0.30701	.	0.170661	0.52532	D	0.000061	T	0.59473	0.2196	N	0.12182	0.205	0.31280	N	0.690656	B;B;B	0.13145	0.007;0.005;0.004	B;B;B	0.11329	0.004;0.004;0.006	T	0.50659	-0.8802	10	0.13853	T	0.58	.	7.9142	0.29808	0.0:0.7332:0.0:0.2668	.	549;549;182	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	D	549;182;524;175	ENSP00000260600:E549D;ENSP00000384484:E182D;ENSP00000410120:E175D	ENSP00000260600:E549D	E	-	3	2	ADCY3	24913305	1.000000	0.71417	0.992000	0.48379	0.051000	0.14879	0.790000	0.26900	0.240000	0.21263	0.650000	0.86243	GAG	.		0.637	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
ALB	213	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	74281995	74281995	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr4:74281995T>C	ENST00000503124.1	+	8	971	c.764T>C	c.(763-765)gTg>gCg	p.V255A	ALB_ENST00000401494.3_Missense_Mutation_p.V290A|ALB_ENST00000295897.4_Missense_Mutation_p.V405A|ALB_ENST00000509063.1_Missense_Mutation_p.V405A|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000415165.2_Missense_Mutation_p.V213A			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAACCTCTTGTGGAAGAGCCT	0.353																																					p.V405A		.											.	ALB	96	0			c.T1214C						.						71.0	72.0	71.0					4																	74281995		2201	4300	6501	SO:0001583	missense	213	exon10			CTCTTGTGGAAGA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.764T>C	4.37:g.74281995T>C	ENSP00000421027:p.Val255Ala	Somatic	142.0	1.0		WXS	Illumina HiSeq	Phase_I	133.0	29.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	37		.	.	.	.	.	.	.	.	.	.	T	10.07	1.248739	0.22880	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84	5.98	2.2	0.27929	Serum albumin-like (1);Serum albumin, N-terminal (2);	0.974277	0.08454	N	0.943536	T	0.80287	0.4595	L	0.60012	1.86	0.09310	N	1	D;B;D;B;B	0.63046	0.992;0.325;0.979;0.09;0.325	D;B;P;B;B	0.63703	0.917;0.145;0.869;0.03;0.1	T	0.63287	-0.6671	10	0.87932	D	0	-2.2885	4.6892	0.12772	0.1394:0.1508:0.0:0.7097	.	290;213;255;405;405	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.;.;.;.;ALBU_HUMAN	A	405;213;192;255;405;290;414	ENSP00000295897:V405A;ENSP00000401820:V213A;ENSP00000421027:V255A;ENSP00000422784:V405A;ENSP00000384695:V290A	ENSP00000295897:V405A	V	+	2	0	ALB	74500859	0.239000	0.23836	0.001000	0.08648	0.065000	0.16274	1.886000	0.39688	0.157000	0.19338	0.482000	0.46254	GTG	.		0.353	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ALKBH5	54890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18110272	18110272	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:18110272A>T	ENST00000399138.4	+	3	1000	c.995A>T	c.(994-996)gAt>gTt	p.D332V	ALKBH5_ENST00000541285.1_De_novo_Start_OutOfFrame	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	332					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					GCAGACCCTGATGCTGCCCAC	0.587																																					p.D332V	Ovarian(166;154 1953 40235 46283 46309)	.											.	ALKBH5	90	0			c.A995T						.						127.0	131.0	130.0					17																	18110272		1939	4127	6066	SO:0001583	missense	54890	exon3			ACCCTGATGCTGC	AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.995A>T	17.37:g.18110272A>T	ENSP00000382091:p.Asp332Val	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	43.0	NM_017758	B4DVJ4|D3DXC6|Q9NXD6	Missense_Mutation	SNP	ENST00000399138.4	37	CCDS42272.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591157	0.86851	.	.	ENSG00000091542	ENST00000261650;ENST00000500385;ENST00000399138	.	.	.	5.56	5.56	0.83823	.	0.046387	0.85682	D	0.000000	T	0.60856	0.2301	L	0.29908	0.895	0.80722	D	1	D	0.67145	0.996	P	0.59487	0.858	T	0.57154	-0.7860	9	0.24483	T	0.36	-3.5368	15.7046	0.77569	1.0:0.0:0.0:0.0	.	332	Q6P6C2-2	.	V	332;321;332	.	ENSP00000261650:D332V	D	+	2	0	ALKBH5	18050997	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.738000	0.84966	2.115000	0.64714	0.533000	0.62120	GAT	.		0.587	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132069.3	NM_017758	
ARHGAP23	57636	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	36622415	36622415	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:36622415C>T	ENST00000431231.2	+	7	559	c.491C>T	c.(490-492)tCc>tTc	p.S164F	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.S164F|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.S70F	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	164					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CAGGCCTACTCCCAGGATGCC	0.642																																					p.S164F		.											.	ARHGAP23	205	0			c.C491T						.						17.0	21.0	20.0					17																	36622415		692	1591	2283	SO:0001583	missense	57636	exon7			CCTACTCCCAGGA	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.491C>T	17.37:g.36622415C>T	ENSP00000393539:p.Ser164Phe	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	20.0	NM_001199417		Missense_Mutation	SNP	ENST00000431231.2	37	CCDS56027.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336551	0.60963	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000549246;ENST00000443378	T;T;T;T	0.35789	2.16;2.54;1.29;2.48	4.35	4.35	0.52113	.	.	.	.	.	T	0.55178	0.1904	L	0.54323	1.7	0.42283	D	0.9921	D	0.71674	0.998	D	0.81914	0.995	T	0.60454	-0.7260	9	0.87932	D	0	.	15.7933	0.78384	0.0:1.0:0.0:0.0	.	164	Q9P227	RHG23_HUMAN	F	164;164;70;70	ENSP00000394153:S164F;ENSP00000393539:S164F;ENSP00000447644:S70F;ENSP00000407333:S70F	ENSP00000393539:S164F	S	+	2	0	ARHGAP23	33875941	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.125000	0.64715	2.250000	0.74265	0.561000	0.74099	TCC	.		0.642	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
ARHGAP32	9743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	128839106	128839106	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr11:128839106T>C	ENST00000310343.9	-	22	5959	c.5960A>G	c.(5959-5961)cAt>cGt	p.H1987R	ARHGAP32_ENST00000392657.3_Missense_Mutation_p.H1638R|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.H1638R|ARHGAP32_ENST00000524655.1_3'UTR	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1987	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TTTGAGGCTATGACTCCTCTC	0.552																																					p.H1987R		.											.	ARHGAP32	231	0			c.A5960G						.						147.0	132.0	137.0					11																	128839106		2201	4297	6498	SO:0001583	missense	9743	exon22			AGGCTATGACTCC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5960A>G	11.37:g.128839106T>C	ENSP00000310561:p.His1987Arg	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	25.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.458099	0.63401	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.20069	2.1;2.1;2.1	5.83	4.7	0.59300	.	0.053099	0.64402	N	0.000001	T	0.23926	0.0579	M	0.64997	1.995	0.48288	D	0.999623	B	0.18461	0.028	B	0.15052	0.012	T	0.03051	-1.1078	10	0.87932	D	0	.	11.5602	0.50772	0.0:0.0693:0.0:0.9307	.	1987	A7KAX9	RHG32_HUMAN	R	1987;1638;1638	ENSP00000310561:H1987R;ENSP00000376425:H1638R;ENSP00000432862:H1638R	ENSP00000310561:H1987R	H	-	2	0	ARHGAP32	128344316	0.986000	0.35501	0.927000	0.36925	0.998000	0.95712	2.347000	0.44036	1.049000	0.40321	0.533000	0.62120	CAT	.		0.552	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
BBS9	27241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	33397473	33397473	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr7:33397473C>T	ENST00000242067.6	+	16	2080	c.1559C>T	c.(1558-1560)cCg>cTg	p.P520L	BBS9_ENST00000396127.2_Missense_Mutation_p.P485L|BBS9_ENST00000354265.4_Missense_Mutation_p.P485L|BBS9_ENST00000350941.3_Missense_Mutation_p.P480L|BBS9_ENST00000355070.2_Missense_Mutation_p.P515L	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	520					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TTAGGCATTCCGCGAGTTATC	0.328									Bardet-Biedl syndrome																												p.P520L		.											.	BBS9	230	0			c.C1559T						.						92.0	99.0	97.0					7																	33397473		2203	4299	6502	SO:0001583	missense	27241	exon16	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	GCATTCCGCGAGT		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1559C>T	7.37:g.33397473C>T	ENSP00000242067:p.Pro520Leu	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	17.0	NM_198428	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	CCDS43566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.547960|4.547960	0.86022|0.86022	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132|ENST00000537775	T;T;T;T;T|.	0.17691|.	2.26;2.26;2.26;2.26;2.26|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	0.052462|.	0.85682|.	D|.	0.000000|.	T|T	0.75102|0.75102	0.3804|0.3804	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.65815|.	0.995;0.989;0.989;0.989;0.989|.	D;D;P;D;P|.	0.65987|.	0.94;0.94;0.89;0.94;0.89|.	T|T	0.75147|0.75147	-0.3420|-0.3420	10|6	0.30854|0.72032	T|D	0.27|0.01	-18.1224|-18.1224	19.9763|19.9763	0.97309|0.97309	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	520;480;515;485;520|.	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;.;PTHB1_HUMAN|.	L|C	520;480;485;515;485;520|398	ENSP00000242067:P520L;ENSP00000313122:P480L;ENSP00000379433:P485L;ENSP00000347182:P515L;ENSP00000346214:P485L|.	ENSP00000242067:P520L|ENSP00000441763:R398C	P|R	+|+	2|1	0|0	BBS9|BBS9	33363998|33363998	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.231000|4.231000	0.58639|0.58639	2.823000|2.823000	0.97156|0.97156	0.643000|0.643000	0.83706|0.83706	CCG|CGC	.		0.328	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
BIRC2	329	hgsc.bcm.edu;broad.mit.edu	37	11	102221361	102221362	+	In_Frame_Ins	INS	-	-	TAG			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr11:102221361_102221362insTAG	ENST00000227758.2	+	2	2175_2176	c.776_777insTAG	c.(775-780)tttagc>ttTAGtagc	p.260_261insS	BIRC2_ENST00000530675.1_In_Frame_Ins_p.211_212insS|BIRC2_ENST00000527910.1_3'UTR|BIRC2_ENST00000532672.1_In_Frame_Ins_p.239_240insS	NM_001166.4|NM_001256163.1	NP_001157.1|NP_001243092.1	Q13490	BIRC2_HUMAN	baculoviral IAP repeat containing 2	260					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein K48-linked ubiquitination (GO:1902524)|positive regulation of protein K63-linked ubiquitination (GO:1902523)|positive regulation of protein monoubiquitination (GO:1902527)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cell cycle (GO:0051726)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription, DNA-templated (GO:0006355)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|Epithelial(9;0.11)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0144)		ACTCTGAGGTTTAGCATTTCAA	0.441																																					p.F259delinsFS		.											.	BIRC2	660	0			c.776_777insTAG						.																																			SO:0001652	inframe_insertion	329	exon2			TGAGGTTTAGCAT	L49431	CCDS8316.1, CCDS58169.1	11q22	2011-01-25	2011-01-25		ENSG00000110330	ENSG00000110330		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	590	protein-coding gene	gene with protein product	"""NFR2-TRAF signalling complex protein"", ""apoptosis inhibitor 1"""	601712	"""baculoviral IAP repeat-containing 2"""	API1		8552191, 8548810	Standard	NM_001166		Approved	cIAP1, hiap-2, MIHB, RNF48, c-IAP1	uc010ruq.3	Q13490	OTTHUMG00000167325	ENST00000227758.2:c.777_779dupTAG	11.37:g.102221362_102221364dupTAG	ENSP00000227758:p.Ser261_Ser262dup	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	0.0	NM_001256163	B4E026|Q16516|Q4TTG0	In_Frame_Ins	INS	ENST00000227758.2	37	CCDS8316.1																																																																																			.		0.441	BIRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394170.1	NM_001166	
BPIFB2	80341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31609598	31609598	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr20:31609598T>C	ENST00000170150.3	+	15	1523	c.1328T>C	c.(1327-1329)gTc>gCc	p.V443A		NM_025227.1	NP_079503.1	Q8N4F0	BPIB2_HUMAN	BPI fold containing family B, member 2	443						extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										GAGATCTTTGTCTATGAGGTG	0.582																																					p.V443A		.											.	.	.	0			c.T1328C						.						145.0	130.0	135.0					20																	31609598		2203	4300	6503	SO:0001583	missense	80341	exon15			TCTTTGTCTATGA	AF465765	CCDS13210.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000078898	ENSG00000078898		"""BPI fold containing"""	16177	protein-coding gene	gene with protein product		614108	"""bactericidal/permeability-increasing protein-like 1"""	C20orf184, BPIL1		12185532, 21787333	Standard	NM_025227		Approved	dJ726C3.2, LPLUNC2	uc002wyj.4	Q8N4F0	OTTHUMG00000032232	ENST00000170150.3:c.1328T>C	20.37:g.31609598T>C	ENSP00000170150:p.Val443Ala	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	33.0	NM_025227	Q6UWN3|Q6ZME0|Q8NFQ7	Missense_Mutation	SNP	ENST00000170150.3	37	CCDS13210.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.095201	0.56075	.	.	ENSG00000078898	ENST00000170150	T	0.09445	2.98	4.49	4.49	0.54785	.	0.312255	0.22950	N	0.053664	T	0.12603	0.0306	L	0.32530	0.975	0.20764	N	0.999859	P	0.51240	0.943	P	0.48454	0.578	T	0.07214	-1.0784	10	0.56958	D	0.05	-20.169	10.7613	0.46266	0.0:0.0:0.0:1.0	.	443	Q8N4F0	BPIB2_HUMAN	A	443	ENSP00000170150:V443A	ENSP00000170150:V443A	V	+	2	0	BPIFB2	31073259	0.052000	0.20516	0.202000	0.23494	0.786000	0.44442	3.506000	0.53364	1.976000	0.57569	0.455000	0.32223	GTC	.		0.582	BPIFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078652.2	NM_025227	
BRWD3	254065	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	79984393	79984393	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chrX:79984393G>A	ENST00000373275.4	-	14	1460	c.1244C>T	c.(1243-1245)cCa>cTa	p.P415L		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	415					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TTCTCCAGATGGCAAATTATT	0.333																																					p.P415L		.											.	BRWD3	134	0			c.C1244T						.						94.0	79.0	84.0					X																	79984393		2203	4300	6503	SO:0001583	missense	254065	exon14			CCAGATGGCAAAT		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1244C>T	X.37:g.79984393G>A	ENSP00000362372:p.Pro415Leu	Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	279.0	18.0	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383534	0.25031	.	.	ENSG00000165288	ENST00000373275	T	0.56103	0.48	4.7	3.81	0.43845	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.433999	0.22617	N	0.057759	T	0.37210	0.0995	L	0.40543	1.245	0.26569	N	0.973599	B	0.06786	0.001	B	0.06405	0.002	T	0.08617	-1.0713	9	.	.	.	-0.1056	5.3057	0.15803	0.1733:0.0:0.6606:0.1661	.	415	Q6RI45	BRWD3_HUMAN	L	415	ENSP00000362372:P415L	.	P	-	2	0	BRWD3	79871049	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	3.231000	0.51294	2.167000	0.68274	0.422000	0.28245	CCA	.		0.333	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
CACNA1S	779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201058470	201058470	+	Silent	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:201058470G>A	ENST00000362061.3	-	6	1042	c.816C>T	c.(814-816)atC>atT	p.I272I	CACNA1S_ENST00000367338.3_Silent_p.I272I	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	272					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGAAGTGGGTGATGCCATGGT	0.637																																					p.I272I		.											.	CACNA1S	94	0			c.C816T						.						91.0	74.0	80.0					1																	201058470		2203	4300	6503	SO:0001819	synonymous_variant	779	exon6			GTGGGTGATGCCA	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.816C>T	1.37:g.201058470G>A		Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	419.0	170.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	37	CCDS1407.1																																																																																			.		0.637	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
CACNA2D3	55799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	55108222	55108222	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr3:55108222T>G	ENST00000474759.1	+	38	3313	c.3265T>G	c.(3265-3267)Ttc>Gtc	p.F1089V	CACNA2D3_ENST00000415676.2_Missense_Mutation_p.F1089V|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.F1089V|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.F995V|CACNA2D3_ENST00000478261.1_3'UTR	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	1089						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TTTGATGCTCTTCTCAAGGTG	0.498																																					p.F1089V		.											.	CACNA2D3	138	0			c.T3265G						.						158.0	156.0	156.0					3																	55108222		2114	4217	6331	SO:0001583	missense	55799	exon38			ATGCTCTTCTCAA	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.3265T>G	3.37:g.55108222T>G	ENSP00000419101:p.Phe1089Val	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	10.0	NM_018398	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	ENST00000474759.1	37	CCDS54598.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.473012	0.43942	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.08370	3.1;3.1;3.1;3.1	5.47	3.09	0.35607	.	0.175509	0.50627	D	0.000102	T	0.03959	0.0111	N	0.08118	0	0.39881	D	0.973642	B	0.06786	0.001	B	0.06405	0.002	T	0.45454	-0.9260	10	0.20046	T	0.44	-1.0083	8.5407	0.33390	0.0:0.1519:0.0:0.8481	.	1089	Q8IZS8	CA2D3_HUMAN	V	1089;1089;1089;995;996	ENSP00000389506:F1089V;ENSP00000419101:F1089V;ENSP00000288197:F1089V;ENSP00000417279:F995V	ENSP00000288197:F1089V	F	+	1	0	CACNA2D3	55083262	0.991000	0.36638	0.998000	0.56505	0.988000	0.76386	1.343000	0.33930	0.466000	0.27193	0.467000	0.42956	TTC	.		0.498	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351402.1		
CCT4	10575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	62107453	62107453	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:62107453A>C	ENST00000394440.3	-	4	643	c.347T>G	c.(346-348)cTc>cGc	p.L116R	CCT4_ENST00000538252.1_Missense_Mutation_p.L60R|CCT4_ENST00000544185.1_Intron|CCT4_ENST00000544079.1_Missense_Mutation_p.L86R|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	116					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			AGAATCTAAGAGGGAGCCAGC	0.398																																					p.L116R		.											.	CCT4	92	0			c.T347G						.						142.0	145.0	144.0					2																	62107453		2203	4300	6503	SO:0001583	missense	10575	exon4			TCTAAGAGGGAGC		CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.347T>G	2.37:g.62107453A>C	ENSP00000377958:p.Leu116Arg	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	32.0	NM_006430	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	37	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.764973	0.90020	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000538252	D;D;D	0.87179	-2.22;-2.22;-2.22	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.97031	0.9030	H	0.99884	4.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	D	0.98991	1.0808	10	0.87932	D	0	-7.3028	15.5562	0.76196	1.0:0.0:0.0:0.0	.	86;116	F5H5W3;P50991	.;TCPD_HUMAN	R	116;86;60	ENSP00000377958:L116R;ENSP00000443061:L86R;ENSP00000442174:L60R	ENSP00000377958:L116R	L	-	2	0	CCT4	61960957	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.188000	0.94921	2.152000	0.67230	0.533000	0.62120	CTC	.		0.398	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325548.2		
CD93	22918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	23065572	23065572	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr20:23065572C>T	ENST00000246006.4	-	1	1405	c.1258G>A	c.(1258-1260)Gag>Aag	p.E420K		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	420	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GTCCCGTCCTCCCCGGCCAGG	0.642																																					p.E420K		.											.	CD93	153	0			c.G1258A						.						42.0	46.0	45.0					20																	23065572		2203	4300	6503	SO:0001583	missense	22918	exon1			CGTCCTCCCCGGC	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1258G>A	20.37:g.23065572C>T	ENSP00000246006:p.Glu420Lys	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	220.0	77.0	NM_012072	O00274	Missense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595530	0.86953	.	.	ENSG00000125810	ENST00000246006	D	0.85556	-2.0	5.18	4.17	0.49024	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.293419	0.24128	N	0.041294	T	0.77103	0.4081	N	0.16266	0.395	0.35307	D	0.783579	P	0.47484	0.896	P	0.48270	0.572	T	0.76061	-0.3097	10	0.09338	T	0.73	-27.3807	14.2591	0.66073	0.0:0.7778:0.2222:0.0	.	420	Q9NPY3	C1QR1_HUMAN	K	420	ENSP00000246006:E420K	ENSP00000246006:E420K	E	-	1	0	CD93	23013572	0.008000	0.16893	0.070000	0.20053	0.034000	0.12701	0.668000	0.25127	2.557000	0.86248	0.650000	0.86243	GAG	.		0.642	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
CDH7	1005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	63489356	63489356	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr18:63489356C>T	ENST00000397968.2	+	5	1091	c.665C>T	c.(664-666)gCt>gTt	p.A222V	CDH7_ENST00000323011.3_Missense_Mutation_p.A222V|CDH7_ENST00000536984.2_Missense_Mutation_p.A222V	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	222	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GATAGAGAGGCTAAAGACCAG	0.403																																					p.A222V		.											.	CDH7	94	0			c.C665T						.						139.0	109.0	119.0					18																	63489356		2203	4300	6503	SO:0001583	missense	1005	exon5			GAGAGGCTAAAGA	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.665C>T	18.37:g.63489356C>T	ENSP00000381058:p.Ala222Val	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	45.0	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.161054	0.57368	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.51817	0.69;0.69;0.69	5.01	5.01	0.66863	Cadherin (4);Cadherin-like (1);	0.058450	0.64402	D	0.000003	T	0.31231	0.0790	N	0.11364	0.135	0.80722	D	1	B;B	0.18863	0.031;0.005	B;B	0.12837	0.008;0.003	T	0.08027	-1.0742	10	0.21014	T	0.42	.	18.69	0.91580	0.0:1.0:0.0:0.0	.	222;222	F5H5X9;Q9ULB5	.;CADH7_HUMAN	V	222	ENSP00000319166:A222V;ENSP00000443030:A222V;ENSP00000381058:A222V	ENSP00000319166:A222V	A	+	2	0	CDH7	61640336	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.627000	0.54252	2.473000	0.83533	0.591000	0.81541	GCT	.		0.403	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
CEP68	23177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	65305033	65305033	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:65305033C>G	ENST00000377990.2	+	5	2242	c.2039C>G	c.(2038-2040)tCt>tGt	p.S680C	RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000260569.4_Missense_Mutation_p.S543C|CEP68_ENST00000546106.1_Intron	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	680					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						GAACATCAGTCTCTGACGGAG	0.398																																					p.S680C		.											.	CEP68	91	0			c.C2039G						.						89.0	90.0	90.0					2																	65305033		2203	4300	6503	SO:0001583	missense	23177	exon5			ATCAGTCTCTGAC	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.2039C>G	2.37:g.65305033C>G	ENSP00000367229:p.Ser680Cys	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	42.0	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	37	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264123	0.59431	.	.	ENSG00000011523	ENST00000377990;ENST00000260569	T;T	0.79940	-1.32;-1.32	5.86	1.56	0.23342	.	0.836245	0.10874	N	0.624631	D	0.83764	0.5325	L	0.60455	1.87	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.61592	0.891;0.891	T	0.77943	-0.2398	10	0.66056	D	0.02	-2.5103	5.9154	0.19052	0.0:0.513:0.1385:0.3485	.	680;543	Q76N32;Q76N32-2	CEP68_HUMAN;.	C	680;543	ENSP00000367229:S680C;ENSP00000260569:S543C	ENSP00000260569:S543C	S	+	2	0	CEP68	65158537	0.778000	0.28640	0.996000	0.52242	0.806000	0.45545	0.421000	0.21280	0.068000	0.16574	0.563000	0.77884	TCT	.		0.398	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
CHDC2	286464	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	36103589	36103589	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chrX:36103589T>C	ENST00000313548.4	+	5	761	c.575T>C	c.(574-576)gTa>gCa	p.V192A		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	192						integral component of membrane (GO:0016021)											TCTTTACCTGTAGATAACCAT	0.358																																					p.V192A		.											.	.	.	0			c.T575C						.						82.0	76.0	78.0					X																	36103589		2202	4300	6502	SO:0001583	missense	286464	exon5			TACCTGTAGATAA	AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.575T>C	X.37:g.36103589T>C	ENSP00000324767:p.Val192Ala	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	52.0	NM_173695		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	T	2.062	-0.415058	0.04766	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.9	-1.31	0.09230	.	1.343430	0.05103	N	0.487525	T	0.18087	0.0434	N	0.19112	0.55	0.09310	N	1	B	0.15473	0.013	B	0.08055	0.003	T	0.13899	-1.0492	9	0.16420	T	0.52	0.0922	0.2529	0.00208	0.2811:0.2452:0.1426:0.3311	.	192	Q8N9S7	CX059_HUMAN	A	192	.	ENSP00000324767:V192A	V	+	2	0	CXorf59	36013510	0.006000	0.16342	0.000000	0.03702	0.007000	0.05969	-0.218000	0.09240	-0.248000	0.09583	0.486000	0.48141	GTA	.		0.358	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
CNGB1	1258	ucsc.edu;bcgsc.ca	37	16	57951296	57951296	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr16:57951296G>A	ENST00000251102.8	-	21	2102	c.2042C>T	c.(2041-2043)cCc>cTc	p.P681L	CNGB1_ENST00000564448.1_Missense_Mutation_p.P675L	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	681					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						GGTCTGGTAGGGGAAGGCCCA	0.557																																					p.P681L	Colon(156;1293 1853 16336 28962 38659)	.											.	CNGB1	137	0			c.C2042T						.						111.0	118.0	116.0					16																	57951296		2095	4219	6314	SO:0001583	missense	1258	exon21			TGGTAGGGGAAGG	AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.2042C>T	16.37:g.57951296G>A	ENSP00000251102:p.Pro681Leu	Somatic	238.0	2.0		WXS	Illumina HiSeq	.	532.0	139.0	NM_001297	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	ENST00000251102.8	37	CCDS42169.1	.	.	.	.	.	.	.	.	.	.	G	32	5.107320	0.94292	.	.	ENSG00000070729	ENST00000251102	T	0.59772	0.24	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.79540	0.4463	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.957	T	0.82068	-0.0640	10	0.87932	D	0	.	18.3732	0.90420	0.0:0.0:1.0:0.0	.	53;681	Q14028-2;Q14028	.;CNGB1_HUMAN	L	681	ENSP00000251102:P681L	ENSP00000251102:P681L	P	-	2	0	CNGB1	56508797	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.556000	0.73932	2.894000	0.99253	0.655000	0.94253	CCC	.		0.557	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337167.2	NM_001297	
CNTNAP5	129684	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	125547604	125547604	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:125547604C>A	ENST00000431078.1	+	18	3239	c.2875C>A	c.(2875-2877)Cac>Aac	p.H959N		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	959	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.			PGHCSS -> SIKKLK (in Ref. 4; BAB71205). {ECO:0000305}.	cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CTGCCCCGGCCACTGCAGCAG	0.552																																					p.H959N		.											.	CNTNAP5	524	0			c.C2875A						.						49.0	56.0	54.0					2																	125547604		2126	4238	6364	SO:0001583	missense	129684	exon18			CCCGGCCACTGCA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2875C>A	2.37:g.125547604C>A	ENSP00000399013:p.His959Asn	Somatic	230.0	2.0		WXS	Illumina HiSeq	Phase_I	332.0	98.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044040	0.55110	.	.	ENSG00000155052	ENST00000431078	T	0.75938	-0.98	5.24	5.24	0.73138	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.52532	D	0.000070	D	0.86192	0.5874	M	0.77313	2.365	0.49687	D	0.999819	D	0.71674	0.998	D	0.75484	0.986	D	0.85360	0.1107	10	0.39692	T	0.17	.	18.1624	0.89712	0.0:1.0:0.0:0.0	.	959	Q8WYK1	CNTP5_HUMAN	N	959	ENSP00000399013:H959N	ENSP00000399013:H959N	H	+	1	0	CNTNAP5	125264074	0.994000	0.37717	0.877000	0.34402	0.191000	0.23601	3.156000	0.50708	2.619000	0.88677	0.655000	0.94253	CAC	.		0.552	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130104098	130104098	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr3:130104098A>G	ENST00000432398.2	+	5	2246	c.1752A>G	c.(1750-1752)atA>atG	p.I584M	COL6A5_ENST00000265379.6_Missense_Mutation_p.I584M	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	584	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CTAATAAAATAGAACTGCAAG	0.438																																					p.I584M		.											.	.	.	0			c.A1752G						.						42.0	38.0	39.0					3																	130104098		692	1590	2282	SO:0001583	missense	256076	exon5			TAAAATAGAACTG	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1752A>G	3.37:g.130104098A>G	ENSP00000390895:p.Ile584Met	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	29.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	A	5.465	0.270854	0.10349	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.83163	-1.69;-1.69	5.28	1.45	0.22620	.	.	.	.	.	T	0.67040	0.2851	N	0.20685	0.6	0.09310	N	1	B	0.15930	0.015	B	0.19666	0.026	T	0.54603	-0.8269	9	0.42905	T	0.14	.	1.9884	0.03441	0.5842:0.134:0.1523:0.1295	.	584	A8TX70-2	.	M	584	ENSP00000390895:I584M;ENSP00000265379:I584M	ENSP00000265379:I584M	I	+	3	3	COL6A5	131586788	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.044000	0.12023	0.348000	0.23949	0.455000	0.32223	ATA	.		0.438	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CWC25	54883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	36958366	36958366	+	Silent	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:36958366C>T	ENST00000225428.5	-	10	1554	c.1257G>A	c.(1255-1257)gaG>gaA	p.E419E	PIP4K2B_ENST00000311500.6_5'Flank|CWC25_ENST00000536127.1_Silent_p.E356E|PIP4K2B_ENST00000269554.3_5'Flank	NM_017748.3	NP_060218.1	Q9NXE8	CWC25_HUMAN	CWC25 spliceosome-associated protein homolog (S. cerevisiae)	419										central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	14						TAAAGTTCTTCTCCAGAGCTA	0.448																																					p.E419E		.											.	.	.	0			c.G1257A						.						70.0	67.0	68.0					17																	36958366		1860	4109	5969	SO:0001819	synonymous_variant	54883	exon10			GTTCTTCTCCAGA	AK000298	CCDS45663.1	17q12	2010-01-26	2010-01-26	2010-01-26		ENSG00000273559			25989	protein-coding gene	gene with protein product			"""coiled-coil domain containing 49"""	CCDC49		19941820	Standard	NM_017748		Approved	FLJ20291	uc002hqu.4	Q9NXE8		ENST00000225428.5:c.1257G>A	17.37:g.36958366C>T		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	35.0	NM_017748	A0JLM3|Q68DK5	Silent	SNP	ENST00000225428.5	37	CCDS45663.1																																																																																			.		0.448	CWC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442186.6	NM_017748	
CWH43	80157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	49046853	49046853	+	Silent	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr4:49046853A>G	ENST00000226432.4	+	14	2037	c.1854A>G	c.(1852-1854)cgA>cgG	p.R618R	CWH43_ENST00000513409.1_Silent_p.R591R	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	618	Required for function in lipid remodeling. {ECO:0000250}.				GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						TTATGTATCGAGGGCTGATCA	0.373																																					p.R618R		.											.	CWH43	93	0			c.A1854G						.						205.0	192.0	196.0					4																	49046853		2203	4300	6503	SO:0001819	synonymous_variant	80157	exon14			GTATCGAGGGCTG		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1854A>G	4.37:g.49046853A>G		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	19.0	NM_025087	B2RPD7	Silent	SNP	ENST00000226432.4	37	CCDS3486.1																																																																																			.		0.373	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
CYP2E1	1571	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	135340926	135340949	+	In_Frame_Del	DEL	CCTGCTGGTGTGGGCGGCCTTCCT	CCTGCTGGTGTGGGCGGCCTTCCT	-	rs543066971|rs563043306|rs367957731|rs375169910		TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	CCTGCTGGTGTGGGCGGCCTTCCT	CCTGCTGGTGTGGGCGGCCTTCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr10:135340926_135340949delCCTGCTGGTGTGGGCGGCCTTCCT	ENST00000463117.2	+	3	299_322	c.27_50delCCTGCTGGTGTGGGCGGCCTTCCT	c.(25-51)gccctgctggtgtgggcggccttcctc>gcc	p.LLVWAAFL10del	SPRN_ENST00000541506.1_Intron|CYP2E1_ENST00000252945.3_In_Frame_Del_p.LLVWAAFL10del			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	10					drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)	p.A14V(1)		NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	TCACCGTGGCCCTGCTGGTGTGGGCGGCCTTCCTCCTGCTGGTG	0.607									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.9_17del		.											.	CYP2E1	514	1	Substitution - Missense(1)	large_intestine(1)	c.27_50del						.																																			SO:0001651	inframe_deletion	1571	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	CGTGGCCCTGCTG	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.27_50delCCTGCTGGTGTGGGCGGCCTTCCT	10.37:g.135340926_135340949delCCTGCTGGTGTGGGCGGCCTTCCT	ENSP00000440689:p.Leu10_Leu17del	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	8.0	NM_000773	Q5VZD5|Q6NWT9|Q9UK47	In_Frame_Del	DEL	ENST00000463117.2	37	CCDS7686.1																																																																																			.		0.607	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051161.2	NM_000773	
CYP46A1	10858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	100191750	100191750	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr14:100191750G>A	ENST00000261835.3	+	13	1303	c.1199G>A	c.(1198-1200)cGg>cAg	p.R400Q	CYP46A1_ENST00000554176.1_Missense_Mutation_p.R237Q|CYP46A1_ENST00000423126.2_Missense_Mutation_p.R303Q	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	400					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				GTCATGGGGCGGATGGACACA	0.607																																					p.R400Q		.											.	CYP46A1	90	0			c.G1199A						.						120.0	103.0	109.0					14																	100191750		2203	4300	6503	SO:0001583	missense	10858	exon13			TGGGGCGGATGGA	AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.1199G>A	14.37:g.100191750G>A	ENSP00000261835:p.Arg400Gln	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	49.0	NM_006668	B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	ENST00000261835.3	37	CCDS9954.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577747	0.86645	.	.	ENSG00000036530	ENST00000261835;ENST00000423126;ENST00000554176	T;D;D	0.82526	-0.83;-1.62;-1.62	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	D	0.89584	0.6757	M	0.70275	2.135	0.50467	D	0.999876	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.90506	0.4477	10	0.72032	D	0.01	.	13.0411	0.58899	0.0:0.0:1.0:0.0	.	237;400	Q8N2B0;Q9Y6A2	.;CP46A_HUMAN	Q	400;303;237	ENSP00000261835:R400Q;ENSP00000405779:R303Q;ENSP00000450553:R237Q	ENSP00000261835:R400Q	R	+	2	0	CYP46A1	99261503	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.402000	0.73260	2.218000	0.71995	0.563000	0.77884	CGG	.		0.607	CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413814.1		
DCDC1	341019	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	30921967	30921972	+	In_Frame_Del	DEL	GACTTG	GACTTG	-			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	GACTTG	GACTTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr11:30921967_30921972delGACTTG	ENST00000597505.1	-	31	4574_4579	c.4575_4580delCAAGTC	c.(4573-4581)gacaagtct>gat	p.KS1526del	DCDC1_ENST00000339794.5_In_Frame_Del_p.KS605del|DCDC1_ENST00000406071.2_In_Frame_Del_p.KS264del			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GGTAAGCAAAGACTTGTCTATACCAT	0.359																																					p.632_634del		.											.	DCDC5	23	0			c.1896_1901del						.																																			SO:0001651	inframe_deletion	100506627	exon14			AGCAAAGACTTGT	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.4575_4580delCAAGTC	11.37:g.30921967_30921972delGACTTG	ENSP00000472625:p.Lys1526_Ser1527del	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	14.0	NM_020869	A6PVL6|B7WNX6|Q6ZU04	In_Frame_Del	DEL	ENST00000597505.1	37																																																																																				.		0.359	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	
DCDC1	341019	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	31312242	31312242	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr11:31312242C>T	ENST00000452803.1	-	7	1113	c.912G>A	c.(910-912)atG>atA	p.M304I	DCDC1_ENST00000597505.1_Missense_Mutation_p.M304I	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	304					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CATCCTGCCCCATGCCATTCT	0.348																																					p.M304I		.											.	DCDC1	91	0			c.G912A						.						78.0	80.0	79.0					11																	31312242		2202	4299	6501	SO:0001583	missense	341019	exon7			CTGCCCCATGCCA	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.912G>A	11.37:g.31312242C>T	ENSP00000389792:p.Met304Ile	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	11.0	NM_181807	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	37	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.294484	0.23564	.	.	ENSG00000188682	ENST00000452803	D	0.92805	-3.11	5.39	3.02	0.34903	Doublecortin domain (2);	0.394631	0.23770	N	0.044734	D	0.87589	0.6215	L	0.51422	1.61	0.23994	N	0.996237	B	0.09022	0.002	B	0.12156	0.007	T	0.76299	-0.3010	10	0.37606	T	0.19	-0.8357	8.2245	0.31560	0.0:0.6823:0.0:0.3177	.	304	P59894	DCDC1_HUMAN	I	304	ENSP00000389792:M304I	ENSP00000389792:M304I	M	-	3	0	DCDC1	31268818	0.898000	0.30612	1.000000	0.80357	0.984000	0.73092	1.351000	0.34022	0.479000	0.27511	-0.136000	0.14681	ATG	.		0.348	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807	
DMRTA1	63951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	22447695	22447695	+	Nonsense_Mutation	SNP	G	G	T	rs558506579		TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr9:22447695G>T	ENST00000325870.2	+	1	856	c.631G>T	c.(631-633)Gaa>Taa	p.E211*		NM_022160.2	NP_071443.2	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	211					male mating behavior (GO:0060179)|ovarian follicle development (GO:0001541)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		CCCCGCTTTCGAAGTTTTCCA	0.547																																					p.E211X		.											.	DMRTA1	578	0			c.G631T						.						26.0	31.0	29.0					9																	22447695		2176	4295	6471	SO:0001587	stop_gained	63951	exon1			GCTTTCGAAGTTT	AJ290954	CCDS6514.1	9p21.3	2008-05-15			ENSG00000176399	ENSG00000176399			13826	protein-coding gene	gene with protein product		614803					Standard	NM_022160		Approved		uc003zpp.1	Q5VZB9	OTTHUMG00000019693	ENST00000325870.2:c.631G>T	9.37:g.22447695G>T	ENSP00000319651:p.Glu211*	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	42.0	NM_022160	A1L481|Q8N8Y9|Q9H4B9	Nonsense_Mutation	SNP	ENST00000325870.2	37	CCDS6514.1	.	.	.	.	.	.	.	.	.	.	G	37	6.162399	0.97338	.	.	ENSG00000176399	ENST00000325870	.	.	.	5.67	1.66	0.24008	.	0.603350	0.16754	N	0.200884	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-1.325	9.1383	0.36888	0.0806:0.4541:0.4653:0.0	.	.	.	.	X	211	.	ENSP00000319651:E211X	E	+	1	0	DMRTA1	22437695	0.121000	0.22262	0.015000	0.15790	0.034000	0.12701	0.712000	0.25779	0.037000	0.15575	0.655000	0.94253	GAA	.		0.547	DMRTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051935.2		
DNAH9	1770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11725907	11725907	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:11725907G>T	ENST00000262442.4	+	47	9071	c.9003G>T	c.(9001-9003)gaG>gaT	p.E3001D	DNAH9_ENST00000454412.2_Missense_Mutation_p.E3001D	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3001	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGAACACAGAGGGCATTGAGG	0.507																																					p.E3001D		.											.	DNAH9	168	0			c.G9003T						.						103.0	101.0	102.0					17																	11725907		2203	4300	6503	SO:0001583	missense	1770	exon47			CACAGAGGGCATT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9003G>T	17.37:g.11725907G>T	ENSP00000262442:p.Glu3001Asp	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	51.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	2.852	-0.238060	0.05944	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.55052	0.54;0.54	3.68	-2.52	0.06346	Dynein heavy chain, P-loop containing D4 domain (1);	0.396595	0.23893	N	0.043532	T	0.31482	0.0798	L	0.31926	0.97	0.43846	D	0.99643	B	0.06786	0.001	B	0.18263	0.021	T	0.06844	-1.0804	10	0.16420	T	0.52	.	6.2515	0.20848	0.3157:0.3713:0.313:0.0	.	3001	Q9NYC9	DYH9_HUMAN	D	3001;3001;1583	ENSP00000262442:E3001D;ENSP00000414874:E3001D	ENSP00000262442:E3001D	E	+	3	2	DNAH9	11666632	0.006000	0.16342	0.023000	0.16930	0.529000	0.34654	0.066000	0.14489	-0.560000	0.06102	0.563000	0.77884	GAG	.		0.507	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76440846	76440846	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:76440846C>A	ENST00000585328.1	-	71	11477	c.11353G>T	c.(11353-11355)Gac>Tac	p.D3785Y	DNAH17_ENST00000389840.5_Missense_Mutation_p.D3776Y|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3776					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ATGTCACTGTCCAGATTTTTG	0.582																																					p.D3790Y		.											.	DNAH17	142	0			c.G11368T						.						67.0	61.0	63.0					17																	76440846		2203	4300	6503	SO:0001583	missense	8632	exon71			CACTGTCCAGATT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.11353G>T	17.37:g.76440846C>A	ENSP00000465516:p.Asp3785Tyr	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	200.0	66.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	C	25.6	4.655751	0.88056	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.09163	3.01	4.99	4.99	0.66335	.	0.166015	0.41396	D	0.000893	T	0.36082	0.0954	M	0.87097	2.86	0.80722	D	1	D	0.56287	0.975	P	0.59221	0.854	T	0.36625	-0.9740	10	0.54805	T	0.06	.	18.2779	0.90089	0.0:1.0:0.0:0.0	.	3785	E7EUM8	.	Y	3785;3776	ENSP00000374490:D3776Y	ENSP00000300671:D3785Y	D	-	1	0	DNAH17	73952441	1.000000	0.71417	0.993000	0.49108	0.913000	0.54294	7.607000	0.82883	2.309000	0.77851	0.561000	0.74099	GAC	.		0.582	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
EPB41L2	2037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	131179313	131179313	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr6:131179313T>C	ENST00000337057.3	-	19	3162	c.2981A>G	c.(2980-2982)cAc>cGc	p.H994R	EPB41L2_ENST00000392427.3_Missense_Mutation_p.H662R|EPB41L2_ENST00000527411.1_Missense_Mutation_p.H924R|EPB41L2_ENST00000530757.1_Missense_Mutation_p.H190R|EPB41L2_ENST00000528282.1_Missense_Mutation_p.H736R|EPB41L2_ENST00000525271.1_Missense_Mutation_p.H662R|EPB41L2_ENST00000530481.1_Missense_Mutation_p.H841R|EPB41L2_ENST00000527659.1_Missense_Mutation_p.H800R|EPB41L2_ENST00000445890.2_Missense_Mutation_p.H736R|EPB41L2_ENST00000525193.1_Missense_Mutation_p.H695R|EPB41L2_ENST00000368128.2_Missense_Mutation_p.H994R|EPB41L2_ENST00000531410.1_Missense_Mutation_p.H115R|EPB41L2_ENST00000524581.1_Missense_Mutation_p.H372R|EPB41L2_ENST00000529208.1_Missense_Mutation_p.H924R	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	994	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TGTTTCTTTGTGTACCACCAC	0.532																																					p.H994R		.											.	EPB41L2	91	0			c.A2981G						.						353.0	256.0	289.0					6																	131179313		2203	4300	6503	SO:0001583	missense	2037	exon19			TCTTTGTGTACCA	AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2981A>G	6.37:g.131179313T>C	ENSP00000338481:p.His994Arg	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	69.0	NM_001431	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	ENST00000337057.3	37	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.423681	0.83559	.	.	ENSG00000079819	ENST00000531410;ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000530757;ENST00000392427;ENST00000368128;ENST00000527411;ENST00000524581;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14;-1.14	6.16	4.99	0.66335	Band 4.1, C-terminal (1);	0.043827	0.85682	D	0.000000	D	0.84419	0.5468	M	0.77820	2.39	0.49582	D	0.999802	P;P;D;P;D;P	0.89917	0.519;0.872;1.0;0.559;1.0;0.789	P;P;D;B;D;P	0.97110	0.635;0.636;0.999;0.435;1.0;0.596	D	0.86723	0.1943	10	0.66056	D	0.02	.	13.7045	0.62629	0.0:0.0:0.1286:0.8713	.	662;841;994;736;372;161	B4DHI8;E9PPD9;O43491;Q68DV2;Q6R5J7;Q9UG62	.;.;E41L2_HUMAN;.;.;.	R	115;736;841;736;994;190;662;994;924;372;662;695;800;924	ENSP00000434596:H115R;ENSP00000434308:H736R;ENSP00000434576:H841R;ENSP00000402041:H736R;ENSP00000338481:H994R;ENSP00000436349:H190R;ENSP00000376222:H662R;ENSP00000357110:H994R;ENSP00000436348:H924R;ENSP00000437207:H372R;ENSP00000432803:H662R;ENSP00000431988:H695R;ENSP00000431647:H800R;ENSP00000436641:H924R	ENSP00000338481:H994R	H	-	2	0	EPB41L2	131221006	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.673000	0.83973	1.129000	0.42072	-0.323000	0.08544	CAC	.		0.532	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042204.3		
ESRP1	54845	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	95677274	95677274	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr8:95677274delC	ENST00000433389.2	+	8	1065	c.875delC	c.(874-876)accfs	p.T292fs	ESRP1_ENST00000423620.2_Frame_Shift_Del_p.T292fs|ESRP1_ENST00000454170.2_Frame_Shift_Del_p.T292fs|ESRP1_ENST00000358397.5_Frame_Shift_Del_p.T292fs	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	292	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						CACATGGGGACCCGGTATATT	0.483																																					p.T292fs		.											.	ESRP1	94	0			c.875delC						.						104.0	101.0	102.0					8																	95677274		1926	4141	6067	SO:0001589	frameshift_variant	54845	exon8			TGGGGACCCGGTA	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.875delC	8.37:g.95677274delC	ENSP00000405738:p.Thr292fs	Somatic	231.0	0.0		WXS	Illumina HiSeq	Phase_I	276.0	86.0	NM_001122827	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Frame_Shift_Del	DEL	ENST00000433389.2	37	CCDS47897.1																																																																																			.		0.483	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
EXPH5	23086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108383488	108383488	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr11:108383488G>T	ENST00000265843.4	-	6	2856	c.2746C>A	c.(2746-2748)Cca>Aca	p.P916T	EXPH5_ENST00000428840.1_Missense_Mutation_p.P840T|EXPH5_ENST00000525344.1_Missense_Mutation_p.P909T|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_Missense_Mutation_p.P728T	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	916					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CCTAGCGATGGATCTTTGTCT	0.423																																					p.P916T		.											.	EXPH5	95	0			c.C2746A						.						195.0	178.0	184.0					11																	108383488		2201	4298	6499	SO:0001583	missense	23086	exon6			GCGATGGATCTTT		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.2746C>A	11.37:g.108383488G>T	ENSP00000265843:p.Pro916Thr	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	28.0	NM_015065	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877999	0.51801	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.05319	4.06;3.98;3.83;4.06;3.88;3.46	5.89	3.94	0.45596	.	0.421653	0.22665	N	0.057160	T	0.13030	0.0316	M	0.65975	2.015	0.09310	N	1	P	0.52842	0.956	P	0.51016	0.656	T	0.06303	-1.0834	10	0.41790	T	0.15	-1.9558	9.6224	0.39730	0.0765:0.1403:0.7832:0.0	.	916	Q8NEV8	EXPH5_HUMAN	T	916;840;728;909;840;728	ENSP00000265843:P916T;ENSP00000391966:P840T;ENSP00000411390:P728T;ENSP00000432546:P909T;ENSP00000432683:P840T;ENSP00000446434:P728T	ENSP00000265843:P916T	P	-	1	0	EXPH5	107888698	0.000000	0.05858	0.240000	0.24138	0.603000	0.37013	-0.042000	0.12063	1.475000	0.48197	0.563000	0.77884	CCA	.		0.423	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
FAM105A	54491	broad.mit.edu;bcgsc.ca	37	5	14608988	14608988	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr5:14608988A>C	ENST00000274217.3	+	7	879	c.759A>C	c.(757-759)gaA>gaC	p.E253D		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	253	OTU.									large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					AAGTCACTGAAGTTTATGAAC	0.373																																					p.E253D		.											.	FAM105A	91	0			c.A759C						.						87.0	88.0	87.0					5																	14608988		2203	4300	6503	SO:0001583	missense	54491	exon7			CACTGAAGTTTAT		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.759A>C	5.37:g.14608988A>C	ENSP00000274217:p.Glu253Asp	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	5.0	NM_019018	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	37	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.818175	0.32145	.	.	ENSG00000145569	ENST00000274217	T	0.16743	2.32	4.78	0.989	0.19802	.	0.081678	0.51477	D	0.000098	T	0.10465	0.0256	L	0.37850	1.14	0.34005	D	0.650739	B	0.32693	0.38	B	0.30316	0.114	T	0.16897	-1.0387	10	0.44086	T	0.13	-20.2231	4.4973	0.11844	0.5067:0.0:0.3487:0.1447	.	253	Q9NUU6	F105A_HUMAN	D	253	ENSP00000274217:E253D	ENSP00000274217:E253D	E	+	3	2	FAM105A	14661988	0.405000	0.25336	0.513000	0.27749	0.941000	0.58515	-0.062000	0.11674	-0.076000	0.12775	-0.386000	0.06593	GAA	.		0.373	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018	
FAM166B	730112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	35563264	35563264	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr9:35563264G>A	ENST00000399742.2	-	2	255	c.185C>T	c.(184-186)cCt>cTt	p.P62L	FAM166B_ENST00000492890.1_5'UTR	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	62										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						CCGAATGGGAGGCAGAAGTGT	0.617																																					p.P62L		.											.	.	.	0			c.C185T						.						109.0	116.0	114.0					9																	35563264		2088	4227	6315	SO:0001583	missense	730112	exon2			ATGGGAGGCAGAA	BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.185C>T	9.37:g.35563264G>A	ENSP00000382646:p.Pro62Leu	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	53.0	NM_001099951	A1L3B2|B7ZBJ0	Missense_Mutation	SNP	ENST00000399742.2	37	CCDS56572.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275430	0.80580	.	.	ENSG00000215187	ENST00000399742;ENST00000537504	.	.	.	5.9	5.9	0.94986	.	0.517299	0.14939	U	0.289603	T	0.78528	0.4297	M	0.65975	2.015	0.51482	D	0.999927	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;0.998;0.986;0.999	T	0.77811	-0.2449	9	0.72032	D	0.01	-10.6523	15.7632	0.78103	0.0:0.0:1.0:0.0	.	62;62;62;62	B7ZW33;B7ZW26;A8MTA8;A8MTA8-2	.;.;F166B_HUMAN;.	L	62	.	ENSP00000382646:P62L	P	-	2	0	FAM166B	35553264	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.829000	0.55760	2.788000	0.95919	0.655000	0.94253	CCT	.		0.617	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336563.1	NM_001099951	
FAM46A	55603	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	82459698	82459698	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr6:82459698T>C	ENST00000320172.6	-	3	1357	c.1043A>G	c.(1042-1044)gAa>gGa	p.E348G	FAM46A_ENST00000369756.3_Missense_Mutation_p.E429G|FAM46A_ENST00000369754.3_Missense_Mutation_p.E367G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	348					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		CTTGCGGTCTTCCAATCCCAC	0.438																																					p.E348G		.											.	FAM46A	90	0			c.A1043G						.						129.0	113.0	118.0					6																	82459698		2203	4300	6503	SO:0001583	missense	55603	exon3			CGGTCTTCCAATC	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.1043A>G	6.37:g.82459698T>C	ENSP00000318298:p.Glu348Gly	Somatic	143.0	1.0		WXS	Illumina HiSeq	Phase_I	159.0	47.0	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	ENST00000320172.6	37	CCDS34489.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.255770	0.39896	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756;ENST00000423467	T;T;T	0.26957	1.7;1.7;1.7	5.95	5.95	0.96441	Domain of unknown function DUF1693 (1);	1.011480	0.07907	N	0.973601	T	0.43831	0.1265	M	0.69358	2.11	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.991	T	0.02371	-1.1169	10	0.42905	T	0.14	-6.6822	16.4237	0.83790	0.0:0.0:0.0:1.0	.	348;367	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	G	367;348;429;82	ENSP00000358769:E367G;ENSP00000318298:E348G;ENSP00000358771:E429G	ENSP00000318298:E348G	E	-	2	0	FAM46A	82516417	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	7.698000	0.84413	2.279000	0.76181	0.533000	0.62120	GAA	.		0.438	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92538485	92538485	+	Silent	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr11:92538485T>C	ENST00000298047.6	+	10	9080	c.9063T>C	c.(9061-9063)gaT>gaC	p.D3021D	FAT3_ENST00000525166.1_Silent_p.D2871D|FAT3_ENST00000409404.2_Silent_p.D3021D			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3021	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCGTCAGTGATGTGAATGACA	0.433										TCGA Ovarian(4;0.039)																											p.D3021D		.											.	FAT3	73	0			c.T9063C						.						63.0	64.0	63.0					11																	92538485		1958	4167	6125	SO:0001819	synonymous_variant	120114	exon10			CAGTGATGTGAAT	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9063T>C	11.37:g.92538485T>C		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	230.0	71.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.		0.433	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FFAR2	2867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35940974	35940974	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr19:35940974T>G	ENST00000599180.2	+	2	438	c.358T>G	c.(358-360)Tcc>Gcc	p.S120A	FFAR2_ENST00000246549.2_Missense_Mutation_p.S120A|FFAR2_ENST00000601590.1_Intron			O15552	FFAR2_HUMAN	free fatty acid receptor 2	120					cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to fatty acid (GO:0071398)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipid storage (GO:0019915)|mucosal immune response (GO:0002385)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of interleukin-8 secretion (GO:2000484)|regulation of acute inflammatory response (GO:0002673)|regulation of peptide hormone secretion (GO:0090276)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(6)|skin(1)|urinary_tract(1)	22	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GTACAAGCTCTCCCGCCGGCC	0.562																																					p.S120A	GBM(40;139 809 9833 23358 48736)	.											.	FFAR2	90	0			c.T358G						.						81.0	70.0	74.0					19																	35940974		2203	4300	6503	SO:0001583	missense	2867	exon1			AAGCTCTCCCGCC	AF024690	CCDS12461.1	19q13.1	2012-08-08	2006-02-15	2006-02-15		ENSG00000126262		"""GPCR / Class A : Fatty acid receptors"""	4501	protein-coding gene	gene with protein product		603823	"""G protein-coupled receptor 43"""	GPR43		9344866	Standard	NM_005306		Approved	FFA2R	uc010eea.3	O15552		ENST00000599180.2:c.358T>G	19.37:g.35940974T>G	ENSP00000473159:p.Ser120Ala	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	60.0	NM_005306	B0M0J9|Q4VAZ3|Q4VAZ5|Q4VBL5	Missense_Mutation	SNP	ENST00000599180.2	37	CCDS12461.1	.	.	.	.	.	.	.	.	.	.	T	3.881	-0.026016	0.07589	.	.	ENSG00000126262	ENST00000246549	T	0.71817	-0.6	5.72	2.16	0.27623	GPCR, rhodopsin-like superfamily (1);	0.440704	0.26522	N	0.023915	T	0.55513	0.1925	L	0.42686	1.345	0.23445	N	0.997662	B	0.06786	0.001	B	0.08055	0.003	T	0.34030	-0.9845	10	0.15499	T	0.54	-44.1769	7.4955	0.27487	0.1381:0.0:0.4283:0.4336	.	120	O15552	FFAR2_HUMAN	A	120	ENSP00000246549:S120A	ENSP00000246549:S120A	S	+	1	0	FFAR2	40632814	0.000000	0.05858	0.996000	0.52242	0.699000	0.40488	0.453000	0.21811	0.469000	0.27268	0.533000	0.62120	TCC	.		0.562	FFAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466120.3	NM_005306	
FKBP10	60681	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	39975544	39975544	+	Silent	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:39975544A>G	ENST00000321562.4	+	5	914	c.810A>G	c.(808-810)ctA>ctG	p.L270L	FKBP10_ENST00000544340.1_5'UTR	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	270					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		CTGTCCAGCTAGAGACGCTGG	0.642																																					p.L270L		.											.	FKBP10	227	0			c.A810G						.						59.0	61.0	60.0					17																	39975544		2203	4300	6503	SO:0001819	synonymous_variant	60681	exon5			CCAGCTAGAGACG	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.810A>G	17.37:g.39975544A>G		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	7.0	NM_021939	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Silent	SNP	ENST00000321562.4	37	CCDS11409.1	.	.	.	.	.	.	.	.	.	.	A	6.798	0.516293	0.12944	.	.	ENSG00000141756	ENST00000455106	.	.	.	5.55	-0.884	0.10597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.868	7.532	0.27689	0.3501:0.0:0.5488:0.1011	.	.	.	.	W	13	.	.	X	+	2	0	FKBP10	37229070	1.000000	0.71417	0.983000	0.44433	0.252000	0.25951	1.401000	0.34589	-0.001000	0.14495	0.459000	0.35465	TAG	.		0.642	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257410.2	NM_021939	
FLG	2312	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	152279760	152279760	+	Silent	SNP	G	G	A	rs3126073	byFrequency	TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:152279760G>A	ENST00000368799.1	-	3	7637	c.7602C>T	c.(7600-7602)caC>caT	p.H2534H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2534	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGCTTCATGGTGACGCGACC	0.582									Ichthyosis				G|||	51	0.0101837	0.0356	0.0058	5008	,	,		19193	0.0		0.0	False		,,,				2504	0.0				p.H2534H		.											.	FLG	106	0			c.C7602T						.	G		140,4266	99.4+/-138.0	1,138,2064	255.0	270.0	265.0		7602	-1.1	0.0	1	dbSNP_103	265	0,8598		0,0,4299	no	coding-synonymous	FLG	NM_002016.1		1,138,6363	AA,AG,GG		0.0,3.1775,1.0766		2534/4062	152279760	140,12864	2203	4299	6502	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TTCATGGTGACGC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7602C>T	1.37:g.152279760G>A		Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	361.0	99.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																			G|0.987;A|0.013		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
GABRQ	55879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	151818957	151818957	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chrX:151818957T>C	ENST00000370306.2	+	7	835	c.815T>C	c.(814-816)gTc>gCc	p.V272A		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	272					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTTGTGCAAGTCTACTGGCCT	0.483																																					p.V272A		.											.	GABRQ	133	0			c.T815C						.						367.0	297.0	321.0					X																	151818957		2203	4300	6503	SO:0001583	missense	55879	exon7			TGCAAGTCTACTG	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.815T>C	X.37:g.151818957T>C	ENSP00000359329:p.Val272Ala	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	445.0	171.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387602	0.61956	.	.	ENSG00000147402	ENST00000370306	D	0.85955	-2.05	6.01	4.88	0.63580	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.429650	0.19931	N	0.102873	T	0.76630	0.4014	L	0.28400	0.85	0.31351	N	0.682548	P	0.42456	0.78	B	0.43301	0.415	T	0.78575	-0.2151	10	0.66056	D	0.02	.	3.9603	0.09407	0.0:0.2646:0.0:0.7354	.	272	Q9UN88	GBRT_HUMAN	A	272	ENSP00000359329:V272A	ENSP00000359329:V272A	V	+	2	0	GABRQ	151569613	1.000000	0.71417	0.743000	0.31040	0.327000	0.28475	6.109000	0.71528	2.019000	0.59389	0.451000	0.29950	GTC	.		0.483	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
GALR1	2587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	74980684	74980684	+	Silent	SNP	G	G	T	rs199730182		TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr18:74980684G>T	ENST00000299727.3	+	3	876	c.876G>T	c.(874-876)gcG>gcT	p.A292A		NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	292					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		ACTGCCTGGCGTACAGCAATT	0.493																																					p.A292A		.											.	GALR1	522	0			c.G876T						.						84.0	83.0	83.0					18																	74980684		2203	4300	6503	SO:0001819	synonymous_variant	2587	exon3			CCTGGCGTACAGC	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.876G>T	18.37:g.74980684G>T		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	41.0	NM_001480	Q4VBL7	Silent	SNP	ENST00000299727.3	37	CCDS12012.1																																																																																			G|0.999;A|0.001		0.493	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256362.1		
GJA8	2703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	147381088	147381088	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:147381088delC	ENST00000369235.1	+	1	1006	c.1006delC	c.(1006-1008)ccgfs	p.P337fs	GJA8_ENST00000240986.4_Frame_Shift_Del_p.P337fs			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	337					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					GGGCGAGGGGCCGCCTGCAGA	0.652																																					p.P336fs	Melanoma(76;1255 1795 8195 52096)	.											.	GJA8	138	0			c.1006delC						.						27.0	27.0	27.0					1																	147381088		2202	4299	6501	SO:0001589	frameshift_variant	2703	exon2			GAGGGGCCGCCTG	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.1006delC	1.37:g.147381088delC	ENSP00000358238:p.Pro337fs	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	39.0	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Frame_Shift_Del	DEL	ENST00000369235.1	37	CCDS30834.1																																																																																			.		0.652	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
GP9	2815	broad.mit.edu;mdanderson.org	37	3	128781113	128781113	+	Silent	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr3:128781113T>C	ENST00000307395.4	+	3	753	c.531T>C	c.(529-531)gaT>gaC	p.D177D		NM_000174.3	NP_000165.1	P14770	GPIX_HUMAN	glycoprotein IX (platelet)	177					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|lung(4)	6					Quinine(DB00468)	AGGCCCTGGATTGAGCCAGGC	0.701																																					p.D177D		.											.	GP9	90	0			c.T531C						.						2.0	2.0	2.0					3																	128781113		1330	2736	4066	SO:0001819	synonymous_variant	2815	exon3			CCTGGATTGAGCC		CCDS3055.1	3q21.3	2014-09-17				ENSG00000169704		"""CD molecules"""	4444	protein-coding gene	gene with protein product		173515				2253772	Standard	XM_005247374		Approved	CD42a, GPIX	uc003elm.2	P14770		ENST00000307395.4:c.531T>C	3.37:g.128781113T>C		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	9.0	NM_000174	Q14445|Q8N1D1|Q92525	Silent	SNP	ENST00000307395.4	37	CCDS3055.1																																																																																			.		0.701	GP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358428.1		
HERC2	8924	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	28421656	28421656	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr15:28421656G>C	ENST00000261609.7	-	63	9712	c.9604C>G	c.(9604-9606)Cta>Gta	p.L3202V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGTCCATTTAGTCTCTCAATG	0.527																																					p.L3202V		.											.	HERC2	234	0			c.C9604G						.						83.0	85.0	84.0					15																	28421656		2203	4298	6501	SO:0001583	missense	8924	exon63			CATTTAGTCTCTC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9604C>G	15.37:g.28421656G>C	ENSP00000261609:p.Leu3202Val	Somatic	209.0	1.0		WXS	Illumina HiSeq	Phase_I	281.0	81.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261629	0.80358	.	.	ENSG00000128731	ENST00000261609	D	0.87256	-2.23	5.65	5.65	0.86999	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.154512	0.44097	D	0.000491	D	0.94670	0.8281	M	0.87547	2.89	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.94997	0.8139	10	0.87932	D	0	.	19.7107	0.96095	0.0:0.0:1.0:0.0	.	3202	O95714	HERC2_HUMAN	V	3202	ENSP00000261609:L3202V	ENSP00000261609:L3202V	L	-	1	2	HERC2	26095251	1.000000	0.71417	0.959000	0.39883	0.584000	0.36387	5.468000	0.66743	2.659000	0.90383	0.585000	0.79938	CTA	.		0.527	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HOXD12	3238	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	176964643	176964643	+	Silent	SNP	G	G	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:176964643G>C	ENST00000406506.2	+	1	186	c.114G>C	c.(112-114)gcG>gcC	p.A38A	HOXD12_ENST00000404162.2_Silent_p.A38A			P35452	HXD12_HUMAN	homeobox D12	38				GGQLAALPPISYPRG -> AASLAFPLSPTRA (in Ref. 1; AAF79044). {ECO:0000305}.	embryonic digit morphogenesis (GO:0042733)|pattern specification process (GO:0007389)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(7)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		AGTTGGCCGCGCTTCCCCCTA	0.697																																					p.A38A		.											.	.	.	0			c.G114C						.						36.0	40.0	39.0					2																	176964643		1816	4063	5879	SO:0001819	synonymous_variant	3238	exon1			GGCCGCGCTTCCC		CCDS46456.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170178	ENSG00000170178		"""Homeoboxes / ANTP class : HOXL subclass"""	5135	protein-coding gene	gene with protein product		142988	"""homeo box D12"""	HOX4H		1675198, 1973146	Standard	NM_021193		Approved		uc010zev.1	P35452	OTTHUMG00000150358	ENST00000406506.2:c.114G>C	2.37:g.176964643G>C		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	10.0	NM_021193	B5MCP0|Q0VAD7|Q0VAD8|Q9NS03	Silent	SNP	ENST00000406506.2	37	CCDS46456.1																																																																																			.		0.697	HOXD12-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359253.2	NM_021193	
HIBCH	26275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	191077767	191077767	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:191077767A>C	ENST00000359678.5	-	12	1220	c.926T>G	c.(925-927)aTc>aGc	p.I309S	HIBCH_ENST00000486981.1_5'UTR|HIBCH_ENST00000392332.3_Missense_Mutation_p.I309S|HIBCH_ENST00000410045.1_Missense_Mutation_p.I86S	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	309					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			CCTTAGTGTGATCTTTAGAGA	0.343																																					p.I309S		.											.	HIBCH	90	0			c.T926G						.						93.0	98.0	96.0					2																	191077767		2203	4300	6503	SO:0001583	missense	26275	exon12			AGTGTGATCTTTA	U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.926T>G	2.37:g.191077767A>C	ENSP00000352706:p.Ile309Ser	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	8.0	NM_014362	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	37	CCDS2304.1	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214076	0.58452	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000410045;ENST00000416732;ENST00000409820	T;T;T;T;T	0.74526	-0.63;-0.63;-0.85;-0.85;-0.85	5.01	5.01	0.66863	.	0.231118	0.43110	D	0.000611	D	0.85741	0.5767	M	0.80028	2.48	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.91635	0.997;0.999	D	0.87646	0.2525	10	0.87932	D	0	0.3696	12.711	0.57089	1.0:0.0:0.0:0.0	.	309;309	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	S	309;309;86;60;89	ENSP00000376144:I309S;ENSP00000352706:I309S;ENSP00000386274:I86S;ENSP00000399263:I60S;ENSP00000387098:I89S	ENSP00000352706:I309S	I	-	2	0	HIBCH	190786012	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	6.889000	0.75627	2.096000	0.63516	0.460000	0.39030	ATC	.		0.343	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1		
IRAK3	11213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	66611016	66611016	+	Splice_Site	SNP	G	G	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr12:66611016G>T	ENST00000261233.4	+	6	1074		c.e6+1		IRAK3_ENST00000457197.2_Splice_Site	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		TTTTACTACTGTGAGTATGTT	0.353																																					.		.											.	IRAK3	1379	0			c.653+1G>T						.						452.0	482.0	472.0					12																	66611016		2203	4300	6503	SO:0001630	splice_region_variant	11213	exon6			ACTACTGTGAGTA	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.653+1G>T	12.37:g.66611016G>T		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	28.0	NM_007199		Splice_Site	SNP	ENST00000261233.4	37	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422174	0.25639	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6645	0.68896	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IRAK3	64897283	1.000000	0.71417	1.000000	0.80357	0.136000	0.21042	4.738000	0.62073	2.514000	0.84764	0.563000	0.77884	.	.		0.353	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1		Intron
IKBIP	121457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	99028193	99028193	+	Splice_Site	SNP	T	T	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr12:99028193T>A	ENST00000342502.2	-	2	591		c.e2-2		IKBIP_ENST00000420861.1_Intron|IKBIP_ENST00000299157.4_Splice_Site|IKBIP_ENST00000393042.3_Intron	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein						response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						AATACAAACCTGGAAAAGAAA	0.308																																					.		.											.	IKBIP	226	0			c.180-2A>T						.						95.0	87.0	89.0					12																	99028193		2203	4300	6503	SO:0001630	splice_region_variant	121457	exon3			CAAACCTGGAAAA	AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.180-2A>T	12.37:g.99028193T>A		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	15.0	NM_201612	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Splice_Site	SNP	ENST00000342502.2	37	CCDS9067.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.260584	0.80246	.	.	ENSG00000166130	ENST00000342502;ENST00000299157	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	IKBIP	97552324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.110000	0.64622	2.288000	0.76882	0.533000	0.62120	.	.		0.308	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2	NM_153687	Intron
ISL1	3670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	50685666	50685666	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr5:50685666C>A	ENST00000230658.7	+	4	1250	c.665C>A	c.(664-666)cCc>cAc	p.P222H	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Missense_Mutation_p.P222H	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	222					atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				GGCCTCAGTCCCCGTGTGATC	0.562																																					p.P222H		.											.	ISL1	515	0			c.C665A						.						63.0	75.0	71.0					5																	50685666		2203	4300	6503	SO:0001583	missense	3670	exon4			TCAGTCCCCGTGT	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.665C>A	5.37:g.50685666C>A	ENSP00000230658:p.Pro222His	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	256.0	84.0	NM_002202	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713780	0.89112	.	.	ENSG00000016082	ENST00000230658;ENST00000503187;ENST00000511384	D;D	0.96168	-3.93;-3.93	5.73	5.73	0.89815	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97832	0.9288	M	0.81802	2.56	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.98225	1.0480	10	0.87932	D	0	.	19.8842	0.96908	0.0:1.0:0.0:0.0	.	222	P61371	ISL1_HUMAN	H	222	ENSP00000230658:P222H;ENSP00000422676:P222H	ENSP00000230658:P222H	P	+	2	0	ISL1	50721423	1.000000	0.71417	0.985000	0.45067	0.740000	0.42216	7.726000	0.84824	2.689000	0.91719	0.585000	0.79938	CCC	.		0.562	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
KCTD16	57528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	143853624	143853624	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr5:143853624C>T	ENST00000507359.3	+	3	2325	c.1234C>T	c.(1234-1236)Cct>Tct	p.P412S	KCTD16_ENST00000512467.1_Missense_Mutation_p.P412S	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	412					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AGATCGGTTTCCTGAGAGAAA	0.378																																					p.P412S		.											.	KCTD16	137	0			c.C1234T						.						53.0	62.0	59.0					5																	143853624		2196	4298	6494	SO:0001583	missense	57528	exon4			CGGTTTCCTGAGA	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1234C>T	5.37:g.143853624C>T	ENSP00000426548:p.Pro412Ser	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	25.0	NM_020768	Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696256	0.88830	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.63913	-0.07;-0.07	6.17	6.17	0.99709	.	0.382752	0.29152	N	0.012981	T	0.74313	0.3700	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.74315	-0.3705	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	412	Q68DU8	KCD16_HUMAN	S	412	ENSP00000424151:P412S;ENSP00000426548:P412S	ENSP00000426548:P412S	P	+	1	0	KCTD16	143833817	1.000000	0.71417	0.950000	0.38849	0.935000	0.57460	7.400000	0.79949	2.941000	0.99782	0.655000	0.94253	CCT	.		0.378	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
KDM5C	8242	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53228047	53228047	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chrX:53228047A>T	ENST00000375401.3	-	16	2799	c.2267T>A	c.(2266-2268)cTt>cAt	p.L756H	KDM5C_ENST00000375383.3_Missense_Mutation_p.L715H|KDM5C_ENST00000452825.3_Missense_Mutation_p.L689H|KDM5C_ENST00000375379.3_Missense_Mutation_p.L756H|KDM5C_ENST00000465402.1_5'Flank|KDM5C_ENST00000404049.3_Missense_Mutation_p.L755H	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	756					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						CATGGCAGGAAGCTCATCCAA	0.587			"""N, F, S"""		clear cell renal carcinoma																																p.L756H		.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C	1272	0			c.T2267A						.						96.0	69.0	78.0					X																	53228047		2203	4300	6503	SO:0001583	missense	8242	exon16			GCAGGAAGCTCAT	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2267T>A	X.37:g.53228047A>T	ENSP00000364550:p.Leu756His	Somatic	149.0	1.0		WXS	Illumina HiSeq	Phase_I	252.0	157.0	NM_004187	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.601282	0.66445	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83;-3.83	4.45	4.45	0.53987	Zinc finger, C5HC2-type (1);	0.000000	0.85682	D	0.000000	D	0.97936	0.9321	M	0.92507	3.315	0.50813	D	0.999896	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.997	D	0.98368	1.0552	10	0.87932	D	0	-15.0051	10.886	0.46968	1.0:0.0:0.0:0.0	.	689;755;756	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	H	689;756;755;756;715	ENSP00000445176:L689H;ENSP00000364550:L756H;ENSP00000385394:L755H;ENSP00000364528:L756H;ENSP00000364532:L715H	ENSP00000364528:L756H	L	-	2	0	KDM5C	53244772	1.000000	0.71417	0.998000	0.56505	0.804000	0.45430	9.229000	0.95273	1.461000	0.47929	0.235000	0.17854	CTT	.		0.587	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
KIAA0232	9778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6864199	6864199	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr4:6864199T>A	ENST00000307659.5	+	7	2545	c.2090T>A	c.(2089-2091)tTt>tAt	p.F697Y	KIAA0232_ENST00000425103.1_Missense_Mutation_p.F697Y	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	697							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						AATAGTGCCTTTGAAGAAAAT	0.343																																					p.F697Y		.											.	KIAA0232	92	0			c.T2090A						.						63.0	59.0	60.0					4																	6864199		1844	4098	5942	SO:0001583	missense	9778	exon7			GTGCCTTTGAAGA	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.2090T>A	4.37:g.6864199T>A	ENSP00000303928:p.Phe697Tyr	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	86.0	NM_014743	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	37	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.786035	0.70337	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.77824	0.4188	M	0.66939	2.045	0.58432	D	0.999996	D	0.76494	0.999	D	0.76071	0.987	T	0.80241	-0.1464	9	0.87932	D	0	-14.357	16.0174	0.80450	0.0:0.0:0.0:1.0	.	697	Q92628	K0232_HUMAN	Y	697	.	ENSP00000303928:F697Y	F	+	2	0	KIAA0232	6915100	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.765000	0.68834	2.186000	0.69663	0.533000	0.62120	TTT	.		0.343	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
KIAA0556	23247	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	27772791	27772791	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr16:27772791G>A	ENST00000261588.4	+	19	3708	c.3689G>A	c.(3688-3690)gGc>gAc	p.G1230D		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1230						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GGGCTCACTGGCCTGGAAGTG	0.592																																					p.G1230D		.											.	KIAA0556	141	0			c.G3689A						.						78.0	69.0	72.0					16																	27772791		2197	4300	6497	SO:0001583	missense	23247	exon19			TCACTGGCCTGGA	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3689G>A	16.37:g.27772791G>A	ENSP00000261588:p.Gly1230Asp	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	8.0	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799317	0.90538	.	.	ENSG00000047578	ENST00000261588	T	0.20069	2.1	4.56	4.56	0.56223	.	0.053288	0.85682	D	0.000000	T	0.56834	0.2012	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69580	-0.5107	10	0.59425	D	0.04	-15.1229	16.9555	0.86258	0.0:0.0:1.0:0.0	.	1230	O60303	K0556_HUMAN	D	1230	ENSP00000261588:G1230D	ENSP00000261588:G1230D	G	+	2	0	KIAA0556	27680292	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.703000	0.98714	2.086000	0.62901	0.561000	0.74099	GGC	.		0.592	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
KIAA0754	643314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	39879769	39879769	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:39879769G>A	ENST00000530275.1	+	1	3619	c.3424G>A	c.(3424-3426)Gag>Aag	p.E1142K	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	1142	Ala-rich.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCCCACCCCCGAGGAGCCTGC	0.667																																					p.E1278K		.											.	.	.	0			c.G3832A						.						13.0	15.0	14.0					1																	39879769		1997	4156	6153	SO:0001583	missense	643314	exon1			ACCCCCGAGGAGC			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.3424G>A	1.37:g.39879769G>A	ENSP00000431179:p.Glu1142Lys	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	55.0	NM_015038	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	ENST00000530275.1	37		.	.	.	.	.	.	.	.	.	.	G	12.43	1.935392	0.34189	.	.	ENSG00000255103	ENST00000530275	T	0.26223	1.75	3.7	0.687	0.18020	.	.	.	.	.	T	0.14184	0.0343	N	0.19112	0.55	0.09310	N	1	B	0.24533	0.105	B	0.15052	0.012	T	0.20874	-1.0262	9	0.51188	T	0.08	.	5.6751	0.17743	0.2889:0.1489:0.5622:0.0	.	1142	O94854	K0754_HUMAN	K	1142	ENSP00000431179:E1142K	ENSP00000431179:E1142K	E	+	1	0	RP4-562N20.1	39652356	0.049000	0.20398	0.005000	0.12908	0.011000	0.07611	0.754000	0.26390	-0.378000	0.07918	-2.039000	0.00418	GAG	.		0.667	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
KIAA2018	205717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113373818	113373818	+	Silent	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr3:113373818T>C	ENST00000478658.1	-	5	6728	c.6711A>G	c.(6709-6711)ctA>ctG	p.L2237L	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.L2237L			Q68DE3	K2018_HUMAN	KIAA2018	2237						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AATCATGACCTAGAATATGGC	0.403																																					p.L2237L		.											.	KIAA2018	93	0			c.A6711G						.						89.0	81.0	83.0					3																	113373818		1921	4136	6057	SO:0001819	synonymous_variant	205717	exon7			ATGACCTAGAATA	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.6711A>G	3.37:g.113373818T>C		Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	62.0	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.		0.403	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
KIAA2022	340533	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	73962088	73962088	+	Silent	SNP	T	T	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chrX:73962088T>A	ENST00000055682.6	-	3	2915	c.2304A>T	c.(2302-2304)tcA>tcT	p.S768S		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	768					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						GGGAACTGTTTGATGTCCCAG	0.418																																					p.S768S		.											.	KIAA2022	183	0			c.A2304T						.						76.0	72.0	73.0					X																	73962088		2203	4298	6501	SO:0001819	synonymous_variant	340533	exon3			ACTGTTTGATGTC		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2304A>T	X.37:g.73962088T>A		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	63.0	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	ENST00000055682.6	37	CCDS35337.1																																																																																			.		0.418	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
MAP3K9	4293	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	71215655	71215655	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr14:71215655A>G	ENST00000554752.2	-	5	1216	c.1217T>C	c.(1216-1218)aTa>aCa	p.I406T	MAP3K9_ENST00000381250.4_Missense_Mutation_p.I406T|MAP3K9_ENST00000553414.1_Missense_Mutation_p.I100T|MAP3K9_ENST00000554146.1_Missense_Mutation_p.I143T|MAP3K9_ENST00000555993.2_Missense_Mutation_p.I406T	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	406	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		AGACTCCTCTATGGTGGTTAG	0.483																																					p.I406T	GBM(114;411 1587 13539 28235 50070)	.											.	MAP3K9	546	0			c.T1217C						.						149.0	137.0	141.0					14																	71215655		2203	4300	6503	SO:0001583	missense	4293	exon5			TCCTCTATGGTGG	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1217T>C	14.37:g.71215655A>G	ENSP00000451612:p.Ile406Thr	Somatic	201.0	1.0		WXS	Illumina HiSeq	Phase_I	286.0	94.0	NM_033141	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	37		.	.	.	.	.	.	.	.	.	.	A	25.2	4.609126	0.87258	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.78816	-1.18;-1.1;-1.21;-1.19	5.37	5.37	0.77165	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89315	0.6680	M	0.86502	2.82	0.80722	D	1	D;D;D;D	0.76494	0.999;0.992;0.995;0.998	D;D;D;D	0.75484	0.986;0.943;0.974;0.982	D	0.91270	0.5043	10	0.87932	D	0	.	15.656	0.77136	1.0:0.0:0.0:0.0	.	143;406;406;100	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	T	406;406;100;406;143;134	ENSP00000451612:I406T;ENSP00000451038:I100T;ENSP00000370649:I406T;ENSP00000451921:I143T	ENSP00000005198:I406T	I	-	2	0	MAP3K9	70285408	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.225000	0.95219	2.160000	0.67779	0.528000	0.53228	ATA	.		0.483	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		
MEGF6	1953	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3432019	3432019	+	Missense_Mutation	SNP	C	C	T	rs375609074		TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:3432019C>T	ENST00000356575.4	-	6	903	c.677G>A	c.(676-678)cGc>cAc	p.R226H	MEGF6_ENST00000294599.4_Missense_Mutation_p.R121H	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	226	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GCACTGGCAGCGATGCCGAGT	0.662																																					p.R226H	Ovarian(73;978 3658)	.											.	MEGF6	90	0			c.G677A						.	C	HIS/ARG	0,4230		0,0,2115	27.0	37.0	34.0		677	3.9	1.0	1		34	1,8431		0,1,4215	no	missense	MEGF6	NM_001409.3	29	0,1,6330	TT,TC,CC		0.0119,0.0,0.0079	probably-damaging	226/1542	3432019	1,12661	2115	4216	6331	SO:0001583	missense	1953	exon6			TGGCAGCGATGCC	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.677G>A	1.37:g.3432019C>T	ENSP00000348982:p.Arg226His	Somatic	134.0	1.0		WXS	Illumina HiSeq	Phase_I	197.0	65.0	NM_001409	Q4AC86|Q5VV39	Missense_Mutation	SNP	ENST00000356575.4	37	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342880	0.41498	0.0	1.19E-4	ENSG00000162591	ENST00000294599;ENST00000356575	D;D	0.87571	-2.27;-2.27	3.92	3.92	0.45320	Epidermal growth factor-like (1);	0.294870	0.32970	N	0.005433	D	0.85358	0.5678	N	0.25825	0.765	0.32517	N	0.536752	D;D	0.69078	0.997;0.996	P;D	0.65573	0.895;0.936	D	0.84690	0.0722	10	0.42905	T	0.14	-43.1842	5.2959	0.15752	0.0:0.7331:0.0:0.2669	.	226;121	O75095;O75095-2	MEGF6_HUMAN;.	H	121;226	ENSP00000294599:R121H;ENSP00000348982:R226H	ENSP00000294599:R121H	R	-	2	0	MEGF6	3421879	0.996000	0.38824	1.000000	0.80357	0.455000	0.32408	0.411000	0.21115	2.153000	0.67306	0.563000	0.77884	CGC	.		0.662	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
MARC2	54996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220935024	220935024	+	Silent	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:220935024C>T	ENST00000366913.3	+	3	669	c.471C>T	c.(469-471)ggC>ggT	p.G157G	MARC2_ENST00000359316.2_Silent_p.G157G	NM_017898.3	NP_060368.2	Q969Z3	MARC2_HUMAN	mitochondrial amidoxime reducing component 2	157					detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										ACATTAAAGGCAGAGACTGTG	0.403																																					p.G157G		.											.	.	.	0			c.C471T						.						89.0	77.0	81.0					1																	220935024		2203	4300	6503	SO:0001819	synonymous_variant	54996	exon3			TAAAGGCAGAGAC		CCDS1525.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000117791	ENSG00000117791			26064	protein-coding gene	gene with protein product		614127	"""MOCO sulphurase C-terminal domain containing 2"""	MOSC2		11886751	Standard	NM_017898		Approved	FLJ20605	uc001hmq.3	Q969Z3	OTTHUMG00000037354	ENST00000366913.3:c.471C>T	1.37:g.220935024C>T		Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	269.0	137.0	NM_017898	B2D0R5|D3DTB3|Q0JSK7|Q5VT67|Q5VXC7|Q7L317|Q9H066|Q9NWU0	Silent	SNP	ENST00000366913.3	37	CCDS1525.1																																																																																			.		0.403	MARC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090911.1	NM_017898	
MEIS3	56917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47910667	47910667	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr19:47910667C>G	ENST00000558555.1	-	9	1064	c.877G>C	c.(877-879)Gag>Cag	p.E293Q	MEIS3_ENST00000560253.1_5'UTR|MEIS3_ENST00000559524.1_Missense_Mutation_p.E339Q|MEIS3_ENST00000331559.5_Missense_Mutation_p.E322Q|MEIS3_ENST00000561096.1_Missense_Mutation_p.E381Q|MEIS3_ENST00000441740.2_Missense_Mutation_p.E276Q|MEIS3_ENST00000561293.1_Missense_Mutation_p.E339Q			Q99687	MEIS3_HUMAN	Meis homeobox 3	293					negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		TTCTTCTGCTCCTCCGAGGGG	0.697																																					p.E339Q		.											.	MEIS3	90	0			c.G1015C						.						47.0	46.0	47.0					19																	47910667		2203	4298	6501	SO:0001583	missense	56917	exon9			TCTGCTCCTCCGA	BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.877G>C	19.37:g.47910667C>G	ENSP00000454073:p.Glu293Gln	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	20.0	NM_020160	A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	ENST00000558555.1	37		.	.	.	.	.	.	.	.	.	.	C	23.1	4.380423	0.82682	.	.	ENSG00000105419	ENST00000331559;ENST00000441740	D	0.93488	-3.23	4.09	4.09	0.47781	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	0.066555	0.56097	D	0.000023	D	0.93996	0.8077	L	0.33710	1.025	0.58432	D	0.999997	D;D;P;P;D	0.89917	1.0;0.997;0.503;0.949;0.992	D;D;B;P;P	0.72982	0.979;0.976;0.155;0.6;0.874	D	0.94630	0.7821	10	0.87932	D	0	-6.4022	14.1793	0.65564	0.0:1.0:0.0:0.0	.	185;293;276;339;168	Q8TCW1;Q99687;Q99687-3;Q99687-2;Q59FK5	.;MEIS3_HUMAN;.;.;.	Q	339;276	ENSP00000388667:E276Q	ENSP00000333552:E339Q	E	-	1	0	MEIS3	52602479	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	5.509000	0.67012	2.277000	0.76020	0.491000	0.48974	GAG	.		0.697	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000417642.1	XM_085929	
MIA3	375056	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	222805522	222805522	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:222805522A>G	ENST00000344922.5	+	5	3210	c.3185A>G	c.(3184-3186)cAt>cGt	p.H1062R	MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Missense_Mutation_p.H1062R|MIA3_ENST00000470521.1_3'UTR	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1062					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		CAACCACTGCATGAAGATAAT	0.502																																					p.H1062R		.											.	MIA3	98	0			c.A3185G						.						111.0	107.0	108.0					1																	222805522		1995	4156	6151	SO:0001583	missense	375056	exon5			CACTGCATGAAGA		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.3185A>G	1.37:g.222805522A>G	ENSP00000340900:p.His1062Arg	Somatic	205.0	1.0		WXS	Illumina HiSeq	Phase_I	433.0	99.0	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	37	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	A	2.708	-0.269375	0.05716	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831	T;T	0.04119	3.7;3.7	3.81	-2.87	0.05700	.	.	.	.	.	T	0.02193	0.0068	N	0.16478	0.41	0.09310	N	1	B;B	0.13145	0.007;0.0	B;B	0.11329	0.006;0.0	T	0.48456	-0.9034	9	0.16896	T	0.51	.	0.2488	0.00202	0.2683:0.1444:0.2213:0.366	.	1062;1062	Q5JRA6-2;Q5JRA6	.;MIA3_HUMAN	R	1062	ENSP00000340900:H1062R;ENSP00000340587:H1062R	ENSP00000325973:H1062R	H	+	2	0	MIA3	220872145	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.977000	0.03782	-0.587000	0.05890	0.455000	0.32223	CAT	.		0.502	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
RP3-368A4.5	0	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	73438407	73438407	+	RNA	SNP	T	T	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chrX:73438407T>G	ENST00000603037.1	-	0	216				MIR421_ENST00000365696.2_RNA|MIR374B_ENST00000390738.1_RNA																							taatacaacctgctaagtgct	0.453																																					.		.											.	.	.	0			.						.						63.0	51.0	55.0					X																	73438407		1568	3581	5149			100126317	.			ACAACCTGCTAAG																													X.37:g.73438407T>G		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	97.0	.		RNA	SNP	ENST00000603037.1	37																																																																																				.		0.453	RP3-368A4.5-001	KNOWN	basic	sense_intronic	sense_intronic	OTTHUMT00000468301.1		
MTRR	4552	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	7892874	7892874	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr5:7892874G>C	ENST00000264668.2	+	11	1516	c.1486G>C	c.(1486-1488)Gtc>Ctc	p.V496L	MTRR_ENST00000440940.2_Missense_Mutation_p.V469L	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	496	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	GCTCCATTTTGTCTTCAACAT	0.433																																					p.V496L		.											.	MTRR	91	0			c.G1486C						.						188.0	169.0	176.0					5																	7892874		2203	4300	6503	SO:0001583	missense	4552	exon11			CATTTTGTCTTCA	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1486G>C	5.37:g.7892874G>C	ENSP00000264668:p.Val496Leu	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	14.0	NM_024010	O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	ENST00000264668.2	37	CCDS3874.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565669	0.45694	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	T;T	0.29655	1.56;1.56	4.89	0.53	0.17102	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.364021	0.30437	N	0.009621	T	0.34019	0.0883	M	0.62266	1.93	0.38294	D	0.942791	P	0.48834	0.916	P	0.48089	0.566	T	0.17653	-1.0362	10	0.51188	T	0.08	-8.869	8.9511	0.35790	0.3913:0.0:0.6087:0.0	.	496	Q9UBK8	MTRR_HUMAN	L	496;469	ENSP00000264668:V496L;ENSP00000402510:V469L	ENSP00000264668:V496L	V	+	1	0	MTRR	7945874	0.749000	0.28305	0.008000	0.14137	0.505000	0.33919	0.981000	0.29526	-0.219000	0.10003	-0.140000	0.14226	GTC	.		0.433	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
MYO1C	4641	hgsc.bcm.edu;broad.mit.edu	37	17	1381960	1381960	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:1381960G>A	ENST00000575158.1	-	10	1233	c.1057C>T	c.(1057-1059)Cgc>Tgc	p.R353C	MYO1C_ENST00000361007.2_Missense_Mutation_p.R353C|MYO1C_ENST00000545534.2_Missense_Mutation_p.R364C|MYO1C_ENST00000573198.1_5'Flank|MYO1C_ENST00000438665.2_Missense_Mutation_p.R369C|MYO1C_ENST00000359786.5_Missense_Mutation_p.R388C			Q12965	MYO1E_HUMAN	myosin IC	362	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GTAAAAGTGCGGCTGTACACA	0.642																																					p.R388C		.											.	MYO1C	90	0			c.C1162T						.						107.0	88.0	94.0					17																	1381960		2203	4300	6503	SO:0001583	missense	4641	exon10			AAGTGCGGCTGTA	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.1057C>T	17.37:g.1381960G>A	ENSP00000459174:p.Arg353Cys	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	6.0	NM_001080779	Q14778	Missense_Mutation	SNP	ENST00000575158.1	37	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655485	0.88056	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.69	5.69	0.88448	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.95557	0.8556	M	0.89414	3.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.95881	0.8899	10	0.87932	D	0	.	18.7983	0.92005	0.0:0.0:1.0:0.0	.	364;388;369	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	C	388;369;369;353;364;353	ENSP00000352834:R388C;ENSP00000412197:R369C;ENSP00000354283:R353C;ENSP00000437685:R364C	ENSP00000352834:R388C	R	-	1	0	MYO1C	1328710	1.000000	0.71417	0.997000	0.53966	0.299000	0.27559	7.894000	0.87336	2.696000	0.92011	0.655000	0.94253	CGC	.		0.642	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
NOP56	10528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2635207	2635207	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr20:2635207C>G	ENST00000329276.5	+	4	872	c.356C>G	c.(355-357)gCt>gGt	p.A119G	MIR1292_ENST00000408135.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD86_ENST00000391196.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORD110_ENST00000408189.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	119					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						GGAGTCATAGCTGAGATCCTG	0.473																																					p.A119G		.											.	NOP56	92	0			c.C356G						.						131.0	124.0	126.0					20																	2635207		2203	4300	6503	SO:0001583	missense	10528	exon4			TCATAGCTGAGAT	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.356C>G	20.37:g.2635207C>G	ENSP00000370589:p.Ala119Gly	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	65.0	NM_006392	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	37	CCDS13030.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616358	0.46736	.	.	ENSG00000101361	ENST00000329276;ENST00000445139	T;T	0.58506	0.33;0.92	5.79	4.85	0.62838	.	0.092470	0.85682	D	0.000000	T	0.44871	0.1314	L	0.35593	1.075	0.58432	D	0.999996	B	0.10296	0.003	B	0.06405	0.002	T	0.30119	-0.9989	10	0.22109	T	0.4	-3.5696	12.384	0.55323	0.0:0.9187:0.0:0.0813	.	119	O00567	NOP56_HUMAN	G	119	ENSP00000370589:A119G;ENSP00000388497:A119G	ENSP00000370589:A119G	A	+	2	0	NOP56	2583207	0.998000	0.40836	0.867000	0.34043	0.984000	0.73092	3.837000	0.55820	1.434000	0.47414	0.555000	0.69702	GCT	.		0.473	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
NSD1	64324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	176721088	176721088	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr5:176721088C>A	ENST00000439151.2	+	23	6764	c.6719C>A	c.(6718-6720)tCa>tAa	p.S2240*	NSD1_ENST00000347982.4_Nonsense_Mutation_p.S1971*|NSD1_ENST00000354179.4_Nonsense_Mutation_p.S1971*|NSD1_ENST00000361032.4_Nonsense_Mutation_p.S2137*	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2240	Pro-rich.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GCAGAGCAATCAACAGGAATG	0.572			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.S2240X		.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	188	0			c.C6719A						.						77.0	77.0	77.0					5																	176721088		2203	4300	6503	SO:0001587	stop_gained	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AGCAATCAACAGG	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6719C>A	5.37:g.176721088C>A	ENSP00000395929:p.Ser2240*	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	34.0	NM_022455	Q96PD8|Q96RN7	Nonsense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	41	8.544165	0.98857	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	5.58	5.58	0.84498	.	0.126320	0.36409	N	0.002606	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6036	0.56511	0.0:0.834:0.166:0.0	.	.	.	.	X	1971;2240;1971;2137	.	ENSP00000343209:S1971X	S	+	2	0	NSD1	176653694	0.269000	0.24143	0.833000	0.33012	0.091000	0.18340	1.420000	0.34804	2.906000	0.99361	0.655000	0.94253	TCA	.		0.572	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
NXPH2	11249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	139428566	139428566	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:139428566C>G	ENST00000272641.3	-	2	827	c.721G>C	c.(721-723)Gat>Cat	p.D241H		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	241	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		AGTTTATAATCAACACTGTAA	0.458																																					p.D241H		.											.	NXPH2	72	0			c.G721C						.						94.0	87.0	89.0					2																	139428566		1925	4136	6061	SO:0001583	missense	11249	exon2			TATAATCAACACT	AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.721G>C	2.37:g.139428566C>G	ENSP00000272641:p.Asp241His	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	31.0	NM_007226	B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	ENST00000272641.3	37	CCDS46421.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.147449	0.77888	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.79464	0.4450	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77960	-0.2391	8	.	.	.	-20.6009	19.7866	0.96442	0.0:1.0:0.0:0.0	.	241	O95156	NXPH2_HUMAN	H	241	.	.	D	-	1	0	NXPH2	139145036	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.756000	0.94617	0.655000	0.94253	GAT	.		0.458	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331901.1		
OR2M7	391196	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248487546	248487546	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:248487546C>G	ENST00000317965.2	-	1	353	c.325G>C	c.(325-327)Ggc>Cgc	p.G109R		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATTCGGAGCCAAGCAATGAT	0.453																																					p.G109R		.											.	OR2M7	70	0			c.G325C						.						200.0	207.0	204.0					1																	248487546		2203	4300	6503	SO:0001583	missense	391196	exon1			CGGAGCCAAGCAA	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.325G>C	1.37:g.248487546C>G	ENSP00000324557:p.Gly109Arg	Somatic	197.0	1.0		WXS	Illumina HiSeq	Phase_I	414.0	188.0	NM_001004691	B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	CCDS31111.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780995	0.31502	.	.	ENSG00000177186	ENST00000317965	T	0.09817	2.94	1.54	-0.407	0.12385	GPCR, rhodopsin-like superfamily (1);	0.247554	0.20872	U	0.084160	T	0.35158	0.0922	H	0.95365	3.66	0.09310	N	1	D	0.89917	1.0	D	0.74348	0.983	T	0.12218	-1.0556	10	0.87932	D	0	.	4.1603	0.10280	0.1889:0.552:0.0:0.2591	.	109	Q8NG81	OR2M7_HUMAN	R	109	ENSP00000324557:G109R	ENSP00000324557:G109R	G	-	1	0	OR2M7	246554169	0.000000	0.05858	0.002000	0.10522	0.080000	0.17528	-2.374000	0.01072	0.002000	0.14630	0.184000	0.17185	GGC	.		0.453	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691	
OR5T1	390155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56043388	56043388	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr11:56043388A>G	ENST00000313033.2	+	1	360	c.274A>G	c.(274-276)Aaa>Gaa	p.K92E		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TGTCACTCCAAAAATGTTGGT	0.373																																					p.K92E		.											.	OR5T1	71	0			c.A274G						.						104.0	102.0	103.0					11																	56043388		2201	4296	6497	SO:0001583	missense	390155	exon1			ACTCCAAAAATGT	AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.274A>G	11.37:g.56043388A>G	ENSP00000323612:p.Lys92Glu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	40.0	NM_001004745	B2RNM9	Missense_Mutation	SNP	ENST00000313033.2	37	CCDS31525.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.503231	0.44558	.	.	ENSG00000181698	ENST00000313033	T	0.01347	4.99	3.59	3.59	0.41128	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000295	T	0.05547	0.0146	M	0.92412	3.305	0.09310	N	1	B	0.34372	0.451	B	0.40038	0.317	T	0.02526	-1.1146	10	0.87932	D	0	.	11.5033	0.50450	1.0:0.0:0.0:0.0	.	92	Q8NG75	OR5T1_HUMAN	E	92	ENSP00000323612:K92E	ENSP00000323612:K92E	K	+	1	0	OR5T1	55799964	0.023000	0.18921	0.021000	0.16686	0.084000	0.17831	2.746000	0.47467	1.648000	0.50643	0.381000	0.24937	AAA	.		0.373	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745	
PGBD5	79605	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	230468595	230468595	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:230468595T>C	ENST00000525115.1	-	5	1084	c.1061A>G	c.(1060-1062)cAg>cGg	p.Q354R	PGBD5_ENST00000321327.2_Missense_Mutation_p.Q453R|PGBD5_ENST00000391860.1_Missense_Mutation_p.Q308R|PGBD5_ENST00000530424.1_5'UTR			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	354						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CTCACCCTGCTGCACCGGGGA	0.617																																					p.Q423R		.											.	PGBD5	93	0			c.A1268G						.						146.0	123.0	131.0					1																	230468595		2203	4300	6503	SO:0001583	missense	79605	exon5			CCCTGCTGCACCG	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.1061A>G	1.37:g.230468595T>C	ENSP00000431404:p.Gln354Arg	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	293.0	22.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37		.	.	.	.	.	.	.	.	.	.	-	12.40	1.927392	0.34002	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.18338	2.22;2.22;2.22	5.62	5.62	0.85841	.	0.099709	0.64402	D	0.000002	T	0.11239	0.0274	N	0.14661	0.345	0.37928	D	0.931928	B;B	0.19331	0.012;0.035	B;B	0.17433	0.011;0.018	T	0.20605	-1.0270	10	0.15499	T	0.54	-37.8999	15.921	0.79575	0.0:0.0:0.0:1.0	.	354;44	Q8N414;B4DM72	PGBD5_HUMAN;.	R	308;453;354	ENSP00000375733:Q308R;ENSP00000322530:Q453R;ENSP00000431404:Q354R	ENSP00000322530:Q453R	Q	-	2	0	PGBD5	228535218	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	4.885000	0.63142	2.164000	0.68074	0.472000	0.43445	CAG	.		0.617	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
PLCB4	5332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9371192	9371192	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr20:9371192A>G	ENST00000378493.1	+	14	1268	c.1253A>G	c.(1252-1254)tAc>tGc	p.Y418C	PLCB4_ENST00000378473.3_Missense_Mutation_p.Y418C|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Missense_Mutation_p.Y418C|PLCB4_ENST00000414679.2_Missense_Mutation_p.Y418C|PLCB4_ENST00000278655.4_Missense_Mutation_p.Y418C|PLCB4_ENST00000334005.3_Missense_Mutation_p.Y418C			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	418	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TATCAACAGTACAAGATGTCC	0.348																																					p.Y418C		.											.	PLCB4	274	0			c.A1253G						.						68.0	67.0	67.0					20																	9371192		2203	4299	6502	SO:0001583	missense	5332	exon15			AACAGTACAAGAT		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1253A>G	20.37:g.9371192A>G	ENSP00000367754:p.Tyr418Cys	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	29.0	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.939251	0.73557	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.64	5.64	0.86602	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.561713	0.20248	N	0.096155	T	0.79167	0.4400	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.931;0.936;0.998;0.969	T	0.79848	-0.1630	10	0.51188	T	0.08	.	15.8569	0.78987	1.0:0.0:0.0:0.0	.	418;265;418;418	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	C	418;418;418;418;418;254	ENSP00000334105:Y418C;ENSP00000367734:Y418C;ENSP00000278655:Y418C;ENSP00000367754:Y418C;ENSP00000367762:Y418C;ENSP00000390616:Y254C	ENSP00000278655:Y418C	Y	+	2	0	PLCB4	9319192	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.214000	0.89760	2.136000	0.66102	0.477000	0.44152	TAC	.		0.348	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PLG	5340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	161139737	161139737	+	Silent	SNP	A	A	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr6:161139737A>G	ENST00000308192.9	+	9	1026	c.963A>G	c.(961-963)gaA>gaG	p.E321E		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	321	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATTTGGATGAAAACTACTGCC	0.448																																					p.E321E		.											.	PLG	94	0			c.A963G						.						62.0	67.0	65.0					6																	161139737		2203	4300	6503	SO:0001819	synonymous_variant	5340	exon9			GGATGAAAACTAC	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.963A>G	6.37:g.161139737A>G		Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	233.0	24.0	NM_000301	Q15146|Q5TEH4|Q6PA00	Silent	SNP	ENST00000308192.9	37	CCDS5279.1																																																																																			.		0.448	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	121653216	121653216	+	Silent	SNP	G	G	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr7:121653216G>C	ENST00000393386.2	+	12	4527	c.4116G>C	c.(4114-4116)ggG>ggC	p.G1372G	PTPRZ1_ENST00000483028.1_3'UTR|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1372					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TAGGAAATGGGCATGTTGCCA	0.418																																					p.G1372G		.											.	PTPRZ1	699	0			c.G4116C						.						185.0	181.0	182.0					7																	121653216		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon12			AAATGGGCATGTT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.4116G>C	7.37:g.121653216G>C		Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	235.0	63.0	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																			.		0.418	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
RP1L1	94137	broad.mit.edu;bcgsc.ca	37	8	10466903	10466903	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr8:10466903G>T	ENST00000382483.3	-	4	4928	c.4705C>A	c.(4705-4707)Cag>Aag	p.Q1569K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1649					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GTGCTGTCCTGGAGGCGTTGG	0.677																																					p.Q1569K		.											.	RP1L1	139	0			c.C4705A						.						13.0	16.0	15.0					8																	10466903		2068	4185	6253	SO:0001583	missense	94137	exon4			TGTCCTGGAGGCG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4705C>A	8.37:g.10466903G>T	ENSP00000371923:p.Gln1569Lys	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	5.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494684	0.26774	.	.	ENSG00000183638	ENST00000382483	T	0.24151	1.87	5.32	2.31	0.28768	.	0.563526	0.13335	U	0.395660	T	0.29716	0.0742	L	0.32530	0.975	0.20403	N	0.9999	D	0.58620	0.983	P	0.53490	0.727	T	0.10109	-1.0644	10	0.62326	D	0.03	-5.3338	10.4915	0.44754	0.0:0.2709:0.589:0.1401	.	1569	A6NKC6	.	K	1569	ENSP00000371923:Q1569K	ENSP00000371923:Q1569K	Q	-	1	0	RP1L1	10504313	1.000000	0.71417	0.518000	0.27811	0.034000	0.12701	4.265000	0.58865	0.594000	0.29761	0.491000	0.48974	CAG	.		0.677	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RXFP3	51289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	33938060	33938060	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr5:33938060G>A	ENST00000330120.3	+	1	1570	c.1215G>A	c.(1213-1215)tgG>tgA	p.W405*		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	405					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						GCCTGCTGTGGCGCATCGCGT	0.682																																					p.W405X		.											.	RXFP3	91	0			c.G1215A						.						53.0	54.0	53.0					5																	33938060		2203	4300	6503	SO:0001587	stop_gained	51289	exon1			GCTGTGGCGCATC	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.1215G>A	5.37:g.33938060G>A	ENSP00000328708:p.Trp405*	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	46.0	NM_016568	Q14DA5	Nonsense_Mutation	SNP	ENST00000330120.3	37	CCDS3900.1	.	.	.	.	.	.	.	.	.	.	G	41	8.931651	0.99008	.	.	ENSG00000182631	ENST00000330120	.	.	.	5.79	5.79	0.91817	.	0.553902	0.19673	N	0.108716	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-5.6355	20.0222	0.97508	0.0:0.0:1.0:0.0	.	.	.	.	X	405	.	ENSP00000328708:W405X	W	+	3	0	RXFP3	33973817	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.938000	0.87678	2.726000	0.93360	0.655000	0.94253	TGG	.		0.682	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
S100A4	6275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153517143	153517143	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:153517143G>T	ENST00000368716.4	-	2	275	c.128C>A	c.(127-129)cCc>cAc	p.P43H	S100A4_ENST00000368714.1_Missense_Mutation_p.P43H|S100A5_ENST00000368718.1_5'Flank|S100A4_ENST00000354332.4_Missense_Mutation_p.P43H|S100A4_ENST00000481009.1_5'UTR|S100A5_ENST00000359215.1_5'Flank|S100A4_ENST00000368715.1_Missense_Mutation_p.P43H	NM_002961.2	NP_002952.1	P26447	S10A4_HUMAN	S100 calcium binding protein A4	43	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epithelial to mesenchymal transition (GO:0001837)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)			large_intestine(2)|lung(1)|prostate(1)	4	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Trifluoperazine(DB00831)	CAAGAAGCTGGGCAGCTCCCG	0.557																																					p.P43H		.											.	S100A4	90	0			c.C128A						.						120.0	123.0	122.0					1																	153517143		2203	4300	6503	SO:0001583	missense	6275	exon2			AAGCTGGGCAGCT	BC016300	CCDS1042.1	1q12-q22	2013-01-10	2006-09-11		ENSG00000196154	ENSG00000196154		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10494	protein-coding gene	gene with protein product	"""fibroblast-specific protein-1"""	114210	"""S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"", ""S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)"""	MTS1, CAPL		3155863	Standard	NM_019554		Approved	P9KA, 18A2, PEL98, 42A, FSP1	uc001fbz.3	P26447	OTTHUMG00000013546	ENST00000368716.4:c.128C>A	1.37:g.153517143G>T	ENSP00000357705:p.Pro43His	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	53.0	NM_002961	A8K7R8|D3DV46|Q6ICP8	Missense_Mutation	SNP	ENST00000368716.4	37	CCDS1042.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727143	0.48833	.	.	ENSG00000196154	ENST00000368715;ENST00000354332;ENST00000368716;ENST00000368714;ENST00000545360	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	4.83	4.83	0.62350	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.144460	0.47852	D	0.000205	T	0.12646	0.0307	M	0.71206	2.165	0.34055	D	0.656633	B	0.27700	0.186	B	0.38500	0.275	T	0.04294	-1.0962	10	0.41790	T	0.15	.	13.4438	0.61129	0.0:0.0:1.0:0.0	.	43	P26447	S10A4_HUMAN	H	43;43;43;43;32	ENSP00000357704:P43H;ENSP00000346294:P43H;ENSP00000357705:P43H;ENSP00000357703:P43H	ENSP00000346294:P43H	P	-	2	0	S100A4	151783767	0.649000	0.27322	1.000000	0.80357	0.959000	0.62525	2.148000	0.42235	2.235000	0.73313	0.561000	0.74099	CCC	.		0.557	S100A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037714.1	NM_002961	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237823313	237823313	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:237823313T>C	ENST00000366574.2	+	55	8554	c.8237T>C	c.(8236-8238)aTa>aCa	p.I2746T	RYR2_ENST00000360064.6_Missense_Mutation_p.I2744T|RYR2_ENST00000542537.1_Missense_Mutation_p.I2730T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2746	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TATGGAGAAATATATTCAGAC	0.289																																					p.I2746T		.											.	RYR2	158	0			c.T8237C						.						66.0	62.0	63.0					1																	237823313		1801	4062	5863	SO:0001583	missense	6262	exon55			GAGAAATATATTC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8237T>C	1.37:g.237823313T>C	ENSP00000355533:p.Ile2746Thr	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	19.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	5.473	0.272335	0.10349	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91068	-2.78;-2.78;-2.78	5.63	4.51	0.55191	Ryanodine receptor Ryr (1);	0.367379	0.25558	N	0.029847	T	0.75510	0.3859	N	0.05230	-0.09	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.65245	-0.6215	10	0.07644	T	0.81	.	7.7902	0.29116	0.0:0.2054:0.0:0.7946	.	2746	Q92736	RYR2_HUMAN	T	2746;2744;2730	ENSP00000355533:I2746T;ENSP00000353174:I2744T;ENSP00000443798:I2730T	ENSP00000353174:I2744T	I	+	2	0	RYR2	235889936	0.032000	0.19561	1.000000	0.80357	0.990000	0.78478	0.779000	0.26746	0.966000	0.38159	0.383000	0.25322	ATA	.		0.289	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SDC2	6383	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	97621749	97621749	+	Silent	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr8:97621749G>A	ENST00000302190.4	+	5	1500	c.579G>A	c.(577-579)aaG>aaA	p.K193K	SDC2_ENST00000519914.1_Silent_p.K164K|SDC2_ENST00000518385.1_Silent_p.K157K|SDC2_ENST00000522911.1_Silent_p.K164K	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	193					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	CTTATCAGAAGGCACCTACTA	0.378																																					p.K193K		.											.	SDC2	516	0			c.G579A						.						105.0	93.0	97.0					8																	97621749		2203	4300	6503	SO:0001819	synonymous_variant	6383	exon5			TCAGAAGGCACCT	BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.579G>A	8.37:g.97621749G>A		Somatic	80.0	2.0		WXS	Illumina HiSeq	Phase_I	148.0	41.0	NM_002998	B3KQA3|Q6PIS6|Q9H6V1	Silent	SNP	ENST00000302190.4	37	CCDS6272.1																																																																																			.		0.378	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379750.1	NM_002998	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	3658865	3658865	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr7:3658865A>T	ENST00000404826.2	+	2	591	c.452A>T	c.(451-453)gAa>gTa	p.E151V	SDK1_ENST00000389531.3_Missense_Mutation_p.E151V	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	151	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TACAGCAGCGAATATAAGTAA	0.448																																					p.E151V		.											.	SDK1	138	0			c.A452T						.						86.0	73.0	77.0					7																	3658865		2203	4300	6503	SO:0001583	missense	221935	exon2			GCAGCGAATATAA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.452A>T	7.37:g.3658865A>T	ENSP00000385899:p.Glu151Val	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	47.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.083102	0.76642	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.12984	2.63;2.63	5.74	5.74	0.90152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.123080	0.36134	N	0.002764	T	0.33527	0.0866	M	0.73598	2.24	0.58432	D	0.999993	P	0.51537	0.946	P	0.56916	0.809	T	0.03068	-1.1076	10	0.48119	T	0.1	.	16.0546	0.80788	1.0:0.0:0.0:0.0	.	151	Q7Z5N4	SDK1_HUMAN	V	151	ENSP00000385899:E151V;ENSP00000374182:E151V	ENSP00000374182:E151V	E	+	2	0	SDK1	3625391	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.723000	0.91458	2.191000	0.70037	0.528000	0.53228	GAA	.		0.448	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SH3RF1	57630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	170077556	170077556	+	Splice_Site	SNP	T	T	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr4:170077556T>G	ENST00000284637.9	-	3	1009	c.668A>C	c.(667-669)aAg>aCg	p.K223T	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	223	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		TACCTTTACCTTTGCAAATGG	0.398																																					p.K223T		.											.	SH3RF1	567	0			c.A668C						.						135.0	135.0	135.0					4																	170077556		2203	4300	6503	SO:0001630	splice_region_variant	57630	exon3			TTTACCTTTGCAA	BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.669+1A>C	4.37:g.170077556T>G		Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	253.0	92.0	NM_020870	Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	ENST00000284637.9	37	CCDS34099.1	.	.	.	.	.	.	.	.	.	.	T	16.50	3.139902	0.56936	.	.	ENSG00000154447	ENST00000284637	T	0.35973	1.28	5.76	5.76	0.90799	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.62502	0.2433	M	0.79123	2.44	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.66866	-0.5815	10	0.87932	D	0	-28.0384	16.3634	0.83296	0.0:0.0:0.0:1.0	.	223	Q7Z6J0	SH3R1_HUMAN	T	223	ENSP00000284637:K223T	ENSP00000284637:K223T	K	-	2	0	SH3RF1	170314131	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	7.655000	0.83696	2.324000	0.78689	0.533000	0.62120	AAG	.		0.398	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363382.3	NM_020870	Missense_Mutation
SLC26A4	5172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107342429	107342429	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr7:107342429C>T	ENST00000265715.3	+	17	2185	c.1961C>T	c.(1960-1962)cCa>cTa	p.P654L	SLC26A4_ENST00000544569.1_Missense_Mutation_p.P241L|SLC26A4_ENST00000541474.1_Missense_Mutation_p.P215L|SLC26A4_ENST00000543100.1_Missense_Mutation_p.P223L	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	654	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CCCAAAGTGCCAATCCATAGC	0.443									Pendred syndrome																												p.P654L		.											.	SLC26A4	96	0			c.C1961T						.						128.0	107.0	114.0					7																	107342429		2203	4300	6503	SO:0001583	missense	5172	exon17	Familial Cancer Database	Goiter-Deafness syndrome	AAGTGCCAATCCA	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1961C>T	7.37:g.107342429C>T	ENSP00000265715:p.Pro654Leu	Somatic	212.0	0.0		WXS	Illumina HiSeq	Phase_I	263.0	83.0	NM_000441	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742652	0.69418	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	5.74	5.74	0.90152	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.133058	0.51477	D	0.000086	D	0.92299	0.7557	L	0.53249	1.67	0.54753	D	0.999989	P;P;B	0.46578	0.855;0.88;0.257	B;B;B	0.42462	0.251;0.388;0.216	D	0.91098	0.4912	10	0.33141	T	0.24	.	19.9351	0.97137	0.0:1.0:0.0:0.0	.	215;241;654	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	L	654;215;241;223	ENSP00000265715:P654L;ENSP00000439743:P215L;ENSP00000437427:P241L;ENSP00000441209:P223L	ENSP00000265715:P654L	P	+	2	0	SLC26A4	107129665	0.981000	0.34729	0.989000	0.46669	0.913000	0.54294	2.840000	0.48215	2.703000	0.92315	0.655000	0.94253	CCA	.		0.443	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
SLC27A3	11000	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	153750269	153750269	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:153750269G>C	ENST00000368661.3	+	4	1275	c.1210G>C	c.(1210-1212)Gct>Cct	p.A404P	SLC27A3_ENST00000271857.2_Missense_Mutation_p.A485P|SLC27A3_ENST00000484014.1_3'UTR	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	404					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAAGTTCTCGGCTGGTCAGTT	0.602																																					p.A404P		.											.	SLC27A3	91	0			c.G1210C						.						75.0	69.0	71.0					1																	153750269		2203	4300	6503	SO:0001583	missense	11000	exon4			TTCTCGGCTGGTC	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.1210G>C	1.37:g.153750269G>C	ENSP00000357650:p.Ala404Pro	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	12.0	NM_024330	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881771	0.91740	.	.	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.08984	3.03;3.03	4.69	4.69	0.59074	AMP-dependent synthetase/ligase (1);	0.000000	0.64402	D	0.000001	T	0.27098	0.0664	M	0.88906	2.99	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	T	0.10474	-1.0628	10	0.87932	D	0	-10.2795	15.1428	0.72623	0.0:0.0:1.0:0.0	.	404	Q5K4L6	S27A3_HUMAN	P	485;404	ENSP00000271857:A485P;ENSP00000357650:A404P	ENSP00000271857:A485P	A	+	1	0	SLC27A3	152016893	1.000000	0.71417	0.814000	0.32528	0.951000	0.60555	7.517000	0.81783	2.437000	0.82529	0.491000	0.48974	GCT	.		0.602	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
SLC39A9	55334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	69925257	69925257	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr14:69925257C>G	ENST00000336643.5	+	7	1549	c.871C>G	c.(871-873)Ctg>Gtg	p.L291V	SLC39A9_ENST00000555245.1_3'UTR|SLC39A9_ENST00000031146.4_Missense_Mutation_p.L225V|SLC39A9_ENST00000556605.1_Intron|SLC39A9_ENST00000557046.1_Missense_Mutation_p.L268V	NM_018375.4	NP_060845.2	Q9NUM3	S39A9_HUMAN	solute carrier family 39, member 9	291					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|skin(1)|stomach(1)	14				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		AGTGGCAGCCCTGGTTCTGGG	0.602																																					p.L291V		.											.	SLC39A9	90	0			c.C871G						.						57.0	49.0	51.0					14																	69925257		2203	4300	6503	SO:0001583	missense	55334	exon7			GCAGCCCTGGTTC		CCDS9795.1, CCDS58327.1, CCDS58328.1	14q24.1	2013-07-17	2013-07-17			ENSG00000029364		"""Solute carriers"""	20182	protein-coding gene	gene with protein product							Standard	NM_018375		Approved	FLJ11274	uc001xle.3	Q9NUM3		ENST00000336643.5:c.871C>G	14.37:g.69925257C>G	ENSP00000336887:p.Leu291Val	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	48.0	NM_018375	G3V5J8|Q53HN3|Q5MJQ0|Q6P2Q1|Q86WY2	Missense_Mutation	SNP	ENST00000336643.5	37	CCDS9795.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670638	0.67814	.	.	ENSG00000029364	ENST00000336643;ENST00000557046	T;T	0.47528	0.84;0.84	5.71	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.53465	0.1798	L	0.56199	1.76	0.58432	D	0.999999	P;D	0.58970	0.882;0.984	P;P	0.56612	0.495;0.802	T	0.50841	-0.8780	10	0.32370	T	0.25	-5.2008	8.9558	0.35816	0.0:0.7796:0.0:0.2204	.	268;291	Q9NUM3-2;Q9NUM3	.;S39A9_HUMAN	V	291;268	ENSP00000336887:L291V;ENSP00000451833:L268V	ENSP00000031146:L291V	L	+	1	2	SLC39A9	68995010	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.753000	0.47524	1.413000	0.46997	0.655000	0.94253	CTG	.		0.602	SLC39A9-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412446.1	NM_018375	
SLITRK2	84631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	144905414	144905414	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chrX:144905414T>A	ENST00000370490.1	+	1	5726	c.1471T>A	c.(1471-1473)Ttt>Att	p.F491I	SLITRK2_ENST00000413937.2_Missense_Mutation_p.F491I|SLITRK2_ENST00000428560.2_Missense_Mutation_p.F491I|SLITRK2_ENST00000434188.2_Missense_Mutation_p.F491I|SLITRK2_ENST00000447897.2_Missense_Mutation_p.F491I			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	491					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TGATAATATATTTGGGGGGAC	0.453																																					p.F491I		.											.	SLITRK2	136	0			c.T1471A						.						113.0	120.0	118.0					X																	144905414		2203	4300	6503	SO:0001583	missense	84631	exon5			AATATATTTGGGG	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1471T>A	X.37:g.144905414T>A	ENSP00000359521:p.Phe491Ile	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	38.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189642	0.78789	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.81432	0.4821	M	0.93939	3.475	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.86052	0.1526	10	0.87932	D	0	-8.0912	12.9065	0.58156	0.0:0.0:0.0:1.0	.	491	Q9H156	SLIK2_HUMAN	I	491	ENSP00000334374:F491I;ENSP00000411681:F491I;ENSP00000359521:F491I;ENSP00000397015:F491I;ENSP00000407347:F491I;ENSP00000412010:F491I	ENSP00000334374:F491I	F	+	1	0	SLITRK2	144713106	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	8.040000	0.89188	1.955000	0.56771	0.486000	0.48141	TTT	.		0.453	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
SPTBN5	51332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42159172	42159172	+	Silent	SNP	G	G	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr15:42159172G>A	ENST00000320955.6	-	36	6692	c.6465C>T	c.(6463-6465)acC>acT	p.T2155T	MIR4310_ENST00000582950.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2155					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TTGCGGCCTGGGTGAAGCTGG	0.657																																					p.T2120T		.											.	SPTBN5	91	0			c.C6360T						.						9.0	13.0	12.0					15																	42159172		2082	4184	6266	SO:0001819	synonymous_variant	51332	exon36			GGCCTGGGTGAAG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.6465C>T	15.37:g.42159172G>A		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	43.0	NM_016642		Silent	SNP	ENST00000320955.6	37																																																																																				.		0.657	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
TJP2	9414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	71840272	71840272	+	Silent	SNP	G	G	T	rs140444730		TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr9:71840272G>T	ENST00000377245.4	+	6	1213	c.1005G>T	c.(1003-1005)acG>acT	p.T335T	TJP2_ENST00000453658.2_Silent_p.T312T|TJP2_ENST00000535702.1_Silent_p.T339T|TJP2_ENST00000265384.7_Silent_p.T335T|TJP2_ENST00000539225.1_Silent_p.T366T|TJP2_ENST00000348208.4_Silent_p.T335T	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	335	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						TGACCCGAACGGGTCTGGCAA	0.463																																					p.T366T		.											.	TJP2	115	0			c.G1098T						.						92.0	76.0	81.0					9																	71840272		2203	4300	6503	SO:0001819	synonymous_variant	9414	exon6			CCGAACGGGTCTG	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.1005G>T	9.37:g.71840272G>T		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	47.0	NM_001170416	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Silent	SNP	ENST00000377245.4	37	CCDS6627.1																																																																																			G|0.999;A|0.000		0.463	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052572.2	NM_201629	
TONSL	4796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145668658	145668658	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr8:145668658G>T	ENST00000409379.3	-	4	340	c.311C>A	c.(310-312)aCg>aAg	p.T104K		NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	104					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)	p.T104M(3)		biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CTGCAGCTCCGTGTGGTTGCG	0.622																																					p.T104K		.											.	TONSL	92	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.C311A						.						90.0	95.0	93.0					8																	145668658		692	1591	2283	SO:0001583	missense	4796	exon4			AGCTCCGTGTGGT		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.311C>A	8.37:g.145668658G>T	ENSP00000386239:p.Thr104Lys	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	61.0	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647335	0.47258	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.75704	-0.96	4.81	1.5	0.22942	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.54415	0.1857	N	0.22421	0.69	0.09310	N	1	P	0.43578	0.811	B	0.39904	0.313	T	0.41378	-0.9512	9	0.12103	T	0.63	.	7.0352	0.24989	0.3913:0.0:0.6087:0.0	.	104	Q96HA7	TONSL_HUMAN	K	104	ENSP00000386239:T104K	ENSP00000386239:T104K	T	-	2	0	TONSL	145639466	0.072000	0.21174	0.066000	0.19879	0.801000	0.45260	0.576000	0.23744	0.310000	0.22990	0.462000	0.41574	ACG	.		0.622	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
TRIM15	89870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30138285	30138285	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr6:30138285A>C	ENST00000376694.4	+	5	1208	c.739A>C	c.(739-741)Atg>Ctg	p.M247L	TRIM15_ENST00000376688.1_Intron	NM_033229.2	NP_150232.2	Q9C019	TRI15_HUMAN	tripartite motif containing 15	247					innate immune response (GO:0045087)|mesodermal cell fate determination (GO:0007500)|negative regulation of intracellular transport of viral material (GO:1901253)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	14						CAGGTGTGAGATGAAGACTTT	0.443																																					p.M247L		.											.	TRIM15	90	0			c.A739C						.						99.0	95.0	97.0					6																	30138285		2203	4300	6503	SO:0001583	missense	89870	exon5			TGTGAGATGAAGA	AF220132, U34249	CCDS4677.1	6p21.33	2013-01-09	2011-01-25		ENSG00000204610	ENSG00000204610		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16284	protein-coding gene	gene with protein product			"""zinc finger protein 178"", ""tripartite motif-containing 15"""	ZNF178		11331580, 8304341, 8812418	Standard	NM_033229		Approved	ZNFB7, RNF93	uc010jrx.3	Q9C019	OTTHUMG00000031031	ENST00000376694.4:c.739A>C	6.37:g.30138285A>C	ENSP00000365884:p.Met247Leu	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	29.0	NM_033229	A2BEC9|O95604|Q8IUX9|Q9C018	Missense_Mutation	SNP	ENST00000376694.4	37	CCDS4677.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.805|9.805	1.181615|1.181615	0.21787|0.21787	.|.	.|.	ENSG00000204610|ENSG00000204610	ENST00000376695;ENST00000376694|ENST00000433744	T|.	0.51817|.	0.69|.	5.42|5.42	-0.0487|-0.0487	0.13837|0.13837	.|.	0.909841|.	0.09382|.	N|.	0.809779|.	T|T	0.05914|0.05914	0.0154|0.0154	N|N	0.12471|0.12471	0.22|0.22	0.09310|0.09310	N|N	0.999998|0.999998	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.39603|0.39603	-0.9606|-0.9606	10|5	0.28530|.	T|.	0.3|.	.|.	4.7476|4.7476	0.13045|0.13045	0.5314:0.3214:0.1472:0.0|0.5314:0.3214:0.1472:0.0	.|.	247|.	Q9C019|.	TRI15_HUMAN|.	L|S	178;247|83	ENSP00000365884:M247L|.	ENSP00000365884:M247L|.	M|R	+|+	1|3	0|2	TRIM15|TRIM15	30246264|30246264	0.035000|0.035000	0.19736|0.19736	0.151000|0.151000	0.22473|0.22473	0.823000|0.823000	0.46562|0.46562	0.389000|0.389000	0.20751|0.20751	0.045000|0.045000	0.15804|0.15804	0.472000|0.472000	0.43445|0.43445	ATG|AGA	.		0.443	TRIM15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076026.2	NM_033229	
TRPV1	7442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	3481004	3481004	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:3481004A>C	ENST00000571088.1	-	11	1814	c.1601T>G	c.(1600-1602)cTc>cGc	p.L534R	RP11-235E17.3_ENST00000573568.1_RNA|TRPV1_ENST00000425167.2_Missense_Mutation_p.L545R|TRPV1_ENST00000576351.1_Missense_Mutation_p.L524R|TRPV1_ENST00000399759.3_Missense_Mutation_p.L534R|TRPV1_ENST00000399756.4_Missense_Mutation_p.L534R|SHPK_ENST00000572705.1_Missense_Mutation_p.L534R|TRPV1_ENST00000174621.6_Missense_Mutation_p.L532R|TRPV1_ENST00000310522.5_Missense_Mutation_p.L474R	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	534					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	ATACTCCTTGAGGTGGCTGAA	0.587																																					p.L534R	Melanoma(38;962 1762 15789)	.											.	TRPV1	23	0			c.T1601G						.						40.0	46.0	44.0					17																	3481004		2090	4219	6309	SO:0001583	missense	7442	exon11			TCCTTGAGGTGGC	AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.1601T>G	17.37:g.3481004A>C	ENSP00000461007:p.Leu534Arg	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	89.0	NM_018727	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Missense_Mutation	SNP	ENST00000571088.1	37	CCDS45576.1	.	.	.	.	.	.	.	.	.	.	a	5.986	0.365878	0.11352	.	.	ENSG00000196689	ENST00000399759;ENST00000399756;ENST00000174621;ENST00000425167;ENST00000310522	D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17	5.23	-1.9	0.07665	Ion transport (1);	0.937438	0.09148	N	0.841989	T	0.60011	0.2236	N	0.01048	-1.04	0.19300	N	0.999976	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.52779	-0.8530	10	0.19590	T	0.45	-3.7513	4.0786	0.09916	0.3732:0.3516:0.0:0.2751	.	534;532;474;545	Q8NER1;E7EQ80;E7ESJ2;E7EQ78	TRPV1_HUMAN;.;.;.	R	534;534;532;545;474	ENSP00000382661:L534R;ENSP00000382659:L534R;ENSP00000174621:L532R;ENSP00000409627:L545R;ENSP00000311692:L474R	ENSP00000174621:L532R	L	-	2	0	TRPV1	3427753	0.000000	0.05858	0.122000	0.21767	0.720000	0.41350	-0.568000	0.05909	-0.206000	0.10203	-0.292000	0.09595	CTC	.		0.587	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438254.1	NM_018727	
TTN	7273	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179448634	179448634	+	Splice_Site	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:179448634C>A	ENST00000591111.1	-	262	60577		c.e262-1		TTN_ENST00000589042.1_Splice_Site|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Splice_Site|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Splice_Site|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Splice_Site|TTN_ENST00000460472.2_Splice_Site|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGGAGGATCTAAAACAAAA	0.403																																					.		.											.	.	.	0			.						.						34.0	32.0	32.0					2																	179448634		1868	4107	5975	SO:0001630	splice_region_variant	100506866	.			GAGGATCTAAAAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.60353-1G>T	2.37:g.179448634C>A		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	41.0	.	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	27.7	4.858967	0.91433	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179156880	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.818000	0.86416	2.832000	0.97577	0.655000	0.94253	.	.		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	Intron
TXK	7294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	48073678	48073678	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr4:48073678C>A	ENST00000264316.4	-	14	1456	c.1371G>T	c.(1369-1371)tgG>tgT	p.W457C	TXK_ENST00000507351.1_Missense_Mutation_p.W112C	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	457	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						TAAAAACTTCCCACATTAAAA	0.383																																					p.W457C		.											.	TXK	521	0			c.G1371T						.						73.0	80.0	77.0					4																	48073678		2203	4300	6503	SO:0001583	missense	7294	exon14			AACTTCCCACATT	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.1371G>T	4.37:g.48073678C>A	ENSP00000264316:p.Trp457Cys	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	13.0	NM_003328	Q14220	Missense_Mutation	SNP	ENST00000264316.4	37	CCDS3480.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854082	0.91355	.	.	ENSG00000074966	ENST00000264316;ENST00000507351	D;D	0.85955	-2.05;-2.05	5.45	5.45	0.79879	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.95017	0.8387	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95108	0.8236	10	0.45353	T	0.12	.	18.4504	0.90702	0.0:1.0:0.0:0.0	.	144;457	B4DTB5;P42681	.;TXK_HUMAN	C	457;112	ENSP00000264316:W457C;ENSP00000423481:W112C	ENSP00000264316:W457C	W	-	3	0	TXK	47768435	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.651000	0.83577	2.836000	0.97738	0.655000	0.94253	TGG	.		0.383	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219869.7	NM_003328	
U2SURP	23350	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	142747437	142747437	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr3:142747437delA	ENST00000473835.2	+	16	1649	c.1559delA	c.(1558-1560)gaafs	p.E520fs	U2SURP_ENST00000493598.2_Frame_Shift_Del_p.E519fs|U2SURP_ENST00000397933.2_Frame_Shift_Del_p.E111fs	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing	520					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						GAAGAGCAAGAAACAGAAGCT	0.363																																					p.E520fs		.											.	U2SURP	71	0			c.1559delA						.						112.0	107.0	109.0					3																	142747437		1827	4082	5909	SO:0001589	frameshift_variant	23350	exon16			AGCAAGAAACAGA	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323	ENST00000473835.2:c.1559delA	3.37:g.142747437delA	ENSP00000418563:p.Glu520fs	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	84.0	NM_001080415	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	Frame_Shift_Del	DEL	ENST00000473835.2	37	CCDS46928.1																																																																																			.		0.363	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354603.2	NM_001080415	
UMODL1	89766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43547324	43547324	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr21:43547324C>A	ENST00000408910.2	+	19	3502	c.3502C>A	c.(3502-3504)Ccc>Acc	p.P1168T	UMODL1_ENST00000408989.2_Missense_Mutation_p.P1296T|UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000400427.1_Missense_Mutation_p.P1224T|UMODL1_ENST00000400424.2_Missense_Mutation_p.P1096T	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1168	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						CGCCCGGGACCCCATCACCTT	0.562																																					p.P1296T	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	.											.	UMODL1	93	0			c.C3886A						.						54.0	55.0	55.0					21																	43547324		1947	4142	6089	SO:0001583	missense	89766	exon18			CGGGACCCCATCA		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3502C>A	21.37:g.43547324C>A	ENSP00000386147:p.Pro1168Thr	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	41.0	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508534	0.44660	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000434156	T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47	3.43	3.43	0.39272	Zona pellucida sperm-binding protein (3);	0.158174	0.28958	N	0.013597	D	0.86422	0.5929	L	0.60012	1.86	0.44976	D	0.997999	P;D	0.89917	0.846;1.0	P;D	0.77557	0.624;0.99	D	0.86107	0.1560	9	.	.	.	-34.6306	14.312	0.66422	0.0:1.0:0.0:0.0	.	1296;1168	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	T	1224;1096;1296;1168;53	ENSP00000383279:P1224T;ENSP00000383276:P1096T;ENSP00000386126:P1296T;ENSP00000386147:P1168T	.	P	+	1	0	UMODL1	42420393	0.989000	0.36119	0.995000	0.50966	0.336000	0.28762	2.012000	0.40932	2.219000	0.72066	0.462000	0.41574	CCC	.		0.562	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215960064	215960064	+	Silent	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:215960064T>C	ENST00000307340.3	-	52	10721	c.10335A>G	c.(10333-10335)tcA>tcG	p.S3445S	USH2A_ENST00000366943.2_Silent_p.S3445S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3445	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTTCGGCAGATGAACACATTT	0.448										HNSCC(13;0.011)																											p.S3445S		.											.	USH2A	115	0			c.A10335G						.						195.0	161.0	173.0					1																	215960064		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon52			GGCAGATGAACAC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10335A>G	1.37:g.215960064T>C		Somatic	235.0	0.0		WXS	Illumina HiSeq	Phase_I	505.0	145.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.448	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
WDPCP	51057	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	63631475	63631475	+	Silent	SNP	T	T	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr2:63631475T>C	ENST00000272321.7	-	10	1670	c.1143A>G	c.(1141-1143)tcA>tcG	p.S381S	WDPCP_ENST00000409835.1_5'UTR|WDPCP_ENST00000409562.3_Silent_p.S381S|WDPCP_ENST00000409199.1_Silent_p.S189S|WDPCP_ENST00000398544.3_Silent_p.S222S|WDPCP_ENST00000409120.1_Silent_p.S189S	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	381					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						AGCTTATTAATGAAGGCAAAA	0.433																																					p.S381S		.											.	WDPCP	91	0			c.A1143G						.						84.0	80.0	81.0					2																	63631475		1879	4109	5988	SO:0001819	synonymous_variant	51057	exon10			TATTAATGAAGGC		CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1143A>G	2.37:g.63631475T>C		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	7.0	NM_015910	Q53RW4|Q7Z2Z3	Silent	SNP	ENST00000272321.7	37	CCDS42688.1																																																																																			.		0.433	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326820.1	NM_015910	
WDR86	349136	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151093228	151093228	+	Silent	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr7:151093228C>G	ENST00000334493.6	-	3	790	c.360G>C	c.(358-360)cgG>cgC	p.R120R	WDR86_ENST00000463000.1_5'Flank|WDR86_ENST00000469830.2_Silent_p.R120R|WDR86_ENST00000477459.1_5'UTR	NM_001284262.1|NM_198285.2	NP_001271191.1|NP_938026.2	Q86TI4	WDR86_HUMAN	WD repeat domain 86	120										breast(1)|endometrium(2)|kidney(1)|lung(6)	10			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CACTCCAGACCCGAGCTGTCC	0.642																																					p.R120R		.											.	.	.	0			c.G360C						.						32.0	36.0	35.0					7																	151093228		2159	4270	6429	SO:0001819	synonymous_variant	349136	exon3			CCAGACCCGAGCT	AK125347	CCDS5925.2, CCDS64805.1, CCDS64806.1, CCDS75680.1	7q36.1	2013-01-09			ENSG00000187260	ENSG00000187260		"""WD repeat domain containing"""	28020	protein-coding gene	gene with protein product						12477932	Standard	NM_198285		Approved		uc003wkb.2	Q86TI4	OTTHUMG00000150764	ENST00000334493.6:c.360G>C	7.37:g.151093228C>G		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	24.0	NM_198285	B4DJF1|C9JAJ5|C9JXE3|Q3KNT1|Q6ZUS8	Silent	SNP	ENST00000334493.6	37	CCDS5925.2																																																																																			.		0.642	WDR86-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319999.3	NM_198285	
ZACN	353174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74076379	74076379	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:74076379G>C	ENST00000334586.5	+	5	501	c.418G>C	c.(418-420)Gac>Cac	p.D140H	EXOC7_ENST00000591724.1_5'Flank|ZACN_ENST00000392503.2_Intron	NM_180990.3	NP_851321.2	Q401N2	ZACN_HUMAN	zinc activated ligand-gated ion channel	140					ion transmembrane transport (GO:0034220)|response to zinc ion (GO:0010043)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)|ligand-gated ion channel activity (GO:0015276)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	11						GGCTCGAGTAGACCAGGACGG	0.667																																					p.D140H		.											.	ZACN	90	0			c.G418C						.						71.0	66.0	68.0					17																	74076379		2203	4300	6503	SO:0001583	missense	353174	exon5			CGAGTAGACCAGG	AK122638	CCDS11740.2	17q25.3	2012-01-18	2008-04-17	2008-04-17	ENSG00000186919	ENSG00000186919		"""Ligand-gated ion channels / Zinc activated channels"""	29504	protein-coding gene	gene with protein product		610935	"""ligand-gated ion channel, zinc activated 1"""	LGICZ1		12381728, 16083862	Standard	NM_180990		Approved	LGICZ, L2, ZAC, ZAC1	uc002jqn.2	Q401N2	OTTHUMG00000157186	ENST00000334586.5:c.418G>C	17.37:g.74076379G>C	ENSP00000334854:p.Asp140His	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	245.0	75.0	NM_180990	Q2TB29|Q6ZWK3|Q86YW4	Missense_Mutation	SNP	ENST00000334586.5	37	CCDS11740.2	.	.	.	.	.	.	.	.	.	.	G	6.198	0.404672	0.11754	.	.	ENSG00000186919	ENST00000334586	T	0.78481	-1.18	3.85	-0.834	0.10779	Neurotransmitter-gated ion-channel ligand-binding (3);	0.763550	0.12013	N	0.507714	T	0.62307	0.2417	L	0.46157	1.445	0.09310	N	0.999998	B	0.12013	0.005	B	0.12837	0.008	T	0.42120	-0.9470	10	0.11182	T	0.66	-10.5351	3.9401	0.09323	0.3459:0.3556:0.2985:0.0	.	140	Q401N2	ZACN_HUMAN	H	140	ENSP00000334854:D140H	ENSP00000334854:D140H	D	+	1	0	ZACN	71587974	0.796000	0.28864	0.001000	0.08648	0.020000	0.10135	0.902000	0.28459	0.020000	0.15106	-0.886000	0.02939	GAC	.		0.667	ZACN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347827.2	NM_180990	
ZBTB40	9923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22848029	22848029	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr1:22848029C>A	ENST00000375647.4	+	15	3296	c.3089C>A	c.(3088-3090)cCt>cAt	p.P1030H	ZBTB40_ENST00000374651.4_Missense_Mutation_p.P918H|ZBTB40_ENST00000404138.1_Missense_Mutation_p.P1030H|ZBTB40-IT1_ENST00000438551.1_RNA	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1030					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		ACCCACCACCCTGACGTATTT	0.493																																					p.P1030H		.											.	ZBTB40	91	0			c.C3089A						.						149.0	122.0	131.0					1																	22848029		2203	4300	6503	SO:0001583	missense	9923	exon16			ACCACCCTGACGT	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.3089C>A	1.37:g.22848029C>A	ENSP00000364798:p.Pro1030His	Somatic	453.0	1.0		WXS	Illumina HiSeq	Phase_I	713.0	223.0	NM_001083621	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144244	0.77888	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000374651	T;T;T	0.10192	2.9;2.9;2.9	5.69	5.69	0.88448	.	0.000000	0.56097	D	0.000038	T	0.22859	0.0552	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.01516	-1.1335	10	0.72032	D	0.01	-12.3833	18.4221	0.90594	0.0:1.0:0.0:0.0	.	918;1030	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	H	1030;1030;918	ENSP00000384527:P1030H;ENSP00000364798:P1030H;ENSP00000363782:P918H	ENSP00000363782:P918H	P	+	2	0	ZBTB40	22720616	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.328000	0.79160	2.705000	0.92388	0.485000	0.47835	CCT	.		0.493	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
ZMIZ2	83637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44797559	44797559	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr7:44797559C>G	ENST00000309315.4	+	6	788	c.665C>G	c.(664-666)tCt>tGt	p.S222C	ZMIZ2_ENST00000441627.1_Missense_Mutation_p.S222C|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.S222C|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.S190C|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.S190C	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	222	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						ATGGGCCCCTCTGGCCTCTCC	0.622																																					p.S222C	NSCLC(20;604 852 1948 16908 50522)	.											.	ZMIZ2	137	0			c.C665G						.						55.0	60.0	59.0					7																	44797559		1877	4096	5973	SO:0001583	missense	83637	exon5			GCCCCTCTGGCCT	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.665C>G	7.37:g.44797559C>G	ENSP00000311778:p.Ser222Cys	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	41.0	NM_174929	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	ENST00000309315.4	37	CCDS43576.1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697355	0.48202	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43	4.79	4.79	0.61399	.	0.539829	0.16950	N	0.192948	T	0.47525	0.1450	M	0.61703	1.905	0.23070	N	0.998344	D;D;D	0.67145	0.993;0.996;0.993	P;P;P	0.59288	0.855;0.827;0.855	T	0.36962	-0.9726	10	0.72032	D	0.01	-9.0171	12.7174	0.57123	0.1646:0.8354:0.0:0.0	.	222;222;190	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	C	190;222;222;190;222;222	ENSP00000409648:S190C;ENSP00000311778:S222C;ENSP00000414723:S222C;ENSP00000396601:S190C;ENSP00000265346:S222C	ENSP00000265346:S222C	S	+	2	0	ZMIZ2	44764084	0.015000	0.18098	0.229000	0.23960	0.190000	0.23558	2.379000	0.44318	2.479000	0.83701	0.561000	0.74099	TCT	.		0.622	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	
ZNF287	57336	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	16470785	16470785	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr17:16470785T>G	ENST00000395824.1	-	2	878	c.261A>C	c.(259-261)caA>caC	p.Q87H	ZNF287_ENST00000461555.1_5'Flank|ZNF287_ENST00000395825.3_Missense_Mutation_p.Q87H			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	80	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		GCTCCAAAATTTGTTCCTTTG	0.517																																					p.Q87H		.											.	ZNF287	90	0			c.A261C						.						89.0	90.0	90.0					17																	16470785		2203	4300	6503	SO:0001583	missense	57336	exon2			CAAAATTTGTTCC	AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.261A>C	17.37:g.16470785T>G	ENSP00000379168:p.Gln87His	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	10.0	NM_020653	Q6IAG1	Missense_Mutation	SNP	ENST00000395824.1	37	CCDS11179.2	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459326	0.63401	.	.	ENSG00000141040	ENST00000395825;ENST00000395824	T;T	0.09255	3.0;3.0	5.18	0.525	0.17072	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.47093	D	0.000259	T	0.35422	0.0931	M	0.92970	3.365	0.28622	N	0.90814	D	0.69078	0.997	D	0.85130	0.997	T	0.17745	-1.0359	10	0.72032	D	0.01	.	7.8292	0.29332	0.0:0.5839:0.0:0.4161	.	80	Q9HBT7	ZN287_HUMAN	H	87	ENSP00000379169:Q87H;ENSP00000379168:Q87H	ENSP00000379168:Q87H	Q	-	3	2	ZNF287	16411510	0.997000	0.39634	0.998000	0.56505	0.980000	0.70556	0.119000	0.15626	-0.017000	0.14103	-0.250000	0.11733	CAA	.		0.517	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130504.1		
ZSWIM3	140831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44506970	44506970	+	Silent	SNP	C	C	G			TCGA-G3-A5SK-01A-11D-A27I-10	TCGA-G3-A5SK-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	30544c96-0217-45e7-98dc-3dcbf4cf5ab3	2acbefee-83af-414b-8ddf-9f823a91bb22	g.chr20:44506970C>G	ENST00000255152.2	+	2	1982	c.1773C>G	c.(1771-1773)ctC>ctG	p.L591L	ZSWIM3_ENST00000454862.2_Silent_p.L585L|ZSWIM1_ENST00000372523.1_5'Flank|ZSWIM1_ENST00000372520.1_5'Flank	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	591							zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				ACCAGTACCTCCTTGGGCCCA	0.592																																					p.L591L		.											.	ZSWIM3	92	0			c.C1773G						.						81.0	69.0	73.0					20																	44506970		2203	4300	6503	SO:0001819	synonymous_variant	140831	exon2			GTACCTCCTTGGG	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1773C>G	20.37:g.44506970C>G		Somatic	224.0	0.0		WXS	Illumina HiSeq	Phase_I	358.0	109.0	NM_080752	Q9BR13	Silent	SNP	ENST00000255152.2	37	CCDS13381.1																																																																																			.		0.592	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
