#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	48273680	48273680	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr7:48273680A>T	ENST00000435803.1	+	8	853	c.829A>T	c.(829-831)Aaa>Taa	p.K277*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	277					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GTATGATCTCAAATCCCAGTT	0.453																																					p.K277X		.											.	ABCA13	521	0			c.A829T						.						130.0	126.0	127.0					7																	48273680		1960	4155	6115	SO:0001587	stop_gained	154664	exon8			GATCTCAAATCCC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.829A>T	7.37:g.48273680A>T	ENSP00000411096:p.Lys277*	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	8.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.375475	0.82682	.	.	ENSG00000179869	ENST00000435803	.	.	.	5.01	-0.744	0.11101	.	0.558774	0.16007	N	0.234002	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6565	0.22990	0.4359:0.4752:0.0889:0.0	.	.	.	.	X	277	.	ENSP00000409268:K277X	K	+	1	0	ABCA13	48244226	0.110000	0.22057	0.043000	0.18650	0.749000	0.42624	0.169000	0.16641	-0.285000	0.09089	0.460000	0.39030	AAA	.		0.453	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
AHNAK	79026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	62286773	62286773	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr11:62286773T>A	ENST00000378024.4	-	5	15390	c.15116A>T	c.(15115-15117)aAa>aTa	p.K5039I	AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5039					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AAATCCCTGTTTTTTGGCCTT	0.448																																					p.K5039I		.											.	AHNAK	109	0			c.A15116T						.						163.0	169.0	167.0					11																	62286773		2202	4299	6501	SO:0001583	missense	79026	exon5			CCCTGTTTTTTGG	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.15116A>T	11.37:g.62286773T>A	ENSP00000367263:p.Lys5039Ile	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	28.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.386748	0.42308	.	.	ENSG00000124942	ENST00000378024	T	0.00678	5.87	4.87	3.74	0.42951	.	0.000000	0.45126	D	0.000398	T	0.03348	0.0097	M	0.77103	2.36	0.29150	N	0.87844	D	0.71674	0.998	D	0.66847	0.947	T	0.08617	-1.0713	10	0.41790	T	0.15	-8.3472	10.3304	0.43818	0.0:0.0794:0.0:0.9206	.	5039	Q09666	AHNK_HUMAN	I	5039	ENSP00000367263:K5039I	ENSP00000367263:K5039I	K	-	2	0	AHNAK	62043349	0.998000	0.40836	0.703000	0.30354	0.968000	0.65278	2.010000	0.40913	0.820000	0.34516	0.448000	0.29417	AAA	.		0.448	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21230621	21230625	+	Frame_Shift_Del	DEL	GAAAA	GAAAA	-			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	GAAAA	GAAAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr2:21230621_21230625delGAAAA	ENST00000233242.1	-	26	9242_9246	c.9115_9119delTTTTC	c.(9115-9120)ttttcafs	p.FS3039fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3039					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGCTGGGCTGAAAAGAAAAGAGAA	0.405																																					p.3039_3040del		.											.	APOB	175	0			c.9115_9119del						.			0,4266		0,0,2133						-1.4	0.3			53	4,8246		1,2,4122	no	frameshift	APOB	NM_000384.2		1,2,6255	A1A1,A1R,RR		0.0485,0.0,0.032				4,12512				SO:0001589	frameshift_variant	338	exon26			TGGGCTGAAAAGA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9115_9119delTTTTC	2.37:g.21230626_21230630delGAAAA	ENSP00000233242:p.Phe3039fs	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	38.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.405	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOH	350	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	64210603	64210603	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr17:64210603T>G	ENST00000205948.6	-	7	987	c.950A>C	c.(949-951)gAt>gCt	p.D317A		NM_000042.2	NP_000033.2	P02749	APOH_HUMAN	apolipoprotein H (beta-2-glycoprotein I)	317	Sushi-like.				blood coagulation, intrinsic pathway (GO:0007597)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of myeloid cell apoptotic process (GO:0033033)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|plasminogen activation (GO:0031639)|positive regulation of blood coagulation (GO:0030194)|positive regulation of lipoprotein lipase activity (GO:0051006)|regulation of fibrinolysis (GO:0051917)|triglyceride metabolic process (GO:0006641)|triglyceride transport (GO:0034197)	cell surface (GO:0009986)|chylomicron (GO:0042627)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipid binding (GO:0005543)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			GATAGTGCCATCTATACACTG	0.403																																					p.D317A	Melanoma(155;624 1882 16869 48804 51309)	.											.	APOH	90	0			c.A950C						.						194.0	157.0	169.0					17																	64210603		2203	4300	6503	SO:0001583	missense	350	exon7			GTGCCATCTATAC		CCDS11663.1	17q24.2	2013-01-24				ENSG00000091583		"""Apolipoproteins"""	616	protein-coding gene	gene with protein product	"""beta-2-glycoprotein I"""	138700		B2G1		1582254	Standard	NM_000042		Approved	BG	uc002jfn.4	P02749		ENST00000205948.6:c.950A>C	17.37:g.64210603T>G	ENSP00000205948:p.Asp317Ala	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	9.0	NM_000042	B2R9M3|Q9UCN7	Missense_Mutation	SNP	ENST00000205948.6	37	CCDS11663.1	.	.	.	.	.	.	.	.	.	.	t	14.15	2.448700	0.43531	.	.	ENSG00000091583	ENST00000205948	T	0.41400	1.0	5.5	5.5	0.81552	Complement control module (2);Beta-2-glycoprotein-1 fifth domain (2);	0.092847	0.64402	D	0.000001	T	0.65080	0.2657	M	0.78049	2.395	0.44000	D	0.996709	D	0.76494	0.999	D	0.74348	0.983	T	0.69165	-0.5217	10	0.62326	D	0.03	.	14.6578	0.68847	0.0:0.0:0.0:1.0	.	317	P02749	APOH_HUMAN	A	317	ENSP00000205948:D317A	ENSP00000205948:D317A	D	-	2	0	APOH	61641065	0.905000	0.30787	0.348000	0.25681	0.087000	0.18053	5.549000	0.67261	2.104000	0.64026	0.529000	0.55759	GAT	.		0.403	APOH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446926.1	NM_000042	
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197071915	197071915	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr1:197071915C>G	ENST00000367409.4	-	18	6722	c.6466G>C	c.(6466-6468)Ggt>Cgt	p.G2156R	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2156					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TGCATTTTACCTTGATAATAT	0.338																																					p.G2156R		.											.	ASPM	615	0			c.G6466C						.						131.0	126.0	128.0					1																	197071915		2203	4300	6503	SO:0001583	missense	259266	exon18			TTTTACCTTGATA	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6466G>C	1.37:g.197071915C>G	ENSP00000356379:p.Gly2156Arg	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	18.0	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	c	17.41	3.383832	0.61845	.	.	ENSG00000066279	ENST00000367409	T	0.63417	-0.04	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000001	T	0.74313	0.3700	L	0.58810	1.83	0.80722	D	1	D	0.67145	0.996	D	0.70487	0.969	T	0.67245	-0.5719	10	0.11182	T	0.66	.	19.3495	0.94378	0.0:1.0:0.0:0.0	.	2156	Q8IZT6	ASPM_HUMAN	R	2156	ENSP00000356379:G2156R	ENSP00000356379:G2156R	G	-	1	0	ASPM	195338538	0.996000	0.38824	0.434000	0.26772	0.890000	0.51754	3.222000	0.51223	2.587000	0.87381	0.639000	0.83563	GGT	.		0.338	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
BCL11A	53335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	60687855	60687855	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr2:60687855C>T	ENST00000335712.6	-	4	2419	c.2192G>A	c.(2191-2193)gGc>gAc	p.G731D	BCL11A_ENST00000537768.1_Missense_Mutation_p.G400D|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.G697D|BCL11A_ENST00000356842.4_Missense_Mutation_p.G731D|BCL11A_ENST00000538214.1_Missense_Mutation_p.G697D|BCL11A_ENST00000477659.1_5'UTR	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	731					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)	p.G731fs*>40(1)|p.G731fs*56(1)		NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GCTGGGCCTGCCCGGGCCCGG	0.627			T	IGH@	B-CLL																																p.G731D		.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A	1149	2	Deletion - Frameshift(2)	lung(2)	c.G2192A						.						67.0	73.0	71.0					2																	60687855		2203	4300	6503	SO:0001583	missense	53335	exon4			GGCCTGCCCGGGC	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.2192G>A	2.37:g.60687855C>T	ENSP00000338774:p.Gly731Asp	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	12.0	NM_018014	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615713	0.46631	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.39056	1.49;3.1;1.1;3.17;3.08	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.63094	0.2482	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;0.999;1.0;1.0	T	0.54344	-0.8308	10	0.31617	T	0.26	-2.8724	20.3312	0.98718	0.0:1.0:0.0:0.0	.	697;400;697;731;731	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	D	731;756;697;400;731;697	ENSP00000349300:G731D;ENSP00000438303:G697D;ENSP00000443712:G400D;ENSP00000338774:G731D;ENSP00000351307:G697D	ENSP00000338774:G731D	G	-	2	0	BCL11A	60541359	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	5.759000	0.68785	2.797000	0.96272	0.655000	0.94253	GGC	.		0.627	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
C16orf59	80178	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	2514087	2514087	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr16:2514087G>A	ENST00000361837.4	+	9	1077	c.1012G>A	c.(1012-1014)Gga>Aga	p.G338R	C16orf59_ENST00000483320.1_Missense_Mutation_p.G171R|C16orf59_ENST00000563531.1_Missense_Mutation_p.G338R|C16orf59_ENST00000569496.1_Missense_Mutation_p.G338R|RP11-715J22.2_ENST00000563775.1_RNA	NM_025108.2	NP_079384.2	Q7L2K0	CP059_HUMAN	chromosome 16 open reading frame 59	338										lung(1)|skin(1)|urinary_tract(1)	3		Ovarian(90;0.17)				GAGGCCCCCCGGAGCCTCGCC	0.677																																					p.G338R		.											.	C16orf59	90	0			c.G1012A						.						19.0	25.0	23.0					16																	2514087		1948	4131	6079	SO:0001583	missense	80178	exon9			CCCCCCGGAGCCT	AK023971	CCDS10468.2	16p13.3	2008-10-30			ENSG00000162062	ENSG00000162062			25849	protein-coding gene	gene with protein product						12477932	Standard	XM_006720955		Approved	FLJ13909	uc002cqh.3	Q7L2K0	OTTHUMG00000128859	ENST00000361837.4:c.1012G>A	16.37:g.2514087G>A	ENSP00000355022:p.Gly338Arg	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	9.0	NM_025108	B4DXD7|Q96H61|Q9H872	Missense_Mutation	SNP	ENST00000361837.4	37	CCDS10468.2	.	.	.	.	.	.	.	.	.	.	G	1.527	-0.545453	0.04024	.	.	ENSG00000162062	ENST00000361837	T	0.43294	0.95	4.14	-2.48	0.06423	.	1.645210	0.03320	N	0.191857	T	0.09113	0.0225	N	0.00347	-1.61	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22173	-1.0224	10	0.07644	T	0.81	0.1429	0.1214	0.00065	0.2641:0.2378:0.2401:0.258	.	338;171;171	Q7L2K0;D3DU95;Q7L2K0-2	CP059_HUMAN;.;.	R	338	ENSP00000355022:G338R	ENSP00000355022:G338R	G	+	1	0	C16orf59	2454088	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.749000	0.04813	-0.216000	0.10048	-0.415000	0.06103	GGA	.		0.677	C16orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250802.3	NM_025108	
CLVS2	134829	broad.mit.edu;bcgsc.ca	37	6	123319206	123319206	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr6:123319206G>A	ENST00000275162.5	+	2	1619	c.284G>A	c.(283-285)gGc>gAc	p.G95D	CLVS2_ENST00000368438.1_Intron	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	95					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						ACCGACCCTGGCATCAAGCAG	0.537																																					p.G95D		.											.	CLVS2	27	0			c.G284A						.						80.0	76.0	78.0					6																	123319206		2203	4300	6503	SO:0001583	missense	134829	exon2			ACCCTGGCATCAA	AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.284G>A	6.37:g.123319206G>A	ENSP00000275162:p.Gly95Asp	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	9.0	NM_001010852	B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Missense_Mutation	SNP	ENST00000275162.5	37	CCDS34525.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783625	0.70222	.	.	ENSG00000146352	ENST00000275162	T	0.78816	-1.21	5.39	5.39	0.77823	Cellular retinaldehyde-binding/triple function, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.50394	0.1613	N	0.11560	0.145	0.80722	D	1	B	0.27791	0.189	B	0.28709	0.093	T	0.51663	-0.8677	10	0.22109	T	0.4	-9.3759	19.3486	0.94374	0.0:0.0:1.0:0.0	.	95	Q5SYC1	CLVS2_HUMAN	D	95	ENSP00000275162:G95D	ENSP00000275162:G95D	G	+	2	0	CLVS2	123360905	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.690000	0.84178	2.814000	0.96858	0.585000	0.79938	GGC	.		0.537	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852	
CTC1	80169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	8139600	8139600	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr17:8139600C>T	ENST00000315684.8	-	6	860	c.853G>A	c.(853-855)Gaa>Aaa	p.E285K	CTC1_ENST00000581671.1_5'UTR	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	285					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						ACTCGCAGTTCTGTCAGCACA	0.577																																					p.E285K		.											.	CTC1	93	0			c.G853A						.						46.0	48.0	47.0					17																	8139600		2103	4212	6315	SO:0001583	missense	80169	exon6			GCAGTTCTGTCAG	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.853G>A	17.37:g.8139600C>T	ENSP00000313759:p.Glu285Lys	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	7.0	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	37	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	c	5.638	0.302300	0.10678	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.82619	-1.63;-1.63	4.76	1.66	0.24008	.	0.978962	0.08388	N	0.953444	T	0.64305	0.2586	N	0.13043	0.29	0.09310	N	1	B	0.16396	0.017	B	0.14578	0.011	T	0.50701	-0.8797	10	0.06757	T	0.87	-0.1245	5.7761	0.18279	0.0:0.66:0.0:0.34	.	285	Q2NKJ3	CTC1_HUMAN	K	285;250	ENSP00000313759:E285K;ENSP00000396018:E250K	ENSP00000313759:E285K	E	-	1	0	CTC1	8080325	0.302000	0.24454	0.355000	0.25773	0.502000	0.33828	0.616000	0.24344	0.696000	0.31696	0.556000	0.70494	GAA	.		0.577	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
FZR1	51343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	3532454	3532454	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr19:3532454C>T	ENST00000395095.3	+	10	1048	c.1048C>T	c.(1048-1050)Cag>Tag	p.Q350*	FZR1_ENST00000313639.8_Nonsense_Mutation_p.Q261*|FZR1_ENST00000441788.2_Nonsense_Mutation_p.Q350*	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	350					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCGTGCAGCAGTACACGGA	0.701																																					p.Q350X		.											.	FZR1	227	0			c.C1048T						.						22.0	25.0	24.0					19																	3532454		2200	4297	6497	SO:0001587	stop_gained	51343	exon10			GTGCAGCAGTACA	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1048C>T	19.37:g.3532454C>T	ENSP00000378529:p.Gln350*	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	18.0	NM_001136198	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Nonsense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	c	38	6.673294	0.97751	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	.	.	.	5.39	5.39	0.77823	.	0.051202	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.2661	17.7131	0.88327	0.0:1.0:0.0:0.0	.	.	.	.	X	350;350;261	.	ENSP00000321800:Q261X	Q	+	1	0	FZR1	3483454	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.468000	0.80943	2.531000	0.85337	0.543000	0.68304	CAG	.		0.701	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
GRIA2	2891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	158242731	158242731	+	Missense_Mutation	SNP	G	G	T	rs147349807		TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr4:158242731G>T	ENST00000264426.9	+	6	1141	c.862G>T	c.(862-864)Gct>Tct	p.A288S	GRIA2_ENST00000507898.1_Missense_Mutation_p.A241S|GRIA2_ENST00000393815.2_Missense_Mutation_p.A241S|GRIA2_ENST00000449365.1_Missense_Mutation_p.A241S|GRIA2_ENST00000296526.7_Missense_Mutation_p.A288S	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	288					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ATACCCTGGAGCTCACACAAC	0.373																																					p.A288S		.											.	GRIA2	515	0			c.G862T						.	G	SER/ALA,SER/ALA,SER/ALA	0,4406		0,0,2203	115.0	124.0	121.0		862,862,721	4.6	1.0	4	dbSNP_134	121	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	GRIA2	NM_000826.3,NM_001083619.1,NM_001083620.1	99,99,99	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	288/884,288/884,241/837	158242731	1,13005	2203	4300	6503	SO:0001583	missense	2891	exon6			CCTGGAGCTCACA		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.862G>T	4.37:g.158242731G>T	ENSP00000264426:p.Ala288Ser	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	23.0	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648812	0.67358	0.0	1.16E-4	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	5.46	4.59	0.56863	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.85517	0.5715	L	0.32530	0.975	0.80722	D	1	B;D;D	0.63880	0.165;0.957;0.993	B;P;D	0.83275	0.345;0.875;0.996	T	0.82323	-0.0514	10	0.20046	T	0.44	.	15.3237	0.74144	0.0:0.0:0.8591:0.1409	.	288;288;241	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	S	241;241;288;288;241	ENSP00000426845:A241S;ENSP00000377403:A241S;ENSP00000296526:A288S;ENSP00000264426:A288S;ENSP00000389837:A241S	ENSP00000264426:A288S	A	+	1	0	GRIA2	158462181	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.238000	0.95380	1.227000	0.43598	0.591000	0.81541	GCT	G|1.000;T|0.000		0.373	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
HMCN1	83872	ucsc.edu;bcgsc.ca	37	1	186077704	186077704	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr1:186077704G>T	ENST00000271588.4	+	71	11193	c.10964G>T	c.(10963-10965)tGg>tTg	p.W3655L	HMCN1_ENST00000367492.2_Missense_Mutation_p.W3655L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3655	Ig-like C2-type 35.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTAATTACTTGGCTCAGAAAT	0.423																																					p.W3655L		.											.	HMCN1	113	0			c.G10964T						.						88.0	78.0	82.0					1																	186077704		2203	4300	6503	SO:0001583	missense	83872	exon71			TTACTTGGCTCAG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10964G>T	1.37:g.186077704G>T	ENSP00000271588:p.Trp3655Leu	Somatic	76.0	0.0		WXS	Illumina HiSeq	.	53.0	5.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	32	5.170104	0.94768	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.96265	-3.96;-3.96	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.97214	3.96	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.99038	1.0823	10	0.87932	D	0	.	20.3473	0.98799	0.0:0.0:1.0:0.0	.	3655	Q96RW7	HMCN1_HUMAN	L	3655	ENSP00000271588:W3655L;ENSP00000356462:W3655L	ENSP00000271588:W3655L	W	+	2	0	HMCN1	184344327	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.340000	0.97038	2.884000	0.98904	0.655000	0.94253	TGG	.		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HOXB7	3217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	46688035	46688035	+	Silent	SNP	C	C	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr17:46688035C>A	ENST00000239165.7	-	1	344	c.246G>T	c.(244-246)ccG>ccT	p.P82P	HOXB7_ENST00000567101.2_Intron	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7	82					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						TGAAGGAACTCGGCTCGAGCC	0.711																																					p.P82P		.											.	HOXB7	90	0			c.G246T						.						8.0	6.0	7.0					17																	46688035		2102	4108	6210	SO:0001819	synonymous_variant	3217	exon1			GGAACTCGGCTCG		CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.246G>T	17.37:g.46688035C>A		Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	34.0	NM_004502	A8K3N8|Q15957|Q53FN3|Q96BQ6	Silent	SNP	ENST00000239165.7	37	CCDS11532.1																																																																																			.		0.711	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358097.3		
INSR	3643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7120659	7120659	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr19:7120659C>T	ENST00000302850.5	-	20	3773	c.3631G>A	c.(3631-3633)Ggg>Agg	p.G1211R	INSR_ENST00000341500.5_Missense_Mutation_p.G1199R	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	1211	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GTGAAGACCCCATCCTTCAGG	0.552																																					p.G1211R		.											.	INSR	1381	0			c.G3631A						.						133.0	108.0	117.0					19																	7120659		2203	4300	6503	SO:0001583	missense	3643	exon20			AGACCCCATCCTT	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.3631G>A	19.37:g.7120659C>T	ENSP00000303830:p.Gly1211Arg	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	37.0	NM_000208	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	ENST00000302850.5	37	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442872	0.83993	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	D;D	0.82526	-1.62;-1.62	4.41	4.41	0.53225	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43260	U	0.000592	D	0.88273	0.6392	L	0.49571	1.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	D	0.89578	0.3818	10	0.87932	D	0	.	14.8438	0.70246	0.0:1.0:0.0:0.0	.	1199;1211	P06213-2;P06213	.;INSR_HUMAN	R	1211;1199	ENSP00000303830:G1211R;ENSP00000342838:G1199R	ENSP00000303830:G1211R	G	-	1	0	INSR	7071659	1.000000	0.71417	0.979000	0.43373	0.734000	0.41952	7.446000	0.80609	2.166000	0.68216	0.455000	0.32223	GGG	.		0.552	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
KIAA1210	57481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	118281508	118281508	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chrX:118281508T>C	ENST00000402510.2	-	2	337	c.338A>G	c.(337-339)gAt>gGt	p.D113G		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	113										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						CCTGGCCAGATCCCCAAGATT	0.463																																					p.D113G		.											.	KIAA1210	67	0			c.A338G						.						98.0	88.0	91.0					X																	118281508		2008	4179	6187	SO:0001583	missense	57481	exon2			GCCAGATCCCCAA	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.338A>G	X.37:g.118281508T>C	ENSP00000384670:p.Asp113Gly	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	9.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	37	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	T	8.983	0.975914	0.18736	.	.	ENSG00000250423	ENST00000402510	T	0.13657	2.57	3.11	-4.96	0.03038	.	.	.	.	.	T	0.05318	0.0141	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.36407	-0.9749	9	0.66056	D	0.02	.	3.1402	0.06453	0.4857:0.252:0.0:0.2624	.	113	Q9ULL0	K1210_HUMAN	G	113	ENSP00000384670:D113G	ENSP00000384670:D113G	D	-	2	0	RP13-347D8.6	118165536	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.006000	0.12833	-1.283000	0.02393	-1.372000	0.01188	GAT	.		0.463	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
LRPPRC	10128	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	44209519	44209519	+	Silent	SNP	A	A	G			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr2:44209519A>G	ENST00000260665.7	-	2	261	c.204T>C	c.(202-204)atT>atC	p.I68I	LRPPRC_ENST00000409659.1_Silent_p.I68I|LRPPRC_ENST00000409946.1_Silent_p.I68I	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	68					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACTCCTCTTGAATATCTTTTT	0.378																																					p.I68I		.											.	LRPPRC	93	0			c.T204C						.						50.0	55.0	54.0					2																	44209519		2203	4300	6503	SO:0001819	synonymous_variant	10128	exon2			CTCTTGAATATCT	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.204T>C	2.37:g.44209519A>G		Somatic	253.0	0.0		WXS	Illumina HiSeq	Phase_I	207.0	12.0	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Silent	SNP	ENST00000260665.7	37	CCDS33189.1																																																																																			.		0.378	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	
LRRC49	54839	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	71329548	71329548	+	Silent	SNP	C	C	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr15:71329548C>T	ENST00000260382.5	+	15	1994	c.1734C>T	c.(1732-1734)tcC>tcT	p.S578S	LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560158.2_Silent_p.S266S|LRRC49_ENST00000560691.1_Silent_p.S284S|LRRC49_ENST00000560369.1_Silent_p.S583S|LRRC49_ENST00000544974.2_Silent_p.S568S|LRRC49_ENST00000443425.2_Silent_p.S534S	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	578						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TACTAGAATCCAAAGGAAAAA	0.308																																					p.S583S		.											.	LRRC49	91	0			c.C1749T						.						81.0	88.0	85.0					15																	71329548		2199	4293	6492	SO:0001819	synonymous_variant	54839	exon15			AGAATCCAAAGGA		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1734C>T	15.37:g.71329548C>T		Somatic	407.0	0.0		WXS	Illumina HiSeq	Phase_I	349.0	31.0	NM_001199017	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Silent	SNP	ENST00000260382.5	37	CCDS32282.1																																																																																			.		0.308	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691	
NSUN2	54888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	6602579	6602579	+	Silent	SNP	A	A	G			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr5:6602579A>G	ENST00000264670.6	-	18	2303	c.1992T>C	c.(1990-1992)gaT>gaC	p.D664D	NSUN2_ENST00000539938.1_Silent_p.D428D|NSUN2_ENST00000506139.1_Silent_p.D629D	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	664					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CTTACGCAGAATCTGGTTCAT	0.493																																					p.D664D		.											.	NSUN2	91	0			c.T1992C						.						390.0	332.0	352.0					5																	6602579		2203	4300	6503	SO:0001819	synonymous_variant	54888	exon18			CGCAGAATCTGGT	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.1992T>C	5.37:g.6602579A>G		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	25.0	NM_017755	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Silent	SNP	ENST00000264670.6	37	CCDS3869.1																																																																																			.		0.493	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
OR56B4	196335	broad.mit.edu;bcgsc.ca	37	11	6129724	6129724	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr11:6129724C>T	ENST00000316529.3	+	1	811	c.716C>T	c.(715-717)gCa>gTa	p.A239V	RP11-290F24.3_ENST00000529961.1_RNA	NM_001005181.1	NP_001005181.1	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B, member 4	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(10)|skin(6)|urinary_tract(2)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCAGCAGAAGCAATGTCCAAG	0.488																																					p.A239V		.											.	OR56B4	68	0			c.C716T						.						178.0	160.0	166.0					11																	6129724		2201	4296	6497	SO:0001583	missense	196335	exon1			CAGAAGCAATGTC	AB065513	CCDS31406.1	11p15.4	2012-08-09			ENSG00000180919	ENSG00000180919		"""GPCR / Class A : Olfactory receptors"""	15248	protein-coding gene	gene with protein product							Standard	NM_001005181		Approved		uc010qzx.2	Q8NH76	OTTHUMG00000165531	ENST00000316529.3:c.716C>T	11.37:g.6129724C>T	ENSP00000321196:p.Ala239Val	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	8.0	NM_001005181	Q6IFD7	Missense_Mutation	SNP	ENST00000316529.3	37	CCDS31406.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142439	0.37825	.	.	ENSG00000180919	ENST00000316529	T	0.00145	8.67	4.06	4.06	0.47325	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36591	U	0.002505	T	0.00695	0.0023	H	0.95950	3.745	0.25985	N	0.982321	D	0.89917	1.0	D	0.74674	0.984	T	0.12116	-1.0560	10	0.72032	D	0.01	.	12.9643	0.58475	0.1624:0.8376:0.0:0.0	.	239	Q8NH76	O56B4_HUMAN	V	239	ENSP00000321196:A239V	ENSP00000321196:A239V	A	+	2	0	OR56B4	6086300	0.020000	0.18652	0.814000	0.32528	0.011000	0.07611	0.175000	0.16762	2.225000	0.72522	0.556000	0.70494	GCA	.		0.488	OR56B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384668.1	NM_001005181	
PAPPA2	60676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	176709306	176709306	+	Silent	SNP	C	C	T	rs376458121		TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr1:176709306C>T	ENST00000367662.3	+	14	5289	c.4125C>T	c.(4123-4125)gaC>gaT	p.D1375D		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1375					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TCTCAGAGGACGAGGGGCAGA	0.483																																					p.D1375D		.											.	PAPPA2	548	0			c.C4125T						.	C		9,3955		0,9,1973	86.0	83.0	84.0		4125	-10.4	0.0	1		84	0,8330		0,0,4165	no	coding-synonymous	PAPPA2	NM_020318.2		0,9,6138	TT,TC,CC		0.0,0.227,0.0732		1375/1792	176709306	9,12285	1982	4165	6147	SO:0001819	synonymous_variant	60676	exon14			AGAGGACGAGGGG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4125C>T	1.37:g.176709306C>T		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	9.0	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	ENST00000367662.3	37	CCDS41438.1																																																																																			.		0.483	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
PGBD4	161779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34394935	34394935	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr15:34394935A>C	ENST00000397766.2	+	1	662	c.203A>C	c.(202-204)gAc>gCc	p.D68A	EMC7_ENST00000532113.1_5'Flank|EMC7_ENST00000256545.4_5'Flank	NM_152595.4	NP_689808.2	Q96DM1	PGBD4_HUMAN	piggyBac transposable element derived 4	68										breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)|prostate(1)	16		all_lung(180;1.76e-08)		all cancers(64;1.22e-17)|GBM - Glioblastoma multiforme(113;1.78e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0242)		ACATCAAGTGACTCAGGGCGC	0.443																																					p.D68A		.											.	PGBD4	90	0			c.A203C						.						78.0	74.0	75.0					15																	34394935		2201	4298	6499	SO:0001583	missense	161779	exon1			CAAGTGACTCAGG	AK057200	CCDS10033.1	15q13.1	2002-10-25			ENSG00000182405	ENSG00000182405			19401	protein-coding gene	gene with protein product							Standard	NM_152595		Approved	FLJ32638, FLJ37497	uc001zho.3	Q96DM1	OTTHUMG00000129370	ENST00000397766.2:c.203A>C	15.37:g.34394935A>C	ENSP00000380872:p.Asp68Ala	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	25.0	NM_152595	A1L487|A8K0C6|Q8N9E8	Missense_Mutation	SNP	ENST00000397766.2	37	CCDS10033.1	.	.	.	.	.	.	.	.	.	.	a	0.008	-1.915541	0.00503	.	.	ENSG00000182405	ENST00000397766	T	0.17370	2.28	0.774	0.774	0.18521	.	419.160000	0.01268	U	0.009394	T	0.07908	0.0198	N	0.08118	0	0.09310	N	1	B	0.22414	0.069	B	0.12837	0.008	T	0.24621	-1.0155	10	0.09338	T	0.73	.	3.8175	0.08821	1.0:0.0:0.0:0.0	.	68	Q96DM1	PGBD4_HUMAN	A	68	ENSP00000380872:D68A	ENSP00000380872:D68A	D	+	2	0	PGBD4	32182227	0.006000	0.16342	0.015000	0.15790	0.051000	0.14879	0.540000	0.23191	0.602000	0.29896	0.248000	0.18094	GAC	.		0.443	PGBD4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251522.1		
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047R	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,bladder,carcinoma,0	PIK3CA	27752	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140G						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290	exon21			ATGCACATCATGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	22.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	.		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
PIWIL4	143689	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94352999	94352999	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr11:94352999C>A	ENST00000299001.6	+	18	2453	c.2242C>A	c.(2242-2244)Cag>Aag	p.Q748K	RP11-867G2.8_ENST00000536540.1_RNA|PIWIL4_ENST00000537419.1_Missense_Mutation_p.Q99K|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	748	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CCGCACTGTACAGAACCCCCC	0.438																																					p.Q748K		.											.	PIWIL4	91	0			c.C2242A						.						133.0	116.0	121.0					11																	94352999		2201	4298	6499	SO:0001583	missense	143689	exon18			ACTGTACAGAACC	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.2242C>A	11.37:g.94352999C>A	ENSP00000299001:p.Gln748Lys	Somatic	186.0	1.0		WXS	Illumina HiSeq	Phase_I	152.0	54.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	C	6.537	0.467391	0.12402	.	.	ENSG00000134627	ENST00000299001;ENST00000537419	T;T	0.31247	1.5;1.5	5.27	1.99	0.26369	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.237263	0.29087	N	0.013200	T	0.25865	0.0630	L	0.52905	1.665	0.09310	N	0.999996	B	0.25272	0.122	B	0.29267	0.1	T	0.21381	-1.0247	10	0.11794	T	0.64	-8.7759	10.8236	0.46619	0.1291:0.6398:0.2311:0.0	.	748	Q7Z3Z4	PIWL4_HUMAN	K	748;99	ENSP00000299001:Q748K;ENSP00000439710:Q99K	ENSP00000299001:Q748K	Q	+	1	0	PIWIL4	93992647	0.015000	0.18098	0.822000	0.32727	0.023000	0.10783	0.043000	0.13971	1.178000	0.42870	0.655000	0.94253	CAG	.		0.438	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
PLEKHA6	22874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	204214797	204214797	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr1:204214797C>A	ENST00000272203.3	-	14	2294	c.1978G>T	c.(1978-1980)Gag>Tag	p.E660*	PLEKHA6_ENST00000414478.1_Nonsense_Mutation_p.E680*	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	660										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CTCAGCCCCTCCATCACGTCC	0.597																																					p.E660X		.											.	PLEKHA6	654	0			c.G1978T						.						138.0	117.0	124.0					1																	204214797		2203	4300	6503	SO:0001587	stop_gained	22874	exon14			GCCCCTCCATCAC	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1978G>T	1.37:g.204214797C>A	ENSP00000272203:p.Glu660*	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	11.0	NM_014935	A7MD51|Q5VTI6	Nonsense_Mutation	SNP	ENST00000272203.3	37	CCDS1444.1	.	.	.	.	.	.	.	.	.	.	C	42	9.820152	0.99272	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-23.9479	17.357	0.87338	0.0:1.0:0.0:0.0	.	.	.	.	X	660;680	.	ENSP00000272203:E660X	E	-	1	0	PLEKHA6	202481420	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.158000	0.77470	2.406000	0.81754	0.563000	0.77884	GAG	.		0.597	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
PTGDR	5729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	52735240	52735240	+	Silent	SNP	G	G	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr14:52735240G>A	ENST00000306051.2	+	1	810	c.708G>A	c.(706-708)ccG>ccA	p.P236P	PTGDR_ENST00000553372.1_Silent_p.P236P	NM_000953.2	NP_000944.1	Q13258	PD2R_HUMAN	prostaglandin D2 receptor (DP)	236					adenosine metabolic process (GO:0046085)|cellular response to prostaglandin D stimulus (GO:0071799)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|male sex determination (GO:0030238)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin D receptor activity (GO:0004956)|prostaglandin J receptor activity (GO:0001785)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	AGCGGCACCCGCGCTCCTGCA	0.706																																					p.P236P		.											.	PTGDR	524	0			c.G708A						.						34.0	34.0	34.0					14																	52735240		2201	4298	6499	SO:0001819	synonymous_variant	5729	exon1			GCACCCGCGCTCC	U31332	CCDS9707.1, CCDS61454.1	14q22.1	2012-08-08			ENSG00000168229	ENSG00000168229		"""GPCR / Class A : Prostanoid receptors"""	9591	protein-coding gene	gene with protein product		604687				7642548	Standard	NM_000953		Approved	DP, DP1, PTGDR1	uc001wzq.3	Q13258	OTTHUMG00000140299	ENST00000306051.2:c.708G>A	14.37:g.52735240G>A		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	12.0	NM_000953	G3V5L3|Q13250|Q13251|Q1ZZ52	Silent	SNP	ENST00000306051.2	37	CCDS9707.1																																																																																			.		0.706	PTGDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276889.1	NM_000953	
RPL15	6138	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	3	23960001	23960001	+	Silent	SNP	C	C	T	rs35608037	byFrequency	TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr3:23960001C>T	ENST00000307839.5	+	3	882	c.243C>T	c.(241-243)taC>taT	p.Y81Y	NKIRAS1_ENST00000425478.2_5'Flank|NKIRAS1_ENST00000388759.3_5'Flank|NKIRAS1_ENST00000416026.2_5'Flank|RPL15_ENST00000435882.1_Silent_p.Y81Y|NKIRAS1_ENST00000412028.1_5'Flank|NKIRAS1_ENST00000437230.1_5'Flank|RPL15_ENST00000456530.2_Silent_p.Y81Y|NKIRAS1_ENST00000415901.2_5'Flank|RPL15_ENST00000354811.5_Silent_p.Y81Y|RPL15_ENST00000415719.1_Silent_p.Y81Y|RPL15_ENST00000413699.1_Silent_p.Y81Y|NKIRAS1_ENST00000421515.2_Intron|NKIRAS1_ENST00000443659.2_5'Flank	NM_001253379.1|NM_001253380.1|NM_002948.3	NP_001240308.1|NP_001240309.1|NP_002939.2	P61313	RL15_HUMAN	ribosomal protein L15	81					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7						GTGCAACTTACGGCAAGCCTG	0.448													C|||	53	0.0105831	0.0371	0.0029	5008	,	,		20319	0.0		0.001	False		,,,				2504	0.001				p.Y81Y		.											.	RPL15	91	0			c.C243T						.	C		103,4303	81.9+/-120.4	2,99,2102	115.0	114.0	114.0		243	-9.5	0.7	3	dbSNP_126	114	2,8590		0,2,4294	no	coding-synonymous	RPL15	NM_002948.2		2,101,6396	TT,TC,CC		0.0233,2.3377,0.8078		81/205	23960001	105,12893	2203	4296	6499	SO:0001819	synonymous_variant	6138	exon3			AACTTACGGCAAG	AB007173	CCDS2640.1, CCDS58818.1	3p24.1	2011-04-06			ENSG00000174748	ENSG00000174748		"""L ribosomal proteins"""	10306	protein-coding gene	gene with protein product		604174				9582194	Standard	NM_002948		Approved	RPL10, RPLY10, RPYL10, EC45, L15	uc003ccp.3	P61313	OTTHUMG00000130485	ENST00000307839.5:c.243C>T	3.37:g.23960001C>T		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	11.0	NM_001253383	P39030|P41051|Q5U0C0|Q642I1|Q6IPX6|Q8WYP2|Q96C44|Q9H2E5	Silent	SNP	ENST00000307839.5	37	CCDS2640.1																																																																																			C|0.992;T|0.008		0.448	RPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252885.3	NM_002948	
SNED1	25992	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	241979571	241979571	+	Silent	SNP	C	C	T			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr2:241979571C>T	ENST00000310397.8	+	7	1125	c.1125C>T	c.(1123-1125)tgC>tgT	p.C375C	AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000342631.6_Silent_p.C375C|SNED1_ENST00000401884.1_Silent_p.C375C|SNED1_ENST00000405547.3_Silent_p.C375C	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	375	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		TGTGTGTGTGCCAGGCCGGAT	0.632																																					p.C375C		.											.	SNED1	72	0			c.C1125T						.						33.0	40.0	37.0					2																	241979571		2136	4239	6375	SO:0001819	synonymous_variant	25992	exon7			TGTGTGCCAGGCC	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.1125C>T	2.37:g.241979571C>T		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	6.0	NM_001080437	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Silent	SNP	ENST00000310397.8	37	CCDS46562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.402|1.402	-0.577857|-0.577857	0.03854|0.03854	.|.	.|.	ENSG00000162804|ENSG00000162804	ENST00000431690|ENST00000401644	.|.	.|.	.|.	4.73|4.73	2.88|2.88	0.33553|0.33553	.|.	.|.	.|.	.|.	.|.	T|T	0.55752|0.55752	0.1940|0.1940	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.50048|0.50048	-0.8873|-0.8873	4|4	.|.	.|.	.|.	.|.	7.2772|7.2772	0.26292|0.26292	0.0:0.7194:0.0:0.2806|0.0:0.7194:0.0:0.2806	.|.	.|.	.|.	.|.	V|S	33|72	.|.	.|.	A|P	+|+	2|1	0|0	SNED1|SNED1	241628244|241628244	0.895000|0.895000	0.30542|0.30542	0.757000|0.757000	0.31301|0.31301	0.005000|0.005000	0.04900|0.04900	0.488000|0.488000	0.22371|0.22371	0.923000|0.923000	0.37045|0.37045	0.591000|0.591000	0.81541|0.81541	GCC|CCA	.		0.632	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
SPCS1	28972	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	52741737	52741737	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr3:52741737A>G	ENST00000602728.1	+	4	387	c.218A>G	c.(217-219)cAt>cGt	p.H73R	SPCS1_ENST00000423431.1_Missense_Mutation_p.H51R|SPCS1_ENST00000233025.7_Missense_Mutation_p.H140R|GLT8D1_ENST00000266014.5_5'Flank|GLT8D1_ENST00000491606.1_5'Flank|GLT8D1_ENST00000478968.2_5'Flank|GLT8D1_ENST00000407584.3_5'Flank			Q9Y6A9	SPCS1_HUMAN	signal peptidase complex subunit 1 homolog (S. cerevisiae)	73					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6				BRCA - Breast invasive adenocarcinoma(193;6.51e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)|OV - Ovarian serous cystadenocarcinoma(275;0.0469)		TATCGCCGGCATCCTCTCAAG	0.383																																					p.H140R		.											.	SPCS1	90	0			c.A419G						.						112.0	115.0	114.0					3																	52741737		2203	4300	6503	SO:0001583	missense	28972	exon4			GCCGGCATCCTCT	AF092138	CCDS33769.2	3p21.31	2005-01-05			ENSG00000114902	ENSG00000114902			23401	protein-coding gene	gene with protein product		610358				8632014	Standard	NM_014041		Approved	SPC12, HSPC033, YJR010C-A, SPC1	uc011bei.2	Q9Y6A9	OTTHUMG00000154930	ENST00000602728.1:c.218A>G	3.37:g.52741737A>G	ENSP00000473265:p.His73Arg	Somatic	428.0	2.0		WXS	Illumina HiSeq	Phase_I	383.0	28.0	NM_014041	B3KNF8|Q9BVW1	Missense_Mutation	SNP	ENST00000602728.1	37		.	.	.	.	.	.	.	.	.	.	A	26.7	4.767194	0.90020	.	.	ENSG00000114902	ENST00000423431;ENST00000233025	.	.	.	5.57	5.57	0.84162	.	0.137582	0.64402	D	0.000004	T	0.75280	0.3828	M	0.83384	2.64	0.43014	D	0.994551	P	0.52692	0.955	P	0.52343	0.696	T	0.80525	-0.1344	9	0.72032	D	0.01	-17.7892	15.7316	0.77810	1.0:0.0:0.0:0.0	.	140	Q9Y6A9	SPCS1_HUMAN	R	51;140	.	ENSP00000233025:H140R	H	+	2	0	SPCS1	52716777	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.417000	0.66423	2.109000	0.64355	0.482000	0.46254	CAT	.		0.383	SPCS1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467759.1	NM_014041	
TNKS	8658	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	9578010	9578010	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr8:9578010A>G	ENST00000310430.6	+	12	1902	c.1876A>G	c.(1876-1878)Aca>Gca	p.T626A	TNKS_ENST00000518281.1_Missense_Mutation_p.T389A	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	626					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		ACAAGGCTTCACAGCAGCACA	0.522																																					p.T626A		.											.	TNKS	660	0			c.A1876G						.						71.0	63.0	66.0					8																	9578010		2203	4300	6503	SO:0001583	missense	8658	exon12			GGCTTCACAGCAG	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.1876A>G	8.37:g.9578010A>G	ENSP00000311579:p.Thr626Ala	Somatic	132.0	1.0		WXS	Illumina HiSeq	Phase_I	121.0	33.0	NM_003747	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	A	17.91	3.504154	0.64410	.	.	ENSG00000173273	ENST00000310430;ENST00000518281	T;T	0.65916	0.07;-0.18	5.98	5.98	0.97165	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.67449	0.2894	M	0.74881	2.28	0.80722	D	1	P	0.36837	0.571	B	0.39419	0.299	T	0.71639	-0.4532	10	0.87932	D	0	.	16.4781	0.84144	1.0:0.0:0.0:0.0	.	626	O95271	TNKS1_HUMAN	A	626;389	ENSP00000311579:T626A;ENSP00000429890:T389A	ENSP00000311579:T626A	T	+	1	0	TNKS	9615420	1.000000	0.71417	0.999000	0.59377	0.689000	0.40095	7.356000	0.79445	2.288000	0.76882	0.528000	0.53228	ACA	.		0.522	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
UTP20	27340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101679570	101679570	+	Silent	SNP	T	T	C			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr12:101679570T>C	ENST00000261637.4	+	4	411	c.237T>C	c.(235-237)aaT>aaC	p.N79N		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	79					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AATCATTCAATCAGTTGGTGT	0.363																																					p.N79N		.											.	UTP20	155	0			c.T237C						.						100.0	100.0	100.0					12																	101679570		2203	4300	6503	SO:0001819	synonymous_variant	27340	exon4			ATTCAATCAGTTG	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.237T>C	12.37:g.101679570T>C		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	32.0	NM_014503	Q9H3H4	Silent	SNP	ENST00000261637.4	37	CCDS9081.1																																																																																			.		0.363	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
ZNF91	7644	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23557476	23557476	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M8-01A-11D-A33Q-10	TCGA-G3-A7M8-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ebbad8e2-34d1-4dfb-9d3b-96d717f3c94d	5ce7cd8f-dec6-4766-bc13-35f2ff250c92	g.chr19:23557476C>A	ENST00000300619.7	-	2	326	c.121G>T	c.(121-123)Gtg>Ttg	p.V41L	ZNF91_ENST00000397082.2_Missense_Mutation_p.V41L|ZNF91_ENST00000599743.1_Missense_Mutation_p.V41L	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	41	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TCTAACATCACATTCCTATAT	0.373																																					p.V41L		.											.	ZNF91	90	0			c.G121T						.						80.0	89.0	86.0					19																	23557476		2202	4300	6502	SO:0001583	missense	7644	exon2			ACATCACATTCCT	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.121G>T	19.37:g.23557476C>A	ENSP00000300619:p.Val41Leu	Somatic	326.0	1.0		WXS	Illumina HiSeq	Phase_I	291.0	102.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.407371	0.25378	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.03801	3.8;3.8	0.149	0.149	0.14863	Krueppel-associated box (4);	.	.	.	.	T	0.13200	0.0320	H	0.95712	3.71	0.18873	N	0.999989	B;B	0.32829	0.386;0.328	B;B	0.35240	0.198;0.18	T	0.10405	-1.0631	8	0.72032	D	0.01	.	.	.	.	.	41;41	Q05481-2;Q05481	.;ZNF91_HUMAN	L	41	ENSP00000300619:V41L;ENSP00000380272:V41L	ENSP00000300619:V41L	V	-	1	0	ZNF91	23349316	0.026000	0.19158	0.610000	0.28997	0.609000	0.37215	-0.113000	0.10774	0.192000	0.20272	0.195000	0.17529	GTG	.		0.373	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
