#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABLIM1	3983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	116417809	116417809	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr10:116417809C>A	ENST00000277895.5	-	1	248	c.151G>T	c.(151-153)Gct>Tct	p.A51S	ABLIM1_ENST00000369252.4_Intron|snoU13_ENST00000458910.1_RNA|ABLIM1_ENST00000533213.2_Intron	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	51					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		CGCCTATGAGCGGTGAAGGAG	0.517																																					p.A51S		.											.	ABLIM1	153	0			c.G151T						.						95.0	87.0	90.0					10																	116417809		2203	4300	6503	SO:0001583	missense	3983	exon1			TATGAGCGGTGAA	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.151G>T	10.37:g.116417809C>A	ENSP00000277895:p.Ala51Ser	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	17.0	NM_002313	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Missense_Mutation	SNP	ENST00000277895.5	37	CCDS7590.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849365	0.32699	.	.	ENSG00000099204	ENST00000336585;ENST00000369262;ENST00000277895	T	0.27720	1.65	5.77	-1.77	0.07982	.	1.937130	0.03007	N	0.148935	T	0.18509	0.0444	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.25433	-1.0132	10	0.41790	T	0.15	.	6.4267	0.21773	0.0:0.1746:0.4573:0.3681	.	51	O14639	ABLM1_HUMAN	S	51	ENSP00000277895:A51S	ENSP00000277895:A51S	A	-	1	0	ABLIM1	116407799	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.873000	0.04214	-0.019000	0.14055	-0.219000	0.12488	GCT	.		0.517	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3		
ACAN	176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89385015	89385015	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr15:89385015A>G	ENST00000561243.1	+	4	674	c.674A>G	c.(673-675)gAt>gGt	p.D225G	ACAN_ENST00000439576.2_Missense_Mutation_p.D225G|ACAN_ENST00000352105.7_Missense_Mutation_p.D225G|ACAN_ENST00000559004.1_Missense_Mutation_p.D225G|ACAN_ENST00000558207.1_Missense_Mutation_p.D225G			P16112	PGCA_HUMAN	aggrecan	225	G1-B.|Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GGAGACAAGGATGAGTTTCCT	0.577																																					p.D225G		.											.	ACAN	25	0			c.A674G						.						171.0	182.0	178.0					15																	89385015		2092	4206	6298	SO:0001583	missense	176	exon5			ACAAGGATGAGTT	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.674A>G	15.37:g.89385015A>G	ENSP00000453342:p.Asp225Gly	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	17.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.005082	0.74932	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02446	4.53;4.29	5.61	5.61	0.85477	.	.	.	.	.	T	0.09379	0.0231	L	0.39020	1.185	0.51482	D	0.999925	D;D;D	0.89917	1.0;1.0;0.994	D;D;D	0.79784	0.993;0.993;0.953	T	0.20273	-1.0280	9	0.45353	T	0.12	-21.726	14.6404	0.68720	1.0:0.0:0.0:0.0	.	225;225;225	E7ENV9;E7EX88;Q6PID9	.;.;.	G	225	ENSP00000387356:D225G;ENSP00000341615:D225G	ENSP00000268134:D225G	D	+	2	0	ACAN	87186019	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	6.048000	0.71046	2.134000	0.65973	0.482000	0.46254	GAT	.		0.577	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
ADAMTSL1	92949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	18639393	18639393	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr9:18639393C>T	ENST00000380548.4	+	7	1157	c.818C>T	c.(817-819)gCa>gTa	p.A273V	ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.A273V|ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.A273V|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.A273V	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	273						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCACTCACAGCAGATTTCATT	0.428																																					p.A273V		.											.	ADAMTSL1	230	0			c.C818T						.						60.0	62.0	61.0					9																	18639393		2203	4299	6502	SO:0001583	missense	92949	exon7			TCACAGCAGATTT	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.818C>T	9.37:g.18639393C>T	ENSP00000369921:p.Ala273Val	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	16.0	NM_052866	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169730	0.78452	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000380566;ENST00000276935	T;T;T;T	0.64085	-0.08;0.65;0.65;0.65	5.77	5.77	0.91146	.	.	.	.	.	T	0.73450	0.3588	L	0.55481	1.735	0.80722	D	1	D;D	0.71674	0.998;0.971	P;P	0.59703	0.862;0.818	T	0.67968	-0.5533	9	0.32370	T	0.25	.	20.3472	0.98799	0.0:1.0:0.0:0.0	.	273;273	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	V	273	ENSP00000369921:A273V;ENSP00000327887:A273V;ENSP00000369940:A273V;ENSP00000276935:A273V	ENSP00000276935:A273V	A	+	2	0	ADAMTSL1	18629393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.879000	0.75572	2.890000	0.99128	0.650000	0.86243	GCA	.		0.428	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
ANKLE2	23141	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133324833	133324833	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr12:133324833G>T	ENST00000357997.5	-	4	1021	c.932C>A	c.(931-933)gCc>gAc	p.A311D	ANKLE2_ENST00000337516.5_Missense_Mutation_p.A311D|ANKLE2_ENST00000539605.1_Missense_Mutation_p.A249D	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	311					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		CCGAAGCTTGGCGGTGAGGTC	0.517																																					p.A311D		.											.	ANKLE2	68	0			c.C932A						.						143.0	142.0	142.0					12																	133324833		1988	4151	6139	SO:0001583	missense	23141	exon4			AGCTTGGCGGTGA	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.932C>A	12.37:g.133324833G>T	ENSP00000350686:p.Ala311Asp	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	7.0	NM_015114	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	ENST00000357997.5	37	CCDS41869.1	.	.	.	.	.	.	.	.	.	.	g	32	5.166826	0.94768	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000337516;ENST00000545623	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.52	5.52	0.82312	.	0.050079	0.85682	D	0.000000	D	0.82697	0.5093	M	0.79475	2.455	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70935	0.971;0.935	D	0.84520	0.0627	10	0.87932	D	0	-4.6334	19.434	0.94783	0.0:0.0:1.0:0.0	.	311;311	Q86XL3-2;Q86XL3	.;ANKL2_HUMAN	D	249;311;311;81	ENSP00000446268:A249D;ENSP00000350686:A311D;ENSP00000337651:A311D;ENSP00000438515:A81D	ENSP00000337651:A311D	A	-	2	0	ANKLE2	131834906	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	9.414000	0.97362	2.590000	0.87494	0.563000	0.77884	GCC	.		0.517	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397712.1		
ARHGAP12	94134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	32150410	32150410	+	Silent	SNP	C	C	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr10:32150410C>G	ENST00000344936.2	-	4	1095	c.861G>C	c.(859-861)ggG>ggC	p.G287G	ARHGAP12_ENST00000396144.4_Silent_p.G287G|ARHGAP12_ENST00000311380.4_Silent_p.G287G|ARHGAP12_ENST00000375250.5_Silent_p.G287G|ARHGAP12_ENST00000375245.4_Silent_p.G287G	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	287	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				TTTCCTGTGTCCCTCTGTTAT	0.473																																					p.G287G		.											.	ARHGAP12	227	0			c.G861C						.						112.0	100.0	104.0					10																	32150410		2203	4300	6503	SO:0001819	synonymous_variant	94134	exon4			CTGTGTCCCTCTG	AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.861G>C	10.37:g.32150410C>G		Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	29.0	NM_001270698	B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Silent	SNP	ENST00000344936.2	37	CCDS7170.1																																																																																			.		0.473	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047465.1		
ASB4	51666	ucsc.edu;bcgsc.ca	37	7	95157219	95157219	+	Silent	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr7:95157219C>T	ENST00000325885.5	+	3	653	c.582C>T	c.(580-582)taC>taT	p.Y194Y	ASB4_ENST00000428113.1_Silent_p.Y194Y	NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	194					intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			TGGCCTTCTACGTGGAACACG	0.592											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y194Y		.											.	ASB4	226	0			c.C582T						.						79.0	65.0	70.0					7																	95157219		2203	4300	6503	SO:0001819	synonymous_variant	51666	exon3			CTTCTACGTGGAA	AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.582C>T	7.37:g.95157219C>T		Somatic	25.0	0.0	1310	WXS	Illumina HiSeq	.	20.0	4.0	NM_016116	A4D1H6|O14586|Q14D68|Q8TBT2	Silent	SNP	ENST00000325885.5	37	CCDS5641.1																																																																																			.		0.592	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333225.2	NM_016116	
ASNA1	439	broad.mit.edu;mdanderson.org	37	19	12856230	12856230	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr19:12856230G>T	ENST00000591090.1	+	4	451	c.349G>T	c.(349-351)Gag>Tag	p.E117*	ASNA1_ENST00000357332.3_Nonsense_Mutation_p.E117*					arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)											endometrium(1)|lung(6)|ovary(3)	10						GCTGCCTGACGAGTTCTTCGA	0.607																																					p.E117X		.											.	ASNA1	92	0			c.G349T						.						64.0	56.0	59.0					19																	12856230		2203	4300	6503	SO:0001587	stop_gained	439	exon3			CCTGACGAGTTCT	U60276	CCDS32920.1	19p13.13	2010-08-05	2001-12-04			ENSG00000198356			752	protein-coding gene	gene with protein product	"""golgi to ER traffic 3 homolog (S. cerevisiae)"", ""transmembrane domain recognition complex, 40kDa"""	601913	"""arsA (bacterial) arsenite transporter, ATP-binding, homolog 1"""			8884272, 17382883	Standard	NM_004317		Approved	ARSA-I, GET3, TRC40	uc002muv.3	O43681		ENST00000591090.1:c.349G>T	19.37:g.12856230G>T	ENSP00000466379:p.Glu117*	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	3.0	NM_004317		Nonsense_Mutation	SNP	ENST00000591090.1	37	CCDS32920.1	.	.	.	.	.	.	.	.	.	.	G	33	5.265680	0.95399	.	.	ENSG00000198356	ENST00000357332	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-29.3391	17.3696	0.87372	0.0:0.0:1.0:0.0	.	.	.	.	X	117	.	ENSP00000349887:E117X	E	+	1	0	ASNA1	12717230	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	9.030000	0.93725	2.466000	0.83321	0.655000	0.94253	GAG	.		0.607	ASNA1-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450921.1	NM_004317	
ASPH	444	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	62475310	62475310	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr8:62475310T>A	ENST00000379454.4	-	18	1617	c.1430A>T	c.(1429-1431)tAt>tTt	p.Y477F	ASPH_ENST00000541428.1_Missense_Mutation_p.Y448F	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	477					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TACCTCTTCATAAACTTTCTT	0.318																																					p.Y477F		.											.	ASPH	93	0			c.A1430T						.						147.0	139.0	141.0					8																	62475310		2203	4300	6503	SO:0001583	missense	444	exon18			TCTTCATAAACTT	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.1430A>T	8.37:g.62475310T>A	ENSP00000368767:p.Tyr477Phe	Somatic	63.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	13.0	NM_004318	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	37	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	T	12.55	1.973098	0.34848	.	.	ENSG00000198363	ENST00000541428;ENST00000379454	T;T	0.38240	1.15;1.15	5.35	5.35	0.76521	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.20292	0.0488	N	0.11201	0.11	0.80722	D	1	P;P	0.41546	0.754;0.64	B;B	0.40285	0.325;0.174	T	0.06881	-1.0802	10	0.19590	T	0.45	-19.5698	10.8207	0.46604	0.141:0.0:0.0:0.8589	.	448;477	F5H667;Q12797	.;ASPH_HUMAN	F	448;477	ENSP00000437864:Y448F;ENSP00000368767:Y477F	ENSP00000368767:Y477F	Y	-	2	0	ASPH	62637864	1.000000	0.71417	0.996000	0.52242	0.935000	0.57460	5.407000	0.66363	2.137000	0.66172	0.528000	0.53228	TAT	.		0.318	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318	
BOC	91653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113005642	113005642	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr3:113005642C>A	ENST00000495514.1	+	20	3982	c.3278C>A	c.(3277-3279)cCt>cAt	p.P1093H	BOC_ENST00000273395.4_Missense_Mutation_p.P1094H|BOC_ENST00000355385.3_Missense_Mutation_p.P1093H			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	1093					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GGACAGGAACCTGGAATGCAG	0.542																																					p.P1093H		.											.	BOC	157	0			c.C3278A						.						112.0	120.0	117.0					3																	113005642		2203	4300	6503	SO:0001583	missense	91653	exon20			AGGAACCTGGAAT	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.3278C>A	3.37:g.113005642C>A	ENSP00000418663:p.Pro1093His	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	12.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524587	0.27299	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.59638	0.25;0.25;0.25	6.17	-0.237	0.13061	.	0.542823	0.18213	N	0.148136	T	0.34048	0.0884	N	0.24115	0.695	0.09310	N	1	B;B	0.12013	0.005;0.003	B;B	0.10450	0.005;0.002	T	0.10730	-1.0617	10	0.39692	T	0.17	.	2.384	0.04361	0.1335:0.4771:0.1308:0.2585	.	1094;1093	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	H	1093;1094;1093	ENSP00000418663:P1093H;ENSP00000273395:P1094H;ENSP00000347546:P1093H	ENSP00000273395:P1094H	P	+	2	0	BOC	114488332	0.000000	0.05858	0.002000	0.10522	0.400000	0.30750	-0.119000	0.10676	-0.106000	0.12110	0.655000	0.94253	CCT	.		0.542	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142275251	142275251	+	Silent	SNP	A	A	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr3:142275251A>C	ENST00000350721.4	-	9	2173	c.2052T>G	c.(2050-2052)tcT>tcG	p.S684S	ATR_ENST00000383101.3_Silent_p.S620S	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	684					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTCTGTTACAAGAATTCTGCT	0.388								Other conserved DNA damage response genes																													p.S684S		.											.	ATR	1139	0			c.T2052G						.						70.0	77.0	74.0					3																	142275251		2203	4300	6503	SO:0001819	synonymous_variant	545	exon9			GTTACAAGAATTC	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.2052T>G	3.37:g.142275251A>C		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	18.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																			.		0.388	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
BRCA1	672	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	41245778	41245778	+	Silent	SNP	A	A	G	rs80359886		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr17:41245778A>G	ENST00000357654.3	-	10	1888	c.1770T>C	c.(1768-1770)agT>agC	p.S590S	BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000309486.4_Silent_p.S294S|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000346315.3_Silent_p.S590S|BRCA1_ENST00000354071.3_Silent_p.S590S|BRCA1_ENST00000471181.2_Silent_p.S590S|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Silent_p.S543S	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	590					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TATTGCTTATACTGCTGCTTA	0.368			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.S590S		.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	3415	0			c.T1770C						.						89.0	88.0	88.0					17																	41245778		2202	4298	6500	SO:0001819	synonymous_variant	672	exon10	Familial Cancer Database		GCTTATACTGCTG	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.1770T>C	17.37:g.41245778A>G		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	13.0	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	ENST00000357654.3	37	CCDS11453.1																																																																																			.		0.368	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
CCDC150	284992	ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197595663	197595663	+	Silent	SNP	A	A	C	rs376832395		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:197595663A>C	ENST00000389175.4	+	26	3198	c.3063A>C	c.(3061-3063)tcA>tcC	p.S1021S	CCDC150_ENST00000272831.7_Silent_p.S668S|CCDC150_ENST00000409270.1_Silent_p.S508S	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	1021										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GTGTGGAATCAGAACAGGTGA	0.428																																					p.S1021S		.											.	.	.	0			c.A3063C						.	A		0,3942		0,0,1971	55.0	55.0	55.0		3063	0.7	1.0	2		55	1,8303		0,1,4151	no	coding-synonymous	CCDC150	NM_001080539.1		0,1,6122	CC,CA,AA		0.012,0.0,0.0082		1021/1102	197595663	1,12245	1971	4152	6123	SO:0001819	synonymous_variant	284992	exon26			GGAATCAGAACAG		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.3063A>C	2.37:g.197595663A>C		Somatic	81.0	1.0		WXS	Illumina HiSeq	.	46.0	10.0	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Silent	SNP	ENST00000389175.4	37	CCDS46478.1																																																																																			.		0.428	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
SOHLH2	54937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36747869	36747869	+	Silent	SNP	G	G	A	rs572238180		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr13:36747869G>A	ENST00000379881.3	-	9	1048	c.960C>T	c.(958-960)tcC>tcT	p.S320S	CCDC169-SOHLH2_ENST00000511166.1_Silent_p.S397S|SOHLH2_ENST00000554962.1_Silent_p.S397S	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	320					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		CATCAGGAGTGGAGCACCCAT	0.522													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19309	0.0		0.0	False		,,,				2504	0.0				p.S397S		.											.	.	.	0			c.C1191T						.						122.0	109.0	113.0					13																	36747869		2203	4300	6503	SO:0001819	synonymous_variant	100526761	exon14			AGGAGTGGAGCAC	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.960C>T	13.37:g.36747869G>A		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	9.0	NM_001198910	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	ENST00000379881.3	37	CCDS9355.1																																																																																			.		0.522	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
CCR6	1235	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	167550438	167550438	+	Silent	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr6:167550438C>T	ENST00000341935.5	+	3	1272	c.720C>T	c.(718-720)acC>acT	p.T240T	CCR6_ENST00000349984.4_Silent_p.T240T|CCR6_ENST00000400926.2_Silent_p.T240T|RP11-517H2.6_ENST00000609590.1_RNA	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	240					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		TTGTCAAAACCTTGGTGCAAG	0.433																																					p.T240T		.											.	CCR6	227	0			c.C720T						.						144.0	132.0	136.0					6																	167550438		2203	4300	6503	SO:0001819	synonymous_variant	1235	exon3			CAAAACCTTGGTG	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.720C>T	6.37:g.167550438C>T		Somatic	58.0	1.0		WXS	Illumina HiSeq	Phase_I	52.0	9.0	NM_004367	E1P5C6|P78553|Q92846	Silent	SNP	ENST00000341935.5	37	CCDS5298.1																																																																																			.		0.433	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1		
CHD2	1106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	93510735	93510735	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr15:93510735G>C	ENST00000394196.4	+	17	3249	c.2181G>C	c.(2179-2181)caG>caC	p.Q727H	CHD2_ENST00000557381.1_Missense_Mutation_p.Q727H	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	727					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TTCAGAAACAGTATTACAAGT	0.393																																					p.Q727H		.											.	CHD2	229	0			c.G2181C						.						75.0	68.0	70.0					15																	93510735		2197	4298	6495	SO:0001583	missense	1106	exon17			GAAACAGTATTAC	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2181G>C	15.37:g.93510735G>C	ENSP00000377747:p.Gln727His	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	13.0	NM_001271	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041729	0.75732	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.92647	-3.08;-3.08	5.83	5.83	0.93111	SNF2-related (1);	0.000000	0.32769	U	0.005678	D	0.95755	0.8619	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.74023	0.966;0.982	D	0.95610	0.8671	10	0.87932	D	0	-29.2142	20.115	0.97926	0.0:0.0:1.0:0.0	.	727;727	O14647;O14647-2	CHD2_HUMAN;.	H	727	ENSP00000377747:Q727H;ENSP00000451366:Q727H	ENSP00000377747:Q727H	Q	+	3	2	CHD2	91311739	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.144000	0.50616	2.761000	0.94854	0.650000	0.86243	CAG	.		0.393	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
COL24A1	255631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	86554879	86554879	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr1:86554879G>A	ENST00000370571.2	-	7	2051	c.1685C>T	c.(1684-1686)cCc>cTc	p.P562L	COL24A1_ENST00000436319.1_Missense_Mutation_p.P562L	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	562	Collagen-like 2.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CATACCAGGGGGGCCCATTAA	0.328																																					p.P562L		.											.	COL24A1	94	0			c.C1685T						.						78.0	77.0	77.0					1																	86554879		1805	4063	5868	SO:0001583	missense	255631	exon7			CCAGGGGGGCCCA	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.1685C>T	1.37:g.86554879G>A	ENSP00000359603:p.Pro562Leu	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	40.0	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	G	6.261	0.416198	0.11870	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;T	0.96685	-4.09;2.33	5.41	4.5	0.54988	.	0.390052	0.18954	N	0.126616	D	0.88291	0.6397	L	0.42529	1.33	0.58432	D	0.99999	P;B	0.41848	0.763;0.001	B;B	0.39465	0.3;0.005	D	0.86991	0.2110	10	0.08837	T	0.75	.	10.1227	0.42630	0.09:0.0:0.91:0.0	.	562;562	F8WDM8;Q17RW2	.;COOA1_HUMAN	L	562	ENSP00000359603:P562L;ENSP00000392531:P562L	ENSP00000359603:P562L	P	-	2	0	COL24A1	86327467	0.999000	0.42202	0.945000	0.38365	0.351000	0.29236	3.506000	0.53364	1.529000	0.49120	-0.291000	0.09656	CCC	.		0.328	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3830772	3830772	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr16:3830772T>C	ENST00000262367.5	-	8	2593	c.1784A>G	c.(1783-1785)cAt>cGt	p.H595R	CREBBP_ENST00000382070.3_Missense_Mutation_p.H557R	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	595	KIX. {ECO:0000255|PROSITE- ProRule:PRU00311}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTGAGTGACATGTTCGTGCCA	0.473			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.H595R		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.A1784G						.						117.0	96.0	104.0					16																	3830772		2197	4300	6497	SO:0001583	missense	1387	exon8			GTGACATGTTCGT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.1784A>G	16.37:g.3830772T>C	ENSP00000262367:p.His595Arg	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	10.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	T	18.52	3.641647	0.67244	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.82984	-1.67;-1.6	5.65	5.65	0.86999	Coactivator CBP, KIX (4);	0.000000	0.85682	D	0.000000	D	0.86117	0.5856	L	0.29908	0.895	0.80722	D	1	D;D	0.76494	0.966;0.999	D;D	0.83275	0.972;0.996	D	0.86055	0.1528	10	0.40728	T	0.16	-19.1248	15.8672	0.79074	0.0:0.0:0.0:1.0	.	625;595	Q4LE28;Q92793	.;CBP_HUMAN	R	595;625;557	ENSP00000262367:H595R;ENSP00000371502:H557R	ENSP00000262367:H595R	H	-	2	0	CREBBP	3770773	1.000000	0.71417	0.976000	0.42696	0.990000	0.78478	7.932000	0.87634	2.156000	0.67533	0.482000	0.46254	CAT	.		0.473	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CST5	1473	broad.mit.edu;ucsc.edu;mdanderson.org	37	20	23856835	23856835	+	Missense_Mutation	SNP	C	C	A	rs146272783	byFrequency	TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr20:23856835C>A	ENST00000304710.4	-	3	492	c.419G>T	c.(418-420)cGg>cTg	p.R140L		NM_001900.4	NP_001891.2	P28325	CYTD_HUMAN	cystatin D	140					negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11						CTAGACTTTCCGGCACTTGTA	0.527																																					p.R140L		.											.	CST5	90	0			c.G419T						.						85.0	92.0	90.0					20																	23856835		2203	4300	6503	SO:0001583	missense	1473	exon3			ACTTTCCGGCACT		CCDS13162.1	20p11.21	2008-04-15			ENSG00000170367	ENSG00000170367			2477	protein-coding gene	gene with protein product		123858				1939105	Standard	NM_001900		Approved		uc002wtr.1	P28325	OTTHUMG00000032089	ENST00000304710.4:c.419G>T	20.37:g.23856835C>A	ENSP00000307132:p.Arg140Leu	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	4.0	NM_001900	Q5JRF5|Q9UCA0	Missense_Mutation	SNP	ENST00000304710.4	37	CCDS13162.1	.	.	.	.	.	.	.	.	.	.	C	8.253	0.809540	0.16537	.	.	ENSG00000170367	ENST00000304710	T	0.10192	2.9	2.01	0.723	0.18231	Proteinase inhibitor I25, cystatin (1);	1.246430	0.05693	U	0.592517	T	0.04952	0.0133	N	0.08118	0	0.09310	N	1	B	0.31910	0.346	B	0.29663	0.105	T	0.39014	-0.9634	10	0.24483	T	0.36	.	3.4257	0.07409	0.0:0.2966:0.0:0.7034	.	140	P28325	CYTD_HUMAN	L	140	ENSP00000307132:R140L	ENSP00000307132:R140L	R	-	2	0	CST5	23804835	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	0.016000	0.13377	0.159000	0.19401	0.448000	0.29417	CGG	C|0.998;T|0.002		0.527	CST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078355.2	NM_001900	
CYP2C8	1558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	96796969	96796969	+	Silent	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr10:96796969A>G	ENST00000371270.3	-	9	1483	c.1389T>C	c.(1387-1389)gaT>gaC	p.D463D	CYP2C8_ENST00000535898.1_Silent_p.D361D	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	463					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	GGTTCTTTAAATCATCAACAG	0.413																																					p.D463D		.											.	CYP2C8	90	0			c.T1389C						.						132.0	136.0	134.0					10																	96796969		2203	4300	6503	SO:0001819	synonymous_variant	1558	exon9			CTTTAAATCATCA	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.1389T>C	10.37:g.96796969A>G		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	16.0	NM_000770	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Silent	SNP	ENST00000371270.3	37	CCDS7438.1																																																																																			.		0.413	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	
DBX2	440097	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	45429822	45429822	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr12:45429822G>C	ENST00000332700.6	-	2	650	c.479C>G	c.(478-480)gCa>gGa	p.A160G		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	160					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A160E(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		agtggaggatgcagggcgccg	0.488																																					p.A160G		.											.	DBX2	90	1	Substitution - Missense(1)	lung(1)	c.C479G						.						71.0	73.0	73.0					12																	45429822		2203	4300	6503	SO:0001583	missense	440097	exon2			GAGGATGCAGGGC		CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.479C>G	12.37:g.45429822G>C	ENSP00000331470:p.Ala160Gly	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	5.0	NM_001004329		Missense_Mutation	SNP	ENST00000332700.6	37	CCDS31781.1	.	.	.	.	.	.	.	.	.	.	G	0.940	-0.709872	0.03230	.	.	ENSG00000185610	ENST00000332700	D	0.91631	-2.88	5.95	1.0	0.19881	.	0.412421	0.23096	N	0.051977	D	0.83566	0.5282	L	0.34521	1.04	0.29558	N	0.850835	B	0.15141	0.012	B	0.09377	0.004	T	0.69548	-0.5116	10	0.18710	T	0.47	-1.599	7.1919	0.25831	0.252:0.1116:0.6364:0.0	.	160	Q6ZNG2	DBX2_HUMAN	G	160	ENSP00000331470:A160G	ENSP00000331470:A160G	A	-	2	0	DBX2	43716089	0.979000	0.34478	0.018000	0.16275	0.039000	0.13416	1.728000	0.38105	0.136000	0.18733	-0.844000	0.03045	GCA	.		0.488	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1	NM_001004329	
DGCR6L	85359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	20307214	20307214	+	Silent	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr22:20307214G>A	ENST00000248879.3	-	2	310	c.219C>T	c.(217-219)ctC>ctT	p.L73L	XXbac-B444P24.13_ENST00000608275.1_RNA|DGCR6L_ENST00000405465.3_Missense_Mutation_p.S69L|XXbac-B444P24.14_ENST00000609632.1_lincRNA	NM_033257.3	NP_150282.2	Q9BY27	DGC6L_HUMAN	DiGeorge syndrome critical region gene 6-like	73						nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(2)|stomach(1)	5	Colorectal(54;0.0993)					TCTTTTCGGTGAGGTGCTGGA	0.672																																					p.L73L		.											.	DGCR6L	90	0			c.C219T						.						35.0	32.0	33.0					22																	20307214		2201	4298	6499	SO:0001819	synonymous_variant	85359	exon2			TTCGGTGAGGTGC	AF228708	CCDS13778.1	22q11.21	2013-02-19			ENSG00000128185	ENSG00000128185			18551	protein-coding gene	gene with protein product		609459				11157784	Standard	NM_033257		Approved	FLJ10666	uc002zrx.3	Q9BY27	OTTHUMG00000150583	ENST00000248879.3:c.219C>T	22.37:g.20307214G>A		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	9.0	NM_033257	A8K1N7|B3KMC0|D3DX29|Q9BW33	Silent	SNP	ENST00000248879.3	37	CCDS13778.1	.	.	.	.	.	.	.	.	.	.	G	8.733	0.917160	0.17982	.	.	ENSG00000128185	ENST00000405465	T	0.35421	1.31	2.49	0.0108	0.14084	.	.	.	.	.	T	0.24851	0.0603	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.27536	-1.0071	5	.	.	.	-12.8707	5.5677	0.17180	0.0:0.4196:0.3673:0.2131	.	.	.	.	L	69	ENSP00000386052:S69L	.	S	-	2	0	DGCR6L	18687214	1.000000	0.71417	0.988000	0.46212	0.087000	0.18053	1.239000	0.32719	-0.051000	0.13334	0.306000	0.20318	TCA	.		0.672	DGCR6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318970.3	NM_033257	
DLST	1743	bcgsc.ca;mdanderson.org	37	14	75360077	75360077	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr14:75360077C>A	ENST00000334220.4	+	9	683	c.622C>A	c.(622-624)Cca>Aca	p.P208T	DLST_ENST00000334212.6_Missense_Mutation_p.P122T|DLST_ENST00000555190.1_3'UTR	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	208					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		CACTGTTGCCCCACCACTAGC	0.502																																					p.P208T		.											.	DLST	227	0			c.C622A						.						99.0	91.0	94.0					14																	75360077		2203	4300	6503	SO:0001583	missense	1743	exon9			GTTGCCCCACCAC		CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.622C>A	14.37:g.75360077C>A	ENSP00000335304:p.Pro208Thr	Somatic	95.0	2.0		WXS	Illumina HiSeq	Phase_1	72.0	20.0	NM_001933	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Missense_Mutation	SNP	ENST00000334220.4	37	CCDS9833.1	.	.	.	.	.	.	.	.	.	.	C	8.900	0.956215	0.18507	.	.	ENSG00000119689	ENST00000334220;ENST00000334212;ENST00000554806	T;T;T	0.52295	0.67;0.67;0.67	5.2	3.23	0.37069	.	0.395134	0.30723	N	0.009002	T	0.26011	0.0634	N	0.08118	0	0.42635	D	0.99339	B;B;B;B;B	0.13145	0.001;0.004;0.004;0.004;0.007	B;B;B;B;B	0.09377	0.002;0.002;0.002;0.004;0.002	T	0.08848	-1.0702	10	0.48119	T	0.1	-48.446	9.9346	0.41543	0.0:0.6653:0.2629:0.0718	.	122;208;208;120;124	B7Z5W8;Q6IBS5;P36957;Q86TQ8;Q86TW7	.;.;ODO2_HUMAN;.;.	T	208;122;191	ENSP00000335304:P208T;ENSP00000335465:P122T;ENSP00000451957:P191T	ENSP00000238671:P191T	P	+	1	0	DLST	74429830	0.975000	0.34042	0.802000	0.32245	0.200000	0.23975	2.075000	0.41538	1.522000	0.49001	0.655000	0.94253	CCA	.		0.502	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413637.1		
ESR1	2099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152415519	152415519	+	Splice_Site	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr6:152415519G>A	ENST00000206249.3	+	7	1731		c.e7-1		ESR1_ENST00000427531.2_Intron|ESR1_ENST00000456483.2_Splice_Site|ESR1_ENST00000406599.1_Splice_Site|ESR1_ENST00000440973.1_Splice_Site|ESR1_ENST00000338799.5_Splice_Site|ESR1_ENST00000443427.1_Splice_Site	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1						androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	TGCGCATTCAGGAGTGTACAC	0.502																																					.		.											.	ESR1	1042	0			c.1370-1G>A						.						121.0	122.0	122.0					6																	152415519		2203	4300	6503	SO:0001630	splice_region_variant	2099	exon9			CATTCAGGAGTGT	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1370-1G>A	6.37:g.152415519G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	10.0	NM_001122742	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Splice_Site	SNP	ENST00000206249.3	37	CCDS5234.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743328	0.89663	.	.	ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000456483;ENST00000443427;ENST00000206249;ENST00000406599;ENST00000431590	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2505	0.93923	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ESR1	152457212	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.888000	0.92464	2.555000	0.86185	0.555000	0.69702	.	.		0.502	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		Intron
FARSB	10056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	223494886	223494886	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:223494886A>G	ENST00000281828.6	-	9	1057	c.794T>C	c.(793-795)aTa>aCa	p.I265T	FARSB_ENST00000536361.1_Missense_Mutation_p.I166T	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	265					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	ATCAAGAACTATTTTTGCCTG	0.303																																					p.I265T		.											.	FARSB	91	0			c.T794C						.						92.0	89.0	90.0					2																	223494886		2202	4300	6502	SO:0001583	missense	10056	exon9			AGAACTATTTTTG	AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.794T>C	2.37:g.223494886A>G	ENSP00000281828:p.Ile265Thr	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	36.0	NM_005687	B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	ENST00000281828.6	37	CCDS2454.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.001283	0.74818	.	.	ENSG00000116120	ENST00000281828;ENST00000536361	T;T	0.28069	1.63;1.63	5.57	5.57	0.84162	B3/B4 tRNA-binding domain (2);Phenylalanyl-tRNA synthetase, B3/B4 (1);	0.041677	0.85682	D	0.000000	T	0.43545	0.1252	M	0.75447	2.3	0.80722	D	1	P;B	0.42973	0.796;0.43	P;P	0.46026	0.501;0.501	T	0.40232	-0.9574	10	0.45353	T	0.12	-15.0248	15.7429	0.77914	1.0:0.0:0.0:0.0	.	265;265	A8K666;Q9NSD9	.;SYFB_HUMAN	T	265;166	ENSP00000281828:I265T;ENSP00000442950:I166T	ENSP00000281828:I265T	I	-	2	0	FARSB	223203130	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.961000	0.76042	2.118000	0.64928	0.528000	0.53228	ATA	.		0.303	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256855.2	NM_005687	
FLG	2312	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152286392	152286392	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr1:152286392A>G	ENST00000368799.1	-	3	1005	c.970T>C	c.(970-972)Tct>Cct	p.S324P	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	324	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCACGCAGATCCATGATGG	0.562									Ichthyosis																												p.S324P		.											.	FLG	106	0			c.T970C						.						180.0	185.0	184.0					1																	152286392		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACGCAGATCCATG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.970T>C	1.37:g.152286392A>G	ENSP00000357789:p.Ser324Pro	Somatic	128.0	1.0		WXS	Illumina HiSeq	Phase_I	90.0	27.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	8.174	0.792287	0.16258	.	.	ENSG00000143631	ENST00000368799	T	0.03772	3.81	1.87	0.644	0.17776	.	.	.	.	.	T	0.06234	0.0161	M	0.74881	2.28	0.09310	N	1	D	0.62365	0.991	D	0.70227	0.968	T	0.25641	-1.0126	9	0.28530	T	0.3	0.0084	4.7854	0.13222	0.6722:0.3278:0.0:0.0	.	324	P20930	FILA_HUMAN	P	324	ENSP00000357789:S324P	ENSP00000357789:S324P	S	-	1	0	FLG	150553016	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.572000	0.05881	0.157000	0.19338	0.329000	0.21502	TCT	.		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLT3LG	2323	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49979435	49979435	+	Missense_Mutation	SNP	G	G	A	rs367551792		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr19:49979435G>A	ENST00000594009.1	+	3	257	c.178G>A	c.(178-180)Gtg>Atg	p.V60M	CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000595510.1_5'UTR|FLT3LG_ENST00000600429.1_Missense_Mutation_p.V60M|FLT3LG_ENST00000344019.3_Missense_Mutation_p.V60M|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000597551.1_Missense_Mutation_p.V60M|FLT3LG_ENST00000596435.1_Missense_Mutation_p.V60M|FLT3LG_ENST00000204637.2_5'UTR	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	60					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)			large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CCCAGTCACCGTGGCCTCCAA	0.567											OREG0025623	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		16374	0.0		0.0	False		,,,				2504	0.0				p.V60M		.											.	FLT3LG	115	0			c.G178A						.	G	MET/VAL,MET/VAL,MET/VAL	0,4406		0,0,2203	165.0	165.0	165.0		178,178,178	3.0	0.2	19		165	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	FLT3LG	NM_001204502.1,NM_001204503.1,NM_001459.3	21,21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	60/236,60/236,60/236	49979435	1,13005	2203	4300	6503	SO:0001583	missense	2323	exon3			GTCACCGTGGCCT	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.178G>A	19.37:g.49979435G>A	ENSP00000469613:p.Val60Met	Somatic	52.0	0.0	966	WXS	Illumina HiSeq	Phase_I	29.0	6.0	NM_001204503	A0AVC2|B9EGH2|Q05C96	Missense_Mutation	SNP	ENST00000594009.1	37	CCDS12767.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927406	0.34002	0.0	1.16E-4	ENSG00000090554	ENST00000204637;ENST00000344019	.	.	.	4.04	2.95	0.34219	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.227351	0.35436	U	0.003217	T	0.48314	0.1493	L	0.34521	1.04	0.09310	N	1	D	0.89917	1.0	D	0.71656	0.974	T	0.29366	-1.0014	9	0.52906	T	0.07	-12.4909	9.7282	0.40344	0.0:0.2126:0.7873:0.0	.	60	P49771	FLT3L_HUMAN	M	60	.	ENSP00000204637:V60M	V	+	1	0	FLT3LG	54671247	0.833000	0.29383	0.201000	0.23476	0.130000	0.20726	1.303000	0.33470	0.761000	0.33130	0.542000	0.68232	GTG	.		0.567	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465305.1		
GGA3	23163	ucsc.edu;mdanderson.org	37	17	73236489	73236489	+	Silent	SNP	G	G	C	rs149621783	byFrequency	TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr17:73236489G>C	ENST00000245541.6	-	12	1413	c.1197C>G	c.(1195-1197)ctC>ctG	p.L399L	GGA3_ENST00000538886.1_Silent_p.L277L|GGA3_ENST00000582717.1_Silent_p.L327L|GGA3_ENST00000578348.1_Silent_p.L277L|GGA3_ENST00000351904.7_Silent_p.L366L|GGA3_ENST00000582486.1_Silent_p.L327L	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	399	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			CTGGGTCGGCGAGGCCTGACA	0.587																																					p.L399L		.											.	GGA3	154	0			c.C1197G						.						37.0	36.0	36.0					17																	73236489		2202	4299	6501	SO:0001819	synonymous_variant	23163	exon12			GTCGGCGAGGCCT	AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.1197C>G	17.37:g.73236489G>C		Somatic	15.0	0.0		WXS	Illumina HiSeq	.	17.0	4.0	NM_138619	B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Silent	SNP	ENST00000245541.6	37	CCDS11717.1																																																																																			G|1.000;A|0.000		0.587	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446645.1	NM_138619	
GLE1	2733	broad.mit.edu;mdanderson.org	37	9	131295815	131295815	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr9:131295815G>A	ENST00000309971.4	+	10	1442	c.1336G>A	c.(1336-1338)Gac>Aac	p.D446N	RP11-216B9.6_ENST00000434999.1_RNA|GLE1_ENST00000372770.4_Missense_Mutation_p.D446N|GLE1_ENST00000539582.1_Missense_Mutation_p.D192N|GLE1_ENST00000494417.1_3'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	446	Mediates the shuttling between the nucleus and the cytoplasm.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						GGAGATCTTTGACAAGATCCA	0.393																																					p.D446N		.											.	GLE1	22	0			c.G1336A						.						84.0	87.0	86.0					9																	131295815		2203	4300	6503	SO:0001583	missense	2733	exon10			ATCTTTGACAAGA	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.1336G>A	9.37:g.131295815G>A	ENSP00000308622:p.Asp446Asn	Somatic	53.0	2.0		WXS	Illumina HiSeq	Phase_I	53.0	11.0	NM_001499	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Missense_Mutation	SNP	ENST00000309971.4	37	CCDS35154.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.760243	0.89932	.	.	ENSG00000119392	ENST00000309971;ENST00000372770;ENST00000539582	T;T;T	0.71341	-0.56;-0.56;-0.56	5.82	5.82	0.92795	.	0.284020	0.44688	D	0.000433	T	0.77018	0.4069	L	0.47016	1.485	0.58432	D	0.999997	D;P	0.60575	0.988;0.953	P;P	0.60286	0.872;0.725	T	0.69756	-0.5059	10	0.15066	T	0.55	-33.2694	19.0734	0.93150	0.0:0.0:1.0:0.0	.	446;446	Q53GS7;Q53GS7-2	GLE1_HUMAN;.	N	446;446;192	ENSP00000308622:D446N;ENSP00000361856:D446N;ENSP00000438670:D192N	ENSP00000308622:D446N	D	+	1	0	GLE1	130335636	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.983000	0.88140	2.756000	0.94617	0.561000	0.74099	GAC	.		0.393	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054456.1	NM_001003722	
GNAS	2778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57484420	57484420	+	Missense_Mutation	SNP	C	C	T	rs11554273		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr20:57484420C>T	ENST00000371085.3	+	8	1025	c.601C>T	c.(601-603)Cgt>Tgt	p.R201C	GNAS_ENST00000265620.7_Missense_Mutation_p.R186C|GNAS_ENST00000354359.7_Missense_Mutation_p.R202C|GNAS_ENST00000371100.4_Missense_Mutation_p.R844C|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371095.3_Missense_Mutation_p.R187C|GNAS_ENST00000306090.10_Missense_Mutation_p.R187C|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.R830C|GNAS_ENST00000371075.3_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201C(228)|p.R844C(9)|p.R201S(5)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCTTCGCTGCCGTGTCCTGAC	0.428			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.R844C	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	GNAS,colon,carcinoma,0	GNAS	4767	242	Substitution - Missense(242)	pituitary(141)|pancreas(35)|large_intestine(14)|ovary(12)|thyroid(10)|adrenal_gland(7)|biliary_tract(6)|parathyroid(5)|liver(3)|kidney(3)|testis(2)|upper_aerodigestive_tract(2)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)	c.C2530T						.						80.0	78.0	79.0					20																	57484420		2203	4300	6503	SO:0001583	missense	2778	exon8			CGCTGCCGTGTCC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.601C>T	20.37:g.57484420C>T	ENSP00000360126:p.Arg201Cys	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	18.0	NM_080425	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215896	0.79352	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99466	-5.95;-5.95;-5.95;-5.95;-5.95;-2.99;-5.95	5.53	4.53	0.55603	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99775	0.9907	H	0.99732	4.735	0.80722	D	1	D;D;D;D	0.89917	0.999;0.983;0.979;1.0	D;P;P;D	0.97110	0.939;0.845;0.643;1.0	D	0.96814	0.9599	10	0.87932	D	0	.	13.0593	0.58997	0.2437:0.7563:0.0:0.0	rs11554273	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	C	844;830;187;201;202;186;187	ENSP00000360141:R844C;ENSP00000360143:R830C;ENSP00000360136:R187C;ENSP00000360126:R201C;ENSP00000346328:R202C;ENSP00000265620:R186C;ENSP00000304472:R187C	ENSP00000265620:R186C	R	+	1	0	GNAS	56917815	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	4.055000	0.57441	2.596000	0.87737	0.563000	0.77884	CGT	C|1.000		0.428	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
HECW2	57520	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197183957	197183957	+	Missense_Mutation	SNP	C	C	T	rs371715457		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:197183957C>T	ENST00000260983.3	-	9	1839	c.1657G>A	c.(1657-1659)Ggc>Agc	p.G553S	HECW2_ENST00000409111.1_Missense_Mutation_p.G197S	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	553					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GGCTCTGGGCCGCCTTCACCT	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		21381	0.001		0.0	False		,,,				2504	0.0				p.G553S		.											.	HECW2	668	0			c.G1657A						.	C	SER/GLY	1,4405	4.2+/-10.8	0,1,2202	58.0	53.0	54.0		1657	4.6	0.0	2		54	0,8600		0,0,4300	no	missense	HECW2	NM_020760.1	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	553/1573	197183957	1,13005	2203	4300	6503	SO:0001583	missense	57520	exon9			CTGGGCCGCCTTC	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.1657G>A	2.37:g.197183957C>T	ENSP00000260983:p.Gly553Ser	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	7.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.321027	0.23994	2.27E-4	0.0	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.28895	1.59;1.6	5.51	4.63	0.57726	.	0.589975	0.19398	N	0.115250	T	0.16300	0.0392	N	0.19112	0.55	0.09310	N	1	B	0.23806	0.091	B	0.14023	0.01	T	0.21518	-1.0243	10	0.13108	T	0.6	.	7.6284	0.28226	0.0:0.6914:0.218:0.0906	.	553	Q9P2P5	HECW2_HUMAN	S	197;553	ENSP00000386775:G197S;ENSP00000260983:G553S	ENSP00000260983:G553S	G	-	1	0	HECW2	196892202	0.007000	0.16637	0.009000	0.14445	0.508000	0.34012	2.054000	0.41335	1.539000	0.49286	0.561000	0.74099	GGC	.		0.577	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
GPC1	2817	ucsc.edu;bcgsc.ca	37	2	241401973	241401973	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:241401973A>T	ENST00000264039.2	+	3	939	c.691A>T	c.(691-693)Agc>Tgc	p.S231C		NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1	231					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		GGGCGTGGCCAGCGACGTGGT	0.701																																					p.S231C		.											.	GPC1	153	0			c.A691T						.						15.0	17.0	16.0					2																	241401973		2169	4244	6413	SO:0001583	missense	2817	exon3			GTGGCCAGCGACG	AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.691A>T	2.37:g.241401973A>T	ENSP00000264039:p.Ser231Cys	Somatic	19.0	0.0		WXS	Illumina HiSeq	.	17.0	4.0	NM_002081	B3KTD1|Q53QM4	Missense_Mutation	SNP	ENST00000264039.2	37	CCDS2534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.65|14.65	2.597637|2.597637	0.46318|0.46318	.|.	.|.	ENSG00000063660|ENSG00000063660	ENST00000420138|ENST00000264039	.|T	.|0.52295	.|0.67	2.97|2.97	-2.65|-2.65	0.06095|0.06095	.|.	.|0.686338	.|0.14978	.|N	.|0.287443	T|T	0.53190|0.53190	0.1781|0.1781	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	0.999999|0.999999	.|P	.|0.52316	.|0.952	.|P	.|0.58520	.|0.84	T|T	0.50866|0.50866	-0.8777|-0.8777	5|10	.|0.48119	.|T	.|0.1	-21.3308|-21.3308	9.3542|9.3542	0.38157|0.38157	0.375:0.0:0.625:0.0|0.375:0.0:0.625:0.0	.|.	.|231	.|P35052	.|GPC1_HUMAN	L|C	270|231	.|ENSP00000264039:S231C	.|ENSP00000264039:S231C	Q|S	+|+	2|1	0|0	GPC1|GPC1	241050646|241050646	0.000000|0.000000	0.05858|0.05858	0.306000|0.306000	0.25113|0.25113	0.870000|0.870000	0.49936|0.49936	-0.010000|-0.010000	0.12743|0.12743	-0.719000|-0.719000	0.04942|0.04942	0.482000|0.482000	0.46254|0.46254	CAG|AGC	.		0.701	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257179.3	NM_002081	
HELZ2	85441	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	62196722	62196722	+	Silent	SNP	G	G	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr20:62196722G>T	ENST00000467148.1	-	8	3522	c.3453C>A	c.(3451-3453)tcC>tcA	p.S1151S	HELZ2_ENST00000427522.2_Silent_p.S582S	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1151					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TGGGGCCCGAGGAGGCATCGT	0.687																																					p.S1151S		.											.	.	.	0			c.C3453A						.						10.0	10.0	10.0					20																	62196722		2160	4255	6415	SO:0001819	synonymous_variant	85441	exon9			GCCCGAGGAGGCA	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3453C>A	20.37:g.62196722G>T		Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	5.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																			.		0.687	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HIPK2	28996	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139258131	139258131	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr7:139258131T>C	ENST00000406875.3	-	15	3233	c.3139A>G	c.(3139-3141)Atc>Gtc	p.I1047V	HIPK2_ENST00000428878.2_Missense_Mutation_p.I1020V	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	1047	Autoinhibitory domain (AID).|Interaction with AXIN1. {ECO:0000250}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					TCCGTGGTGATGTGCTGCTGA	0.662																																					p.I1047V		.											.	HIPK2	785	0			c.A3139G						.						71.0	86.0	81.0					7																	139258131		2179	4268	6447	SO:0001583	missense	28996	exon15			TGGTGATGTGCTG	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.3139A>G	7.37:g.139258131T>C	ENSP00000385571:p.Ile1047Val	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	5.0	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	T	4.906	0.168331	0.09339	.	.	ENSG00000064393	ENST00000406875;ENST00000428878	T;T	0.47528	0.84;0.85	4.72	2.4	0.29515	.	.	.	.	.	T	0.27866	0.0686	.	.	.	0.33794	D	0.625789	B;B	0.15930	0.015;0.011	B;B	0.12156	0.007;0.003	T	0.29518	-1.0009	8	0.12766	T	0.61	.	8.401	0.32586	0.0:0.159:0.0:0.841	.	1047;1020	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	V	1047;1020	ENSP00000385571:I1047V;ENSP00000413724:I1020V	ENSP00000385571:I1047V	I	-	1	0	HIPK2	138908671	1.000000	0.71417	0.915000	0.36163	0.847000	0.48162	1.643000	0.37217	0.352000	0.24053	0.459000	0.35465	ATC	.		0.662	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
IFNA14	3448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21239523	21239523	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr9:21239523C>A	ENST00000380222.2	-	1	455	c.412G>T	c.(412-414)Gac>Tac	p.D138Y		NM_002172.2	NP_002163.2	P01570	IFN14_HUMAN	interferon, alpha 14	138					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)	11				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		AGGATGGAGTCCTCATTCATC	0.448																																					p.D138Y		.											.	IFNA14	68	0			c.G412T						.						205.0	208.0	207.0					9																	21239523		2203	4297	6500	SO:0001583	missense	3448	exon1			TGGAGTCCTCATT		CCDS6501.1	9p22	2010-08-24			ENSG00000228083	ENSG00000228083		"""Interferons"""	5420	protein-coding gene	gene with protein product		147579				1385305	Standard	NM_002172		Approved	LEIF2H, IFN-alphaH	uc010mis.3	P01570	OTTHUMG00000019665	ENST00000380222.2:c.412G>T	9.37:g.21239523C>A	ENSP00000369571:p.Asp138Tyr	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	18.0	NM_002172	Q5VZ56|Q7M4S1	Missense_Mutation	SNP	ENST00000380222.2	37	CCDS6501.1	.	.	.	.	.	.	.	.	.	.	-	13.87	2.366666	0.41902	.	.	ENSG00000228083	ENST00000380222	T	0.06608	3.28	3.38	0.263	0.15602	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.540907	0.17422	N	0.174794	T	0.23054	0.0557	M	0.91406	3.205	0.09310	N	1	D	0.57571	0.98	D	0.71414	0.973	T	0.06320	-1.0833	10	0.87932	D	0	.	3.0236	0.06084	0.181:0.5317:0.1769:0.1103	.	138	P01570	IFN14_HUMAN	Y	138	ENSP00000369571:D138Y	ENSP00000369571:D138Y	D	-	1	0	IFNA14	21229523	0.000000	0.05858	0.017000	0.16124	0.375000	0.29983	0.259000	0.18405	0.216000	0.20781	0.398000	0.26397	GAC	.		0.448	IFNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051894.1	NM_002172	
JAKMIP1	152789	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6087184	6087184	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr4:6087184G>C	ENST00000282924.5	-	4	1282	c.797C>G	c.(796-798)cCc>cGc	p.P266R	JAKMIP1_ENST00000457227.2_5'UTR|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.P266R|JAKMIP1_ENST00000409021.3_Missense_Mutation_p.P266R|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.P101R|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.P101R	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	266	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCCGATCCCGGGCGGGAGCTC	0.607																																					p.P266R		.											.	JAKMIP1	292	0			c.C797G						.						46.0	48.0	47.0					4																	6087184		2203	4300	6503	SO:0001583	missense	152789	exon4			ATCCCGGGCGGGA	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.797C>G	4.37:g.6087184G>C	ENSP00000282924:p.Pro266Arg	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	5.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	G	6.471	0.455156	0.12283	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	4.29	3.4	0.38934	.	0.317639	0.25798	N	0.028236	T	0.26412	0.0645	L	0.53249	1.67	0.09310	N	1	P;P;P;P;P	0.49559	0.514;0.773;0.514;0.514;0.925	B;B;B;B;B	0.42422	0.206;0.277;0.206;0.206;0.387	T	0.18116	-1.0347	10	0.35671	T	0.21	.	14.5602	0.68130	0.0:0.1604:0.8396:0.0	.	101;266;101;266;266	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	R	266;101;266;266;158;266;266;101	ENSP00000386711:P266R;ENSP00000387042:P101R;ENSP00000282924:P266R;ENSP00000386925:P266R;ENSP00000386745:P101R	ENSP00000282924:P266R	P	-	2	0	JAKMIP1	6138085	0.999000	0.42202	0.266000	0.24541	0.049000	0.14656	3.471000	0.53107	2.239000	0.73571	0.655000	0.94253	CCC	.		0.607	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
KIF24	347240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34310818	34310818	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr9:34310818T>C	ENST00000402558.2	-	1	551	c.527A>G	c.(526-528)tAc>tGc	p.Y176C	KIF24_ENST00000379166.2_Missense_Mutation_p.Y176C|KIF24_ENST00000345050.2_Missense_Mutation_p.Y176C|KIF24_ENST00000379174.3_Missense_Mutation_p.Y176C			Q5T7B8	KIF24_HUMAN	kinesin family member 24	176					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			TGCAGAAAGGTAATTTGGTGA	0.388																																					p.Y176C		.											.	KIF24	22	0			c.A527G						.						203.0	194.0	197.0					9																	34310818		1859	4101	5960	SO:0001583	missense	347240	exon2			GAAAGGTAATTTG	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.527A>G	9.37:g.34310818T>C	ENSP00000384433:p.Tyr176Cys	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	34.0	NM_194313	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	ENST00000402558.2	37	CCDS6551.2	.	.	.	.	.	.	.	.	.	.	T	10.59	1.392350	0.25118	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	T;T;T;T	0.71461	-0.36;-0.57;-0.36;-0.57	5.48	3.03	0.35002	.	0.859366	0.09781	N	0.756736	T	0.58552	0.2130	N	0.19112	0.55	0.09310	N	1	D;D	0.58970	0.984;0.973	P;B	0.46452	0.517;0.319	T	0.48833	-0.9000	10	0.72032	D	0.01	.	5.5086	0.16868	0.2587:0.0714:0.0:0.6698	.	176;176	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	C	176	ENSP00000384433:Y176C;ENSP00000368472:Y176C;ENSP00000368464:Y176C;ENSP00000340179:Y176C	ENSP00000340179:Y176C	Y	-	2	0	KIF24	34300818	0.953000	0.32496	0.988000	0.46212	0.110000	0.19582	1.345000	0.33953	0.333000	0.23563	0.528000	0.53228	TAC	.		0.388	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052150.5		
KRT14	3861	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39740122	39740122	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr17:39740122C>T	ENST00000167586.6	-	4	903	c.817G>A	c.(817-819)Gac>Aac	p.D273N		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	273	Linker 12.|Rod.		D -> G (in WC-EBS; dbSNP:rs59375065). {ECO:0000269|PubMed:9804357}.		aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				GGTGCAGCGTCCATCTCCACA	0.577																																					p.D273N		.											.	KRT14	91	0			c.G817A						.						147.0	121.0	130.0					17																	39740122		2203	4300	6503	SO:0001583	missense	3861	exon4			CAGCGTCCATCTC	BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.817G>A	17.37:g.39740122C>T	ENSP00000167586:p.Asp273Asn	Somatic	53.0	1.0		WXS	Illumina HiSeq	Phase_I	43.0	11.0	NM_000526	Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Missense_Mutation	SNP	ENST00000167586.6	37	CCDS11400.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901502	0.72754	.	.	ENSG00000186847	ENST00000167586	T	0.76709	-1.04	5.31	4.33	0.51752	Prefoldin (1);Filament (1);	0.000000	0.56097	D	0.000026	D	0.84019	0.5380	M	0.76433	2.335	0.48135	D	0.999595	D	0.55172	0.97	P	0.59012	0.85	D	0.84826	0.0799	10	0.59425	D	0.04	.	11.0963	0.48145	0.0:0.8595:0.0:0.1405	.	273	P02533	K1C14_HUMAN	N	273	ENSP00000167586:D273N	ENSP00000167586:D273N	D	-	1	0	KRT14	36993648	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	2.550000	0.45811	2.637000	0.89404	0.655000	0.94253	GAC	.		0.577	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257289.1	NM_000526	
LHCGR	3973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	48950602	48950602	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:48950602C>A	ENST00000294954.7	-	6	550	c.529G>T	c.(529-531)Gta>Tta	p.V177L	LHCGR_ENST00000401907.1_Missense_Mutation_p.V177L|LHCGR_ENST00000405626.1_Missense_Mutation_p.V177L|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_Missense_Mutation_p.V177L|LHCGR_ENST00000344775.3_Missense_Mutation_p.V177L	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	177					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CACAGTGTTACAGATTCATTA	0.383																																					p.V177L		.											.	LHCGR	589	0			c.G529T						.						114.0	104.0	108.0					2																	48950602		2203	4300	6503	SO:0001583	missense	3973	exon6			GTGTTACAGATTC		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.529G>T	2.37:g.48950602C>A	ENSP00000294954:p.Val177Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	11.0	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	C	8.709	0.911526	0.17833	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907;ENST00000428232	D;D;T;D;D;T	0.91843	-2.92;-2.92;-1.19;-2.92;-2.92;-1.19	5.62	-5.23	0.02798	.	0.688144	0.15640	N	0.251926	T	0.76877	0.4049	N	0.13003	0.285	0.18873	N	0.999983	B	0.06786	0.001	B	0.08055	0.003	T	0.65092	-0.6252	9	.	.	.	.	3.6028	0.08031	0.1807:0.4397:0.1135:0.2661	.	177	P22888	LSHR_HUMAN	L	177;177;177;177;177;143	ENSP00000344301:V177L;ENSP00000294954:V177L;ENSP00000386033:V177L;ENSP00000385847:V177L;ENSP00000385406:V177L;ENSP00000403748:V143L	.	V	-	1	0	LHCGR	48804106	0.000000	0.05858	0.978000	0.43139	0.948000	0.59901	-1.301000	0.02749	-0.364000	0.08088	-1.124000	0.02001	GTA	.		0.383	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
LMOD2	442721	broad.mit.edu;bcgsc.ca	37	7	123303229	123303229	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr7:123303229G>A	ENST00000458573.2	+	2	1746	c.1589G>A	c.(1588-1590)cGg>cAg	p.R530Q	LMOD2_ENST00000456238.2_Missense_Mutation_p.R137Q	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	530	WH2. {ECO:0000255|PROSITE- ProRule:PRU00406}.					cytoskeleton (GO:0005856)											GAAGCAATTCGGGGAAGCAGC	0.453																																					p.R530Q		.											.	LMOD2	68	0			c.G1589A						.						19.0	17.0	18.0					7																	123303229		1886	4111	5997	SO:0001583	missense	442721	exon2			CAATTCGGGGAAG	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.1589G>A	7.37:g.123303229G>A	ENSP00000411932:p.Arg530Gln	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	7.0	NM_207163	A4D0W9|A4D0Y2|Q8WVJ8	Missense_Mutation	SNP	ENST00000458573.2	37	CCDS47693.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008537	0.75046	.	.	ENSG00000170807	ENST00000458573;ENST00000444702;ENST00000332074;ENST00000456238	T;T	0.45668	0.89;0.89	5.39	5.39	0.77823	Actin-binding WH2 (1);	.	.	.	.	T	0.49592	0.1566	M	0.68593	2.085	0.22903	N	0.99858	D	0.63880	0.993	P	0.47786	0.557	T	0.51779	-0.8662	9	0.87932	D	0	.	12.8155	0.57663	0.0753:0.0:0.9247:0.0	.	530	Q6P5Q4	LMOD2_HUMAN	Q	530;490;481;137	ENSP00000411932:R530Q;ENSP00000398975:R137Q	ENSP00000405123:R481Q	R	+	2	0	LMOD2	123090465	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	6.519000	0.73768	2.692000	0.91855	0.655000	0.94253	CGG	.		0.453	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1		
LRRC6	23639	ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133584681	133584681	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr8:133584681A>G	ENST00000519595.1	-	12	1372	c.1274T>C	c.(1273-1275)tTc>tCc	p.F425S	LRRC6_ENST00000518642.1_3'UTR|LRRC6_ENST00000250173.1_Missense_Mutation_p.F425S			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	425					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			CACATCAGGGAATGAGTGCTT	0.378																																					p.F425S		.											.	LRRC6	92	0			c.T1274C						.						267.0	244.0	252.0					8																	133584681		2203	4300	6503	SO:0001583	missense	23639	exon12			TCAGGGAATGAGT	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.1274T>C	8.37:g.133584681A>G	ENSP00000429791:p.Phe425Ser	Somatic	254.0	2.0		WXS	Illumina HiSeq	.	357.0	49.0	NM_012472	Q13648|Q4G183	Missense_Mutation	SNP	ENST00000519595.1	37		.	.	.	.	.	.	.	.	.	.	A	9.626	1.135233	0.21123	.	.	ENSG00000129295	ENST00000519595;ENST00000522789;ENST00000250173	T;T;T	0.48836	0.8;0.95;0.8	5.5	1.06	0.20224	.	0.545047	0.20378	N	0.093520	T	0.31544	0.0800	L	0.50333	1.59	0.23896	N	0.996534	B	0.32302	0.363	B	0.25291	0.059	T	0.10683	-1.0619	10	0.21540	T	0.41	-5.3525	4.9774	0.14148	0.4934:0.2221:0.0:0.2846	.	425	Q86X45	LRRC6_HUMAN	S	425;165;425	ENSP00000429791:F425S;ENSP00000428015:F165S;ENSP00000250173:F425S	ENSP00000250173:F425S	F	-	2	0	LRRC6	133653863	0.997000	0.39634	0.604000	0.28916	0.567000	0.35839	0.965000	0.29319	0.337000	0.23665	0.533000	0.62120	TTC	.		0.378	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472	
MAD2L2	10459	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11736162	11736162	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr1:11736162A>T	ENST00000235310.3	-	8	1296	c.368T>A	c.(367-369)cTc>cAc	p.L123H	MAD2L2_ENST00000376669.5_Missense_Mutation_p.L136H|MAD2L2_ENST00000376672.1_Missense_Mutation_p.L136H|MAD2L2_ENST00000376667.3_Missense_Mutation_p.L123H|MAD2L2_ENST00000376692.4_Missense_Mutation_p.L123H			Q9UI95	MD2L2_HUMAN	MAD2 mitotic arrest deficient-like 2 (yeast)	123	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.|Mediates interaction with REV1 and REV3L and homodimerization.				actin filament organization (GO:0007015)|DNA damage response, signal transduction resulting in transcription (GO:0042772)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|zeta DNA polymerase complex (GO:0016035)	JUN kinase binding (GO:0008432)|RNA polymerase II activating transcription factor binding (GO:0001102)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGGCCCGGAGCAGCTGCTC	0.607								DNA polymerases (catalytic subunits)																													p.L123H		.											.	MAD2L2	659	0			c.T368A						.						77.0	69.0	71.0					1																	11736162		2203	4300	6503	SO:0001583	missense	10459	exon6			GCCCGGAGCAGCT	AF139365	CCDS134.1	1p36	2013-01-17	2001-11-28		ENSG00000116670	ENSG00000116670		"""DNA polymerases"""	6764	protein-coding gene	gene with protein product	"""mitotic arrest deficient homolog-like 2"", ""polymerase (DNA-directed), zeta 2, accessory subunit"""	604094	"""MAD2 (mitotic arrest deficient, yeast, homolog)-like 2"""			10366450	Standard	NM_006341		Approved	MAD2B, REV7, POLZ2	uc009vnc.3	Q9UI95	OTTHUMG00000002231	ENST00000235310.3:c.368T>A	1.37:g.11736162A>T	ENSP00000235310:p.Leu123His	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	5.0	NM_006341	B3KNE3|Q5TGW7|Q9UNA7|Q9Y6I6	Missense_Mutation	SNP	ENST00000235310.3	37	CCDS134.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.696031	0.88830	.	.	ENSG00000116670	ENST00000376692;ENST00000235310;ENST00000376672;ENST00000376669;ENST00000376667;ENST00000376664;ENST00000445656;ENST00000456915	.	.	.	5.27	5.27	0.74061	DNA-binding HORMA (4);	0.000000	0.85682	D	0.000000	T	0.80757	0.4684	M	0.86097	2.795	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84223	0.0462	9	0.87932	D	0	-17.252	14.0213	0.64558	1.0:0.0:0.0:0.0	.	123	Q9UI95	MD2L2_HUMAN	H	123;123;136;136;123;99;153;123	.	ENSP00000235310:L123H	L	-	2	0	MAD2L2	11658749	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.669000	0.91163	1.993000	0.58246	0.460000	0.39030	CTC	.		0.607	MAD2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006344.2	NM_006341	
MFAP3	4238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	153429404	153429404	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr5:153429404A>G	ENST00000436816.1	+	2	341	c.122A>G	c.(121-123)aAt>aGt	p.N41S	MFAP3_ENST00000322602.5_Missense_Mutation_p.N41S|MFAP3_ENST00000439768.2_Intron	NM_001242336.1|NM_005927.4	NP_001229265.1|NP_005918.1	P55082	MFAP3_HUMAN	microfibrillar-associated protein 3	41					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)	7	Renal(175;0.00488)	Lung NSC(249;0.00145)|all_lung(500;0.00226)|all_neural(177;0.122)|Breast(839;0.14)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;9.69e-06)|GBM - Glioblastoma multiforme(465;0.0201)		AGTTCTTACAATGCATCCTTT	0.423																																					p.N41S		.											.	MFAP3	90	0			c.A122G						.						107.0	95.0	99.0					5																	153429404		2203	4300	6503	SO:0001583	missense	4238	exon2			CTTACAATGCATC		CCDS4324.1, CCDS47319.1	5q32-q33.2	2013-01-11			ENSG00000037749	ENSG00000037749		"""Immunoglobulin superfamily / I-set domain containing"""	7034	protein-coding gene	gene with protein product		600491				7782085	Standard	NM_005927		Approved		uc010jib.2	P55082	OTTHUMG00000130149	ENST00000436816.1:c.122A>G	5.37:g.153429404A>G	ENSP00000409933:p.Asn41Ser	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	21.0	NM_005927	B2RDK0|B4DKA1|Q9NXA7	Missense_Mutation	SNP	ENST00000436816.1	37	CCDS4324.1	.	.	.	.	.	.	.	.	.	.	A	18.77	3.694667	0.68386	.	.	ENSG00000037749	ENST00000522782;ENST00000436816;ENST00000322602;ENST00000522177	T;T	0.19250	2.16;2.16	5.8	5.8	0.92144	.	0.350970	0.33092	N	0.005295	T	0.18593	0.0446	L	0.29908	0.895	0.42581	D	0.993218	B	0.26876	0.162	B	0.21917	0.037	T	0.02498	-1.1150	10	0.62326	D	0.03	-28.0662	16.1512	0.81624	1.0:0.0:0.0:0.0	.	41	P55082	MFAP3_HUMAN	S	41	ENSP00000409933:N41S;ENSP00000322956:N41S	ENSP00000322956:N41S	N	+	2	0	MFAP3	153409597	0.998000	0.40836	0.811000	0.32455	0.919000	0.55068	2.503000	0.45407	2.222000	0.72286	0.533000	0.62120	AAT	.		0.423	MFAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252457.2	NM_005927	
MICU1	10367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	74326487	74326487	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr10:74326487C>A	ENST00000361114.5	-	2	161	c.65G>T	c.(64-66)gGa>gTa	p.G22V	MICU1_ENST00000401998.3_Missense_Mutation_p.G22V|MICU1_ENST00000604025.1_5'UTR|MICU1_ENST00000398761.4_Missense_Mutation_p.G22V	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	22					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										CTGTGATCCTCCATGGTACCA	0.483																																					p.G22V		.											.	.	.	0			c.G65T						.						71.0	71.0	71.0					10																	74326487		1950	4164	6114	SO:0001583	missense	10367	exon2			GATCCTCCATGGT	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.65G>T	10.37:g.74326487C>A	ENSP00000354415:p.Gly22Val	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	17.0	NM_001195518	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Missense_Mutation	SNP	ENST00000361114.5	37	CCDS55715.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779263	0.90195	.	.	ENSG00000107745	ENST00000361114;ENST00000398761;ENST00000401998	D;D;D	0.81908	-1.54;-1.55;-1.54	5.91	5.91	0.95273	.	0.115517	0.64402	D	0.000011	T	0.80166	0.4573	L	0.48642	1.525	0.80722	D	1	P	0.36222	0.544	B	0.33339	0.162	T	0.81252	-0.1017	10	0.87932	D	0	.	19.0678	0.93119	0.0:1.0:0.0:0.0	.	22	Q9BPX6	MICU1_HUMAN	V	22	ENSP00000354415:G22V;ENSP00000381745:G22V;ENSP00000384068:G22V	ENSP00000354415:G22V	G	-	2	0	MICU1	73996493	0.994000	0.37717	1.000000	0.80357	0.989000	0.77384	3.430000	0.52807	2.813000	0.96785	0.655000	0.94253	GGA	.		0.483	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
MIRLET7BHG	400931	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46501301	46501301	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr22:46501301G>A	ENST00000381051.2	+	5	273	c.220G>A	c.(220-222)Gtc>Atc	p.V74I	FLJ27365_ENST00000360737.3_Intron																							GTCGACGCAGGTCCTCTGGGC	0.612																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	400931	.			ACGCAGGTCCTCT																												ENST00000381051.2:c.220G>A	22.37:g.46501301G>A	ENSP00000370439:p.Val74Ile	Somatic	131.0	1.0		WXS	Illumina HiSeq	Phase_I	56.0	9.0	.		RNA	SNP	ENST00000381051.2	37		.	.	.	.	.	.	.	.	.	.	G	6.815	0.519447	0.13005	.	.	ENSG00000197182	ENST00000381051	.	.	.	2.51	-5.0	0.03001	.	.	.	.	.	T	0.19967	0.0480	.	.	.	.	.	.	B	0.20988	0.05	B	0.17979	0.02	T	0.28713	-1.0035	6	0.87932	D	0	.	0.4885	0.00560	0.3539:0.2821:0.1676:0.1964	.	74	B1AKH7	.	I	74	.	ENSP00000370439:V74I	V	+	1	0	MIRLET7BHG	44879965	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.616000	0.02053	-1.346000	0.02211	0.561000	0.74099	GTC	.		0.612	FLJ27365-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316783.1		
N4BP1	9683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	48595832	48595832	+	Missense_Mutation	SNP	C	C	A	rs374516858		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr16:48595832C>A	ENST00000262384.3	-	2	958	c.722G>T	c.(721-723)gGg>gTg	p.G241V	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	241					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				AACAGGAGTCCCAGCTTTATT	0.413																																					p.G241V		.											.	N4BP1	22	0			c.G722T						.						75.0	72.0	73.0					16																	48595832		1871	4083	5954	SO:0001583	missense	9683	exon2			GGAGTCCCAGCTT	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.722G>T	16.37:g.48595832C>A	ENSP00000262384:p.Gly241Val	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	24.0	NM_153029	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	37	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017658	0.75161	.	.	ENSG00000102921	ENST00000262384	T	0.52526	0.66	5.61	5.61	0.85477	.	0.388030	0.26871	N	0.022074	T	0.56499	0.1989	L	0.29908	0.895	0.58432	D	0.999999	D	0.69078	0.997	P	0.59643	0.861	T	0.59637	-0.7417	10	0.87932	D	0	-6.7919	19.6397	0.95753	0.0:1.0:0.0:0.0	.	241	O75113	N4BP1_HUMAN	V	241	ENSP00000262384:G241V	ENSP00000262384:G241V	G	-	2	0	N4BP1	47153333	0.756000	0.28383	0.997000	0.53966	0.959000	0.62525	4.141000	0.58038	2.632000	0.89209	0.655000	0.94253	GGG	.		0.413	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
NCOA1	8648	broad.mit.edu;mdanderson.org	37	2	24962370	24962370	+	Silent	SNP	A	A	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:24962370A>C	ENST00000406961.1	+	18	3923	c.3271A>C	c.(3271-3273)Aga>Cga	p.R1091R	NCOA1_ENST00000395856.3_Silent_p.R1091R|NCOA1_ENST00000538539.1_Silent_p.R1091R|NCOA1_ENST00000348332.3_Silent_p.R1091R|NCOA1_ENST00000288599.5_Silent_p.R1091R|NCOA1_ENST00000405141.1_Silent_p.R1091R|NCOA1_ENST00000407230.1_Silent_p.R940R			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1091	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCAATATGAGATCAGGCAT	0.373			T	PAX3	alveolar rhadomyosarcoma																																p.R1091R		.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1	228	0			c.A3271C						.						133.0	121.0	125.0					2																	24962370		2203	4300	6503	SO:0001819	synonymous_variant	8648	exon16			AATATGAGATCAG	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.3271A>C	2.37:g.24962370A>C		Somatic	43.0	2.0		WXS	Illumina HiSeq	Phase_I	52.0	8.0	NM_147223	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	37	CCDS1712.1																																																																																			.		0.373	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
NDRG2	57447	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	21486186	21486186	+	Silent	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr14:21486186C>T	ENST00000556147.1	-	15	1849	c.909G>A	c.(907-909)ctG>ctA	p.L303L	NDRG2_ENST00000397844.2_Silent_p.L273L|NDRG2_ENST00000554277.1_5'Flank|NDRG2_ENST00000553503.1_Silent_p.L289L|NDRG2_ENST00000554143.1_Silent_p.L289L|NDRG2_ENST00000360463.3_Silent_p.L289L|NDRG2_ENST00000298687.5_Silent_p.L303L|NDRG2_ENST00000555158.1_Silent_p.L289L|NDRG2_ENST00000397856.3_Silent_p.L273L|NDRG2_ENST00000397851.2_Silent_p.L303L|NDRG2_ENST00000350792.3_Silent_p.L289L|NDRG2_ENST00000298684.5_Silent_p.L260L|NDRG2_ENST00000554104.1_Silent_p.L216L|NDRG2_ENST00000397847.2_Silent_p.L292L|NDRG2_ENST00000403829.3_Silent_p.L299L|NDRG2_ENST00000397853.3_Silent_p.L303L|NDRG2_ENST00000397858.1_Silent_p.L303L|NDRG2_ENST00000397855.3_Silent_p.L260L			Q9UN36	NDRG2_HUMAN	NDRG family member 2	303					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		AGGCCTCGGTCAGCTTGCCTG	0.592																																					p.L303L		.											.	NDRG2	154	0			c.G909A						.						182.0	172.0	175.0					14																	21486186		2203	4300	6503	SO:0001819	synonymous_variant	57447	exon15			CTCGGTCAGCTTG	AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.909G>A	14.37:g.21486186C>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	15.0	NM_201537	B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Silent	SNP	ENST00000556147.1	37	CCDS9565.1																																																																																			.		0.592	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411717.1		
NMD3	51068	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	160960387	160960387	+	Silent	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr3:160960387C>T	ENST00000460469.1	+	10	1418	c.963C>T	c.(961-963)tgC>tgT	p.C321C	NMD3_ENST00000472947.1_Silent_p.C321C|NMD3_ENST00000351193.2_Silent_p.C321C			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	321					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			TGATGGAATGCAGCATAGTCC	0.403																																					p.C321C		.											.	NMD3	91	0			c.C963T						.						99.0	94.0	95.0					3																	160960387		2203	4300	6503	SO:0001819	synonymous_variant	51068	exon11			GGAATGCAGCATA	BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.963C>T	3.37:g.160960387C>T		Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	52.0	9.0	NM_015938	D3DNM7|Q9Y2Z6	Silent	SNP	ENST00000460469.1	37	CCDS3194.1																																																																																			.		0.403	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353114.1	NM_015938	
NR1D1	9572	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	38252734	38252734	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr17:38252734C>T	ENST00000246672.3	-	4	1196	c.566G>A	c.(565-567)cGc>cAc	p.R189H		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	189	Crucial for activation of GJA1. {ECO:0000250}.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					CTTCTTGAAGCGACATTGCTG	0.522																																					p.R189H		.											.	NR1D1	226	0			c.G566A						.						118.0	104.0	109.0					17																	38252734		2203	4300	6503	SO:0001583	missense	9572	exon4			TTGAAGCGACATT	X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.566G>A	17.37:g.38252734C>T	ENSP00000246672:p.Arg189His	Somatic	61.0	1.0		WXS	Illumina HiSeq	Phase_I	45.0	12.0	NM_021724	Q0P5Z4|Q15304	Missense_Mutation	SNP	ENST00000246672.3	37	CCDS11361.1	.	.	.	.	.	.	.	.	.	.	C	33	5.209532	0.95069	.	.	ENSG00000126368	ENST00000246672	D	0.98585	-5.01	4.41	4.41	0.53225	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (4);	0.154623	0.43260	D	0.000582	D	0.99474	0.9813	H	0.99435	4.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97713	1.0192	10	0.87932	D	0	.	16.3353	0.83059	0.0:1.0:0.0:0.0	.	189	P20393	NR1D1_HUMAN	H	189	ENSP00000246672:R189H	ENSP00000246672:R189H	R	-	2	0	NR1D1	35506260	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.553000	0.82203	2.451000	0.82905	0.306000	0.20318	CGC	.		0.522	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257135.1		
OR2F1	26211	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143657370	143657370	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr7:143657370T>C	ENST00000392899.1	+	1	344	c.307T>C	c.(307-309)Ttc>Ctc	p.F103L	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	103					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					CCAGTTATTTTTCTCCCTGGC	0.527																																					p.F103L		.											.	OR2F1	71	0			c.T307C						.						158.0	144.0	149.0					7																	143657370		2203	4300	6503	SO:0001583	missense	26211	exon1			TTATTTTTCTCCC	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.307T>C	7.37:g.143657370T>C	ENSP00000376633:p.Phe103Leu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	17.0	NM_012369	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	37	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	T	8.542	0.873541	0.17322	.	.	ENSG00000213215	ENST00000392899	T	0.00495	6.99	5.41	1.62	0.23740	GPCR, rhodopsin-like superfamily (1);	0.111768	0.40908	N	0.000987	T	0.00271	0.0008	N	0.12853	0.265	0.32041	N	0.598204	B	0.12630	0.006	B	0.10450	0.005	T	0.19451	-1.0305	10	0.15952	T	0.53	-43.3321	5.7545	0.18164	0.2791:0.0:0.2897:0.4313	.	103	Q13607	OR2F1_HUMAN	L	103	ENSP00000376633:F103L	ENSP00000376633:F103L	F	+	1	0	OR2F1	143288303	0.000000	0.05858	0.987000	0.45799	0.857000	0.48899	0.123000	0.15708	0.115000	0.18071	0.533000	0.62120	TTC	.		0.527	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
PCDHB5	26167	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	5	140516880	140516880	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr5:140516880G>C	ENST00000231134.5	+	1	2081	c.1864G>C	c.(1864-1866)Gag>Cag	p.E622Q		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	622	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACAATGGCGAGGTGCGCAC	0.706																																					p.E622Q		.											.	PCDHB5	95	0			c.G1864C						.						44.0	46.0	45.0					5																	140516880		2155	4208	6363	SO:0001583	missense	26167	exon1			AATGGCGAGGTGC	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.1864G>C	5.37:g.140516880G>C	ENSP00000231134:p.Glu622Gln	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	4.0	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650117	0.67472	.	.	ENSG00000113209	ENST00000231134	T	0.53423	0.62	4.65	4.65	0.58169	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70954	0.3283	M	0.84156	2.68	0.36717	D	0.880998	D	0.65815	0.995	D	0.68039	0.955	T	0.80763	-0.1237	9	0.87932	D	0	.	17.92	0.88963	0.0:0.0:1.0:0.0	.	622	Q9Y5E4	PCDB5_HUMAN	Q	622	ENSP00000231134:E622Q	ENSP00000231134:E622Q	E	+	1	0	PCDHB5	140497064	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.522000	0.53480	2.301000	0.77427	0.430000	0.28490	GAG	.		0.706	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCF11	51585	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	82879585	82879585	+	Silent	SNP	G	G	A	rs149809762	byFrequency	TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr11:82879585G>A	ENST00000298281.4	+	8	2660	c.2208G>A	c.(2206-2208)ctG>ctA	p.L736L		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	736	Gly-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TCGCCGGCCTGGATACAAATC	0.433													G|||	6	0.00119808	0.0	0.0	5008	,	,		18468	0.006		0.0	False		,,,				2504	0.0				p.L736L		.											.	PCF11	23	0			c.G2208A						.						107.0	105.0	106.0					11																	82879585		1885	4116	6001	SO:0001819	synonymous_variant	51585	exon8			CGGCCTGGATACA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.2208G>A	11.37:g.82879585G>A		Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	13.0	NM_015885	A6H8W7|O43671|Q6P0X8	Silent	SNP	ENST00000298281.4	37	CCDS44689.1																																																																																			G|0.998;A|0.002		0.433	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
PGBD2	267002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	249211312	249211312	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr1:249211312C>T	ENST00000329291.5	+	3	676	c.529C>T	c.(529-531)Cag>Tag	p.Q177*	PGBD2_ENST00000355360.4_Intron|PGBD2_ENST00000539153.1_Nonsense_Mutation_p.Q174*|PGBD2_ENST00000462488.1_Intron	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	177										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCTTACGGCTCAGGAATTGAA	0.368																																					p.Q177X		.											.	PGBD2	91	0			c.C529T						.						146.0	150.0	149.0					1																	249211312		2203	4300	6503	SO:0001587	stop_gained	267002	exon3			ACGGCTCAGGAAT	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.529C>T	1.37:g.249211312C>T	ENSP00000331643:p.Gln177*	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	12.0	NM_170725	B3KVR8|Q6MZF8	Nonsense_Mutation	SNP	ENST00000329291.5	37	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322177	0.81580	.	.	ENSG00000185220	ENST00000329291;ENST00000539153	.	.	.	4.04	4.04	0.47022	.	0.000000	0.33792	N	0.004560	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-13.8225	11.9052	0.52708	0.0:1.0:0.0:0.0	.	.	.	.	X	177;174	.	ENSP00000331643:Q177X	Q	+	1	0	PGBD2	247177935	0.739000	0.28196	0.939000	0.37840	0.528000	0.34623	0.864000	0.27926	2.243000	0.73865	0.655000	0.94253	CAG	.		0.368	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
PIGZ	80235	bcgsc.ca;mdanderson.org	37	3	196674072	196674072	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr3:196674072C>A	ENST00000412723.1	-	3	1842	c.1696G>T	c.(1696-1698)Gac>Tac	p.D566Y		NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	566					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		CTGAGGTGGTCCCTCCAAGCC	0.547																																					p.D566Y		.											.	PIGZ	93	0			c.G1696T						.						73.0	77.0	76.0					3																	196674072		2203	4300	6503	SO:0001583	missense	80235	exon3			GGTGGTCCCTCCA	BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.1696G>T	3.37:g.196674072C>A	ENSP00000413405:p.Asp566Tyr	Somatic	28.0	1.0		WXS	Illumina HiSeq	Phase_1	13.0	7.0	NM_025163	Q9H9G6	Missense_Mutation	SNP	ENST00000412723.1	37	CCDS3324.1	.	.	.	.	.	.	.	.	.	.	C	13.14	2.149575	0.37923	.	.	ENSG00000119227	ENST00000412723	T	0.12569	2.67	5.11	2.24	0.28232	.	0.643785	0.14362	N	0.324360	T	0.07638	0.0192	N	0.19112	0.55	0.80722	D	1	B	0.17465	0.022	B	0.12837	0.008	T	0.22347	-1.0219	10	0.48119	T	0.1	-5.5413	3.2152	0.06696	0.1848:0.5026:0.0:0.3126	.	566	Q86VD9	PIGZ_HUMAN	Y	566	ENSP00000413405:D566Y	ENSP00000413405:D566Y	D	-	1	0	PIGZ	198158469	0.907000	0.30839	1.000000	0.80357	0.987000	0.75469	0.249000	0.18216	0.638000	0.30545	0.456000	0.33151	GAC	.		0.547	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163	
YPEL1	29799	broad.mit.edu;ucsc.edu;mdanderson.org	37	22	22049306	22049306	+	IGR	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr22:22049306G>A	ENST00000339468.3	-	0	4329				PPIL2_ENST00000492445.2_Silent_p.Q471Q|PPIL2_ENST00000446951.1_3'UTR|PPIL2_ENST00000406385.1_Silent_p.Q471Q|PPIL2_ENST00000335025.8_Silent_p.Q471Q|PPIL2_ENST00000398831.3_Silent_p.Q471Q|PPIL2_ENST00000456792.2_Intron|PPIL2_ENST00000412327.1_Silent_p.Q471Q	NM_013313.3	NP_037445.1	O60688	YPEL1_HUMAN	yippee-like 1 (Drosophila)							nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(1)	3	Colorectal(54;0.105)					CAGGGAGCCAGGGCCCCCAGA	0.647																																					p.Q471Q		.											.	PPIL2	92	0			c.G1413A						.						40.0	49.0	46.0					22																	22049306		2203	4300	6503	SO:0001628	intergenic_variant	23759	exon19			GAGCCAGGGCCCC	AF060862	CCDS13794.1	22q11.2	2008-02-04	2001-11-28		ENSG00000100027	ENSG00000100027			12845	protein-coding gene	gene with protein product		608082	"""yippee (Drosophila) homolog-like 1"""			11473580	Standard	NM_013313		Approved		uc002zvl.3	O60688	OTTHUMG00000150830		22.37:g.22049306G>A		Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	10.0	6.0	NM_014337	Q65ZA1|Q6GLI6	Silent	SNP	ENST00000339468.3	37	CCDS13794.1																																																																																			.		0.647	YPEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320245.1	NM_013313	
PRDM2	7799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	14105806	14105806	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr1:14105806C>T	ENST00000235372.7	+	8	2372	c.1516C>T	c.(1516-1518)Cac>Tac	p.H506Y	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.H305Y|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.H506Y|PRDM2_ENST00000343137.4_Missense_Mutation_p.H305Y	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GCGTAGAGTTCACGAACGTCA	0.478																																					p.H506Y		.											.	PRDM2	116	0			c.C1516T						.						43.0	43.0	43.0					1																	14105806		2203	4300	6503	SO:0001583	missense	7799	exon8			AGAGTTCACGAAC	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.1516C>T	1.37:g.14105806C>T	ENSP00000235372:p.His506Tyr	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	13.0	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	37	CCDS150.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.158860	0.57368	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05	5.62	5.62	0.85841	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	D	0.89086	0.6615	L	0.34521	1.04	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.90131	0.4206	10	0.87932	D	0	.	18.2252	0.89915	0.0:1.0:0.0:0.0	.	506;364;506;506	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	Y	506;506;506;305;305	ENSP00000235372:H506Y;ENSP00000312352:H506Y;ENSP00000411103:H305Y;ENSP00000341621:H305Y	ENSP00000235372:H506Y	H	+	1	0	PRDM2	13978393	1.000000	0.71417	0.113000	0.21522	0.980000	0.70556	7.487000	0.81328	2.633000	0.89246	0.655000	0.94253	CAC	.		0.478	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PSD4	23550	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113955466	113955466	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:113955466G>T	ENST00000245796.6	+	14	2795	c.2600G>T	c.(2599-2601)tGg>tTg	p.W867L	PSD4_ENST00000441564.3_Missense_Mutation_p.W838L	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	867	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACGGCTGACTGGCGCCTCTAC	0.652																																					p.W867L		.											.	PSD4	229	0			c.G2600T						.						26.0	25.0	25.0					2																	113955466		2203	4300	6503	SO:0001583	missense	23550	exon14			CTGACTGGCGCCT	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.2600G>T	2.37:g.113955466G>T	ENSP00000245796:p.Trp867Leu	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	7.0	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012476	0.75161	.	.	ENSG00000125637	ENST00000245796;ENST00000441564;ENST00000409378	T;T;T	0.78595	-1.19;-1.19;1.6	5.06	5.06	0.68205	Pleckstrin homology-type (1);Pleckstrin homology domain, spectrin-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.82079	0.4959	M	0.72118	2.19	0.51012	D	0.999908	B;B;B;B	0.32302	0.161;0.363;0.313;0.363	B;B;B;B	0.42386	0.292;0.386;0.138;0.217	D	0.83805	0.0238	10	0.87932	D	0	.	15.9174	0.79531	0.0:0.0:1.0:0.0	.	97;524;838;867	B4DFU9;Q59HG0;Q8NDX1-2;Q8NDX1	.;.;.;PSD4_HUMAN	L	867;838;80	ENSP00000245796:W867L;ENSP00000413997:W838L;ENSP00000386606:W80L	ENSP00000245796:W867L	W	+	2	0	PSD4	113671937	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.049000	0.93837	2.351000	0.79841	0.462000	0.41574	TGG	.		0.652	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
PTGR1	22949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	114348335	114348335	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr9:114348335G>A	ENST00000407693.2	-	5	582	c.320C>T	c.(319-321)aCa>aTa	p.T107I	PTGR1_ENST00000238248.3_5'UTR|PTGR1_ENST00000309195.5_Missense_Mutation_p.T107I|PTGR1_ENST00000538962.1_Missense_Mutation_p.T107I	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	107					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						TGGCCACTCTGTCAGCAGCTT	0.463																																					p.T107I	Ovarian(200;132 2151 7551 19220 46064)	.											.	PTGR1	90	0			c.C320T						.						138.0	109.0	119.0					9																	114348335		2203	4300	6503	SO:0001583	missense	22949	exon5			CACTCTGTCAGCA	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.320C>T	9.37:g.114348335G>A	ENSP00000385763:p.Thr107Ile	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	18.0	NM_001146108	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Missense_Mutation	SNP	ENST00000407693.2	37	CCDS6779.1	.	.	.	.	.	.	.	.	.	.	G	9.614	1.132170	0.21041	.	.	ENSG00000106853	ENST00000538962;ENST00000309195;ENST00000407693;ENST00000333580;ENST00000422125	T;T;T;T	0.51817	0.69;0.69;0.69;0.85	4.74	0.169	0.15017	GroES-like (1);	1.008970	0.07932	N	0.977675	T	0.39545	0.1082	L	0.46819	1.47	0.09310	N	0.999995	B;B;B	0.18741	0.03;0.001;0.029	B;B;B	0.17722	0.019;0.003;0.01	T	0.34428	-0.9829	10	0.37606	T	0.19	-8.3056	8.3144	0.32091	0.0759:0.0:0.5129:0.4113	.	107;107;107	F5GY50;B4DPK3;Q14914	.;.;PTGR1_HUMAN	I	107;107;107;88;88	ENSP00000440281:T107I;ENSP00000311572:T107I;ENSP00000385763:T107I;ENSP00000395965:T88I	ENSP00000311572:T107I	T	-	2	0	PTGR1	113388156	0.005000	0.15991	0.003000	0.11579	0.909000	0.53808	1.506000	0.35747	0.211000	0.20683	-0.310000	0.09108	ACA	.		0.463	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
PXDN	7837	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1638057	1638057	+	Silent	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:1638057A>G	ENST00000252804.4	-	23	4409	c.4359T>C	c.(4357-4359)ccT>ccC	p.P1453P		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1453	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CACAGGTGGCAGGGGGGCAAG	0.627																																					p.P1453P		.											.	PXDN	166	0			c.T4359C						.						20.0	24.0	23.0					2																	1638057		2046	4188	6234	SO:0001819	synonymous_variant	7837	exon23			GGTGGCAGGGGGG	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.4359T>C	2.37:g.1638057A>G		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	7.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1																																																																																			.		0.627	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
RARG	5916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53609161	53609161	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr12:53609161T>C	ENST00000425354.2	-	5	878	c.391A>G	c.(391-393)Aac>Gac	p.N131D	RARG_ENST00000543762.1_5'UTR|RARG_ENST00000543726.1_Missense_Mutation_p.N109D|RARG_ENST00000338561.5_Missense_Mutation_p.N120D|RARG_ENST00000327550.3_Missense_Mutation_p.N59D|RARG_ENST00000394426.1_Missense_Mutation_p.N131D	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	131					anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	ATGATACAGTTTTTGTCGCGG	0.527																																					p.N131D		.											.	RARG	722	0			c.A391G						.						257.0	199.0	219.0					12																	53609161		2203	4300	6503	SO:0001583	missense	5916	exon5			TACAGTTTTTGTC	M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.391A>G	12.37:g.53609161T>C	ENSP00000388510:p.Asn131Asp	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	6.0	NM_000966	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	ENST00000425354.2	37	CCDS8850.1	.	.	.	.	.	.	.	.	.	.	T	17.35	3.367774	0.61513	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000327550;ENST00000338561;ENST00000543726;ENST00000550265	D;D;D;D;D	0.97066	-4.0;-4.0;-4.0;-4.0;-4.23	4.43	4.43	0.53597	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.95875	0.8657	N	0.20881	0.62	0.80722	D	1	P;D;D;P	0.67145	0.928;0.992;0.996;0.755	P;P;D;P	0.67382	0.775;0.906;0.951;0.809	D	0.93560	0.6894	10	0.13853	T	0.58	.	13.1019	0.59224	0.0:0.0:0.0:1.0	.	168;109;131;120	F8VR45;B7Z4F1;P13631;F1D8P1	.;.;RARG_HUMAN;.	D	131;131;59;120;109;168	ENSP00000388510:N131D;ENSP00000377947:N131D;ENSP00000332695:N59D;ENSP00000343698:N120D;ENSP00000444335:N109D	ENSP00000332695:N59D	N	-	1	0	RARG	51895428	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.798000	0.85924	1.992000	0.58205	0.472000	0.43445	AAC	.		0.527	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109404.2	NM_000966	
RNF43	54894	ucsc.edu;mdanderson.org	37	17	56437569	56437569	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr17:56437569C>T	ENST00000584437.1	-	7	2848	c.893G>A	c.(892-894)tGt>tAt	p.C298Y	RNF43_ENST00000577716.1_Missense_Mutation_p.C298Y|RNF43_ENST00000407977.2_Missense_Mutation_p.C298Y|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577625.1_Missense_Mutation_p.C171Y|RNF43_ENST00000500597.2_Missense_Mutation_p.C257Y|RNF43_ENST00000581868.1_Missense_Mutation_p.C171Y|RNF43_ENST00000583753.1_Missense_Mutation_p.C257Y			Q68DV7	RNF43_HUMAN	ring finger protein 43	298					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGGGTCCACACAGTTACGATG	0.542																																					p.C298Y		.											.	RNF43	92	0			c.G893A						.						139.0	113.0	122.0					17																	56437569		2203	4300	6503	SO:0001583	missense	54894	exon8			TCCACACAGTTAC		CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.893G>A	17.37:g.56437569C>T	ENSP00000463069:p.Cys298Tyr	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_017763	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788359	0.90367	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	D;D	0.84146	-1.81;-1.81	5.09	5.09	0.68999	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.052868	0.85682	D	0.000000	D	0.95815	0.8638	H	0.98701	4.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.77004	0.986;0.989;0.973	D	0.97862	1.0281	10	0.87932	D	0	-13.2994	17.4798	0.87670	0.0:1.0:0.0:0.0	.	257;298;298	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	Y	298;257	ENSP00000385328:C298Y;ENSP00000441969:C257Y	ENSP00000385328:C298Y	C	-	2	0	RNF43	53792568	1.000000	0.71417	0.976000	0.42696	0.936000	0.57629	7.440000	0.80464	2.377000	0.81083	0.555000	0.69702	TGT	.		0.542	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
SAMD9	54809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92733863	92733863	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr7:92733863T>A	ENST00000379958.2	-	3	1817	c.1548A>T	c.(1546-1548)gaA>gaT	p.E516D		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	516						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CAGAAGCTCTTTCTCTTTGCC	0.393																																					p.E516D		.											.	SAMD9	140	0			c.A1548T						.						92.0	95.0	94.0					7																	92733863		2203	4300	6503	SO:0001583	missense	54809	exon2			AGCTCTTTCTCTT	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.1548A>T	7.37:g.92733863T>A	ENSP00000369292:p.Glu516Asp	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	18.0	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	37	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	T	7.051	0.564393	0.13498	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.13778	2.56;2.56	4.08	0.513	0.17000	.	0.178248	0.33959	U	0.004389	T	0.07052	0.0179	L	0.28192	0.835	0.23449	N	0.997659	B	0.25272	0.122	B	0.25614	0.062	T	0.32666	-0.9898	10	0.21014	T	0.42	.	3.8598	0.08991	0.1589:0.2907:0.0:0.5504	.	516	Q5K651	SAMD9_HUMAN	D	516	ENSP00000369292:E516D;ENSP00000414529:E516D	ENSP00000369292:E516D	E	-	3	2	SAMD9	92571799	0.610000	0.26983	1.000000	0.80357	0.996000	0.88848	-0.004000	0.12878	0.249000	0.21456	0.491000	0.48974	GAA	.		0.393	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
POMK	84197	bcgsc.ca;mdanderson.org	37	8	42977499	42977499	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr8:42977499A>G	ENST00000331373.5	+	5	787	c.532A>G	c.(532-534)Agg>Ggg	p.R178G		NM_001277971.1|NM_032237.3	NP_001264900.1|NP_115613.1	Q9H5K3	SG196_HUMAN	protein-O-mannose kinase	178	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|carbohydrate phosphorylation (GO:0046835)|learning or memory (GO:0007611)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|protein O-linked glycosylation (GO:0006493)|sensory perception of pain (GO:0019233)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|carbohydrate kinase activity (GO:0019200)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|protein kinase activity (GO:0004672)										GTGGCAGCACAGGCTGGAGCT	0.498																																					p.R178G		.											.	.	.	0			c.A532G						.						80.0	71.0	74.0					8																	42977499		2203	4300	6503	SO:0001583	missense	0	exon5			CAGCACAGGCTGG		CCDS6141.1	8p11.21	2013-08-22			ENSG00000185900	ENSG00000185900			26267	protein-coding gene	gene with protein product		615247				16879967, 23519211	Standard	NM_001277971		Approved	FLJ23356, SgK196		Q9H5K3	OTTHUMG00000164100	ENST00000331373.5:c.532A>G	8.37:g.42977499A>G	ENSP00000331258:p.Arg178Gly	Somatic	55.0	2.0		WXS	Illumina HiSeq	Phase_1	22.0	11.0	NM_032237		Missense_Mutation	SNP	ENST00000331373.5	37	CCDS6141.1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.617890	0.66787	.	.	ENSG00000185900	ENST00000331373	D	0.82619	-1.63	5.53	-2.34	0.06704	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93009	0.7775	H	0.95745	3.715	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	D	0.93726	0.7037	9	.	.	.	-13.2713	18.5335	0.91001	0.244:0.756:0.0:0.0	.	178	Q9H5K3	SG196_HUMAN	G	178	ENSP00000331258:R178G	.	R	+	1	2	AC113191.1	43096656	0.111000	0.22076	0.970000	0.41538	0.906000	0.53458	0.690000	0.25451	-0.541000	0.06257	-0.313000	0.08912	AGG	.		0.498	POMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377291.2	NM_032237	
TMEM187	8269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153247691	153247691	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chrX:153247691G>A	ENST00000369982.4	+	2	925	c.178G>A	c.(178-180)Gtg>Atg	p.V60M	MIR3202-1_ENST00000580198.1_RNA	NM_003492.2	NP_003483.1	Q14656	TM187_HUMAN	transmembrane protein 187	60						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|large_intestine(1)|lung(1)|prostate(2)	5	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAACTCACTCGTGAACATGGC	0.652																																					p.V60M		.											.	TMEM187	130	0			c.G178A						.						48.0	48.0	48.0					X																	153247691		2203	4300	6503	SO:0001583	missense	8269	exon2			TCACTCGTGAACA	X92475	CCDS14739.1	Xq28	2007-03-14	2007-03-14	2007-03-14	ENSG00000177854	ENSG00000177854			13705	protein-coding gene	gene with protein product		300059	"""chromosome X open reading frame 12"""	CXorf12		8661027	Standard	NM_003492		Approved	ITBA1, DXS9878E	uc004fjq.2	Q14656	OTTHUMG00000024220	ENST00000369982.4:c.178G>A	X.37:g.153247691G>A	ENSP00000358999:p.Val60Met	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	23.0	NM_003492	B2RC47|Q6IAV7	Missense_Mutation	SNP	ENST00000369982.4	37	CCDS14739.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002389	0.35320	.	.	ENSG00000177854	ENST00000369982;ENST00000425274	T;T	0.35048	1.33;1.33	4.13	-7.34	0.01427	.	0.899723	0.08783	U	0.894396	T	0.47544	0.1451	M	0.63843	1.955	0.09310	N	1	D	0.67145	0.996	P	0.55667	0.781	T	0.61242	-0.7102	10	0.87932	D	0	.	16.9406	0.86217	0.1944:0.0:0.8056:0.0	.	60	Q14656	TM187_HUMAN	M	60	ENSP00000358999:V60M;ENSP00000390108:V60M	ENSP00000358999:V60M	V	+	1	0	TMEM187	152900885	0.015000	0.18098	0.000000	0.03702	0.006000	0.05464	0.079000	0.14782	-1.849000	0.01171	0.436000	0.28706	GTG	.		0.652	TMEM187-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061093.1	NM_003492	
TMEM233	387890	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120031811	120031811	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr12:120031811A>G	ENST00000426426.1	+	1	548	c.158A>G	c.(157-159)aAc>aGc	p.N53S	RP11-768F21.1_ENST00000509470.2_lincRNA|TMEM233_ENST00000453450.2_3'UTR	NM_001136534.1	NP_001130006.1	B4DJY2	TM233_HUMAN	transmembrane protein 233	53					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				endometrium(1)	1						TACCCCATCAACATCGTGGCT	0.587																																					p.N53S		.											.	.	.	0			c.A158G						.						474.0	392.0	417.0					12																	120031811		692	1591	2283	SO:0001583	missense	387890	exon1			CCATCAACATCGT		CCDS44995.1	12q24.23	2009-10-16			ENSG00000224982	ENSG00000224982			37219	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 2"""						Standard	NM_001136534		Approved	IFITMD2	uc010szd.1	B4DJY2	OTTHUMG00000168944	ENST00000426426.1:c.158A>G	12.37:g.120031811A>G	ENSP00000403130:p.Asn53Ser	Somatic	85.0	1.0		WXS	Illumina HiSeq	Phase_I	51.0	12.0	NM_001136534		Missense_Mutation	SNP	ENST00000426426.1	37	CCDS44995.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.950715	0.73787	.	.	ENSG00000224982	ENST00000426426	D	0.85955	-2.05	4.09	4.09	0.47781	.	.	.	.	.	D	0.87861	0.6284	L	0.40543	1.245	0.41672	D	0.989249	D	0.76494	0.999	D	0.81914	0.995	D	0.86965	0.2094	8	.	.	.	.	13.273	0.60172	1.0:0.0:0.0:0.0	.	53	B4DJY2	TM233_HUMAN	S	53	ENSP00000403130:N53S	.	N	+	2	0	TMEM233	118516194	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.586000	0.67503	1.733000	0.51620	0.454000	0.30748	AAC	.		0.587	TMEM233-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401684.1	NM_001136534	
TPO	7173	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	1481014	1481014	+	Missense_Mutation	SNP	G	G	T	rs371367459		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:1481014G>T	ENST00000345913.4	+	8	1067	c.976G>T	c.(976-978)Gcg>Tcg	p.A326S	TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.A326S|TPO_ENST00000329066.4_Missense_Mutation_p.A326S|TPO_ENST00000382201.3_Missense_Mutation_p.A326S|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.A326S|TPO_ENST00000382198.1_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	326			A -> T (in TDH2A). {ECO:0000269|PubMed:11061528}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GTTCCTGGACGCGTCCACCGT	0.697																																					p.A326S		.											.	TPO	332	0			c.G976T	GRCh37	CM002642	TPO	M		.						20.0	18.0	19.0					2																	1481014		2200	4289	6489	SO:0001583	missense	7173	exon8			CTGGACGCGTCCA		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.976G>T	2.37:g.1481014G>T	ENSP00000318820:p.Ala326Ser	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	10.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853799	0.91355	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000536482;ENST00000329066;ENST00000382201;ENST00000422464	T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67;-0.67	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.87261	0.6133	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89533	0.3787	10	0.56958	D	0.05	-31.3582	18.2781	0.90089	0.0:0.0:1.0:0.0	.	326;326;326	P07202-4;P07202-2;P07202	.;.;PERT_HUMAN	S	326;326;326;10;326;326;255	ENSP00000337263:A326S;ENSP00000318820:A326S;ENSP00000263886:A326S;ENSP00000329869:A326S;ENSP00000371636:A326S;ENSP00000405788:A255S	ENSP00000329869:A326S	A	+	1	0	TPO	1460021	1.000000	0.71417	0.987000	0.45799	0.765000	0.43378	7.517000	0.81783	2.315000	0.78130	0.460000	0.39030	GCG	.		0.697	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TRABD2A	129293	bcgsc.ca;mdanderson.org	37	2	85097547	85097547	+	Silent	SNP	G	G	A	rs552109610		TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:85097547G>A	ENST00000409520.2	-	2	513	c.471C>T	c.(469-471)gcC>gcT	p.A157A	TRABD2A_ENST00000409133.1_Silent_p.A157A|TRABD2A_ENST00000335459.5_Silent_p.A157A	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	157					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										CCCAGTTTCCGGCAATAGCAT	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20817	0.0		0.0	False		,,,				2504	0.0				p.A157A		.											.	.	.	0			c.T471T						.						98.0	104.0	102.0					2																	85097547		2147	4269	6416	SO:0001819	synonymous_variant	129293	exon2			GTTTCCGGCAATA	BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.471C>T	2.37:g.85097547G>A		Somatic	31.0	1.0		WXS	Illumina HiSeq	Phase_1	30.0	12.0	NM_001080824	B4DKK8|I6UMB9	Silent	SNP	ENST00000409520.2	37																																																																																				.		0.562	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001080824	
TRPM8	79054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234839334	234839334	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:234839334G>A	ENST00000324695.4	+	3	179	c.139G>A	c.(139-141)Gca>Aca	p.A47T	TRPM8_ENST00000355722.4_5'UTR|TRPM8_ENST00000409625.1_5'UTR|TRPM8_ENST00000433712.2_5'UTR	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	47					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	TTTTATTCAAGCAAATTTTAA	0.328																																					p.A47T		.											TRPM8,upper_arm,malignant_melanoma,-1	TRPM8	94	0			c.G139A						.						105.0	112.0	110.0					2																	234839334		2203	4299	6502	SO:0001583	missense	79054	exon3			ATTCAAGCAAATT	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.139G>A	2.37:g.234839334G>A	ENSP00000323926:p.Ala47Thr	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	13.0	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	ENST00000324695.4	37	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960578	0.53400	.	.	ENSG00000144481	ENST00000324695	T	0.61392	0.11	5.51	4.63	0.57726	.	0.150706	0.45361	N	0.000377	T	0.41096	0.1144	N	0.20685	0.6	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18777	-1.0326	10	0.21014	T	0.42	-0.4364	13.1702	0.59593	0.0773:0.0:0.9227:0.0	.	47	Q7Z2W7	TRPM8_HUMAN	T	47	ENSP00000323926:A47T	ENSP00000323926:A47T	A	+	1	0	TRPM8	234504073	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.752000	0.62176	1.320000	0.45209	0.650000	0.86243	GCA	.		0.328	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
TXNRD1	7296	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	104645406	104645406	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr12:104645406G>A	ENST00000525566.1	+	2	217	c.193G>A	c.(193-195)Ggt>Agt	p.G65S	TXNRD1_ENST00000526006.1_3'UTR|TXNRD1_ENST00000429002.2_Missense_Mutation_p.G65S	NM_001093771.2	NP_001087240.1	Q16881	TRXR1_HUMAN	thioredoxin reductase 1	65	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CTATATAGATGGTCACTCTGT	0.478																																					.	Ovarian(139;555 1836 9186 9946 10884)	.											.	TXNRD1	90	0			.						.						79.0	83.0	81.0					12																	104645406		2118	4238	6356	SO:0001583	missense	7296	.			ATAGATGGTCACT		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000525566.1:c.193G>A	12.37:g.104645406G>A	ENSP00000434516:p.Gly65Ser	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	6.0	.	B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	ENST00000525566.1	37	CCDS53820.1	.	.	.	.	.	.	.	.	.	.	G	0.436	-0.900798	0.02472	.	.	ENSG00000198431	ENST00000525566;ENST00000429002	T;T	0.27402	1.67;1.67	4.7	2.12	0.27331	Glutaredoxin (1);Thioredoxin-like fold (2);	.	.	.	.	T	0.07324	0.0185	N	0.00690	-1.25	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.37079	-0.9721	9	0.02654	T	1	.	6.6257	0.22828	0.7966:0.0:0.2034:0.0	.	65	Q16881	TRXR1_HUMAN	S	65	ENSP00000434516:G65S;ENSP00000412045:G65S	ENSP00000412045:G65S	G	+	1	0	TXNRD1	103169536	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-0.375000	0.07475	0.364000	0.24374	-0.459000	0.05422	GGT	.		0.478	TXNRD1-001	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000389960.1	NM_003330	
WDR17	116966	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	177071281	177071281	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr4:177071281A>T	ENST00000280190.4	+	16	2363	c.2207A>T	c.(2206-2208)aAt>aTt	p.N736I	WDR17_ENST00000508596.1_Missense_Mutation_p.N712I|WDR17_ENST00000507824.2_Missense_Mutation_p.N719I|WDR17_ENST00000393643.2_Missense_Mutation_p.N712I			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	736										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CTAACTGCTAATTCTCAAGTG	0.343																																					p.N736I		.											.	WDR17	95	0			c.A2207T						.						79.0	84.0	82.0					4																	177071281		2202	4299	6501	SO:0001583	missense	116966	exon16			CTGCTAATTCTCA	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2207A>T	4.37:g.177071281A>T	ENSP00000280190:p.Asn736Ile	Somatic	82.0	1.0		WXS	Illumina HiSeq	Phase_I	73.0	20.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	A	12.77	2.038946	0.35989	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.59224	0.31;0.33;0.28	5.41	4.24	0.50183	.	0.231431	0.42420	D	0.000712	T	0.57301	0.2044	M	0.67953	2.075	0.09310	N	0.999997	P;P	0.48998	0.918;0.918	P;P	0.45167	0.472;0.472	T	0.58561	-0.7615	10	0.87932	D	0	-21.5642	9.6572	0.39932	0.8609:0.0:0.1391:0.0	.	712;736	E7EQX0;Q8IZU2	.;WDR17_HUMAN	I	712;712;736;719	ENSP00000422763:N712I;ENSP00000377258:N712I;ENSP00000280190:N736I	ENSP00000280190:N736I	N	+	2	0	WDR17	177308275	1.000000	0.71417	0.010000	0.14722	0.307000	0.27823	5.562000	0.67346	2.047000	0.60756	0.455000	0.32223	AAT	.		0.343	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
ZG16B	124220	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	2880751	2880751	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr16:2880751G>T	ENST00000382280.3	+	3	296	c.217G>T	c.(217-219)Gaa>Taa	p.E73*	ZG16B_ENST00000572863.1_Nonsense_Mutation_p.E43*	NM_145252.2	NP_660295.2	Q96DA0	ZG16B_HUMAN	zymogen granule protein 16B	73					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5						CTACGACCATGAAATCACAGG	0.537																																					p.E73X		.											.	ZG16B	91	0			c.G217T						.						192.0	201.0	198.0					16																	2880751		1964	4151	6115	SO:0001587	stop_gained	124220	exon3			GACCATGAAATCA	BC009722	CCDS10479.2	16p13.3	2014-02-12	2012-12-07		ENSG00000162078	ENSG00000162078			30456	protein-coding gene	gene with protein product	"""jacalin-like lectin domain containing 2"""		"""zymogen granule protein 16 homolog B (rat)"""			12477932	Standard	NM_145252		Approved	HRPE773, PRO1567, JCLN2	uc002cru.3	Q96DA0	OTTHUMG00000128933	ENST00000382280.3:c.217G>T	16.37:g.2880751G>T	ENSP00000371715:p.Glu73*	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	10.0	NM_145252	A6NIY1|B2R4F6|Q6UW28	Nonsense_Mutation	SNP	ENST00000382280.3	37	CCDS10479.2	.	.	.	.	.	.	.	.	.	.	g	12.99	2.103496	0.37145	.	.	ENSG00000162078	ENST00000382280	.	.	.	3.4	-1.17	0.09648	.	1.348350	0.05624	N	0.580385	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-8.364	4.8454	0.13510	0.1114:0.0:0.3387:0.5499	.	.	.	.	X	73	.	ENSP00000371715:E73X	E	+	1	0	ZG16B	2820752	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.643000	0.24750	-0.170000	0.10816	-0.187000	0.12897	GAA	.		0.537	ZG16B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250912.1	NM_145252	
ZNF675	171392	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	23844915	23844915	+	Splice_Site	SNP	C	C	G			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr19:23844915C>G	ENST00000359788.4	-	3	395		c.e3+1		ZNF675_ENST00000601935.1_Splice_Site|ZNF675_ENST00000601010.1_Splice_Site|ZNF675_ENST00000596211.1_Splice_Site|ZNF675_ENST00000600313.1_Splice_Site|ZNF675_ENST00000599168.1_Missense_Mutation_p.G76A	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675						bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTCTCACTTACCTGGGGGTTC	0.443																																					.		.											.	ZNF675	228	0			c.226+1G>C						.						128.0	128.0	128.0					19																	23844915		2203	4300	6503	SO:0001630	splice_region_variant	171392	exon4			CACTTACCTGGGG		CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.226+1G>C	19.37:g.23844915C>G		Somatic	51.0	1.0		WXS	Illumina HiSeq	Phase_I	57.0	15.0	NM_138330	Q8N211	Splice_Site	SNP	ENST00000359788.4	37	CCDS32981.1	.	.	.	.	.	.	.	.	.	.	.	3.730	-0.055756	0.07362	.	.	ENSG00000197372	ENST00000359788	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	.	.	.	.	.	.	0.40956	D	0.98458	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF675	23636755	0.124000	0.22315	0.064000	0.19789	0.065000	0.16274	0.459000	0.21908	0.300000	0.22699	0.305000	0.20034	.	.		0.443	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466433.1	NM_138330	Intron
ZNF616	90317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52618825	52618825	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr19:52618825C>A	ENST00000600228.1	-	4	1853	c.1592G>T	c.(1591-1593)aGt>aTt	p.S531I	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TGAACGGTCACTGAAGACCTT	0.443																																					p.S531I		.											.	ZNF616	90	0			c.G1592T						.						99.0	96.0	97.0					19																	52618825		2203	4300	6503	SO:0001583	missense	90317	exon4			CGGTCACTGAAGA	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1592G>T	19.37:g.52618825C>A	ENSP00000471000:p.Ser531Ile	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	10.0	NM_178523	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	ENST00000600228.1	37	CCDS33090.1	.	.	.	.	.	.	.	.	.	.	C	6.113	0.389086	0.11581	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.08	-2.15	0.07102	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15132	0.0365	N	0.17594	0.5	0.09310	N	1	P	0.41784	0.762	B	0.41619	0.361	T	0.10019	-1.0648	8	0.33141	T	0.24	.	1.8145	0.03097	0.1737:0.2287:0.4384:0.1591	.	531	Q08AN1	ZN616_HUMAN	I	531	.	ENSP00000328722:S531I	S	-	2	0	ZNF616	57310637	0.000000	0.05858	0.000000	0.03702	0.803000	0.45373	-8.110000	0.00025	-0.756000	0.04703	0.305000	0.20034	AGT	.		0.443	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892	
ZSWIM2	151112	broad.mit.edu;bcgsc.ca	37	2	187713759	187713759	+	Silent	SNP	G	G	C			TCGA-G3-A7M7-01A-12D-A34Z-10	TCGA-G3-A7M7-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2e2d5d14-93c7-44fb-bee9-d6bf7c286368	3a264183-655d-4ab5-ade1-24ffbfd0cdb0	g.chr2:187713759G>C	ENST00000295131.2	-	1	138	c.99C>G	c.(97-99)ctC>ctG	p.L33L		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	33					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TCTCTCGTAGGAGGTAGATGC	0.597																																					p.L33L		.											.	ZSWIM2	93	0			c.C99G						.						59.0	55.0	56.0					2																	187713759		2203	4300	6503	SO:0001819	synonymous_variant	151112	exon1			TCGTAGGAGGTAG	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.99C>G	2.37:g.187713759G>C		Somatic	104.0	2.0		WXS	Illumina HiSeq	Phase_I	57.0	15.0	NM_182521	B3KXV6|Q53SI3|Q57ZY3	Silent	SNP	ENST00000295131.2	37	CCDS33348.1																																																																																			.		0.597	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521	
