#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A2ML1	144568	bcgsc.ca;mdanderson.org	37	12	8994020	8994020	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:8994020T>A	ENST00000299698.7	+	11	1316	c.1136T>A	c.(1135-1137)gTg>gAg	p.V379E		NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						GTGTTTCTGGTGATTTATGGC	0.443																																					p.V379E		.											.	A2ML1	93	0			c.T1136A						.						134.0	123.0	126.0					12																	8994020		1903	4142	6045	SO:0001583	missense	144568	exon11			TTCTGGTGATTTA	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1136T>A	12.37:g.8994020T>A	ENSP00000299698:p.Val379Glu	Somatic	77.0	2.0		WXS	Illumina HiSeq	Phase_1	71.0	26.0	NM_144670		Missense_Mutation	SNP	ENST00000299698.7	37	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	T	13.68	2.309174	0.40895	.	.	ENSG00000166535	ENST00000299698;ENST00000539161	T	0.32753	1.44	3.96	3.96	0.45880	.	0.371511	0.19764	N	0.106606	T	0.27454	0.0674	L	0.49350	1.555	0.80722	D	1	B	0.34329	0.449	B	0.39562	0.303	T	0.02975	-1.1087	10	0.17832	T	0.49	.	7.4835	0.27419	0.0:0.1005:0.0:0.8995	.	379	A8K2U0	A2ML1_HUMAN	E	379	ENSP00000299698:V379E	ENSP00000299698:V379E	V	+	2	0	A2ML1	8885287	0.995000	0.38212	0.912000	0.35992	0.801000	0.45260	1.671000	0.37513	2.025000	0.59659	0.533000	0.62120	GTG	.		0.443	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	48431663	48431663	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:48431663G>T	ENST00000435803.1	+	38	11824	c.11800G>T	c.(11800-11802)Gaa>Taa	p.E3934*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3934	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E3879K(1)|p.E3934K(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CACCGTCCGGGAACATTTGCT	0.517																																					p.E3934X		.											.	ABCA13	521	2	Substitution - Missense(2)	skin(2)	c.G11800T						.						124.0	127.0	126.0					7																	48431663		2021	4180	6201	SO:0001587	stop_gained	154664	exon38			GTCCGGGAACATT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11800G>T	7.37:g.48431663G>T	ENSP00000411096:p.Glu3934*	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	21.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	52	19.415468	0.99919	.	.	ENSG00000179869	ENST00000435803	.	.	.	5.32	5.32	0.75619	.	0.000000	0.41294	U	0.000908	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.7134	0.77649	0.0:0.0:1.0:0.0	.	.	.	.	X	3934	.	ENSP00000411096:E3934X	E	+	1	0	ABCA13	48402209	1.000000	0.71417	0.046000	0.18839	0.049000	0.14656	8.042000	0.89430	2.485000	0.83878	0.467000	0.42956	GAA	.		0.517	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCA5	23461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	67287403	67287403	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:67287403C>T	ENST00000392676.3	-	12	1624	c.1560G>A	c.(1558-1560)aaG>aaA	p.K520K	ABCA5_ENST00000392677.2_Silent_p.K520K|ABCA5_ENST00000588877.1_Silent_p.K520K			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	520	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TCAATGTACTCTTTCCTGTTC	0.333																																					p.K520K		.											.	ABCA5	93	0			c.G1560A						.						94.0	91.0	92.0					17																	67287403		2203	4300	6503	SO:0001819	synonymous_variant	23461	exon11			TGTACTCTTTCCT	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.1560G>A	17.37:g.67287403C>T		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	18.0	NM_018672	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Silent	SNP	ENST00000392676.3	37	CCDS11685.1																																																																																			.		0.333	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
ACTR6	64431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	100594687	100594687	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:100594687G>A	ENST00000188312.2	+	1	823	c.58G>A	c.(58-60)Gaa>Aaa	p.E20K	ACTR6_ENST00000552376.1_Missense_Mutation_p.E20K|ACTR6_ENST00000550813.1_3'UTR|ACTR6_ENST00000551617.1_5'UTR|ACTR6_ENST00000546902.1_5'UTR	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	20						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						TTACAGCCATGAAAATGTGTC	0.463																																					p.E20K		.											.	ACTR6	91	0			c.G58A						.						238.0	193.0	208.0					12																	100594687		2203	4300	6503	SO:0001583	missense	64431	exon1			AGCCATGAAAATG	AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.58G>A	12.37:g.100594687G>A	ENSP00000188312:p.Glu20Lys	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	11.0	NM_022496	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	37	CCDS9074.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732152	0.48939	.	.	ENSG00000075089	ENST00000188312;ENST00000552376	D;D	0.96104	-3.91;-3.91	5.5	4.6	0.57074	.	0.251983	0.45126	D	0.000385	D	0.95121	0.8419	M	0.79011	2.435	0.80722	D	1	P;B;B	0.35242	0.492;0.098;0.119	B;B;B	0.38225	0.268;0.107;0.171	D	0.95250	0.8359	10	0.87932	D	0	.	14.4601	0.67442	0.0722:0.0:0.9278:0.0	.	20;20;20	B4DLG9;F8W057;Q9GZN1	.;.;ARP6_HUMAN	K	20	ENSP00000188312:E20K;ENSP00000447237:E20K	ENSP00000188312:E20K	E	+	1	0	ACTR6	99118818	1.000000	0.71417	0.996000	0.52242	0.301000	0.27625	4.773000	0.62331	2.854000	0.98071	0.655000	0.94253	GAA	.		0.463	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496	
ADRA1A	148	ucsc.edu;bcgsc.ca	37	8	26627995	26627995	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:26627995A>G	ENST00000519229.1	-	2	1078	c.1072T>C	c.(1072-1074)Tac>Cac	p.Y358H	ADRA1A_ENST00000380582.3_Missense_Mutation_p.Y358H|ADRA1A_ENST00000354550.4_Missense_Mutation_p.Y358H|ADRA1A_ENST00000380573.3_Missense_Mutation_p.Y358H|ADRA1A_ENST00000276393.4_Missense_Mutation_p.Y358H|ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380586.1_Missense_Mutation_p.Y358H			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	321					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TGCAGGGTGTAGCCCAGGGCA	0.542																																					p.Y358H		.											.	ADRA1A	587	0			c.T1072C						.						139.0	138.0	138.0					8																	26627995		2203	4300	6503	SO:0001583	missense	148	exon2			GGGTGTAGCCCAG	L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.1072T>C	8.37:g.26627995A>G	ENSP00000430793:p.Tyr358His	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_033303	Q9NPY0	Missense_Mutation	SNP	ENST00000519229.1	37		.	.	.	.	.	.	.	.	.	.	A	11.42	1.634753	0.29068	.	.	ENSG00000120907	ENST00000380586;ENST00000380582;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573	T;T;T;T;T;T	0.62105	0.1;0.11;0.08;0.05;0.07;0.07	5.96	5.96	0.96718	.	0.596543	0.16125	N	0.228469	T	0.61413	0.2345	L	0.57536	1.79	0.80722	D	1	B;B;B;B	0.16603	0.018;0.014;0.002;0.008	B;B;B;B	0.17722	0.013;0.019;0.004;0.009	T	0.55679	-0.8103	10	0.36615	T	0.2	.	16.1012	0.81172	1.0:0.0:0.0:0.0	.	358;358;358;358	P35348;P35348-4;P35348-3;B0ZBD3	ADA1A_HUMAN;.;.;.	H	358	ENSP00000369960:Y358H;ENSP00000369956:Y358H;ENSP00000430793:Y358H;ENSP00000346557:Y358H;ENSP00000276393:Y358H;ENSP00000369947:Y358H	ENSP00000276393:Y358H	Y	-	1	0	ADRA1A	26683912	1.000000	0.71417	0.968000	0.41197	0.197000	0.23852	5.218000	0.65257	2.279000	0.76181	0.533000	0.62120	TAC	.		0.542	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000376207.1	NM_033303	
ADAM18	8749	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	39505913	39505913	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:39505913G>C	ENST00000265707.5	+	12	1142	c.1097G>C	c.(1096-1098)aGa>aCa	p.R366T	ADAM18_ENST00000379866.1_Missense_Mutation_p.R342T|ADAM18_ENST00000541111.1_Intron	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	366	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CACGACTATAGATATTTTGTT	0.348																																					p.R366T		.											.	ADAM18	228	0			c.G1097C						.						62.0	63.0	63.0					8																	39505913		2203	4300	6503	SO:0001583	missense	8749	exon12			ACTATAGATATTT	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1097G>C	8.37:g.39505913G>C	ENSP00000265707:p.Arg366Thr	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	12.0	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	37	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	G	5.674	0.308908	0.10733	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	T;T	0.63580	-0.05;-0.05	5.4	-5.51	0.02568	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.930373	0.08987	N	0.864945	T	0.43831	0.1265	L	0.52364	1.645	0.09310	N	1	B;B	0.14805	0.009;0.011	B;B	0.18263	0.012;0.021	T	0.34527	-0.9825	10	0.22109	T	0.4	.	0.9863	0.01447	0.3381:0.3169:0.1508:0.1942	.	342;366	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	T	366;342;298	ENSP00000265707:R366T;ENSP00000369195:R342T	ENSP00000265707:R366T	R	+	2	0	ADAM18	39625070	0.002000	0.14202	0.000000	0.03702	0.034000	0.12701	-0.404000	0.07205	-0.904000	0.03876	0.585000	0.79938	AGA	.		0.348	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
ADAM18	8749	broad.mit.edu;bcgsc.ca	37	8	39505935	39505935	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:39505935G>A	ENST00000265707.5	+	12	1164	c.1119G>A	c.(1117-1119)gaG>gaA	p.E373E	ADAM18_ENST00000379866.1_Silent_p.E349E|ADAM18_ENST00000541111.1_Intron	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	373	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CAAAATTTGAGACTAAATGCC	0.353																																					p.E373E		.											.	ADAM18	228	0			c.G1119A						.						65.0	66.0	65.0					8																	39505935		2203	4300	6503	SO:0001819	synonymous_variant	8749	exon12			ATTTGAGACTAAA	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1119G>A	8.37:g.39505935G>A		Somatic	167.0	1.0		WXS	Illumina HiSeq	Phase_I	158.0	12.0	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Silent	SNP	ENST00000265707.5	37	CCDS6113.1																																																																																			.		0.353	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
AKAP4	8852	broad.mit.edu;bcgsc.ca	37	X	49957907	49957907	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chrX:49957907G>T	ENST00000376056.2	-	5	1580	c.1430C>A	c.(1429-1431)cCa>cAa	p.P477Q	AKAP4_ENST00000358526.2_Missense_Mutation_p.P486Q|AKAP4_ENST00000376064.3_Missense_Mutation_p.P477Q|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TGACTTGCATGGGTCTGATTT	0.463																																					p.P486Q		.											.	AKAP4	540	0			c.C1457A						.						163.0	147.0	152.0					X																	49957907		2203	4300	6503	SO:0001583	missense	8852	exon5			TTGCATGGGTCTG	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1430C>A	X.37:g.49957907G>T	ENSP00000365224:p.Pro477Gln	Somatic	60.0	2.0		WXS	Illumina HiSeq	Phase_I	53.0	39.0	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.480175	0.01027	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.06449	3.3;3.3;3.3	4.82	-6.56	0.01848	A-kinase anchor 110kDa, C-terminal (1);	0.786745	0.10958	N	0.615311	T	0.03263	0.0095	N	0.11364	0.135	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.44236	-0.9341	9	.	.	.	-0.469	16.1312	0.81442	0.0:0.0:0.8026:0.1974	.	486	Q5JQC9	AKAP4_HUMAN	Q	477;486;477	ENSP00000365224:P477Q;ENSP00000351327:P486Q;ENSP00000365232:P477Q	.	P	-	2	0	AKAP4	49844647	0.000000	0.05858	0.000000	0.03702	0.231000	0.25187	-0.278000	0.08490	-0.966000	0.03587	0.458000	0.33432	CCA	.		0.463	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
AMOTL2	51421	broad.mit.edu;ucsc.edu;mdanderson.org	37	3	134076549	134076549	+	Nonstop_Mutation	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:134076549A>C	ENST00000422605.2	-	10	2504	c.2338T>G	c.(2338-2340)Tga>Gga	p.*780G	AMOTL2_ENST00000514516.1_Nonstop_Mutation_p.*838G|AMOTL2_ENST00000249883.5_Nonstop_Mutation_p.*781G|AMOTL2_ENST00000513145.1_Nonstop_Mutation_p.*778G|RPL39P5_ENST00000273411.2_RNA			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	0					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						CACCTCCTTCAGATCAGTATC	0.547																																					p.X781G		.											.	AMOTL2	135	0			c.T2341G						.						235.0	190.0	205.0					3																	134076549		2203	4300	6503	SO:0001578	stop_lost	51421	exon10			TCCTTCAGATCAG	AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.2338T>G	3.37:g.134076549A>C	ENSP00000409999:p.*780Argext*43	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	5.0	NM_016201	A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Missense_Mutation	SNP	ENST00000422605.2	37		.	.	.	.	.	.	.	.	.	.	A	19.03	3.746964	0.69418	.	.	ENSG00000114019	ENST00000249883;ENST00000422605;ENST00000514516;ENST00000513145	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9909	0.64367	1.0:0.0:0.0:0.0	.	.	.	.	G	781;780;838;778	.	.	X	-	1	0	AMOTL2	135559239	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.502000	0.73695	2.030000	0.59900	0.533000	0.62120	TGA	.		0.547	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358149.1	NM_016201	
LVRN	206338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	115323605	115323605	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:115323605G>C	ENST00000357872.4	+	4	1198	c.1074G>C	c.(1072-1074)ttG>ttC	p.L358F	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		358						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										TGGAGGATTTGTTTAATATCA	0.423																																					p.L358F		.											.	.	.	0			c.G1074C						.						166.0	158.0	161.0					5																	115323605		2202	4300	6502	SO:0001583	missense	0	exon4			GGATTTGTTTAAT																												ENST00000357872.4:c.1074G>C	5.37:g.115323605G>C	ENSP00000350541:p.Leu358Phe	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	13.0	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	G	9.466	1.094306	0.20471	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.02631	4.22	5.14	1.06	0.20224	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.289067	0.24323	N	0.039539	T	0.04679	0.0127	L	0.31926	0.97	0.80722	D	1	D	0.53312	0.959	P	0.56960	0.81	T	0.55360	-0.8153	10	0.22706	T	0.39	.	7.9111	0.29791	0.6546:0.0:0.3454:0.0	.	358	Q6Q4G3	AMPQ_HUMAN	F	358;347	ENSP00000350541:L358F	ENSP00000350541:L358F	L	+	3	2	AC010282.1	115351504	0.929000	0.31497	0.998000	0.56505	0.981000	0.71138	0.051000	0.14141	-0.103000	0.12175	-0.471000	0.05019	TTG	.		0.423	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
ARHGAP15	55843	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	144314011	144314011	+	Silent	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:144314011C>A	ENST00000295095.6	+	11	1127	c.960C>A	c.(958-960)ggC>ggA	p.G320G	RP11-570L15.1_ENST00000553076.1_RNA|RP11-570L15.2_ENST00000546678.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	320	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		GAGTTAGTGGCAATCTGGCAA	0.313																																					p.G320G		.											.	ARHGAP15	653	0			c.C960A						.						197.0	204.0	201.0					2																	144314011		2203	4297	6500	SO:0001819	synonymous_variant	55843	exon11			TAGTGGCAATCTG	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.960C>A	2.37:g.144314011C>A		Somatic	68.0	1.0		WXS	Illumina HiSeq	Phase_I	50.0	24.0	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Silent	SNP	ENST00000295095.6	37	CCDS2184.1																																																																																			.		0.313	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
ARNT2	9915	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	80762629	80762629	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr15:80762629A>G	ENST00000303329.4	+	4	430	c.265A>G	c.(265-267)Atg>Gtg	p.M89V	ARNT2_ENST00000527771.1_Missense_Mutation_p.M78V|ARNT2_ENST00000531595.3_3'UTR|ARNT2_ENST00000533983.1_Missense_Mutation_p.M78V	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	89	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			GCTCTCCGACATGGTCCCCAC	0.547																																					p.M89V		.											.	ARNT2	175	0			c.A265G						.						85.0	72.0	77.0					15																	80762629		2203	4300	6503	SO:0001583	missense	9915	exon4			TCCGACATGGTCC	AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.265A>G	15.37:g.80762629A>G	ENSP00000307479:p.Met89Val	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	8.0	NM_014862	B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	ENST00000303329.4	37	CCDS32307.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.380205	0.82682	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	D	0.97831	-4.56	5.0	5.0	0.66597	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.97328	0.9126	M	0.62154	1.92	0.80722	D	1	P;P	0.51449	0.945;0.576	P;P	0.50049	0.629;0.513	D	0.97875	1.0288	10	0.87932	D	0	.	14.8575	0.70351	1.0:0.0:0.0:0.0	.	89;89	Q9HBZ2;Q86TN1	ARNT2_HUMAN;.	V	78;89;89	ENSP00000307479:M89V	ENSP00000307479:M89V	M	+	1	0	ARNT2	78549684	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.697000	0.91307	2.099000	0.63709	0.528000	0.53228	ATG	.		0.547	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2		
ASCC3	10973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	101166124	101166124	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:101166124C>T	ENST00000369162.2	-	12	2250	c.1906G>A	c.(1906-1908)Gaa>Aaa	p.E636K	ASCC3_ENST00000522650.1_Missense_Mutation_p.E636K	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	636	Helicase ATP-binding 1. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TGTGTGGATTCCACCTATATG	0.303																																					p.E636K		.											.	ASCC3	96	0			c.G1906A						.						83.0	83.0	83.0					6																	101166124		2203	4300	6503	SO:0001583	missense	10973	exon12			TGGATTCCACCTA	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.1906G>A	6.37:g.101166124C>T	ENSP00000358159:p.Glu636Lys	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	19.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	32	5.148786	0.94603	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	T;T	0.14640	2.49;2.49	5.36	5.36	0.76844	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.119748	0.56097	D	0.000034	T	0.34164	0.0888	M	0.81614	2.55	0.80722	D	1	D;D	0.71674	0.998;0.992	D;D	0.73380	0.98;0.954	T	0.18524	-1.0334	10	0.66056	D	0.02	.	19.0903	0.93224	0.0:1.0:0.0:0.0	.	636;636	E7EW23;Q8N3C0	.;HELC1_HUMAN	K	636	ENSP00000358159:E636K;ENSP00000430769:E636K	ENSP00000358159:E636K	E	-	1	0	ASCC3	101272845	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	7.818000	0.86416	2.499000	0.84300	0.585000	0.79938	GAA	.		0.303	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
ATP2C2	9914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	84444352	84444352	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr16:84444352G>T	ENST00000262429.4	+	6	585	c.496G>T	c.(496-498)Gtt>Ttt	p.V166F	ATP2C2_ENST00000420010.2_Intron|ATP2C2_ENST00000416219.2_Missense_Mutation_p.V166F	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	166					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						GACCAAGATGGTTCCTCCAGA	0.507																																					p.V166F		.											.	ATP2C2	91	0			c.G496T						.						53.0	50.0	51.0					16																	84444352		1914	4115	6029	SO:0001583	missense	9914	exon6			AAGATGGTTCCTC	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.496G>T	16.37:g.84444352G>T	ENSP00000262429:p.Val166Phe	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	16.0	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592570	0.66219	.	.	ENSG00000064270	ENST00000416219;ENST00000262429	D;D	0.91011	-2.77;-2.77	4.84	4.84	0.62591	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.191324	0.35096	N	0.003441	D	0.97195	0.9083	H	0.98178	4.165	0.52099	D	0.999945	D;D;D	0.69078	0.997;0.996;0.997	D;D;D	0.79784	0.993;0.978;0.993	D	0.98821	1.0747	10	0.72032	D	0.01	.	16.4968	0.84247	0.0:0.0:1.0:0.0	.	166;183;166	E7ES94;O75185-2;O75185	.;.;AT2C2_HUMAN	F	166	ENSP00000397925:V166F;ENSP00000262429:V166F	ENSP00000262429:V166F	V	+	1	0	ATP2C2	83001853	1.000000	0.71417	0.988000	0.46212	0.667000	0.39255	6.769000	0.74985	2.233000	0.73108	0.585000	0.79938	GTT	.		0.507	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
C10orf11	83938	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	77795792	77795792	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:77795792G>A	ENST00000372499.1	+	2	289	c.74G>A	c.(73-75)aGg>aAg	p.R25K	C10orf11_ENST00000593699.1_3'UTR	NM_032024.3	NP_114413.1	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11	25					melanocyte differentiation (GO:0030318)					endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	10	Prostate(51;0.0095)|all_epithelial(25;0.0221)					AGCGCATTCAGGAGCCTGGAG	0.488											OREG0020279	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R25K		.											.	C10orf11	90	0			c.G74A						.						185.0	157.0	167.0					10																	77795792		2203	4300	6503	SO:0001583	missense	83938	exon2			CATTCAGGAGCCT	AF267860	CCDS7351.1	10q22.3	2013-08-22			ENSG00000148655	ENSG00000148655			23405	protein-coding gene	gene with protein product	"""oculocutaneous albinism 7, autosomal recessive"""	614537				23395477	Standard	NM_032024		Approved	CDA017, OCA7	uc001jxi.3	Q9H2I8	OTTHUMG00000018532	ENST00000372499.1:c.74G>A	10.37:g.77795792G>A	ENSP00000361577:p.Arg25Lys	Somatic	56.0	1.0	1178	WXS	Illumina HiSeq	Phase_I	33.0	14.0	NM_032024	B1AVW6	Missense_Mutation	SNP	ENST00000372499.1	37	CCDS7351.1	.	.	.	.	.	.	.	.	.	.	G	2.650	-0.282192	0.05642	.	.	ENSG00000148655	ENST00000354343;ENST00000372499	T	0.29655	1.56	4.39	2.25	0.28309	.	0.712589	0.13086	N	0.414957	T	0.14614	0.0353	N	0.11724	0.165	0.23765	N	0.996907	B	0.02656	0.0	B	0.04013	0.001	T	0.27226	-1.0080	10	0.05620	T	0.96	-1.4813	10.9443	0.47292	0.1706:0.0:0.8294:0.0	.	25	Q9H2I8	CJ011_HUMAN	K	53;25	ENSP00000361577:R25K	ENSP00000346310:R53K	R	+	2	0	C10orf11	77465798	1.000000	0.71417	0.984000	0.44739	0.984000	0.73092	1.720000	0.38022	0.430000	0.26230	0.455000	0.32223	AGG	.		0.488	C10orf11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048839.1	NM_032024	
C9orf156	51531	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	100667207	100667207	+	Silent	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:100667207C>A	ENST00000375119.3	-	5	1210	c.1134G>T	c.(1132-1134)gtG>gtT	p.V378V		NM_016481.3	NP_057565.3	Q9BU70	NAP1_HUMAN	chromosome 9 open reading frame 156	378					viral process (GO:0016032)		hydrolase activity (GO:0016787)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)	13		Acute lymphoblastic leukemia(62;0.158)				CCGCTGACAGCACAGCCTCAA	0.478																																					p.V378V		.											.	C9orf156	90	0			c.G1134T						.						80.0	77.0	78.0					9																	100667207		2203	4300	6503	SO:0001819	synonymous_variant	51531	exon5			TGACAGCACAGCC	AK023069	CCDS6730.1	9q31.1	2011-03-02			ENSG00000136932	ENSG00000136932			30967	protein-coding gene	gene with protein product	"""Nef (lentivirus myristoylated factor) associated protein 1"""						Standard	NM_016481		Approved	HSPC219, NAP1	uc004axv.1	Q9BU70	OTTHUMG00000021007	ENST00000375119.3:c.1134G>T	9.37:g.100667207C>A		Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	5.0	NM_016481	Q5T113|Q86SK0|Q9NXJ7|Q9P0Q7	Silent	SNP	ENST00000375119.3	37	CCDS6730.1																																																																																			.		0.478	C9orf156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055401.1	NM_016481	
CDRT1	374286	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	15522794	15522794	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:15522794G>A	ENST00000395906.3	-	1	32	c.33C>T	c.(31-33)gcC>gcT	p.A11A	RP11-385D13.1_ENST00000455584.2_Intron	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	11										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		GAAAATAGGGGGCATTCTTGA	0.493																																					p.A11A		.											.	CDRT1	68	0			c.C33T						.						199.0	224.0	216.0					17																	15522794		2203	4297	6500	SO:0001819	synonymous_variant	374286	exon1			ATAGGGGGCATTC	U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.33C>T	17.37:g.15522794G>A		Somatic	174.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	35.0	NM_006382	O43848|O95611	Silent	SNP	ENST00000395906.3	37	CCDS45619.1																																																																																			.		0.493	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448127.1	NM_006382	
CBX4	8535	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	77808471	77808471	+	Missense_Mutation	SNP	G	G	A	rs138355116		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:77808471G>A	ENST00000269397.4	-	5	1147	c.970C>T	c.(970-972)Ccg>Tcg	p.P324S		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	324	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.P324S(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTCTTGGGCGGCGCCTCCACC	0.672											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P324S		.											CBX4,abdomen,malignant_melanoma,0	CBX4	228	1	Substitution - Missense(1)	skin(1)	c.C970T						.						26.0	26.0	26.0					17																	77808471		2202	4300	6502	SO:0001583	missense	8535	exon5			TGGGCGGCGCCTC	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.970C>T	17.37:g.77808471G>A	ENSP00000269397:p.Pro324Ser	Somatic	39.0	0.0	1178	WXS	Illumina HiSeq	Phase_I	27.0	11.0	NM_003655	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	37	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	g	8.228	0.803951	0.16467	.	.	ENSG00000141582	ENST00000269397	.	.	.	3.67	1.54	0.23209	.	0.686289	0.10318	U	0.689154	T	0.26629	0.0651	L	0.44542	1.39	0.18873	N	0.999981	B	0.16802	0.019	B	0.14578	0.011	T	0.30995	-0.9959	9	0.10636	T	0.68	-24.3783	1.2937	0.02065	0.1348:0.1775:0.3268:0.361	.	324	O00257	CBX4_HUMAN	S	324	.	ENSP00000269397:P324S	P	-	1	0	CBX4	75423066	0.781000	0.28676	0.003000	0.11579	0.868000	0.49771	1.202000	0.32271	0.059000	0.16252	-0.851000	0.03033	CCG	.		0.672	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
CFI	3426	broad.mit.edu;bcgsc.ca	37	4	110682850	110682850	+	Splice_Site	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:110682850T>A	ENST00000394634.2	-	4	690		c.e4-2		CFI_ENST00000394635.3_Splice_Site|CFI_ENST00000512148.1_Splice_Site	NM_000204.3	NP_000195	P05156	CFAI_HUMAN	complement factor I						complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|skin(2)|stomach(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		TCAGCACCTCTGCAAATAGAA	0.368																																					.		.											.	CFI	90	0			c.483-2A>T						.						81.0	86.0	85.0					4																	110682850		2203	4300	6503	SO:0001630	splice_region_variant	3426	exon5			CACCTCTGCAAAT	J02770	CCDS34049.1	4q25	2014-09-17	2006-02-10	2006-02-10		ENSG00000205403	3.4.21.45	"""Complement system"""	5394	protein-coding gene	gene with protein product	"""Konglutinogen-activating factor"", ""C3b-inactivator"""	217030	"""I factor (complement)"""	IF		2956252	Standard	NM_000204		Approved	FI, C3b-INA, KAF	uc003hzr.4	P05156		ENST00000394634.2:c.483-2A>T	4.37:g.110682850T>A		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	7.0	NM_000204	O60442	Splice_Site	SNP	ENST00000394634.2	37	CCDS34049.1	.	.	.	.	.	.	.	.	.	.	.	14.00	2.404923	0.42613	.	.	ENSG00000205403	ENST00000394635;ENST00000394634;ENST00000540104;ENST00000512148;ENST00000536228	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9694	0.58503	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CFI	110902299	1.000000	0.71417	0.986000	0.45419	0.122000	0.20287	5.330000	0.65899	1.992000	0.58205	0.482000	0.46254	.	.		0.368	CFI-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_000204	Intron
CGN	57530	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151502577	151502577	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:151502577C>T	ENST00000271636.7	+	12	2432	c.2299C>T	c.(2299-2301)Ctg>Ttg	p.L767L	SNORA44_ENST00000517031.1_RNA	NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	761	Glu-rich.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACGGGACAAGCTGCAGCGGCT	0.587																																					p.L767L		.											.	CGN	93	0			c.C2299T						.						76.0	76.0	76.0					1																	151502577		2203	4300	6503	SO:0001819	synonymous_variant	57530	exon12			GACAAGCTGCAGC	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.2299C>T	1.37:g.151502577C>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	9.0	NM_020770	A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	ENST00000271636.7	37	CCDS999.1																																																																																			.		0.587	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
CHDH	55349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	53851908	53851908	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:53851908T>C	ENST00000315251.6	-	9	2118	c.1681A>G	c.(1681-1683)Atc>Gtc	p.I561V		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	561					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	GCGATCATGATTGTGGGGGCG	0.597																																					p.I561V		.											.	CHDH	91	0			c.A1681G						.						98.0	80.0	86.0					3																	53851908		2203	4300	6503	SO:0001583	missense	55349	exon9			TCATGATTGTGGG	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.1681A>G	3.37:g.53851908T>C	ENSP00000319851:p.Ile561Val	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	25.0	NM_018397	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	T	11.41	1.630713	0.28978	.	.	ENSG00000016391	ENST00000315251	T	0.41758	0.99	5.69	1.48	0.22813	Glucose-methanol-choline oxidoreductase, C-terminal (1);	0.120942	0.56097	N	0.000039	T	0.32734	0.0839	L	0.39898	1.24	0.47037	D	0.999293	B	0.19073	0.033	B	0.21708	0.036	T	0.11421	-1.0588	10	0.62326	D	0.03	-24.6102	9.8993	0.41338	0.0:0.2126:0.0:0.7874	.	561	Q8NE62	CHDH_HUMAN	V	561	ENSP00000319851:I561V	ENSP00000319851:I561V	I	-	1	0	CHDH	53826948	0.995000	0.38212	0.181000	0.23098	0.410000	0.31052	2.417000	0.44653	0.017000	0.15025	-0.290000	0.09829	ATC	.		0.597	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
CLEC2A	387836	ucsc.edu;mdanderson.org	37	12	10066275	10066275	+	Nonsense_Mutation	SNP	C	C	A	rs115598241	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:10066275C>A	ENST00000455827.1	-	5	466	c.415G>T	c.(415-417)Gaa>Taa	p.E139*	CLEC2A_ENST00000339766.4_Intron	NM_001130711.1	NP_001124183.1	Q6UVW9	CLC2A_HUMAN	C-type lectin domain family 2, member A	139	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				natural killer cell mediated cytotoxicity (GO:0042267)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	4						CCTATAATTTCAAACCTGAAA	0.338																																					p.E139X		.											.	.	.	0			c.G415T						.						83.0	70.0	74.0					12																	10066275		692	1591	2283	SO:0001587	stop_gained	387836	exon5			TAATTTCAAACCT	AY359126	CCDS44829.1, CCDS8606.1	12p13.31	2010-06-30			ENSG00000188393	ENSG00000188393		"""C-type lectin domain containing"""	24191	protein-coding gene	gene with protein product	"""keratinocyte-associated C-type lectin"", ""proliferation-induced lymphocyte-associated receptor"""	612087				12975309	Standard	NM_001130711		Approved	UNQ5792, INPE5792, KACL, PILAR	uc009zhc.2	Q6UVW9	OTTHUMG00000140393	ENST00000455827.1:c.415G>T	12.37:g.10066275C>A	ENSP00000396163:p.Glu139*	Somatic	18.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_001130711	A5Y4G5|A9QKS2|A9QKS3	Nonsense_Mutation	SNP	ENST00000455827.1	37	CCDS44829.1	.	.	.	.	.	.	.	.	.	.	C	7.933	0.741071	0.15642	.	.	ENSG00000188393	ENST00000455827	.	.	.	2.51	1.58	0.23477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	7.2101	0.25929	0.0:0.6883:0.3117:0.0	.	.	.	.	X	139	.	ENSP00000396163:E139X	E	-	1	0	CLEC2A	9957542	0.284000	0.24287	0.992000	0.48379	0.067000	0.16453	-0.085000	0.11250	0.594000	0.29761	0.313000	0.20887	GAA	C|0.984;G|0.016		0.338	CLEC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399919.1	NM_207375	
COL5A1	1289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137630354	137630354	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:137630354G>A	ENST00000371817.3	+	10	1838	c.1424G>A	c.(1423-1425)gGc>gAc	p.G475D		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	475	Interrupted collagenous region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGCCCAGAAGGCCCCGCGGTG	0.632																																					p.G475D		.											.	COL5A1	524	0			c.G1424A						.						44.0	47.0	46.0					9																	137630354		2203	4300	6503	SO:0001583	missense	1289	exon10			CAGAAGGCCCCGC	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1424G>A	9.37:g.137630354G>A	ENSP00000360882:p.Gly475Asp	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	26.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521900	0.44866	.	.	ENSG00000130635	ENST00000371817	D	0.99353	-5.77	4.69	4.69	0.59074	.	0.000000	0.85682	U	0.000000	D	0.99711	0.9889	H	0.99197	4.465	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.97007	0.9733	10	0.66056	D	0.02	.	16.3829	0.83481	0.0:0.0:1.0:0.0	.	475	P20908	CO5A1_HUMAN	D	475	ENSP00000360882:G475D	ENSP00000360882:G475D	G	+	2	0	COL5A1	136770175	1.000000	0.71417	0.999000	0.59377	0.201000	0.24016	5.554000	0.67294	2.166000	0.68216	0.491000	0.48974	GGC	.		0.632	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
CPNE9	151835	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9759770	9759770	+	Missense_Mutation	SNP	A	A	G	rs560497816		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:9759770A>G	ENST00000383832.3	+	16	1179	c.989A>G	c.(988-990)tAt>tGt	p.Y330C	CPNE9_ENST00000383831.3_Missense_Mutation_p.Y330C	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	330	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					CTCAGCGCCTATGCCATGGCC	0.567																																					.		.											.	CPNE9	70	0			.						.						85.0	85.0	85.0					3																	9759770		2119	4273	6392	SO:0001583	missense	151835	.			GCGCCTATGCCAT		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.989A>G	3.37:g.9759770A>G	ENSP00000373343:p.Tyr330Cys	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	15.0	.	A1L430|A6NDX6|A8MSP8	Missense_Mutation	SNP	ENST00000383832.3	37	CCDS2574.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.0|21.0	4.081671|4.081671	0.76528|0.76528	.|.	.|.	ENSG00000144550|ENSG00000144550	ENST00000273027|ENST00000383832;ENST00000383831	.|T;T	.|0.50001	.|0.76;0.76	5.27|5.27	5.27|5.27	0.74061|0.74061	.|von Willebrand factor, type A (2);Copine (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81356|0.81356	0.4805|0.4805	H|H	0.98802|0.98802	4.335|4.335	0.50467|0.50467	D|D	0.999875|0.999875	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.89049|0.89049	0.3454|0.3454	5|10	.|0.87932	.|D	.|0	.|.	14.878|14.878	0.70510|0.70510	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|330	.|Q8IYJ1	.|CPNE9_HUMAN	V|C	62|330	.|ENSP00000373343:Y330C;ENSP00000373342:Y330C	.|ENSP00000373342:Y330C	M|Y	+|+	1|2	0|0	CPNE9|CPNE9	9734770|9734770	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.911000|8.911000	0.92721|0.92721	1.977000|1.977000	0.57605|0.57605	0.523000|0.523000	0.50628|0.50628	ATG|TAT	.		0.567	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250205.4	NM_001033755	
CUBN	8029	broad.mit.edu;ucsc.edu	37	10	16870834	16870834	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:16870834G>T	ENST00000377833.4	-	66	10799	c.10734C>A	c.(10732-10734)agC>agA	p.S3578R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3578	CUB 27. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGGATGGAGAGCTGGCGTTGG	0.438											OREG0020047	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S3578R		.											.	CUBN	166	0			c.C10734A						.						127.0	118.0	121.0					10																	16870834		2203	4300	6503	SO:0001583	missense	8029	exon66			TGGAGAGCTGGCG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10734C>A	10.37:g.16870834G>T	ENSP00000367064:p.Ser3578Arg	Somatic	55.0	1.0	713	WXS	Illumina HiSeq	Phase_I	45.0	4.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	8.102	0.776958	0.16120	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.19105	2.17	5.74	-3.82	0.04281	CUB (5);	1.099270	0.07068	N	0.834907	T	0.21468	0.0517	L	0.55481	1.735	0.32735	N	0.508509	P	0.36392	0.551	B	0.37833	0.259	T	0.40040	-0.9584	10	0.48119	T	0.1	.	10.8469	0.46748	0.1268:0.1156:0.7575:0.0	.	3578	O60494	CUBN_HUMAN	R	3578;419	ENSP00000367064:S3578R	ENSP00000367064:S3578R	S	-	3	2	CUBN	16910840	0.011000	0.17503	0.000000	0.03702	0.005000	0.04900	0.203000	0.17315	-0.960000	0.03613	0.561000	0.74099	AGC	.		0.438	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
PRR32	100130613	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	125955203	125955203	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chrX:125955203G>C	ENST00000371125.3	+	2	662	c.582G>C	c.(580-582)gaG>gaC	p.E194D		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		194																	TAGTAATGGAGGTGCCGCCCG	0.537																																					p.E194D		.											.	.	.	0			c.G582C						.						48.0	46.0	47.0					X																	125955203		692	1591	2283	SO:0001583	missense	100130613	exon2			AATGGAGGTGCCG																												ENST00000371125.3:c.582G>C	X.37:g.125955203G>C	ENSP00000360166:p.Glu194Asp	Somatic	47.0	1.0		WXS	Illumina HiSeq	Phase_I	43.0	31.0	NM_001122716		Missense_Mutation	SNP	ENST00000371125.3	37	CCDS48163.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706266	0.48412	.	.	ENSG00000183631	ENST00000371125	T	0.47869	0.83	4.02	0.76	0.18442	.	0.000000	0.34156	N	0.004208	T	0.48714	0.1515	L	0.34521	1.04	0.09310	N	0.999995	D	0.76494	0.999	D	0.67900	0.954	T	0.35051	-0.9804	10	0.87932	D	0	-10.5594	5.7641	0.18217	0.4643:0.0:0.5356:0.0	.	194	B1ATL7	CX064_HUMAN	D	194	ENSP00000360166:E194D	ENSP00000360166:E194D	E	+	3	2	CXorf64	125782884	0.148000	0.22702	0.116000	0.21606	0.016000	0.09150	0.090000	0.15025	0.010000	0.14839	0.600000	0.82982	GAG	.		0.537	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058188.1		
DDR1	780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30866689	30866689	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:30866689G>T	ENST00000324771.8	+	19	3024	c.2476G>T	c.(2476-2478)Gtg>Ttg	p.V826L	DDR1_ENST00000508312.1_Missense_Mutation_p.V807L|DDR1_ENST00000452441.1_Missense_Mutation_p.V826L|DDR1_ENST00000513240.1_Missense_Mutation_p.V832L|DDR1_ENST00000376575.3_Missense_Mutation_p.V832L|DDR1_ENST00000376568.3_Missense_Mutation_p.V826L|DDR1_ENST00000376570.4_Missense_Mutation_p.V789L|DDR1_ENST00000376567.2_Missense_Mutation_p.V789L|DDR1_ENST00000446312.1_3'UTR|DDR1_ENST00000376569.3_Missense_Mutation_p.V789L|DDR1_ENST00000361741.4_Intron|DDR1_ENST00000418800.2_Missense_Mutation_p.V789L|DDR1_ENST00000454612.2_Missense_Mutation_p.V789L			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	826	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	TGCGAGTGACGTGTGGGCCTT	0.597																																					p.V832L		.											.	DDR1	1403	0			c.G2494T						.						169.0	132.0	144.0					6																	30866689		2203	4300	6503	SO:0001583	missense	780	exon16			AGTGACGTGTGGG	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.2476G>T	6.37:g.30866689G>T	ENSP00000318217:p.Val826Leu	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	31.0	NM_013994	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	37	CCDS34385.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957658	0.53400	.	.	ENSG00000204580	ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000376567;ENST00000513240	D;D;D;D;D;D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	4.89	4.89	0.63831	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.86209	0.5878	M	0.80422	2.495	0.80722	D	1	B;B;B;B	0.25206	0.003;0.12;0.023;0.003	B;B;B;B	0.34722	0.012;0.188;0.082;0.017	D	0.87341	0.2331	10	0.87932	D	0	.	15.5589	0.76223	0.0:0.0:1.0:0.0	.	807;290;832;826	B7Z2K0;A2ABL4;Q08345-5;Q08345	.;.;.;DDR1_HUMAN	L	826;789;789;789;832;789;826;826;807;789;832	ENSP00000318217:V826L;ENSP00000407699:V789L;ENSP00000406091:V789L;ENSP00000365753:V789L;ENSP00000365759:V832L;ENSP00000365754:V789L;ENSP00000365752:V826L;ENSP00000405039:V826L;ENSP00000422442:V807L;ENSP00000365751:V789L;ENSP00000427552:V832L	ENSP00000318217:V826L	V	+	1	0	DDR1	30974668	1.000000	0.71417	0.990000	0.47175	0.515000	0.34225	9.823000	0.99369	2.256000	0.74724	0.467000	0.42956	GTG	.		0.597	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994	
DIP2C	22982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	375432	375432	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:375432A>G	ENST00000280886.6	-	30	3781	c.3694T>C	c.(3694-3696)Tcc>Ccc	p.S1232P		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1232						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ACGGAGTAGGAGCAAAACGTG	0.597																																					p.S1232P		.											.	DIP2C	156	0			c.T3694C						.						64.0	54.0	58.0					10																	375432		2203	4300	6503	SO:0001583	missense	22982	exon30			AGTAGGAGCAAAA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3694T>C	10.37:g.375432A>G	ENSP00000280886:p.Ser1232Pro	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	7.0	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.409065|5.409065	0.96072|0.96072	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000434695|ENST00000280886;ENST00000535541;ENST00000381503	.|T	.|0.39997	.|1.05	5.84|5.84	5.84|5.84	0.93424|0.93424	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.44519|0.44519	0.1297|0.1297	L|L	0.33668|0.33668	1.02|1.02	0.80722|0.80722	D|D	1|1	.|P	.|0.41475	.|0.751	.|P	.|0.54060	.|0.741	T|T	0.21793|0.21793	-1.0235|-1.0235	5|10	.|0.02654	.|T	.|1	-29.0651|-29.0651	16.2141|16.2141	0.82191|0.82191	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1232	.|Q9Y2E4	.|DIP2C_HUMAN	P|P	37|1232;157;81	.|ENSP00000280886:S1232P	.|ENSP00000280886:S1232P	L|S	-|-	2|1	0|0	DIP2C|DIP2C	365432|365432	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	9.339000|9.339000	0.96797|0.96797	2.230000|2.230000	0.72887|0.72887	0.528000|0.528000	0.53228|0.53228	CTC|TCC	.		0.597	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
DNAJB5	25822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34993331	34993331	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:34993331A>C	ENST00000541010.1	+	1	3113	c.101A>C	c.(100-102)gAc>gCc	p.D34A	DNAJB5_ENST00000312316.5_Missense_Mutation_p.D34A|DNAJB5_ENST00000453597.3_Missense_Mutation_p.D148A|DNAJB5_ENST00000454002.2_Missense_Mutation_p.D106A|DNAJB5_ENST00000545841.1_Missense_Mutation_p.D34A|DNAJB5_ENST00000335998.3_Missense_Mutation_p.D68A			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	34	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			TACCACCCAGACAAGAATAAA	0.478																																					p.D148A		.											.	DNAJB5	226	0			c.A443C						.						140.0	138.0	139.0					9																	34993331		2203	4300	6503	SO:0001583	missense	25822	exon3			ACCCAGACAAGAA	AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.101A>C	9.37:g.34993331A>C	ENSP00000443151:p.Asp34Ala	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	16.0	NM_001135004	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	ENST00000541010.1	37	CCDS35007.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.118223	0.77323	.	.	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000378751;ENST00000312316;ENST00000541010;ENST00000454002;ENST00000545841;ENST00000539059;ENST00000443266	D;D;D;D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86;-2.86;-2.86;-2.86	5.31	5.31	0.75309	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	D	0.96796	0.8954	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97952	1.0332	10	0.87932	D	0	.	14.5924	0.68378	1.0:0.0:0.0:0.0	.	106;34	B4DSA6;O75953	.;DNJB5_HUMAN	A	148;68;34;34;34;106;34;70;34	ENSP00000404079:D148A;ENSP00000337626:D68A;ENSP00000312517:D34A;ENSP00000443151:D34A;ENSP00000413684:D106A;ENSP00000441999:D34A;ENSP00000445536:D70A;ENSP00000396332:D34A	ENSP00000312517:D34A	D	+	2	0	DNAJB5	34983331	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.761000	0.91691	2.234000	0.73211	0.459000	0.35465	GAC	.		0.478	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401397.1		
DSPP	1834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88535262	88535262	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:88535262A>G	ENST00000282478.7	+	4	1481	c.1448A>G	c.(1447-1449)aAt>aGt	p.N483S	DSPP_ENST00000399271.1_Missense_Mutation_p.N483S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	483	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GAAAGTGACAATAACAGCAGT	0.383																																					p.N483S		.											.	DSPP	90	0			c.A1448G						.						126.0	119.0	121.0					4																	88535262		2008	4181	6189	SO:0001583	missense	1834	exon5			GTGACAATAACAG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1448A>G	4.37:g.88535262A>G	ENSP00000282478:p.Asn483Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	24.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	5.630	0.300953	0.10678	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.89050	-2.46;-2.46	4.74	2.17	0.27698	.	0.713649	0.11506	N	0.557210	D	0.82669	0.5087	M	0.64997	1.995	0.09310	N	1	B	0.28713	0.22	B	0.23574	0.047	T	0.65417	-0.6173	10	0.08599	T	0.76	-16.9559	5.7554	0.18170	0.7372:0.169:0.0938:0.0	.	483	Q9NZW4	DSPP_HUMAN	S	483	ENSP00000382213:N483S;ENSP00000282478:N483S	ENSP00000282478:N483S	N	+	2	0	DSPP	88754286	0.000000	0.05858	0.006000	0.13384	0.107000	0.19398	0.581000	0.23819	0.684000	0.31448	0.366000	0.22137	AAT	.		0.383	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102446826	102446826	+	Silent	SNP	T	T	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr14:102446826T>G	ENST00000360184.4	+	5	1064	c.900T>G	c.(898-900)acT>acG	p.T300T		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	300	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TTCTCCTGACTCTGGATATCT	0.448																																					p.T300T		.											.	DYNC1H1	98	0			c.T900G						.						72.0	73.0	72.0					14																	102446826		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon5			CCTGACTCTGGAT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.900T>G	14.37:g.102446826T>G		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	11.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1																																																																																			.		0.448	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
ECD	11319	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	74912126	74912126	+	Silent	SNP	T	T	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:74912126T>G	ENST00000372979.4	-	7	1043	c.837A>C	c.(835-837)ccA>ccC	p.P279P	ECD_ENST00000454759.2_Intron|ECD_ENST00000430082.2_Silent_p.P279P	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	279					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					TCCGCCGGTCTGGCACAAACC	0.443																																					p.P279P		.											.	ECD	91	0			c.A837C						.						94.0	89.0	91.0					10																	74912126		2203	4300	6503	SO:0001819	synonymous_variant	11319	exon7			CCGGTCTGGCACA	BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.837A>C	10.37:g.74912126T>G		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	9.0	NM_001135752	C9JX46|E9PAW8	Silent	SNP	ENST00000372979.4	37	CCDS7321.1																																																																																			.		0.443	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048606.1	NM_007265	
ENDOG	2021	broad.mit.edu;ucsc.edu	37	9	131584861	131584861	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:131584861T>G	ENST00000372642.4	+	3	1077	c.866T>G	c.(865-867)cTc>cGc	p.L289R	C9orf114_ENST00000361256.5_3'UTR	NM_004435.2	NP_004426.2	Q14249	NUCG_HUMAN	endonuclease G	289					apoptotic DNA fragmentation (GO:0006309)|DNA recombination (GO:0006310)|in utero embryonic development (GO:0001701)|positive regulation of apoptotic process (GO:0043065)|response to antibiotic (GO:0046677)|response to tumor necrosis factor (GO:0034612)	mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|nucleic acid binding (GO:0003676)										GCAGGCAGCCTCAAGGCCATC	0.612																																					p.L289R		.											.	ENDOG	90	0			c.T866G						.						25.0	21.0	22.0					9																	131584861		2177	4282	6459	SO:0001583	missense	2021	exon3			GCAGCCTCAAGGC	X79444	CCDS6912.1	9q34.1	2008-06-04			ENSG00000167136	ENSG00000167136			3346	protein-coding gene	gene with protein product		600440				7789991	Standard	NM_004435		Approved		uc004bwc.3	Q14249	OTTHUMG00000020763	ENST00000372642.4:c.866T>G	9.37:g.131584861T>G	ENSP00000361725:p.Leu289Arg	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	5.0	NM_004435	Q5T281|Q9BSP2	Missense_Mutation	SNP	ENST00000372642.4	37	CCDS6912.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.163514	0.57476	.	.	ENSG00000167136	ENST00000372642	T	0.38077	1.16	5.44	5.44	0.79542	.	0.169683	0.39341	N	0.001386	T	0.29190	0.0726	L	0.28274	0.84	0.80722	D	1	B	0.13145	0.007	B	0.14023	0.01	T	0.06734	-1.0810	10	0.87932	D	0	-11.4624	14.6736	0.68961	0.0:0.0:0.0:1.0	.	289	Q14249	NUCG_HUMAN	R	289	ENSP00000361725:L289R	ENSP00000361725:L289R	L	+	2	0	ENDOG	130624682	0.998000	0.40836	0.998000	0.56505	0.971000	0.66376	4.579000	0.60936	2.060000	0.61445	0.374000	0.22700	CTC	.		0.612	ENDOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054505.1	NM_004435	
EPHA7	2045	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	94120578	94120578	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:94120578C>T	ENST00000369303.4	-	3	657	c.473G>A	c.(472-474)gGt>gAt	p.G158D	EPHA7_ENST00000369297.1_Missense_Mutation_p.G158D	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	158	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ACCAAGGTCACCTTGGGTAAA	0.398																																					p.G158D		.											.	EPHA7	1453	0			c.G473A						.						135.0	135.0	135.0					6																	94120578		2203	4300	6503	SO:0001583	missense	2045	exon3			AGGTCACCTTGGG	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.473G>A	6.37:g.94120578C>T	ENSP00000358309:p.Gly158Asp	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	28.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288944	0.59976	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.09350	2.99;2.99	5.32	5.32	0.75619	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.22975	0.0555	L	0.55103	1.725	0.58432	D	0.999991	D;D;D;D	0.89917	0.983;1.0;1.0;1.0	P;D;D;D	0.97110	0.644;1.0;1.0;1.0	T	0.00503	-1.1701	10	0.52906	T	0.07	.	19.4211	0.94721	0.0:1.0:0.0:0.0	.	158;158;158;158	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	D	158	ENSP00000358309:G158D;ENSP00000358303:G158D	ENSP00000358303:G158D	G	-	2	0	EPHA7	94177299	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.744000	0.62118	2.676000	0.91093	0.650000	0.86243	GGT	.		0.398	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
FAHD2B	151313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	97751541	97751541	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:97751541G>A	ENST00000414820.1	-	6	850	c.580C>T	c.(580-582)Cgt>Tgt	p.R194C	FAHD2B_ENST00000272610.3_Missense_Mutation_p.R194C|FAHD2B_ENST00000440566.2_Missense_Mutation_p.R194C|FAHD2B_ENST00000468548.1_5'Flank			Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing 2B	194							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			kidney(5)|large_intestine(2)|lung(3)|skin(2)	12						AGCCAGTCACGAGCACTCACG	0.582																																					p.R194C		.											.	FAHD2B	90	0			c.C580T						.						114.0	102.0	106.0					2																	97751541		2203	4300	6503	SO:0001583	missense	151313	exon5			AGTCACGAGCACT		CCDS2030.1	2q11.2	2012-06-29			ENSG00000144199	ENSG00000144199			25318	protein-coding gene	gene with protein product							Standard	NM_199336		Approved	DKFZp434N062	uc002sxm.3	Q6P2I3	OTTHUMG00000130533	ENST00000414820.1:c.580C>T	2.37:g.97751541G>A	ENSP00000410470:p.Arg194Cys	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	44.0	NM_199336	D3DXH7|Q8NDK1	Missense_Mutation	SNP	ENST00000414820.1	37	CCDS2030.1	.	.	.	.	.	.	.	.	.	.	g	18.38	3.610637	0.66558	.	.	ENSG00000144199	ENST00000414820;ENST00000272610;ENST00000440566	D;D;D	0.99226	-5.59;-5.59;-5.59	0.624	-1.25	0.09405	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99348	0.9771	H	0.95574	3.69	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	D	0.98323	1.0529	10	0.87932	D	0	.	4.9789	0.14155	0.0:0.0:0.6568:0.3432	.	194	Q6P2I3	FAH2B_HUMAN	C	194	ENSP00000410470:R194C;ENSP00000272610:R194C;ENSP00000444599:R194C	ENSP00000272610:R194C	R	-	1	0	FAHD2B	97115268	1.000000	0.71417	0.792000	0.32020	0.673000	0.39480	1.987000	0.40687	-0.423000	0.07394	0.306000	0.20318	CGT	.		0.582	FAHD2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339482.1	NM_199336	
FAM13C	220965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	61028335	61028335	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:61028335A>G	ENST00000373868.2	-	8	1007	c.920T>C	c.(919-921)tTt>tCt	p.F307S	FAM13C_ENST00000422313.2_Missense_Mutation_p.F307S|FAM13C_ENST00000435852.2_Missense_Mutation_p.F307S|FAM13C_ENST00000373867.3_Missense_Mutation_p.F224S|FAM13C_ENST00000277705.6_Missense_Mutation_p.F328S|FAM13C_ENST00000468840.2_Missense_Mutation_p.F224S|FAM13C_ENST00000442566.3_Missense_Mutation_p.F328S|FAM13C_ENST00000419214.2_Missense_Mutation_p.F307S	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	307										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TTCTTGTTCAAATTTTTCTTC	0.498																																					p.F307S		.											.	FAM13C	70	0			c.T920C						.						89.0	89.0	89.0					10																	61028335		2203	4300	6503	SO:0001583	missense	220965	exon8			TGTTCAAATTTTT	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.920T>C	10.37:g.61028335A>G	ENSP00000362975:p.Phe307Ser	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	13.0	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	37	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.983183	0.93044	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-0.26;-1.02;-1.02;-1.02;-1.02	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.89174	0.6640	M	0.83483	2.645	0.50813	D	0.999891	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.999	D	0.90406	0.4406	10	0.87932	D	0	-15.8349	16.8222	0.85835	1.0:0.0:0.0:0.0	.	307;224;307;307;307	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	S	224;307;328;328;307;224;307;307;85	ENSP00000362974:F224S;ENSP00000362975:F307S;ENSP00000395661:F328S;ENSP00000277705:F328S;ENSP00000391993:F307S;ENSP00000423896:F224S;ENSP00000392302:F307S;ENSP00000400241:F307S;ENSP00000445068:F85S	ENSP00000277705:F328S	F	-	2	0	FAM13C	60698341	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.207000	0.89746	2.371000	0.80710	0.533000	0.62120	TTT	.		0.498	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
FCGR1A	2209	broad.mit.edu;bcgsc.ca	37	1	149755799	149755799	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:149755799T>A	ENST00000369168.4	+	3	347	c.293T>A	c.(292-294)cTg>cAg	p.L98Q	RP11-196G18.3_ENST00000428289.1_RNA|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000545683.1_Intron	NM_000566.3	NP_000557.1	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor (CD64)	98	Ig-like C2-type 1.|Ig-like C2-type 2.				antibody-dependent cellular cytotoxicity (GO:0001788)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intracellular signal transduction (GO:0035556)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of phagocytosis (GO:0050766)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG receptor activity (GO:0019770)|receptor signaling protein activity (GO:0005057)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)	10	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCCATACAGCTGGAAATCCAC	0.532																																					p.L98Q		.											.	FCGR1A	23	0			c.T293A						.						26.0	34.0	32.0					1																	149755799		1945	4046	5991	SO:0001583	missense	2209	exon3			TACAGCTGGAAAT	BC032634	CCDS933.1	1q21.2-q21.3	2014-09-17	2005-02-02		ENSG00000150337	ENSG00000150337		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3613	protein-coding gene	gene with protein product		146760	"""Fc fragment of IgG, high affinity Ia, receptor for (CD64)"""			8697799, 9763663	Standard	NM_000566		Approved	CD64, CD64A	uc001esp.4	P12314	OTTHUMG00000012089	ENST00000369168.4:c.293T>A	1.37:g.149755799T>A	ENSP00000358165:p.Leu98Gln	Somatic	331.0	0.0		WXS	Illumina HiSeq	Phase_I	294.0	91.0	NM_000566	P12315|Q5QNW7|Q92495|Q92663	Missense_Mutation	SNP	ENST00000369168.4	37	CCDS933.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.628744	0.46944	.	.	ENSG00000150337	ENST00000369168	T	0.19394	2.15	3.13	3.13	0.36017	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40385	N	0.001117	T	0.45236	0.1332	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56183	-0.8021	10	0.87932	D	0	.	8.326	0.32158	0.0:0.0:0.0:1.0	.	98	P12314	FCGR1_HUMAN	Q	98	ENSP00000358165:L98Q	ENSP00000358165:L98Q	L	+	2	0	FCGR1A	148022423	0.976000	0.34144	0.269000	0.24586	0.718000	0.41266	3.481000	0.53179	1.390000	0.46547	0.338000	0.21704	CTG	.		0.532	FCGR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033446.1	NM_000566	
FIGN	55137	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	164468244	164468244	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:164468244C>G	ENST00000333129.3	-	3	412	c.98G>C	c.(97-99)cGg>cCg	p.R33P	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'UTR	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	33					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.R33Q(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GGCAGGAGACCGAGTGGTTGA	0.517																																					p.R33P		.											.	FIGN	156	1	Substitution - Missense(1)	breast(1)	c.G98C						.						100.0	101.0	100.0					2																	164468244		2082	4234	6316	SO:0001583	missense	55137	exon3			GGAGACCGAGTGG	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.98G>C	2.37:g.164468244C>G	ENSP00000333836:p.Arg33Pro	Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	64.0	21.0	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371699	0.61624	.	.	ENSG00000182263	ENST00000333129	T	0.25414	1.8	6.17	6.17	0.99709	.	0.000000	0.85682	U	0.000000	T	0.47116	0.1428	L	0.48362	1.52	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	T	0.03148	-1.1067	10	0.31617	T	0.26	-14.7367	20.8794	0.99867	0.0:1.0:0.0:0.0	.	33	Q5HY92	FIGN_HUMAN	P	33	ENSP00000333836:R33P	ENSP00000333836:R33P	R	-	2	0	FIGN	164176490	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CGG	.		0.517	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
FN1	2335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	216256381	216256381	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:216256381G>T	ENST00000359671.1	-	25	4218	c.3953C>A	c.(3952-3954)cCt>cAt	p.P1318H	FN1_ENST00000357009.2_Missense_Mutation_p.P1318H|FN1_ENST00000421182.1_Missense_Mutation_p.P1318H|FN1_ENST00000345488.5_Missense_Mutation_p.P1318H|FN1_ENST00000357867.4_Missense_Mutation_p.P1318H|FN1_ENST00000446046.1_Missense_Mutation_p.P1318H|FN1_ENST00000443816.1_Missense_Mutation_p.P1318H|FN1_ENST00000356005.4_Missense_Mutation_p.P1318H|FN1_ENST00000354785.4_Missense_Mutation_p.P1409H|FN1_ENST00000323926.6_Missense_Mutation_p.P1409H|FN1_ENST00000336916.4_Missense_Mutation_p.P1318H|FN1_ENST00000432072.2_Missense_Mutation_p.P1409H|FN1_ENST00000346544.3_Missense_Mutation_p.P1318H			P02751	FINC_HUMAN	fibronectin 1	1318	Cell-attachment.|Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ATTGTCTGAAGGAGAAATTGA	0.403																																					p.P1409H		.											.	FN1	584	0			c.C4226A						.						134.0	126.0	129.0					2																	216256381		2203	4300	6503	SO:0001583	missense	2335	exon26			TCTGAAGGAGAAA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3953C>A	2.37:g.216256381G>T	ENSP00000352696:p.Pro1318His	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	21.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	G	18.76	3.691754	0.68271	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000003	T	0.75170	0.3813	M	0.80982	2.52	0.45515	D	0.99847	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.988;0.999;1.0;1.0;0.999;1.0;1.0;0.999	D;P;D;D;D;D;D;D;D	0.97110	0.999;0.899;0.985;1.0;1.0;0.967;0.999;0.999;0.972	T	0.73795	-0.3870	10	0.38643	T	0.18	.	19.6604	0.95864	0.0:0.0:1.0:0.0	.	1409;1409;1318;1318;1318;1318;1318;1318;1409	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.	H	1318;1409;1318;1318;1409;1318;1318;1318;1318;1318;1318;1409;1318;125	ENSP00000394423:P1318H;ENSP00000323534:P1409H;ENSP00000338200:P1318H;ENSP00000350534:P1318H;ENSP00000346839:P1409H;ENSP00000352696:P1318H;ENSP00000265312:P1318H;ENSP00000273049:P1318H;ENSP00000349509:P1318H;ENSP00000410422:P1318H;ENSP00000415018:P1318H;ENSP00000399538:P1409H;ENSP00000348285:P1318H;ENSP00000416139:P125H	ENSP00000323534:P1409H	P	-	2	0	FN1	215964626	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	7.627000	0.83176	2.648000	0.89879	0.655000	0.94253	CCT	.		0.403	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79295351	79295351	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:79295351G>T	ENST00000325942.6	+	25	3537	c.3097G>T	c.(3097-3099)Gtc>Ttc	p.V1033F	FRAS1_ENST00000264895.6_Missense_Mutation_p.V1033F	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1033					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGCCCAGTGTGTCCAGGAATG	0.502																																					p.V1033F		.											.	FRAS1	68	0			c.G3097T						.						125.0	123.0	123.0					4																	79295351		1948	4160	6108	SO:0001583	missense	80144	exon25			CAGTGTGTCCAGG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.3097G>T	4.37:g.79295351G>T	ENSP00000326330:p.Val1033Phe	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	21.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748993	0.49257	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	D;D	0.87334	-2.24;-2.24	5.94	4.93	0.64822	.	0.063513	0.64402	D	0.000008	D	0.93429	0.7904	M	0.86097	2.795	0.80722	D	1	D;D	0.64830	0.983;0.994	P;D	0.65684	0.873;0.937	D	0.94029	0.7299	10	0.87932	D	0	.	15.7332	0.77822	0.0767:0.0:0.9233:0.0	.	1033;1033	E9PHH6;A2RRR8	.;.	F	1033	ENSP00000326330:V1033F;ENSP00000264895:V1033F	ENSP00000264895:V1033F	V	+	1	0	FRAS1	79514375	1.000000	0.71417	0.999000	0.59377	0.001000	0.01503	5.694000	0.68272	2.820000	0.97059	0.650000	0.86243	GTC	.		0.502	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
FREM2	341640	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39263789	39263789	+	Missense_Mutation	SNP	G	G	T	rs7327915	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr13:39263789G>T	ENST00000280481.7	+	1	2524	c.2308G>T	c.(2308-2310)Gtg>Ttg	p.V770L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	770			V -> M (in dbSNP:rs7327915).		cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CCCCTCAGTCGTGGTGACCCA	0.537																																					p.V770L		.											.	FREM2	100	0			c.G2308T						.						84.0	87.0	86.0					13																	39263789		2203	4300	6503	SO:0001583	missense	341640	exon1			TCAGTCGTGGTGA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2308G>T	13.37:g.39263789G>T	ENSP00000280481:p.Val770Leu	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	18.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	7.127	0.579210	0.13686	.	.	ENSG00000150893	ENST00000280481	T	0.41400	1.0	5.8	1.81	0.25067	.	0.599178	0.17790	N	0.161915	T	0.28433	0.0703	L	0.34521	1.04	0.80722	P	0.0	B	0.10296	0.003	B	0.09377	0.004	T	0.25117	-1.0141	9	0.28530	T	0.3	.	8.671	0.34149	0.1301:0.2312:0.6386:0.0	.	770	Q5SZK8	FREM2_HUMAN	L	770	ENSP00000280481:V770L	ENSP00000280481:V770L	V	+	1	0	FREM2	38161789	0.018000	0.18449	0.310000	0.25168	0.901000	0.52897	1.470000	0.35354	0.330000	0.23485	0.655000	0.94253	GTG	G|0.960;A|0.040		0.537	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FRMD4A	55691	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	13699408	13699408	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:13699408G>T	ENST00000357447.2	-	22	2549	c.2181C>A	c.(2179-2181)agC>agA	p.S727R	FRMD4A_ENST00000378503.1_Missense_Mutation_p.S727R|FRMD4A_ENST00000358621.4_Missense_Mutation_p.S712R	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	727	Ser-rich.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						AGAAGTCGGGGCTCCCGGTGT	0.657																																					p.S727R		.											.	FRMD4A	229	0			c.C2181A						.						33.0	32.0	32.0					10																	13699408		2203	4300	6503	SO:0001583	missense	55691	exon22			GTCGGGGCTCCCG	AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.2181C>A	10.37:g.13699408G>T	ENSP00000350032:p.Ser727Arg	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	10.0	NM_018027	A7E2Y3|Q5T377	Missense_Mutation	SNP	ENST00000357447.2	37	CCDS7101.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273415	0.59649	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	D;D;D	0.83673	-1.75;-1.75;-1.75	4.81	4.81	0.61882	.	0.082265	0.85682	D	0.000000	T	0.77896	0.4199	L	0.44542	1.39	0.80722	D	1	B	0.27679	0.185	B	0.24974	0.057	T	0.73704	-0.3899	10	0.21014	T	0.42	-20.1118	18.237	0.89952	0.0:0.0:1.0:0.0	.	727	Q9P2Q2	FRM4A_HUMAN	R	712;727;727	ENSP00000351438:S712R;ENSP00000350032:S727R;ENSP00000367764:S727R	ENSP00000350032:S727R	S	-	3	2	FRMD4A	13739414	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.031000	0.70911	2.353000	0.79882	0.436000	0.28706	AGC	.		0.657	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046889.1	NM_018027	
GATA4	2626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	11615852	11615852	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:11615852C>T	ENST00000335135.4	+	7	1755	c.1197C>T	c.(1195-1197)gtC>gtT	p.V399V	GATA4_ENST00000532059.1_Silent_p.V400V|GATA4_ENST00000528712.1_Silent_p.V193V	NM_002052.3	NP_002043.2	P43694	GATA4_HUMAN	GATA binding protein 4	399					atrial septum morphogenesis (GO:0060413)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle morphogenesis (GO:0003208)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion development (GO:0003197)|endoderm development (GO:0007492)|endoderm formation (GO:0001706)|epithelial cell fate commitment (GO:0072148)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|lung lobe formation (GO:0060464)|male gonad development (GO:0008584)|negative regulation of autophagy (GO:0010507)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to mechanical stimulus (GO:0009612)|seminiferous tubule development (GO:0072520)|Sertoli cell differentiation (GO:0060008)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(10)	13	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		TCCACCCTGTCCTCTCGGCCC	0.602																																					p.V399V		.											.	GATA4	90	0			c.C1197T						.						154.0	134.0	141.0					8																	11615852		2203	4300	6503	SO:0001819	synonymous_variant	2626	exon7			CCCTGTCCTCTCG	AK097060	CCDS5983.1	8p23.1-p22	2013-01-25	2001-11-28		ENSG00000136574	ENSG00000136574		"""GATA zinc finger domain containing"""	4173	protein-coding gene	gene with protein product		600576	"""GATA-binding protein 4"""			7665171	Standard	NM_002052		Approved		uc003wuc.2	P43694	OTTHUMG00000090800	ENST00000335135.4:c.1197C>T	8.37:g.11615852C>T		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	15.0	NM_002052	B7ZKX0|B7ZKZ4|Q3MJ45|Q5IFM8	Silent	SNP	ENST00000335135.4	37	CCDS5983.1																																																																																			.		0.602	GATA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207587.2	NM_002052	
GCLM	2730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	94354618	94354618	+	Silent	SNP	C	C	T	rs567112849	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:94354618C>T	ENST00000370238.3	-	7	999	c.753G>A	c.(751-753)tcG>tcA	p.S251S		NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	251					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	TCACAATGACCGAATACCGCA	0.423													C|||	2	0.000399361	0.0	0.0	5008	,	,		16268	0.0		0.0	False		,,,				2504	0.002				p.S251S		.											.	GCLM	91	0			c.G753A						.						87.0	93.0	91.0					1																	94354618		2203	4300	6503	SO:0001819	synonymous_variant	2730	exon7			AATGACCGAATAC	L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.753G>A	1.37:g.94354618C>T		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	19.0	NM_002061	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Silent	SNP	ENST00000370238.3	37	CCDS746.1																																																																																			.		0.423	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029169.1	NM_002061	
GDPD3	79153	ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30116234	30116234	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr16:30116234G>T	ENST00000406256.3	-	10	1293	c.916C>A	c.(916-918)Cac>Aac	p.H306N	RP11-455F5.4_ENST00000566190.1_RNA|RP11-455F5.3_ENST00000515455.2_RNA	NM_024307.2	NP_077283.2	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain containing 3	306	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)	11						TCCAGGTAGTGCCGCAGGGCT	0.517																																					p.H306N		.											.	GDPD3	90	0			c.C916A						.						84.0	81.0	82.0					16																	30116234		2197	4300	6497	SO:0001583	missense	79153	exon10			GGTAGTGCCGCAG	AK026256	CCDS10671.2	16p11.2	2008-02-05			ENSG00000102886	ENSG00000102886			28638	protein-coding gene	gene with protein product							Standard	NM_024307		Approved	MGC4171	uc002dwp.3	Q7L5L3	OTTHUMG00000132106	ENST00000406256.3:c.916C>A	16.37:g.30116234G>T	ENSP00000384363:p.His306Asn	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	30.0	5.0	NM_024307	Q9H652	Missense_Mutation	SNP	ENST00000406256.3	37	CCDS10671.2	.	.	.	.	.	.	.	.	.	.	G	8.482	0.860039	0.17178	.	.	ENSG00000102886	ENST00000406256;ENST00000360688	T	0.10477	2.87	4.65	3.7	0.42460	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.858857	0.10715	N	0.642474	T	0.05731	0.0150	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40515	-0.9559	10	0.22109	T	0.4	.	8.5946	0.33707	0.1043:0.0:0.8957:0.0	.	306	Q7L5L3	GDPD3_HUMAN	N	306;244	ENSP00000384363:H306N	ENSP00000353909:H244N	H	-	1	0	GDPD3	30023735	0.001000	0.12720	0.987000	0.45799	0.926000	0.56050	0.852000	0.27764	1.193000	0.43086	0.561000	0.74099	CAC	.		0.517	GDPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255144.1	NM_024307	
GPC5	2262	broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	92797096	92797096	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr13:92797096G>T	ENST00000377067.3	+	7	1787	c.1415G>T	c.(1414-1416)aGa>aTa	p.R472I		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	472					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTACAGGGTAGATCACCCAAA	0.388																																					p.R472I		.											.	GPC5	519	0			c.G1415T						.						142.0	135.0	138.0					13																	92797096		2203	4300	6503	SO:0001583	missense	2262	exon7			AGGGTAGATCACC	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1415G>T	13.37:g.92797096G>T	ENSP00000366267:p.Arg472Ile	Somatic	80.0	2.0		WXS	Illumina HiSeq	Phase_I	59.0	19.0	NM_004466	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	.	.	.	.	.	.	.	.	.	.	G	14.50	2.555196	0.45487	.	.	ENSG00000179399	ENST00000377067	T	0.48522	0.81	5.67	4.83	0.62350	.	0.795939	0.11244	N	0.584369	T	0.48909	0.1526	L	0.54323	1.7	0.34827	D	0.739329	P	0.37276	0.589	B	0.43018	0.405	T	0.57860	-0.7738	10	0.49607	T	0.09	-2.3047	8.1219	0.30976	0.1875:0.0:0.8125:0.0	.	472	P78333	GPC5_HUMAN	I	472	ENSP00000366267:R472I	ENSP00000366267:R472I	R	+	2	0	GPC5	91595097	0.996000	0.38824	0.236000	0.24074	0.777000	0.43975	1.859000	0.39418	1.400000	0.46741	0.557000	0.71058	AGA	.		0.388	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466	
GPR124	25960	broad.mit.edu;ucsc.edu	37	8	37691506	37691506	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:37691506A>G	ENST00000412232.2	+	11	1481	c.1468A>G	c.(1468-1470)Atg>Gtg	p.M490V	GPR124_ENST00000315215.7_Missense_Mutation_p.M490V	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	490					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GATGGTGGACATGGCCAGCAA	0.652																																					p.M490V		.											.	GPR124	157	0			c.A1468G						.						67.0	76.0	73.0					8																	37691506		2203	4300	6503	SO:0001583	missense	25960	exon11			GTGGACATGGCCA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1468A>G	8.37:g.37691506A>G	ENSP00000406367:p.Met490Val	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	5.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	A	20.9	4.065105	0.76187	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.40225	1.04;1.04	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.51890	0.1701	L	0.56769	1.78	0.58432	D	0.999999	B;D	0.53619	0.067;0.961	B;P	0.55055	0.12;0.767	T	0.47459	-0.9116	10	0.25751	T	0.34	-22.1721	14.2527	0.66031	1.0:0.0:0.0:0.0	.	490;490	Q96PE1-2;Q96PE1	.;GP124_HUMAN	V	483;490;490	ENSP00000323508:M490V;ENSP00000406367:M490V	ENSP00000323508:M490V	M	+	1	0	GPR124	37810664	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.232000	0.95325	1.772000	0.52199	0.459000	0.35465	ATG	.		0.652	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89948314	89948314	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:89948314C>T	ENST00000405460.2	+	19	3664	c.3568C>T	c.(3568-3570)Cat>Tat	p.H1190Y		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1190	Calx-beta 9. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AATCATTCTCCATGCTTTTCC	0.348																																					p.H1190Y		.											.	GPR98	103	0			c.C3568T						.						90.0	82.0	85.0					5																	89948314		1878	4115	5993	SO:0001583	missense	84059	exon19			ATTCTCCATGCTT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3568C>T	5.37:g.89948314C>T	ENSP00000384582:p.His1190Tyr	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	39.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.32|15.32	2.797986|2.797986	0.50208|0.50208	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.26957|.	1.7|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.247806|.	0.47852|.	D|.	0.000218|.	T|T	0.57621|0.57621	0.2066|0.2066	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	P|.	0.40230|.	0.708|.	B|.	0.31191|.	0.125|.	T|T	0.48399|0.48399	-0.9039|-0.9039	10|5	0.66056|.	D|.	0.02|.	.|.	20.6525|20.6525	0.99598|0.99598	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1190|.	Q8WXG9|.	GPR98_HUMAN|.	Y|L	1190|778	ENSP00000384582:H1190Y|.	ENSP00000296619:H1190Y|.	H|P	+|+	1|2	0|0	GPR98|GPR98	89984070|89984070	0.975000|0.975000	0.34042|0.34042	0.994000|0.994000	0.49952|0.49952	0.861000|0.861000	0.49209|0.49209	2.369000|2.369000	0.44231|0.44231	2.890000|2.890000	0.99128|0.99128	0.585000|0.585000	0.79938|0.79938	CAT|CCA	.		0.348	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GREB1	9687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	11716535	11716535	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:11716535T>C	ENST00000381486.2	+	5	811	c.511T>C	c.(511-513)Ttc>Ctc	p.F171L	GREB1_ENST00000381483.2_Missense_Mutation_p.F171L|GREB1_ENST00000263834.5_Missense_Mutation_p.F171L|GREB1_ENST00000234142.5_Missense_Mutation_p.F171L|GREB1_ENST00000389825.3_Missense_Mutation_p.F61L	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	171						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CTTCACGGAATTCTCCAATCA	0.393																																					p.F171L	Ovarian(39;850 945 2785 23371 33093)	.											.	GREB1	91	0			c.T511C						.						135.0	140.0	138.0					2																	11716535		2203	4300	6503	SO:0001583	missense	9687	exon5			ACGGAATTCTCCA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.511T>C	2.37:g.11716535T>C	ENSP00000370896:p.Phe171Leu	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	37.0	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	37	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.929320	0.92389	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;D;D;D;T	0.81821	2.77;-1.54;-1.54;-1.54;2.77	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.88621	0.6486	M	0.73962	2.25	0.80722	D	1	D;D;P;P	0.76494	0.995;0.999;0.954;0.95	D;D;P;P	0.85130	0.917;0.997;0.654;0.73	D	0.88557	0.3120	10	0.42905	T	0.14	-36.4097	14.6441	0.68748	0.0:0.0:0.0:1.0	.	171;61;171;171	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	L	171;171;61;171;171	ENSP00000370896:F171L;ENSP00000263834:F171L;ENSP00000374475:F61L;ENSP00000370892:F171L;ENSP00000234142:F171L	ENSP00000234142:F171L	F	+	1	0	GREB1	11633986	1.000000	0.71417	0.916000	0.36221	0.880000	0.50808	7.726000	0.84824	2.049000	0.60858	0.533000	0.62120	TTC	.		0.393	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
GUF1	60558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	44693809	44693809	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:44693809T>C	ENST00000281543.5	+	13	1800	c.1606T>C	c.(1606-1608)Tat>Cat	p.Y536H	RP11-700J17.1_ENST00000610260.1_RNA|GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						ATCTTCTGGATATGCTAGGTA	0.279																																					p.Y536H		.											.	GUF1	91	0			c.T1606C						.						91.0	107.0	102.0					4																	44693809		2201	4283	6484	SO:0001583	missense	60558	exon13			TCTGGATATGCTA		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1606T>C	4.37:g.44693809T>C	ENSP00000281543:p.Tyr536His	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	15.0	NM_021927		Missense_Mutation	SNP	ENST00000281543.5	37	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.168090	0.78339	.	.	ENSG00000151806	ENST00000281543	T	0.63913	-0.07	4.87	4.87	0.63330	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.84515	0.5489	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89165	0.3533	10	0.87932	D	0	-13.5349	13.9439	0.64073	0.0:0.0:0.0:1.0	.	536	Q8N442	GUF1_HUMAN	H	536	ENSP00000281543:Y536H	ENSP00000281543:Y536H	Y	+	1	0	GUF1	44388566	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.562000	0.82300	1.952000	0.56665	0.533000	0.62120	TAT	.		0.279	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	
HELT	391723	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	185941802	185941802	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:185941802C>T	ENST00000515777.1	+	4	693	c.605C>T	c.(604-606)gCg>gTg	p.A202V	HELT_ENST00000338875.4_Missense_Mutation_p.A287V|HELT_ENST00000505610.1_Missense_Mutation_p.A201V			A6NFD8	HELT_HUMAN	helt bHLH transcription factor	202	Pro-rich.				central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		GCTAGCCCAGCGCAGCAGCAC	0.726																																					p.A287V		.											.	HELT	226	0			c.C860T						.						16.0	18.0	17.0					4																	185941802		2200	4290	6490	SO:0001583	missense	391723	exon4			GCCCAGCGCAGCA	BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.605C>T	4.37:g.185941802C>T	ENSP00000426033:p.Ala202Val	Somatic	11.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	13.0	NM_001029887	B2RTS5|B7ZMI7|B7ZMI8	Missense_Mutation	SNP	ENST00000515777.1	37		.	.	.	.	.	.	.	.	.	.	C	10.59	1.393785	0.25205	.	.	ENSG00000187821	ENST00000505610;ENST00000515777;ENST00000338875	T;T;T	0.64991	-0.13;-0.12;1.81	4.96	3.22	0.36961	.	0.134936	0.49916	D	0.000123	T	0.38904	0.1058	L	0.27053	0.805	0.26792	N	0.969387	P;B;B	0.41131	0.739;0.063;0.104	B;B;B	0.22753	0.041;0.016;0.036	T	0.16719	-1.0393	10	0.34782	T	0.22	.	10.6558	0.45673	0.1224:0.5445:0.333:0.0	.	287;202;201	A6NFD8;B7ZMI7;A6NFD8-2	HELT_HUMAN;.;.	V	201;202;287	ENSP00000422140:A201V;ENSP00000426033:A202V;ENSP00000343464:A287V	ENSP00000343464:A287V	A	+	2	0	HELT	186178796	0.975000	0.34042	0.924000	0.36721	0.088000	0.18126	2.287000	0.43505	0.493000	0.27837	0.561000	0.74099	GCG	.		0.726	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000360792.1	NM_001300781	
HEPACAM2	253012	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92837990	92837990	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:92837990T>A	ENST00000394468.2	-	4	992	c.915A>T	c.(913-915)aaA>aaT	p.K305N	HEPACAM2_ENST00000440868.1_Missense_Mutation_p.K293N|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.K328N|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.K293N	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	305	Ig-like C2-type 2.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TCTGGGCTACTTTCTCAGATG	0.443																																					p.K305N		.											.	HEPACAM2	157	0			c.A915T						.						167.0	147.0	154.0					7																	92837990		2203	4300	6503	SO:0001583	missense	253012	exon4			GGCTACTTTCTCA	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.915A>T	7.37:g.92837990T>A	ENSP00000377980:p.Lys305Asn	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	32.0	NM_001039372	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	37	CCDS43616.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.817667	0.32145	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.23	-2.05	0.07321	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.394694	0.29631	N	0.011605	T	0.10337	0.0253	N	0.24115	0.695	0.26828	N	0.968639	P;P;B;B	0.49307	0.922;0.801;0.379;0.178	P;P;B;B	0.49528	0.614;0.494;0.196;0.145	T	0.28299	-1.0048	10	0.30854	T	0.27	-3.3532	8.3344	0.32206	0.0:0.1251:0.4308:0.444	.	328;293;305;293	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	N	305;293;293;328	ENSP00000377980:K305N;ENSP00000340532:K293N;ENSP00000389592:K293N;ENSP00000390204:K328N	ENSP00000340532:K293N	K	-	3	2	HEPACAM2	92675926	0.720000	0.27996	0.984000	0.44739	0.018000	0.09664	0.183000	0.16919	-0.089000	0.12484	-1.151000	0.01829	AAA	.		0.443	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151	
IMPG1	3617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76720891	76720891	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:76720891T>A	ENST00000369950.3	-	8	1047	c.858A>T	c.(856-858)ttA>ttT	p.L286F	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				ACCTAAATCCTAACACATGGA	0.313																																					p.L286F	Pancreas(37;839 1141 2599 26037)	.											.	IMPG1	93	0			c.A858T						.						50.0	54.0	53.0					6																	76720891		2200	4297	6497	SO:0001583	missense	3617	exon8			AAATCCTAACACA	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.858A>T	6.37:g.76720891T>A	ENSP00000358966:p.Leu286Phe	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	36.0	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.619027	0.66787	.	.	ENSG00000112706	ENST00000369950	T	0.44881	0.91	5.56	1.55	0.23275	SEA (3);	0.275088	0.25978	N	0.027093	T	0.47820	0.1466	M	0.73962	2.25	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.50398	-0.8833	10	0.59425	D	0.04	.	8.2252	0.31564	0.0:0.2951:0.0:0.7049	.	286	Q17R60	IMPG1_HUMAN	F	286	ENSP00000358966:L286F	ENSP00000358966:L286F	L	-	3	2	IMPG1	76777611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.498000	0.22530	0.487000	0.27698	0.528000	0.53228	TTA	.		0.313	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
INPPL1	3636	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	71943737	71943737	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr11:71943737G>T	ENST00000298229.2	+	15	1984	c.1780G>T	c.(1780-1782)Gac>Tac	p.D594Y	INPPL1_ENST00000541756.1_Missense_Mutation_p.D352Y|INPPL1_ENST00000538751.1_Missense_Mutation_p.D352Y	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	594					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CAATGCCTTTGACATCTCTCT	0.597																																					p.D594Y		.											.	INPPL1	660	0			c.G1780T						.						92.0	88.0	90.0					11																	71943737		2200	4293	6493	SO:0001583	missense	3636	exon15			GCCTTTGACATCT	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.1780G>T	11.37:g.71943737G>T	ENSP00000298229:p.Asp594Tyr	Somatic	41.0	1.0		WXS	Illumina HiSeq	Phase_I	38.0	10.0	NM_001567	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.	.	.	.	.	.	.	.	.	.	g	26.1	4.701633	0.88924	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751	D;D;D	0.95622	-3.76;-3.76;-3.76	5.42	5.42	0.78866	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.110790	0.64402	D	0.000010	D	0.98226	0.9413	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.98905	1.0778	10	0.66056	D	0.02	.	17.0484	0.86511	0.0:0.0:1.0:0.0	.	594	O15357	SHIP2_HUMAN	Y	594;352;352	ENSP00000298229:D594Y;ENSP00000446360:D352Y;ENSP00000444619:D352Y	ENSP00000298229:D594Y	D	+	1	0	INPPL1	71621385	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.393000	0.97256	2.703000	0.92315	0.561000	0.74099	GAC	.		0.597	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
INSL4	3641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5231621	5231621	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:5231621C>A	ENST00000239316.4	+	1	203	c.98C>A	c.(97-99)cCc>cAc	p.P33H		NM_002195.1	NP_002186.1	Q14641	INSL4_HUMAN	insulin-like 4 (placenta)	33					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	insulin-like growth factor receptor binding (GO:0005159)|receptor binding (GO:0005102)			endometrium(2)|lung(2)|skin(1)|urinary_tract(1)	6	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.14)		GGATGTGGTCCCCGATTTGGA	0.562																																					p.P33H		.											.	INSL4	90	0			c.C98A						.						96.0	84.0	88.0					9																	5231621		2203	4300	6503	SO:0001583	missense	3641	exon1			GTGGTCCCCGATT		CCDS6459.1	9p24	2008-02-05			ENSG00000120211	ENSG00000120211			6087	protein-coding gene	gene with protein product		600910				8666396, 9730618	Standard	NM_002195		Approved	EPIL	uc003ziy.3	Q14641	OTTHUMG00000019494	ENST00000239316.4:c.98C>A	9.37:g.5231621C>A	ENSP00000239316:p.Pro33His	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	11.0	NM_002195	A8K678|Q5W127	Missense_Mutation	SNP	ENST00000239316.4	37	CCDS6459.1	.	.	.	.	.	.	.	.	.	.	C	5.242	0.230205	0.09969	.	.	ENSG00000120211	ENST00000239316	D	0.84516	-1.86	1.8	-3.59	0.04583	.	0.850582	0.08754	U	0.898665	T	0.65080	0.2657	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.47686	-0.9098	10	0.59425	D	0.04	.	2.6307	0.04943	0.4657:0.2892:0.0:0.245	.	33	Q14641	INSL4_HUMAN	H	33	ENSP00000239316:P33H	ENSP00000239316:P33H	P	+	2	0	INSL4	5221621	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.654000	0.00855	-1.510000	0.01796	0.205000	0.17691	CCC	.		0.562	INSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051616.2	NM_002195	
IPO8	10526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	30816574	30816574	+	Silent	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:30816574A>C	ENST00000256079.4	-	14	1781	c.1443T>G	c.(1441-1443)ctT>ctG	p.L481L	IPO8_ENST00000544829.1_Silent_p.L276L	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	481					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TAAATGCATGAAGTACCCAGC	0.338																																					p.L481L		.											.	IPO8	227	0			c.T1443G						.						76.0	73.0	74.0					12																	30816574		2203	4300	6503	SO:0001819	synonymous_variant	10526	exon14			TGCATGAAGTACC	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1443T>G	12.37:g.30816574A>C		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	13.0	NM_006390	B7Z7M3	Silent	SNP	ENST00000256079.4	37	CCDS8719.1																																																																																			.		0.338	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
ITGB4	3691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	73723340	73723340	+	Missense_Mutation	SNP	G	G	T	rs146966502	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:73723340G>T	ENST00000200181.3	+	3	332	c.145G>T	c.(145-147)Gcc>Tcc	p.A49S	ITGB4_ENST00000339591.3_Missense_Mutation_p.A49S|ITGB4_ENST00000579662.1_Missense_Mutation_p.A49S|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000449880.2_Missense_Mutation_p.A49S|ITGB4_ENST00000450894.3_Missense_Mutation_p.A49S	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	49	PSI.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TAAGGACTGCGCCTACTGCAC	0.602																																					p.A49S		.											.	ITGB4	227	0			c.G145T						.						78.0	65.0	69.0					17																	73723340		2203	4300	6503	SO:0001583	missense	3691	exon3			GACTGCGCCTACT		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.145G>T	17.37:g.73723340G>T	ENSP00000200181:p.Ala49Ser	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	11.0	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.164637	0.38217	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.86497	-2.13;-2.13;-2.13	5.36	5.36	0.76844	Integrin beta subunit, N-terminal (2);	0.063342	0.64402	D	0.000007	D	0.86740	0.6005	L	0.52364	1.645	0.51012	D	0.999901	B;P;P;P	0.45768	0.247;0.651;0.866;0.866	B;B;P;P	0.49276	0.279;0.354;0.605;0.605	D	0.85406	0.1134	10	0.36615	T	0.2	.	12.2711	0.54706	0.0:0.0:0.7128:0.2872	.	49;49;49;49	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	S	49	ENSP00000200181:A49S;ENSP00000344079:A49S;ENSP00000400217:A49S	ENSP00000200181:A49S	A	+	1	0	ITGB4	71234935	1.000000	0.71417	0.995000	0.50966	0.881000	0.50899	4.928000	0.63447	2.505000	0.84491	0.655000	0.94253	GCC	G|1.000;A|0.000		0.602	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
ITPKB	3707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226923399	226923399	+	Silent	SNP	T	T	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:226923399T>G	ENST00000272117.3	-	1	1760	c.1761A>C	c.(1759-1761)ggA>ggC	p.G587G	ITPKB_ENST00000429204.1_Silent_p.G587G|ITPKB_ENST00000366784.1_Silent_p.G587G			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	587					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCCGAGGGCTTCCCTGCGTCT	0.602																																					p.G587G	Colon(84;110 1851 5306 33547)	.											.	ITPKB	230	0			c.A1761C						.						54.0	49.0	51.0					1																	226923399		2203	4300	6503	SO:0001819	synonymous_variant	3707	exon2			AGGGCTTCCCTGC	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1761A>C	1.37:g.226923399T>G		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	15.0	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	ENST00000272117.3	37	CCDS1555.1																																																																																			.		0.602	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
ITPR3	3710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33639857	33639857	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:33639857T>C	ENST00000374316.5	+	23	3840	c.2780T>C	c.(2779-2781)aTg>aCg	p.M927T	ITPR3_ENST00000605930.1_Missense_Mutation_p.M927T			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	927					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	ATGTCCACCATGGTGCTGAGC	0.612																																					p.M927T		.											.	ITPR3	1085	0			c.T2780C						.						93.0	81.0	85.0					6																	33639857		2203	4300	6503	SO:0001583	missense	3710	exon22			CCACCATGGTGCT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2780T>C	6.37:g.33639857T>C	ENSP00000363435:p.Met927Thr	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	11.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.576476	0.86645	.	.	ENSG00000096433	ENST00000374316	D	0.92348	-3.02	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	M	0.79926	2.475	0.58432	D	0.999998	P	0.47910	0.902	P	0.51229	0.663	D	0.94018	0.7290	10	0.66056	D	0.02	-47.7924	15.5417	0.76057	0.0:0.0:0.0:1.0	.	927	Q14573	ITPR3_HUMAN	T	927	ENSP00000363435:M927T	ENSP00000363435:M927T	M	+	2	0	ITPR3	33747835	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.072000	0.62099	0.533000	0.62120	ATG	.		0.612	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
KHDC3L	154288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	74072885	74072886	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:74072885_74072886GG>TT	ENST00000370367.3	+	2	290_291	c.237_238GG>TT	c.(235-240)ttGGac>ttTTac	p.79_80LD>FY		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	79	KH; atypical.						RNA binding (GO:0003723)										TGAATCGATTGGACCCTAACGG	0.569																																					p.L79F|p.D80Y		.											.	.	.	0			c.G237T|c.G238T						.																																			SO:0001583	missense	154288	exon2			TCGATTGGACCCT|CGATTGGACCCTA	AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	Exception_encountered	6.37:g.74072885_74072886delinsTT	ENSP00000359392:p.L79_D80delinsFY	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0|33.0	10.0|11.0	NM_001017361	B2RNW7	Missense_Mutation	SNP	ENST00000370367.3	37	CCDS34484.1																																																																																			.		0.569	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041202.3	NM_001017361	
KIF21B	23046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200945972	200945972	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:200945972G>A	ENST00000422435.2	-	32	4691	c.4375C>T	c.(4375-4377)Ctg>Ttg	p.L1459L	KIF21B_ENST00000360529.5_Silent_p.L1446L|KIF21B_ENST00000461742.2_Silent_p.L1459L|KIF21B_ENST00000332129.2_Silent_p.L1446L	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1459					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GTGACCGTCAGGCACATCACA	0.627																																					p.L1459L		.											.	KIF21B	96	0			c.C4375T						.						45.0	40.0	42.0					1																	200945972		2203	4300	6503	SO:0001819	synonymous_variant	23046	exon32			CCGTCAGGCACAT	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4375C>T	1.37:g.200945972G>A		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	13.0	NM_001252102	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	37	CCDS58056.1																																																																																			.		0.627	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
KRTAP10-2	386679	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45970816	45970816	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr21:45970816A>T	ENST00000391621.1	-	1	572	c.526T>A	c.(526-528)Tcc>Acc	p.S176T	KRTAP10-2_ENST00000498210.1_Intron|TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	176	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						TGACACGGGGAGGAGGTGCAG	0.607																																					p.S176T		.											.	KRTAP10-2	135	0			c.T526A						.						116.0	119.0	118.0					21																	45970816		2203	4300	6503	SO:0001583	missense	386679	exon1			ACGGGGAGGAGGT	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.526T>A	21.37:g.45970816A>T	ENSP00000375479:p.Ser176Thr	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	7.0	NM_198693	Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	a	7.284	0.609734	0.14066	.	.	ENSG00000205445	ENST00000391621	T	0.01787	4.64	2.77	-1.16	0.09678	.	.	.	.	.	T	0.02533	0.0077	M	0.82716	2.605	0.09310	N	1	B	0.14805	0.011	B	0.14023	0.01	T	0.49428	-0.8941	9	0.13853	T	0.58	.	2.8818	0.05649	0.5442:0.0:0.26:0.1957	.	176	P60368	KR102_HUMAN	T	176	ENSP00000375479:S176T	ENSP00000375479:S176T	S	-	1	0	KRTAP10-2	44795244	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.918000	0.04021	-0.093000	0.12396	0.379000	0.24179	TCC	.		0.607	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
LENG8	114823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54966690	54966690	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:54966690G>A	ENST00000326764.5	+	8	1448	c.969G>A	c.(967-969)gcG>gcA	p.A323A	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	286										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		TGCTGCAGGCGCGGCTGCAGG	0.632																																					p.A323A		.											.	LENG8	91	0			c.G969A						.						40.0	44.0	43.0					19																	54966690		2203	4300	6503	SO:0001819	synonymous_variant	114823	exon8			GCAGGCGCGGCTG	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.969G>A	19.37:g.54966690G>A		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	8.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	ENST00000326764.5	37	CCDS12894.1																																																																																			.		0.632	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
MAP2K1	5604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	66729188	66729188	+	Silent	SNP	G	G	A	rs139364105		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr15:66729188G>A	ENST00000307102.5	+	3	927	c.396G>A	c.(394-396)gcG>gcA	p.A132A		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	132	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	TCTATGGTGCGTTCTACAGCG	0.532													A|||	1	0.000199681	0.0008	0.0	5008	,	,		22193	0.0		0.0	False		,,,				2504	0.0				p.A132A		.											.	MAP2K1	978	0			c.G396A						.						184.0	139.0	154.0					15																	66729188		2201	4299	6500	SO:0001819	synonymous_variant	5604	exon3			TGGTGCGTTCTAC	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.396G>A	15.37:g.66729188G>A		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	17.0	NM_002755		Silent	SNP	ENST00000307102.5	37	CCDS10216.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	9.281	1.048178	0.19827	.	.	ENSG00000169032	ENST00000425818	.	.	.	5.15	-10.3	0.00346	.	.	.	.	.	T	0.50051	0.1593	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65269	-0.6209	4	.	.	.	-13.449	11.6939	0.51532	0.0948:0.5501:0.2921:0.0631	.	.	.	.	I	72	.	.	V	+	1	0	MAP2K1	64516242	0.000000	0.05858	0.062000	0.19696	0.925000	0.55904	-4.593000	0.00211	-2.957000	0.00291	-1.126000	0.01995	GTT	G|0.999;A|0.001		0.532	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
MAP3K7	6885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	91269811	91269811	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:91269811C>A	ENST00000369329.3	-	5	627	c.466G>T	c.(466-468)Gac>Tac	p.D156Y	MAP3K7_ENST00000369325.3_Missense_Mutation_p.D156Y|MAP3K7_ENST00000369327.3_Missense_Mutation_p.D156Y|MAP3K7_ENST00000369332.3_Missense_Mutation_p.D156Y	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	156	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GGTTTCAGGTCCCTGTGAATT	0.478																																					p.D156Y		.											.	MAP3K7	980	0			c.G466T						.						239.0	217.0	225.0					6																	91269811		2203	4300	6503	SO:0001583	missense	6885	exon5			TCAGGTCCCTGTG	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.466G>T	6.37:g.91269811C>A	ENSP00000358335:p.Asp156Tyr	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	46.0	NM_145333	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	37	CCDS5028.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417423	0.83449	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	5.11	5.11	0.69529	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86657	0.5985	H	0.99675	4.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92805	0.6259	10	0.87932	D	0	.	18.8863	0.92379	0.0:1.0:0.0:0.0	.	156;156;156;156	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	Y	156	ENSP00000358338:D156Y;ENSP00000358335:D156Y;ENSP00000358331:D156Y;ENSP00000358333:D156Y	ENSP00000358331:D156Y	D	-	1	0	MAP3K7	91326532	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.530000	0.85305	0.585000	0.79938	GAC	.		0.478	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	
MGAT4B	11282	ucsc.edu;mdanderson.org	37	5	179225293	179225293	+	Intron	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:179225293G>A	ENST00000292591.7	-	14	1861				MIR1229_ENST00000408467.1_RNA|MGAT4B_ENST00000521305.1_5'Flank|MGAT4B_ENST00000337755.5_Intron	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B						cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAGGGCAGTGGTGAGAGGGT	0.667																																					.	GBM(13;414 434 4098 22176 23230)	.											.	.	.	0			.						.						26.0	31.0	30.0					5																	179225293		2201	4300	6501	SO:0001627	intron_variant	100302156	.			GGCAGTGGTGAGA	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1511-16C>T	5.37:g.179225293G>A		Somatic	14.0	0.0		WXS	Illumina HiSeq	.	19.0	9.0	.	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	RNA	SNP	ENST00000292591.7	37	CCDS4448.1																																																																																			.		0.667	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275	
MUT	4594	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49427174	49427174	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:49427174T>A	ENST00000274813.3	-	2	133	c.6A>T	c.(4-6)ttA>ttT	p.L2F		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	2					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCTTAGCTCTTAACATGGTGG	0.413																																					p.L2F		.											.	MUT	91	0			c.A6T						.						61.0	63.0	63.0					6																	49427174		2203	4299	6502	SO:0001583	missense	4594	exon2			AGCTCTTAACATG		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.6A>T	6.37:g.49427174T>A	ENSP00000274813:p.Leu2Phe	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	8.0	NM_000255	A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	ENST00000274813.3	37	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.359392	0.61403	.	.	ENSG00000146085	ENST00000274813	D	0.98105	-4.72	5.38	2.56	0.30785	.	0.000000	0.64402	D	0.000004	D	0.94466	0.8219	N	0.08118	0	0.38160	D	0.938996	D	0.65815	0.995	D	0.70487	0.969	D	0.94454	0.7670	10	0.54805	T	0.06	-15.4134	10.3353	0.43846	0.0:0.7:0.0:0.3	.	2	P22033	MUTA_HUMAN	F	2	ENSP00000274813:L2F	ENSP00000274813:L2F	L	-	3	2	MUT	49535133	0.997000	0.39634	1.000000	0.80357	0.828000	0.46876	0.418000	0.21230	0.738000	0.32606	-0.242000	0.12053	TTA	.		0.413	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1		
MYH9	4627	ucsc.edu;bcgsc.ca;mdanderson.org	37	22	36689429	36689429	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr22:36689429C>T	ENST00000216181.5	-	30	4271	c.4041G>A	c.(4039-4041)gaG>gaA	p.E1347E		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1347					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCTCCTCCTCCTCCTCCAGCT	0.637			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.E1347E		.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9	292	0			c.G4041A						.						82.0	78.0	79.0					22																	36689429		2203	4300	6503	SO:0001819	synonymous_variant	4627	exon30	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	CTCCTCCTCCTCC		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4041G>A	22.37:g.36689429C>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	.	18.0	4.0	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	37	CCDS13927.1																																																																																			.		0.637	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
MYO3A	53904	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	26462717	26462717	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:26462717delC	ENST00000265944.5	+	30	3690	c.3524delC	c.(3523-3525)accfs	p.T1176fs	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1176					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GAAGAGGAAACCACCAATGCT	0.373																																					p.T1175fs		.											.	MYO3A	1007	0			c.3524delC						.						64.0	62.0	63.0					10																	26462717		2203	4300	6503	SO:0001589	frameshift_variant	53904	exon30			AGGAAACCACCAA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3524delC	10.37:g.26462717delC	ENSP00000265944:p.Thr1176fs	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	27.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Frame_Shift_Del	DEL	ENST00000265944.5	37	CCDS7148.1																																																																																			.		0.373	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
NBEAL2	23218	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47040281	47040281	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:47040281A>G	ENST00000450053.3	+	23	3475	c.3296A>G	c.(3295-3297)gAg>gGg	p.E1099G	NBEAL2_ENST00000292309.5_Missense_Mutation_p.E1099G|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1099					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CTGGCGAGGGAGTTCCTGGTG	0.667											OREG0015546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E1099G		.											.	NBEAL2	69	0			c.A3296G						.						30.0	31.0	31.0					3																	47040281		2023	4171	6194	SO:0001583	missense	23218	exon23			CGAGGGAGTTCCT	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.3296A>G	3.37:g.47040281A>G	ENSP00000415034:p.Glu1099Gly	Somatic	48.0	1.0	943	WXS	Illumina HiSeq	Phase_I	31.0	9.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.27|17.27	3.346484|3.346484	0.61073|0.61073	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000450053|ENST00000416683	T;T|.	0.51325|.	0.71;1.2|.	5.05|5.05	5.05|5.05	0.67936|0.67936	Armadillo-like helical (1);|.	0.741239|.	0.11865|.	N|.	0.522010|.	T|T	0.59742|0.59742	0.2216|0.2216	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	P|.	0.44734|.	0.842|.	B|.	0.36922|.	0.236|.	T|T	0.57148|0.57148	-0.7861|-0.7861	10|5	0.46703|.	T|.	0.11|.	.|.	13.8206|13.8206	0.63318|0.63318	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1099|.	Q6ZNJ1|.	NBEL2_HUMAN|.	G|G	1099|571	ENSP00000292309:E1099G;ENSP00000415034:E1099G|.	ENSP00000292309:E1099G|.	E|S	+|+	2|1	0|0	NBEAL2|NBEAL2	47015285|47015285	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.786000|0.786000	0.44442|0.44442	7.099000|7.099000	0.76981|0.76981	2.138000|2.138000	0.66242|0.66242	0.454000|0.454000	0.30748|0.30748	GAG|AGT	.		0.667	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
NELFB	25920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140158810	140158810	+	Splice_Site	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:140158810G>T	ENST00000343053.4	+	6	1233		c.e6+1			NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AGGTGCTGGGGTGAGGGTCGG	0.657																																					.		.											.	.	.	0			c.896+1G>T						.						51.0	52.0	52.0					9																	140158810		2192	4296	6488	SO:0001630	splice_region_variant	25920	exon6			GCTGGGGTGAGGG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.896+1G>T	9.37:g.140158810G>T		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	19.0	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Splice_Site	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153040	0.78001	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.902	0.79384	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COBRA1	139278631	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	9.611000	0.98342	2.134000	0.65973	0.313000	0.20887	.	.		0.657	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	Intron
NFXL1	152518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	47850329	47850329	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:47850329T>A	ENST00000507489.1	-	23	2763	c.2587A>T	c.(2587-2589)Aga>Tga	p.R863*	NFXL1_ENST00000381538.3_Nonsense_Mutation_p.R863*	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	863						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CCCTTCAGTCTGTTTTCAAAA	0.328																																					p.R863X		.											.	NFXL1	524	0			c.A2587T						.						122.0	119.0	120.0					4																	47850329		2203	4300	6503	SO:0001587	stop_gained	152518	exon23			TCAGTCTGTTTTC	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2587A>T	4.37:g.47850329T>A	ENSP00000422037:p.Arg863*	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	36.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Nonsense_Mutation	SNP	ENST00000507489.1	37	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	T	37	6.286246	0.97444	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	.	.	.	5.66	4.41	0.53225	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.0455	12.1758	0.54184	0.0:0.0:0.1426:0.8574	.	.	.	.	X	863	.	ENSP00000370949:R863X	R	-	1	2	NFXL1	47545086	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.341000	0.33907	2.158000	0.67659	0.528000	0.53228	AGA	.		0.328	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
NGFR	4804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47587941	47587941	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:47587941G>C	ENST00000172229.3	+	4	861	c.736G>C	c.(736-738)Ggc>Cgc	p.G246R	NGFR_ENST00000504201.1_Missense_Mutation_p.G152R|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	246	Ser/Thr-rich.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GGTGACCCGAGGCACCACCGA	0.607																																					p.G246R		.											.	NGFR	947	0			c.G736C						.						109.0	99.0	102.0					17																	47587941		2203	4300	6503	SO:0001583	missense	4804	exon4			ACCCGAGGCACCA	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.736G>C	17.37:g.47587941G>C	ENSP00000172229:p.Gly246Arg	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	15.0	NM_002507	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	37	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449678	0.43531	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.91295	-2.74;-2.82	4.85	4.85	0.62838	.	0.168500	0.51477	D	0.000088	D	0.88328	0.6407	M	0.65975	2.015	0.34770	D	0.733639	P	0.38617	0.64	B	0.33121	0.158	D	0.91457	0.5186	10	0.33940	T	0.23	-48.9827	16.0977	0.81139	0.0:0.0:1.0:0.0	.	246	P08138	TNR16_HUMAN	R	246;152	ENSP00000172229:G246R;ENSP00000421731:G152R	ENSP00000172229:G246R	G	+	1	0	NGFR	44942940	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	8.372000	0.90127	2.397000	0.81536	0.650000	0.86243	GGC	.		0.607	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
NPY5R	4889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	164272303	164272303	+	Missense_Mutation	SNP	C	C	T	rs146231711		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:164272303C>T	ENST00000515560.1	+	4	2400	c.878C>T	c.(877-879)aCa>aTa	p.T293I	NPY5R_ENST00000338566.3_Missense_Mutation_p.T293I|NPY5R_ENST00000506953.1_Missense_Mutation_p.T293I			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	293					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				AGCAAGAAGACAGCATGTGTG	0.428																																					p.T293I	Melanoma(139;1287 1774 9781 19750 25599)	.											.	NPY5R	523	0			c.C878T						.	C	ILE/THR	1,4405	2.1+/-5.4	0,1,2202	99.0	99.0	99.0		878	2.7	0.8	4	dbSNP_134	99	0,8600		0,0,4300	no	missense	NPY5R	NM_006174.2	89	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	293/446	164272303	1,13005	2203	4300	6503	SO:0001583	missense	4889	exon4			AGAAGACAGCATG	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.878C>T	4.37:g.164272303C>T	ENSP00000423917:p.Thr293Ile	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	9.0	NM_006174	Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	37	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332690	0.24167	2.27E-4	0.0	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.71817	-0.6;-0.6;-0.6	4.49	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.166788	0.27126	N	0.020803	T	0.63920	0.2552	L	0.43152	1.355	0.30306	N	0.789	P	0.45396	0.857	B	0.43623	0.425	T	0.62388	-0.6865	10	0.30078	T	0.28	.	13.6284	0.62181	0.2831:0.7169:0.0:0.0	.	293	Q15761	NPY5R_HUMAN	I	293	ENSP00000339377:T293I;ENSP00000423917:T293I;ENSP00000423474:T293I	ENSP00000339377:T293I	T	+	2	0	NPY5R	164491753	0.857000	0.29778	0.849000	0.33467	0.724000	0.41520	1.591000	0.36665	0.555000	0.29079	0.467000	0.42956	ACA	C|1.000;T|0.000		0.428	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174	
NTRK1	4914	broad.mit.edu;bcgsc.ca	37	1	156843727	156843727	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:156843727T>C	ENST00000524377.1	+	8	1194	c.1153T>C	c.(1153-1155)Ttc>Ctc	p.F385L	NTRK1_ENST00000392302.2_Missense_Mutation_p.F355L|NTRK1_ENST00000368196.3_Missense_Mutation_p.F385L|NTRK1_ENST00000358660.3_Missense_Mutation_p.F385L	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	385					activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CCCTTTCGAGTTCAACCCCGA	0.627			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.F385L		.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1	1393	0			c.T1153C						.						44.0	32.0	36.0					1																	156843727		2180	4254	6434	SO:0001583	missense	4914	exon8			TTCGAGTTCAACC	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1153T>C	1.37:g.156843727T>C	ENSP00000431418:p.Phe385Leu	Somatic	67.0	2.0		WXS	Illumina HiSeq	Phase_I	76.0	26.0	NM_001012331	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	T	13.24	2.179605	0.38511	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.75154	-0.88;-0.88;-0.89;-0.91	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000013	T	0.48447	0.1500	L	0.29908	0.895	0.49687	D	0.999813	B;P;B;B	0.42248	0.093;0.774;0.126;0.084	B;B;B;B	0.35813	0.046;0.211;0.023;0.047	T	0.54309	-0.8313	9	.	.	.	.	14.9197	0.70829	0.0:0.0:0.0:1.0	.	385;385;385;355	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	L	355;385;385;385	ENSP00000376120:F355L;ENSP00000357179:F385L;ENSP00000431418:F385L;ENSP00000351486:F385L	.	F	+	1	0	NTRK1	155110351	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.994000	0.56994	2.199000	0.70637	0.533000	0.62120	TTC	.		0.627	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
NUP205	23165	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135300725	135300725	+	Silent	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:135300725A>G	ENST00000285968.6	+	24	3398	c.3372A>G	c.(3370-3372)ctA>ctG	p.L1124L		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1124					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						CAATAGAGCTAAGGGTAACCT	0.403																																					p.L1124L		.											.	NUP205	207	0			c.A3372G						.						134.0	120.0	125.0					7																	135300725		2203	4300	6503	SO:0001819	synonymous_variant	23165	exon24			AGAGCTAAGGGTA	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.3372A>G	7.37:g.135300725A>G		Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	48.0	11.0	NM_015135	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	37	CCDS34759.1																																																																																			.		0.403	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
NUP210L	91181	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154067567	154067567	+	Silent	SNP	C	C	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:154067567C>G	ENST00000368559.3	-	15	2102	c.2031G>C	c.(2029-2031)ggG>ggC	p.G677G	NUP210L_ENST00000271854.3_Silent_p.G677G	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	677					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GACGAGGACCCCCTTCAAATA	0.433																																					p.G677G		.											.	NUP210L	77	0			c.G2031C						.						87.0	82.0	84.0					1																	154067567		1846	4087	5933	SO:0001819	synonymous_variant	91181	exon15			AGGACCCCCTTCA	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2031G>C	1.37:g.154067567C>G		Somatic	98.0	1.0		WXS	Illumina HiSeq	Phase_I	60.0	23.0	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	ENST00000368559.3	37	CCDS41399.1																																																																																			.		0.433	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
OBSCN	84033	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228496800	228496800	+	Splice_Site	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:228496800C>T	ENST00000422127.1	+	48	12784	c.12740C>T	c.(12739-12741)gCt>gTt	p.A4247V	OBSCN_ENST00000284548.11_Splice_Site_p.A4247V|OBSCN_ENST00000570156.2_Splice_Site_p.A5204V|OBSCN_ENST00000366707.4_Splice_Site_p.A1881V|OBSCN_ENST00000366709.4_Splice_Site_p.A1366V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4247					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTGTGTCCAGCTCCTGAGGTG	0.632																																					p.A5204V		.											.	OBSCN	403	0			c.C15611T						.						12.0	13.0	13.0					1																	228496800		2003	4178	6181	SO:0001630	splice_region_variant	84033	exon59			GTCCAGCTCCTGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12740-1C>T	1.37:g.228496800C>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	11.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360709	0.82353	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.05258	3.47;3.47;3.47;3.47	5.38	-1.98	0.07480	Immunoglobulin-like fold (1);	0.684498	0.13545	N	0.379904	T	0.02970	0.0088	N	0.16708	0.43	0.09310	N	1	B;B	0.29766	0.214;0.256	B;B	0.21546	0.035;0.034	T	0.45234	-0.9275	9	.	.	.	.	6.1059	0.20073	0.1567:0.293:0.0:0.5503	.	4247;4247	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	V	4247;4247;1881;1366	ENSP00000284548:A4247V;ENSP00000409493:A4247V;ENSP00000355668:A1881V;ENSP00000355670:A1366V	.	A	+	2	0	OBSCN	226563423	0.001000	0.12720	0.000000	0.03702	0.811000	0.45836	-0.514000	0.06298	-0.598000	0.05806	0.561000	0.74099	GCT	.		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	Missense_Mutation
OGG1	4968	ucsc.edu;bcgsc.ca	37	3	9792767	9792767	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:9792767G>T	ENST00000344629.7	+	2	619	c.276G>T	c.(274-276)gaG>gaT	p.E92D	OGG1_ENST00000302008.8_Missense_Mutation_p.E92D|OGG1_ENST00000349503.5_Missense_Mutation_p.E92D|OGG1_ENST00000449570.2_Missense_Mutation_p.E92D|OGG1_ENST00000302003.7_Missense_Mutation_p.E92D|OGG1_ENST00000339511.5_Missense_Mutation_p.E92D|OGG1_ENST00000383826.5_Missense_Mutation_p.E92D|OGG1_ENST00000302036.7_Missense_Mutation_p.E92D			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	92					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					CACCAGACGAGCTGGAGGCCG	0.572								Base excision repair (BER), DNA glycosylases																													p.E92D		.											.	OGG1	660	0			c.G276T						.						100.0	80.0	87.0					3																	9792767		2203	4300	6503	SO:0001583	missense	4968	exon2			AGACGAGCTGGAG	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.276G>T	3.37:g.9792767G>T	ENSP00000342851:p.Glu92Asp	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_016819	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Missense_Mutation	SNP	ENST00000344629.7	37	CCDS2581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.01|13.01	2.109214|2.109214	0.37242|0.37242	.|.	.|.	ENSG00000114026|ENSG00000114026	ENST00000302003;ENST00000344629;ENST00000302036;ENST00000349503;ENST00000339511;ENST00000449570;ENST00000302008;ENST00000383826|ENST00000426518	T;T;T;T;T;T;T;T|.	0.53857|.	0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6|.	5.54|5.54	3.66|3.66	0.41972|0.41972	8-oxoguanine DNA glycosylase, N-terminal (1);Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);|.	0.224044|.	0.47093|.	D|.	0.000253|.	T|T	0.32823|0.32823	0.0842|0.0842	N|N	0.20881|0.20881	0.62|0.62	0.36598|0.36598	D|D	0.874512|0.874512	B;B;B;B;B;B;B;B|.	0.23128|.	0.001;0.029;0.08;0.006;0.002;0.047;0.001;0.008|.	B;B;B;B;B;B;B;B|.	0.21546|.	0.015;0.035;0.016;0.009;0.005;0.035;0.004;0.006|.	T|T	0.27739|0.27739	-1.0065|-1.0065	10|5	0.27785|.	T|.	0.31|.	-29.3912|-29.3912	3.7961|3.7961	0.08740|0.08740	0.1024:0.2812:0.4695:0.1469|0.1024:0.2812:0.4695:0.1469	.|.	92;92;92;92;92;92;92;92|.	E5KPM8;E5KPM6;E5KPM5;E5KPM7;E5KPM9;E5KPN0;O15527;O15527-2|.	.;.;.;.;.;.;OGG1_HUMAN;.|.	D|I	92|2	ENSP00000305584:E92D;ENSP00000342851:E92D;ENSP00000306561:E92D;ENSP00000303132:E92D;ENSP00000345520:E92D;ENSP00000403598:E92D;ENSP00000305527:E92D;ENSP00000373337:E92D|.	ENSP00000305584:E92D|.	E|S	+|+	3|2	2|0	OGG1|OGG1	9767767|9767767	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.586000|0.586000	0.36452|0.36452	2.389000|2.389000	0.44407|0.44407	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	GAG|AGC	.		0.572	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214223.2	NM_016821	
OR10T2	128360	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158368833	158368833	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:158368833C>A	ENST00000334438.1	-	1	423	c.424G>T	c.(424-426)Ggg>Tgg	p.G142W		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					AACTCCAACCCCAGCCTTTTG	0.478																																					p.G142W		.											.	OR10T2	70	0			c.G424T						.						100.0	99.0	99.0					1																	158368833		2203	4300	6503	SO:0001583	missense	128360	exon1			CCAACCCCAGCCT	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.424G>T	1.37:g.158368833C>A	ENSP00000334115:p.Gly142Trp	Somatic	71.0	2.0		WXS	Illumina HiSeq	Phase_I	57.0	21.0	NM_001004475	Q6IF98	Missense_Mutation	SNP	ENST00000334438.1	37	CCDS30895.1	.	.	.	.	.	.	.	.	.	.	C	7.652	0.683036	0.14907	.	.	ENSG00000186306	ENST00000334438	T	0.38077	1.16	4.57	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41938	D	0.000797	T	0.21509	0.0518	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.75484	0.986	T	0.08700	-1.0709	10	0.87932	D	0	.	9.222	0.37382	0.1641:0.6768:0.1591:0.0	.	142	Q8NGX3	O10T2_HUMAN	W	142	ENSP00000334115:G142W	ENSP00000334115:G142W	G	-	1	0	OR10T2	156635457	0.003000	0.15002	0.018000	0.16275	0.087000	0.18053	1.768000	0.38511	1.090000	0.41315	0.655000	0.94253	GGG	.		0.478	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046371.1	NM_001004475	
OR4C46	119749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	51515655	51515655	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr11:51515655G>T	ENST00000328188.1	+	1	374	c.374G>T	c.(373-375)tGc>tTc	p.C125F		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						GTGGCCATCTGCAAGCCCTTG	0.483																																					p.C125F		.											.	OR4C46	69	0			c.G374T						.						159.0	157.0	157.0					11																	51515655		2201	4296	6497	SO:0001583	missense	119749	exon1			CCATCTGCAAGCC		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.374G>T	11.37:g.51515655G>T	ENSP00000329056:p.Cys125Phe	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	38.0	NM_001004703		Missense_Mutation	SNP	ENST00000328188.1	37	CCDS31498.1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.398440	0.25205	.	.	ENSG00000185926	ENST00000328188	T	0.34472	1.36	2.63	1.69	0.24217	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000127	T	0.68476	0.3005	H	0.98901	4.365	0.35436	D	0.79443	D	0.76494	0.999	D	0.63488	0.915	T	0.76677	-0.2871	10	0.87932	D	0	.	7.4418	0.27187	0.1419:0.0:0.8581:0.0	.	125	A6NHA9	O4C46_HUMAN	F	125	ENSP00000329056:C125F	ENSP00000329056:C125F	C	+	2	0	OR4C46	51372231	1.000000	0.71417	0.974000	0.42286	0.038000	0.13279	7.151000	0.77411	0.463000	0.27118	0.134000	0.15878	TGC	.		0.483	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703	
PAK3	5063	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	110416299	110416299	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chrX:110416299A>G	ENST00000372010.1	+	12	1307	c.865A>G	c.(865-867)Att>Gtt	p.I289V	PAK3_ENST00000519681.1_Missense_Mutation_p.I295V|PAK3_ENST00000262836.4_Missense_Mutation_p.I289V|PAK3_ENST00000518291.1_Missense_Mutation_p.I310V|PAK3_ENST00000425146.1_Missense_Mutation_p.I274V|PAK3_ENST00000372007.5_Missense_Mutation_p.I274V|PAK3_ENST00000446737.1_Missense_Mutation_p.I274V|PAK3_ENST00000417227.1_Missense_Mutation_p.I295V|PAK3_ENST00000360648.4_Missense_Mutation_p.I310V			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	289	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						ATTTGAAAAAATTGGTCAAGG	0.358										TSP Lung(19;0.15)																											p.I310V		.											.	PAK3	1043	0			c.A928G						.						44.0	41.0	42.0					X																	110416299		2202	4298	6500	SO:0001583	missense	5063	exon9			GAAAAAATTGGTC	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.865A>G	X.37:g.110416299A>G	ENSP00000361080:p.Ile289Val	Somatic	103.0	1.0		WXS	Illumina HiSeq	Phase_I	97.0	81.0	NM_001128168	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	A	15.64	2.893305	0.52121	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27	5.57	5.57	0.84162	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.22044	0.0531	L	0.41124	1.26	0.80722	D	1	P;B;P;B;P	0.37985	0.558;0.203;0.613;0.044;0.613	B;B;B;B;B	0.44278	0.317;0.213;0.445;0.06;0.445	T	0.01448	-1.1352	10	0.49607	T	0.09	.	14.4575	0.67425	1.0:0.0:0.0:0.0	.	295;310;289;274;289	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	V	274;274;289;295;274;310;310;295;289	ENSP00000410853:I274V;ENSP00000401982:I274V;ENSP00000361080:I289V;ENSP00000429113:I295V;ENSP00000361077:I274V;ENSP00000428921:I310V;ENSP00000353864:I310V;ENSP00000389172:I295V;ENSP00000262836:I289V	ENSP00000262836:I289V	I	+	1	0	PAK3	110302955	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.993000	0.88291	1.874000	0.54306	0.481000	0.45027	ATT	.		0.358	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
PCDH15	65217	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	55568699	55568699	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:55568699G>T	ENST00000395445.1	-	36	5505	c.5111C>A	c.(5110-5112)gCc>gAc	p.A1704D	PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000395440.1_Missense_Mutation_p.A638D|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395446.1_Missense_Mutation_p.A900D|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395442.1_Missense_Mutation_p.A569D|PCDH15_ENST00000409834.1_3'UTR	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCCACAGGGGCTGGTCCACT	0.478										HNSCC(58;0.16)																											.		.											.	PCDH15	193	0			.						.						86.0	68.0	73.0					10																	55568699		1565	3572	5137	SO:0001583	missense	65217	.			ACAGGGGCTGGTC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.5111C>A	10.37:g.55568699G>T	ENSP00000378832:p.Ala1704Asp	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	50.0	.	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000395445.1	37		.	.	.	.	.	.	.	.	.	.	G	11.36	1.616962	0.28801	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.46	2.53	0.30540	.	.	.	.	.	T	0.48995	0.1531	N	0.14661	0.345	0.18873	N	0.999984	B;B	0.18741	0.03;0.03	B;B	0.18561	0.022;0.022	T	0.44003	-0.9356	9	0.87932	D	0	.	9.7805	0.40645	0.1302:0.2135:0.6563:0.0	.	1702;1704	C6ZEF5;A2A3E2	.;.	D	1704;900;569;638	ENSP00000378832:A1704D;ENSP00000378833:A900D;ENSP00000378829:A569D;ENSP00000378827:A638D	ENSP00000378827:A638D	A	-	2	0	PCDH15	55238705	0.000000	0.05858	0.005000	0.12908	0.002000	0.02628	0.065000	0.14466	0.280000	0.22209	-0.797000	0.03246	GCC	.		0.478	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291335.1	NM_033056	
PAX2	5076	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	102584502	102584502	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:102584502G>A	ENST00000428433.1	+	9	1636	c.1086G>A	c.(1084-1086)gtG>gtA	p.V362V	PAX2_ENST00000370296.2_Silent_p.V362V|PAX2_ENST00000355243.3_Silent_p.V339V|PAX2_ENST00000556085.1_Silent_p.V338V|PAX2_ENST00000361791.3_Silent_p.V339V	NM_003987.3|NM_003990.3	NP_003978|NP_003981.2	Q02962	PAX2_HUMAN	paired box 2	362					aging (GO:0007568)|axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cell fate determination (GO:0001709)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucose stimulus (GO:0071333)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|glial cell differentiation (GO:0010001)|inner ear morphogenesis (GO:0042472)|mesenchymal to epithelial transition (GO:0060231)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|mesonephric duct development (GO:0072177)|mesonephric tubule formation (GO:0072172)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric nephron tubule formation (GO:0072289)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytolysis (GO:0045918)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of programmed cell death (GO:0043069)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|neural tube closure (GO:0001843)|optic chiasma development (GO:0061360)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|optic nerve development (GO:0021554)|optic nerve morphogenesis (GO:0021631)|optic nerve structural organization (GO:0021633)|pancreas development (GO:0031016)|paramesonephric duct development (GO:0061205)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of optic nerve formation (GO:2000597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|protein kinase B signaling (GO:0043491)|reactive oxygen species metabolic process (GO:0072593)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of metanephros size (GO:0035566)|response to nutrient levels (GO:0031667)|retinal pigment epithelium development (GO:0003406)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|ureter development (GO:0072189)|ureter maturation (GO:0035799)|ureter morphogenesis (GO:0072197)|urogenital system development (GO:0001655)|vestibulocochlear nerve formation (GO:0021650)|visual perception (GO:0007601)	centriolar satellite (GO:0034451)|lysosome (GO:0005764)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|superoxide-generating NADPH oxidase activity (GO:0016175)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		CAGGAATGGTGCCTGGTAGGT	0.617																																					p.V362V		.											.	PAX2	90	0			c.G1086A						.						79.0	72.0	75.0					10																	102584502		2203	4300	6503	SO:0001819	synonymous_variant	5076	exon9			AATGGTGCCTGGT		CCDS7499.1, CCDS41561.1	10q24.31	2011-06-20	2007-07-12		ENSG00000075891	ENSG00000075891		"""Paired boxes"", ""Homeoboxes / PRD class"""	8616	protein-coding gene	gene with protein product		167409	"""paired box gene 2"""			8431641, 7981748	Standard	NM_003990		Approved		uc001krk.4	Q02962	OTTHUMG00000018913	ENST00000428433.1:c.1086G>A	10.37:g.102584502G>A		Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	9.0	NM_003987	Q15105|Q15110|Q15837|Q5SZP2|Q5SZP3	Silent	SNP	ENST00000428433.1	37	CCDS53569.1																																																																																			.		0.617	PAX2-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
PCDHA7	56141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140215989	140215989	+	Missense_Mutation	SNP	A	A	T	rs370529939		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:140215989A>T	ENST00000525929.1	+	1	2021	c.2021A>T	c.(2020-2022)cAg>cTg	p.Q674L	PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.Q674L|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	674	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAAGCGGCCAGGCACCAAAG	0.657																																					p.Q674L	NSCLC(160;258 2013 5070 22440 28951)	.											.	PCDHA7	94	0			c.A2021T						.						77.0	75.0	76.0					5																	140215989		2203	4299	6502	SO:0001583	missense	56141	exon1			GCGGCCAGGCACC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2021A>T	5.37:g.140215989A>T	ENSP00000436426:p.Gln674Leu	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	15.0	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	A	2.151	-0.394480	0.04899	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.52295	0.67;0.7	3.57	2.36	0.29203	Cadherin (2);	0.298550	0.17684	U	0.165532	T	0.44829	0.1312	M	0.69358	2.11	0.09310	N	1	B;B	0.16802	0.019;0.011	B;B	0.23150	0.044;0.013	T	0.45145	-0.9281	10	0.62326	D	0.03	.	8.7292	0.34489	0.63:0.37:0.0:0.0	.	674;674	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	L	674	ENSP00000436426:Q674L;ENSP00000367365:Q674L	ENSP00000367365:Q674L	Q	+	2	0	PCDHA7	140196173	0.000000	0.05858	0.024000	0.17045	0.008000	0.06430	-0.103000	0.10940	0.513000	0.28278	0.379000	0.24179	CAG	.		0.657	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHB10	56126	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	5	140573688	140573688	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:140573688C>A	ENST00000239446.4	+	1	1747	c.1563C>A	c.(1561-1563)taC>taA	p.Y521*		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	521	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTGGACTACGAGGCCCTGC	0.706																																					p.Y521X		.											.	PCDHB10	92	0			c.C1563A						.						93.0	111.0	105.0					5																	140573688		2203	4298	6501	SO:0001587	stop_gained	56126	exon1			GGACTACGAGGCC	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1563C>A	5.37:g.140573688C>A	ENSP00000239446:p.Tyr521*	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	17.0	NM_018930	Q96T99	Nonsense_Mutation	SNP	ENST00000239446.4	37	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	c	36	5.833420	0.97003	.	.	ENSG00000120324	ENST00000239446	.	.	.	3.53	0.623	0.17654	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.8578	0.18730	0.0:0.4142:0.0:0.5858	.	.	.	.	X	521	.	ENSP00000239446:Y521X	Y	+	3	2	PCDHB10	140553872	0.000000	0.05858	0.960000	0.40013	0.961000	0.63080	-2.742000	0.00798	0.289000	0.22422	0.549000	0.68633	TAC	.		0.706	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82531973	82531973	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:82531973C>T	ENST00000333891.9	-	9	13859	c.13522G>A	c.(13522-13524)Gtt>Att	p.V4508I	PCLO_ENST00000423517.2_Missense_Mutation_p.V4508I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTACCTGAAACTGTGTGATCC	0.279																																					p.V4508I		.											.	PCLO	29	0			c.G13522A						.						217.0	185.0	195.0					7																	82531973		1814	4082	5896	SO:0001583	missense	27445	exon9			CTGAAACTGTGTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13522G>A	7.37:g.82531973C>T	ENSP00000334319:p.Val4508Ile	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	27.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173092	0.38413	.	.	ENSG00000186472	ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.32	5.7	4.82	0.62117	.	.	.	.	.	T	0.13457	0.0326	L	0.28115	0.83	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.12156	0.007;0.007	T	0.03773	-1.1005	9	0.87932	D	0	.	11.4181	0.49965	0.0:0.862:0.0:0.138	.	4508;4508	Q9Y6V0-5;Q9Y6V0-6	.;.	I	4508	ENSP00000334319:V4508I;ENSP00000388393:V4508I	ENSP00000334319:V4508I	V	-	1	0	PCLO	82369909	0.997000	0.39634	1.000000	0.80357	0.987000	0.75469	3.627000	0.54252	2.694000	0.91930	0.467000	0.42956	GTT	.		0.279	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PDZD7	79955	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	102782138	102782138	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:102782138C>A	ENST00000370215.3	-	5	772	c.547G>T	c.(547-549)Gat>Tat	p.D183Y		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	183						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		TTCACCACATCCACCCTGGAC	0.607																																					p.D183Y		.											.	PDZD7	136	0			c.G547T						.						75.0	69.0	71.0					10																	102782138		2203	4300	6503	SO:0001583	missense	79955	exon5			CCACATCCACCCT	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.547G>T	10.37:g.102782138C>A	ENSP00000359234:p.Asp183Tyr	Somatic	37.0	1.0		WXS	Illumina HiSeq	Phase_I	25.0	13.0	NM_001195263	D5FJ77|Q8N321	Missense_Mutation	SNP	ENST00000370215.3	37	CCDS31269.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464495	0.84425	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.14516	2.5	5.29	5.29	0.74685	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.35098	0.0920	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.01858	-1.1259	10	0.49607	T	0.09	.	18.9253	0.92541	0.0:1.0:0.0:0.0	.	183;183	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	Y	183	ENSP00000359234:D183Y	ENSP00000359234:D183Y	D	-	1	0	PDZD7	102772128	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	7.783000	0.85696	2.479000	0.83701	0.462000	0.41574	GAT	.		0.607	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
PLD4	122618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105398614	105398614	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr14:105398614G>T	ENST00000392593.4	+	10	1411	c.1243G>T	c.(1243-1245)Gtg>Ttg	p.V415L	PLD4_ENST00000553861.1_5'UTR|PLD4_ENST00000540372.1_Missense_Mutation_p.V422L	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	415					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			CATCGTGCCGGTGGGGAACCA	0.627																																					p.V415L		.											.	PLD4	651	0			c.G1243T						.						47.0	53.0	51.0					14																	105398614		2100	4218	6318	SO:0001583	missense	122618	exon10			GTGCCGGTGGGGA		CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.1243G>T	14.37:g.105398614G>T	ENSP00000376372:p.Val415Leu	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	13.0	NM_138790	Q6UWD2	Missense_Mutation	SNP	ENST00000392593.4	37	CCDS9995.2	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067649	0.36470	.	.	ENSG00000166428	ENST00000540372;ENST00000392593	T;T	0.22945	1.93;1.93	4.51	2.67	0.31697	.	0.085365	0.47093	D	0.000245	T	0.24198	0.0586	M	0.64404	1.975	0.80722	D	1	B;B	0.20988	0.044;0.05	B;B	0.24974	0.034;0.057	T	0.05209	-1.0899	10	0.37606	T	0.19	-18.6312	7.1021	0.25343	0.3452:0.0:0.6548:0.0	.	422;415	F5H2B5;Q96BZ4	.;PLD4_HUMAN	L	422;415	ENSP00000438677:V422L;ENSP00000376372:V415L	ENSP00000376372:V415L	V	+	1	0	PLD4	104469659	0.746000	0.28272	0.927000	0.36925	0.678000	0.39670	2.109000	0.41863	0.908000	0.36671	0.550000	0.68814	GTG	.		0.627	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000291348.2	NM_138790	
PPFIBP1	8496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	27787982	27787982	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:27787982A>T	ENST00000318304.8	+	4	487	c.204A>T	c.(202-204)gaA>gaT	p.E68D	PPFIBP1_ENST00000228425.6_Missense_Mutation_p.E68D|PPFIBP1_ENST00000535047.1_Missense_Mutation_p.E68D|PPFIBP1_ENST00000542629.1_Missense_Mutation_p.E68D|PPFIBP1_ENST00000545334.1_Missense_Mutation_p.E68D|PPFIBP1_ENST00000537927.1_Intron	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	68					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					ATGAGAAAGAAGGCTTGAGAT	0.463																																					p.E68D		.											.	PPFIBP1	228	0			c.A204T						.						102.0	104.0	104.0					12																	27787982		2203	4300	6503	SO:0001583	missense	8496	exon4			GAAAGAAGGCTTG	AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.204A>T	12.37:g.27787982A>T	ENSP00000314724:p.Glu68Asp	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	33.0	NM_003622	O75336|Q86X70|Q9NY03|Q9ULJ0	Missense_Mutation	SNP	ENST00000318304.8	37	CCDS55812.1	.	.	.	.	.	.	.	.	.	.	A	10.05	1.245443	0.22796	.	.	ENSG00000110841	ENST00000543820;ENST00000545381;ENST00000545334;ENST00000318304;ENST00000535047;ENST00000542629;ENST00000228425;ENST00000535575;ENST00000542187	T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48	4.53	0.91	0.19337	.	0.000000	0.33005	U	0.005396	T	0.05686	0.0149	N	0.11064	0.09	0.35587	D	0.80678	B;B;B;B;B	0.21452	0.002;0.056;0.004;0.003;0.039	B;B;B;B;B	0.23574	0.005;0.027;0.012;0.006;0.047	T	0.38607	-0.9653	10	0.19147	T	0.46	-22.965	5.2389	0.15462	0.5106:0.1516:0.3378:0.0	.	68;68;68;68;68	Q86W92;Q86W92-2;Q86W92-4;Q86W92-5;F5H0E0	LIPB1_HUMAN;.;.;.;.	D	68;68;68;68;68;68;68;68;81	ENSP00000445822:E68D;ENSP00000314724:E68D;ENSP00000444046:E68D;ENSP00000443442:E68D;ENSP00000228425:E68D	ENSP00000228425:E68D	E	+	3	2	PPFIBP1	27679249	0.972000	0.33761	0.999000	0.59377	0.856000	0.48823	0.226000	0.17776	0.006000	0.14734	0.254000	0.18369	GAA	.		0.463	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	NM_003622	
PRSS50	29122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46755757	46755757	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:46755757C>A	ENST00000460241.1	-	9	2375	c.705G>T	c.(703-705)aaG>aaT	p.K235N	PRSS50_ENST00000315170.7_Missense_Mutation_p.K235N			Q9UI38	TSP50_HUMAN	protease, serine, 50	235	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						GGGAATGGTCCTTCAACACAT	0.597																																					p.K235N	Pancreas(41;915 1239 11561 17469)	.											.	PRSS50	90	0			c.G705T						.						121.0	91.0	101.0					3																	46755757		2202	4300	6502	SO:0001583	missense	29122	exon4			ATGGTCCTTCAAC	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.705G>T	3.37:g.46755757C>A	ENSP00000418875:p.Lys235Asn	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	20.0	NM_013270		Missense_Mutation	SNP	ENST00000460241.1	37	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983530	0.53827	.	.	ENSG00000206549	ENST00000455218;ENST00000315170;ENST00000460241	D;D	0.89196	-2.48;-2.48	3.6	1.81	0.25067	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.735756	0.11871	N	0.521475	T	0.79317	0.4425	N	0.19112	0.55	0.22199	N	0.9993	B	0.30634	0.288	B	0.34038	0.174	T	0.66909	-0.5804	10	0.33141	T	0.24	.	5.9328	0.19148	0.0:0.7625:0.0:0.2375	.	235	Q9UI38	TSP50_HUMAN	N	149;235;235	ENSP00000326598:K235N;ENSP00000418875:K235N	ENSP00000326598:K235N	K	-	3	2	PRSS50	46730761	0.007000	0.16637	0.972000	0.41901	0.019000	0.09904	0.282000	0.18829	0.533000	0.28675	-0.381000	0.06696	AAG	.		0.597	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1		
PTX3	5806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	157160183	157160183	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:157160183G>A	ENST00000295927.3	+	3	706	c.561G>A	c.(559-561)atG>atA	p.M187I	VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392832.2_Intron|VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000392833.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	187	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TATTCCCAATGCGTTCCAAGA	0.348																																					p.M187I		.											.	PTX3	514	0			c.G561A						.						54.0	54.0	54.0					3																	157160183		2203	4300	6503	SO:0001583	missense	5806	exon3			CCCAATGCGTTCC	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.561G>A	3.37:g.157160183G>A	ENSP00000295927:p.Met187Ile	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	11.0	NM_002852	B2R6T6|Q38M82	Missense_Mutation	SNP	ENST00000295927.3	37	CCDS3180.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105810	0.77096	.	.	ENSG00000163661	ENST00000295927	T	0.06218	3.33	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.037066	0.85682	D	0.000000	T	0.29028	0.0721	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.01520	-1.1334	10	0.31617	T	0.26	-36.0161	19.3998	0.94623	0.0:0.0:1.0:0.0	.	187	P26022	PTX3_HUMAN	I	187	ENSP00000295927:M187I	ENSP00000295927:M187I	M	+	3	0	PTX3	158642877	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.238000	0.78173	2.586000	0.87340	0.655000	0.94253	ATG	.		0.348	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852	
RINT1	60561	broad.mit.edu;ucsc.edu	37	7	105189009	105189009	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:105189009T>A	ENST00000257700.2	+	7	1079	c.848T>A	c.(847-849)tTa>tAa	p.L283*		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	283	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGAGATGAATTACTTACTGAG	0.393																																					p.L283X		.											.	RINT1	517	0			c.T848A						.						156.0	136.0	143.0					7																	105189009		2203	4300	6503	SO:0001587	stop_gained	60561	exon7			ATGAATTACTTAC	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.848T>A	7.37:g.105189009T>A	ENSP00000257700:p.Leu283*	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	6.0	NM_021930	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Nonsense_Mutation	SNP	ENST00000257700.2	37	CCDS34726.1	.	.	.	.	.	.	.	.	.	.	T	40	7.942649	0.98574	.	.	ENSG00000135249	ENST00000257700	.	.	.	5.78	5.78	0.91487	.	0.403782	0.26279	N	0.025300	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-11.4192	16.106	0.81223	0.0:0.0:0.0:1.0	.	.	.	.	X	283	.	ENSP00000257700:L283X	L	+	2	0	RINT1	104976245	1.000000	0.71417	0.986000	0.45419	0.966000	0.64601	7.018000	0.76406	2.194000	0.70268	0.528000	0.53228	TTA	.		0.393	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	
RNF135	84282	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	29326075	29326075	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:29326075T>C	ENST00000328381.5	+	5	2038	c.1165T>C	c.(1165-1167)Ttc>Ctc	p.F389L	RNF135_ENST00000324689.4_3'UTR|RNF135_ENST00000443677.2_3'UTR|RNF135_ENST00000535306.2_3'UTR	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	389	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				AAAGCTTGCCTTCTATTCAGT	0.532																																					p.F389L		.											.	RNF135	227	1	Unknown(1)	central_nervous_system(1)	c.T1165C						.						117.0	115.0	116.0					17																	29326075		2203	4300	6503	SO:0001583	missense	84282	exon5			CTTGCCTTCTATT	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.1165T>C	17.37:g.29326075T>C	ENSP00000328340:p.Phe389Leu	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	5.0	NM_032322	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	37	CCDS11262.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.788634	0.90367	.	.	ENSG00000181481	ENST00000328381;ENST00000535605	D	0.89343	-2.5	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.47093	D	0.000241	D	0.95121	0.8419	M	0.90595	3.13	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95864	0.8885	10	0.87932	D	0	-20.0779	13.3379	0.60528	0.0:0.0:0.0:1.0	.	389	Q8IUD6	RN135_HUMAN	L	389;208	ENSP00000328340:F389L	ENSP00000328340:F389L	F	+	1	0	RNF135	26350201	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	5.296000	0.65698	2.112000	0.64535	0.533000	0.62120	TTC	.		0.532	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	
RNF149	284996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	101911551	101911551	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:101911551T>C	ENST00000295317.3	-	2	660	c.553A>G	c.(553-555)Ata>Gta	p.I185V		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	185					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						CCAACCCCTATGGTCATCGTT	0.453																																					p.I185V	Colon(25;331 612 6521 7355 31028)	.											.	RNF149	290	0			c.A553G						.						153.0	140.0	144.0					2																	101911551		2203	4300	6503	SO:0001583	missense	284996	exon2			CCCCTATGGTCAT	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.553A>G	2.37:g.101911551T>C	ENSP00000295317:p.Ile185Val	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	14.0	NM_173647	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	37	CCDS2051.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.009826	0.35415	.	.	ENSG00000163162	ENST00000295317	T	0.07688	3.17	5.26	4.1	0.47936	.	0.082861	0.48767	D	0.000172	T	0.07773	0.0195	L	0.45051	1.395	0.46028	D	0.998825	P	0.43750	0.816	B	0.36766	0.232	T	0.21999	-1.0229	10	0.44086	T	0.13	.	10.9748	0.47459	0.0:0.0733:0.0:0.9267	.	185	Q8NC42	RN149_HUMAN	V	185	ENSP00000295317:I185V	ENSP00000295317:I185V	I	-	1	0	RNF149	101277983	1.000000	0.71417	0.217000	0.23759	0.157000	0.22087	5.073000	0.64395	0.841000	0.35020	0.482000	0.46254	ATA	.		0.453	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
RPL18	6141	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	49121059	49121059	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:49121059G>T	ENST00000549920.1	-	2	471	c.79C>A	c.(79-81)Ctg>Atg	p.L27M	RPL18_ENST00000552588.1_Intron|SPHK2_ENST00000598088.1_5'Flank|SPHK2_ENST00000601712.1_5'Flank|RPL18_ENST00000550645.1_Missense_Mutation_p.L27M|RPL18_ENST00000549273.1_Missense_Mutation_p.L27M|SPHK2_ENST00000340932.3_5'Flank|FAM83E_ENST00000595110.1_5'Flank|AC022154.7_ENST00000594850.1_RNA|SPHK2_ENST00000600537.1_5'Flank|AC022154.7_ENST00000600303.1_RNA|SPHK2_ENST00000245222.4_5'Flank|AC022154.7_ENST00000598735.1_RNA	NM_000979.3	NP_000970.1	Q07020	RL18_HUMAN	ribosomal protein L18	27					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|kidney(2)	3		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		TTGACCAACAGCCTCAGGTAG	0.587																																					p.L27M		.											.	RPL18	90	0			c.C79A						.						103.0	79.0	87.0					19																	49121059		2203	4300	6503	SO:0001583	missense	6141	exon2			CCAACAGCCTCAG	L11566	CCDS12726.1, CCDS58669.1	19q13	2011-04-06				ENSG00000063177		"""L ribosomal proteins"""	10310	protein-coding gene	gene with protein product	"""60S ribosomal protein L18"""	604179				8218404	Standard	NM_000979		Approved	L18	uc002pjq.2	Q07020	OTTHUMG00000169760	ENST00000549920.1:c.79C>A	19.37:g.49121059G>T	ENSP00000447001:p.Leu27Met	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	27.0	NM_000979	F8VWC5|Q8WTZ6	Missense_Mutation	SNP	ENST00000549920.1	37	CCDS12726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.772589|4.772589	0.90108|0.90108	.|.	.|.	ENSG00000063177|ENSG00000063177	ENST00000084795|ENST00000549920;ENST00000550645;ENST00000549273;ENST00000450952	.|.	.|.	.|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|Ribosomal protein L18e/L15P (2);	.|0.070269	.|0.64402	.|D	.|0.000018	D|D	0.85292|0.85292	0.5663|0.5663	M|M	0.91561|0.91561	3.22|3.22	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.989	.|D;D	.|0.85130	.|0.997;0.918	D|D	0.87980|0.87980	0.2742|0.2742	5|9	.|0.62326	.|D	.|0.03	-18.4838|-18.4838	16.506|16.506	0.84272|0.84272	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|27;27	.|B4DDY5;Q07020	.|.;RL18_HUMAN	D|M	28|27	.|.	.|ENSP00000407348:L27M	A|L	-|-	2|1	0|2	RPL18|RPL18	53812871|53812871	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.991000|0.991000	0.79684|0.79684	6.673000|6.673000	0.74482|0.74482	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	GCT|CTG	.		0.587	RPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405732.2	NM_000979	
RPP40	10799	broad.mit.edu;bcgsc.ca	37	6	5000046	5000050	+	Frame_Shift_Del	DEL	ATTTC	ATTTC	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	ATTTC	ATTTC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:5000046_5000050delATTTC	ENST00000380051.2	-	4	470_474	c.426_430delGAAAT	c.(424-432)atgaaatttfs	p.MKF142fs	RPP40_ENST00000319533.5_Frame_Shift_Del_p.MKF119fs|RPP40_ENST00000464646.1_Frame_Shift_Del_p.MKF82fs	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	142					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				TACTTACTAAATTTCATAATTTTTC	0.302																																					p.142_144del		.											.	RPP40	90	0			c.426_430del						.																																			SO:0001589	frameshift_variant	10799	exon4			TACTAAATTTCAT	U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.426_430delGAAAT	6.37:g.5000046_5000050delATTTC	ENSP00000369391:p.Met142fs	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	9.0	NM_006638	Q5VX97|Q8WVK8	Frame_Shift_Del	DEL	ENST00000380051.2	37	CCDS34333.1																																																																																			.		0.302	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039733.2	NM_006638	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38960151	38960151	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:38960151G>A	ENST00000359596.3	+	27	3763	c.3763G>A	c.(3763-3765)Gag>Aag	p.E1255K	RYR1_ENST00000360985.3_Missense_Mutation_p.E1255K|RYR1_ENST00000355481.4_Missense_Mutation_p.E1255K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1255	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCCTCACTATGAGGTAAGGAC	0.532																																					p.E1255K		.											.	RYR1	100	0			c.G3763A						.						80.0	73.0	75.0					19																	38960151		2203	4300	6503	SO:0001583	missense	6261	exon27			CACTATGAGGTAA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3763G>A	19.37:g.38960151G>A	ENSP00000352608:p.Glu1255Lys	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	13.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	g	12.97	2.096627	0.36952	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96885	-4.15;-4.16;-4.16	3.48	3.48	0.39840	.	0.000000	0.64402	U	0.000007	D	0.95414	0.8511	L	0.50333	1.59	0.51767	D	0.999937	D;P	0.59767	0.986;0.817	P;B	0.50405	0.64;0.164	D	0.94650	0.7838	10	0.39692	T	0.17	.	14.86	0.70372	0.0:0.0:1.0:0.0	.	1255;1255	P21817-2;P21817	.;RYR1_HUMAN	K	1255	ENSP00000352608:E1255K;ENSP00000347667:E1255K;ENSP00000354254:E1255K	ENSP00000347667:E1255K	E	+	1	0	RYR1	43651991	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	5.925000	0.70062	1.816000	0.52996	0.434000	0.28630	GAG	.		0.532	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
RYR2	6262	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237711846	237711846	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:237711846G>T	ENST00000366574.2	+	26	3339	c.3022G>T	c.(3022-3024)Gcg>Tcg	p.A1008S	RYR2_ENST00000360064.6_Missense_Mutation_p.A1006S|RYR2_ENST00000542537.1_Missense_Mutation_p.A992S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1008	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAATGTGTGGGCGCGGGATCG	0.473																																					p.A1008S		.											.	RYR2	158	0			c.G3022T						.						64.0	60.0	61.0					1																	237711846		1936	4147	6083	SO:0001583	missense	6262	exon26			GTGTGGGCGCGGG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3022G>T	1.37:g.237711846G>T	ENSP00000355533:p.Ala1008Ser	Somatic	74.0	1.0		WXS	Illumina HiSeq	Phase_I	56.0	16.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616478	0.87359	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.94576	-3.46;-3.46;-3.46	5.73	4.81	0.61882	Ryanodine receptor Ryr (1);	0.082305	0.46442	N	0.000294	D	0.95294	0.8473	M	0.76002	2.32	0.80722	D	1	P	0.52170	0.951	P	0.49085	0.6	D	0.95384	0.8475	10	0.62326	D	0.03	.	16.454	0.84007	0.0:0.0:0.8676:0.1324	.	1008	Q92736	RYR2_HUMAN	S	1008;1006;992	ENSP00000355533:A1008S;ENSP00000353174:A1006S;ENSP00000443798:A992S	ENSP00000353174:A1006S	A	+	1	0	RYR2	235778469	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.643000	0.98464	1.531000	0.49152	-0.182000	0.12963	GCG	.		0.473	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33895514	33895514	+	Missense_Mutation	SNP	G	G	T	rs552872767		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr15:33895514G>T	ENST00000389232.4	+	18	2183	c.2113G>T	c.(2113-2115)Gtt>Ttt	p.V705F	RYR3_ENST00000415757.3_Missense_Mutation_p.V705F	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	705	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGGCAATGGTGTTGGTGACGA	0.532																																					p.V705F		.											.	RYR3	520	0			c.G2113T						.						243.0	254.0	250.0					15																	33895514		2136	4245	6381	SO:0001583	missense	6263	exon18			AATGGTGTTGGTG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2113G>T	15.37:g.33895514G>T	ENSP00000373884:p.Val705Phe	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	29.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996826	0.93167	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.62364	0.03;0.03	5.42	5.42	0.78866	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000001	D	0.83811	0.5335	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.86455	0.1775	10	0.87932	D	0	.	19.4732	0.94971	0.0:0.0:1.0:0.0	.	705;705	Q15413-2;Q15413	.;RYR3_HUMAN	F	705	ENSP00000373884:V705F;ENSP00000399610:V705F	ENSP00000354735:V705F	V	+	1	0	RYR3	31682806	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.539000	0.98076	2.831000	0.97527	0.644000	0.83932	GTT	.		0.532	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SEPT9	10801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	75303253	75303253	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:75303253G>C	ENST00000427177.1	+	2	176	c.50G>C	c.(49-51)cGg>cCg	p.R17P	SEPT9_ENST00000591198.1_Intron|SEPT9_ENST00000449803.2_5'UTR|SEPT9_ENST00000431235.2_5'UTR	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	17					cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			GGCCGGCTCCGGAGGCTTGGT	0.622																																					p.R17P		.											.	SEPT9	659	0			c.G50C						.						90.0	89.0	90.0					17																	75303253		1568	3582	5150	SO:0001583	missense	10801	exon2			GGCTCCGGAGGCT	AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.50G>C	17.37:g.75303253G>C	ENSP00000391249:p.Arg17Pro	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	17.0	NM_001113491	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	ENST00000427177.1	37	CCDS45790.1	.	.	.	.	.	.	.	.	.	.	g	15.13	2.742457	0.49151	.	.	ENSG00000184640	ENST00000427177	T	0.37915	1.17	3.66	2.69	0.31865	.	.	.	.	.	T	0.28333	0.0700	N	0.08118	0	0.80722	D	1	D	0.67145	0.996	P	0.55455	0.776	T	0.12192	-1.0557	9	0.87932	D	0	.	7.1862	0.25801	0.1219:0.0:0.8781:0.0	.	17	Q9UHD8	SEPT9_HUMAN	P	17	ENSP00000391249:R17P	ENSP00000391249:R17P	R	+	2	0	SEPT9	72814848	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	4.328000	0.59253	1.132000	0.42129	-0.265000	0.10407	CGG	.		0.622	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640	
SETD2	29072	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47164729	47164729	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:47164729T>C	ENST00000409792.3	-	3	1439	c.1397A>G	c.(1396-1398)aAg>aGg	p.K466R		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	466					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GTATGTCTTCTTATACTCTTC	0.463			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.K466R		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.A1397G						.						251.0	196.0	213.0					3																	47164729		692	1591	2283	SO:0001583	missense	29072	exon3			GTCTTCTTATACT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1397A>G	3.37:g.47164729T>C	ENSP00000386759:p.Lys466Arg	Somatic	71.0	1.0		WXS	Illumina HiSeq	Phase_I	48.0	23.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	T	11.22	1.574767	0.28092	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	T;T	0.13307	2.6;2.6	5.0	5.0	0.66597	.	.	.	.	.	T	0.05640	0.0148	N	0.04508	-0.205	0.27925	N	0.938083	B;B	0.15930	0.015;0.015	B;B	0.09377	0.004;0.004	T	0.31392	-0.9945	9	0.20046	T	0.44	.	5.1446	0.14977	0.0:0.2164:0.0:0.7836	.	466;466	F2Z317;Q9BYW2	.;SETD2_HUMAN	R	466;466;466;422	ENSP00000386759:K466R;ENSP00000416401:K422R	ENSP00000386759:K466R	K	-	2	0	SETD2	47139733	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.448000	0.66612	2.226000	0.72624	0.533000	0.62120	AAG	.		0.463	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SH2B3	10019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	111885820	111885820	+	Missense_Mutation	SNP	T	T	C	rs537932422	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:111885820T>C	ENST00000341259.2	+	8	1799	c.1442T>C	c.(1441-1443)cTt>cCt	p.L481P	SH2B3_ENST00000538307.1_Missense_Mutation_p.L279P	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	481					blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	CCTTTCTCCCTTCCTCACTGG	0.567																																					p.L481P		.											.	SH2B3	91	0			c.T1442C						.						236.0	195.0	209.0					12																	111885820		2203	4300	6503	SO:0001583	missense	10019	exon8			TCTCCCTTCCTCA	AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1442T>C	12.37:g.111885820T>C	ENSP00000345492:p.Leu481Pro	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	9.0	NM_005475	B9EGG5|O95184	Missense_Mutation	SNP	ENST00000341259.2	37	CCDS9153.1	.	.	.	.	.	.	.	.	.	.	T	9.555	1.116826	0.20795	.	.	ENSG00000111252	ENST00000341259;ENST00000551001;ENST00000538307	T;T	0.35421	1.32;1.31	4.96	4.96	0.65561	.	0.312186	0.30347	N	0.009823	T	0.21145	0.0509	N	0.14661	0.345	0.80722	D	1	B;B;B	0.29612	0.023;0.017;0.251	B;B;B	0.21917	0.032;0.009;0.037	T	0.06826	-1.0805	10	0.42905	T	0.14	.	11.5822	0.50898	0.0:0.0:0.1491:0.8509	.	279;345;481	F5GYM4;Q59H48;Q9UQQ2	.;.;SH2B3_HUMAN	P	481;291;279	ENSP00000345492:L481P;ENSP00000440597:L279P	ENSP00000345492:L481P	L	+	2	0	SH2B3	110370203	0.886000	0.30341	0.953000	0.39169	0.567000	0.35839	3.418000	0.52721	2.002000	0.58637	0.379000	0.24179	CTT	.		0.567	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475	
SI	6476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	164737493	164737493	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:164737493G>T	ENST00000264382.3	-	28	3382	c.3320C>A	c.(3319-3321)cCa>cAa	p.P1107Q		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1107	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATATTCTGATGGCAGGCGAGT	0.408										HNSCC(35;0.089)																											p.P1107Q		.											.	SI	104	0			c.C3320A						.						102.0	99.0	100.0					3																	164737493		2203	4299	6502	SO:0001583	missense	6476	exon28			TCTGATGGCAGGC	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3320C>A	3.37:g.164737493G>T	ENSP00000264382:p.Pro1107Gln	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	23.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349569	0.82132	.	.	ENSG00000090402	ENST00000264382	D	0.86497	-2.13	4.46	4.46	0.54185	Glycoside hydrolase-type carbohydrate-binding (1);	0.075502	0.64402	D	0.000020	D	0.95127	0.8421	M	0.93898	3.47	0.54753	D	0.999982	D	0.89917	1.0	D	0.79784	0.993	D	0.96547	0.9405	10	0.87932	D	0	.	17.305	0.87192	0.0:0.0:1.0:0.0	.	1107	P14410	SUIS_HUMAN	Q	1107	ENSP00000264382:P1107Q	ENSP00000264382:P1107Q	P	-	2	0	SI	166220187	1.000000	0.71417	0.996000	0.52242	0.922000	0.55478	8.963000	0.93385	2.293000	0.77203	0.591000	0.81541	CCA	.		0.408	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SLCO1C1	53919	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	20893142	20893145	+	Frame_Shift_Del	DEL	GGAA	GGAA	-	rs558577357		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	GGAA	GGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:20893142_20893145delGGAA	ENST00000266509.2	+	12	1941_1944	c.1573_1576delGGAA	c.(1573-1578)ggaattfs	p.GI525fs	SLCO1C1_ENST00000545102.1_Frame_Shift_Del_p.GI407fs|SLCO1C1_ENST00000545604.1_Frame_Shift_Del_p.GI525fs|SLCO1C1_ENST00000540354.1_Frame_Shift_Del_p.GI476fs|SLCO1C1_ENST00000381552.1_Frame_Shift_Del_p.GI525fs	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	525	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	CACTTGTGTGGGAATTGCAGCTTC	0.343																																					p.525_526del		.											.	SLCO1C1	97	0			c.1573_1576del						.																																			SO:0001589	frameshift_variant	53919	exon12			TGTGTGGGAATTG	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1573_1576delGGAA	12.37:g.20893142_20893145delGGAA	ENSP00000266509:p.Gly525fs	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	28.0	NM_017435	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Frame_Shift_Del	DEL	ENST00000266509.2	37	CCDS8683.1																																																																																			.		0.343	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
SLC6A15	55117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85277689	85277689	+	Silent	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:85277689G>T	ENST00000266682.5	-	5	1246	c.705C>A	c.(703-705)gcC>gcA	p.A235A	SLC6A15_ENST00000552192.1_Silent_p.A128A|SLC6A15_ENST00000450363.3_Silent_p.A235A|SLC6A15_ENST00000551388.1_Intron	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	235					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						CCATGACCCAGGCAGCCAACA	0.443																																					p.A235A		.											.	SLC6A15	93	0			c.C705A						.						82.0	73.0	76.0					12																	85277689		2203	4300	6503	SO:0001819	synonymous_variant	55117	exon5			GACCCAGGCAGCC	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.705C>A	12.37:g.85277689G>T		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	21.0	NM_018057	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Silent	SNP	ENST00000266682.5	37	CCDS9026.1																																																																																			.		0.443	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	101813521	101813521	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:101813521C>T	ENST00000506729.1	-	3	832	c.661G>A	c.(661-663)Ggt>Agt	p.G221S	SLCO6A1_ENST00000514551.1_Intron|SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.G221S|SLCO6A1_ENST00000389019.3_Intron|SLCO6A1_ENST00000379810.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AATGATATACCACTGCTCTGG	0.338																																					p.G221S		.											.	SLCO6A1	96	0			c.G661A						.						170.0	166.0	168.0					5																	101813521		2203	4300	6503	SO:0001583	missense	133482	exon3			ATATACCACTGCT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.661G>A	5.37:g.101813521C>T	ENSP00000421339:p.Gly221Ser	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	17.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	C	4.681	0.126682	0.08931	.	.	ENSG00000205359	ENST00000506729;ENST00000379807	T;T	0.37235	1.21;1.21	4.84	-3.85	0.04243	Major facilitator superfamily domain, general substrate transporter (1);	5.373610	0.00754	N	0.001085	T	0.10294	0.0252	N	0.01576	-0.805	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.14699	-1.0463	10	0.08599	T	0.76	.	0.3132	0.00291	0.2792:0.1788:0.1454:0.3966	.	221	Q86UG4	SO6A1_HUMAN	S	221	ENSP00000421339:G221S;ENSP00000369135:G221S	ENSP00000369135:G221S	G	-	1	0	SLCO6A1	101841420	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.636000	0.05465	-0.485000	0.06754	-0.229000	0.12294	GGT	.		0.338	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
SORCS1	114815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	108459041	108459041	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:108459041G>A	ENST00000263054.6	-	9	1351	c.1344C>T	c.(1342-1344)ttC>ttT	p.F448F	SORCS1_ENST00000369698.1_5'UTR|SORCS1_ENST00000344440.6_Silent_p.F448F	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	448					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGGCCAGGGTGAAGTAGACAC	0.517																																					p.F448F		.											.	SORCS1	153	0			c.C1344T						.						263.0	197.0	219.0					10																	108459041		2203	4300	6503	SO:0001819	synonymous_variant	114815	exon9			CAGGGTGAAGTAG	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1344C>T	10.37:g.108459041G>A		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	19.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	37	CCDS7559.1																																																																																			.		0.517	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
SPHK1	8877	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	74382080	74382096	+	Frame_Shift_Del	DEL	GGCGTGCTCCCGCGGCC	GGCGTGCTCCCGCGGCC	-	rs373986019		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	GGCGTGCTCCCGCGGCC	GGCGTGCTCCCGCGGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:74382080_74382096delGGCGTGCTCCCGCGGCC	ENST00000545180.1	+	5	834_850	c.25_41delGGCGTGCTCCCGCGGCC	c.(25-42)ggcgtgctcccgcggcccfs	p.GVLPRP9fs	SPHK1_ENST00000590959.1_Frame_Shift_Del_p.GVLPRP23fs|SPHK1_ENST00000392496.3_Frame_Shift_Del_p.GVLPRP9fs|SPHK1_ENST00000323374.4_Frame_Shift_Del_p.GVLPRP95fs|SPHK1_ENST00000592299.1_Frame_Shift_Del_p.GVLPRP9fs			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	9					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	CGGCCCCCGGGGCGTGCTCCCGCGGCCCTGCCGCGTG	0.659											OREG0024750	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.95_100del	GBM(90;966 1307 27369 33775 44498)	.											.	SPHK1	1107	0			c.283_299del						.																																			SO:0001589	frameshift_variant	8877	exon3			CCCCGGGGCGTGC	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.25_41delGGCGTGCTCCCGCGGCC	17.37:g.74382080_74382096delGGCGTGCTCCCGCGGCC	ENSP00000440970:p.Gly9fs	Somatic	32.0	0.0	1152	WXS	Illumina HiSeq	Phase_I	28.0	10.0	NM_182965	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Frame_Shift_Del	DEL	ENST00000545180.1	37	CCDS45785.1																																																																																			.		0.659	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
SPRR4	163778	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152944518	152944518	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:152944518A>C	ENST00000328051.2	+	2	201	c.152A>C	c.(151-153)aAg>aCg	p.K51T		NM_173080.1	NP_775103.1	Q96PI1	SPRR4_HUMAN	small proline-rich protein 4	51	Gln-rich.				keratinization (GO:0031424)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)				lung(1)|prostate(1)	2	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCCAGGTCAAGAAGCAATGC	0.547																																					p.K51T		.											.	SPRR4	68	0			c.A152C						.						190.0	158.0	169.0					1																	152944518		2203	4300	6503	SO:0001583	missense	163778	exon2			AGGTCAAGAAGCA	AF335109	CCDS1031.1	1q21.3	2008-02-05	2006-11-29		ENSG00000184148	ENSG00000184148			23173	protein-coding gene	gene with protein product						11719550, 11279051	Standard	NM_173080		Approved		uc001fav.1	Q96PI1	OTTHUMG00000012450	ENST00000328051.2:c.152A>C	1.37:g.152944518A>C	ENSP00000332163:p.Lys51Thr	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	8.0	NM_173080	Q2M1Y7|Q5T522	Missense_Mutation	SNP	ENST00000328051.2	37	CCDS1031.1	.	.	.	.	.	.	.	.	.	.	A	10.51	1.371016	0.24771	.	.	ENSG00000184148	ENST00000328051	T	0.11063	2.81	4.55	3.42	0.39159	.	0.180691	0.26761	N	0.022623	T	0.04724	0.0128	.	.	.	0.26874	N	0.96769	P	0.51537	0.946	P	0.44897	0.463	T	0.19095	-1.0316	9	0.87932	D	0	-0.0175	6.9419	0.24498	0.8957:0.0:0.1043:0.0	.	51	Q96PI1	SPRR4_HUMAN	T	51	ENSP00000332163:K51T	ENSP00000332163:K51T	K	+	2	0	SPRR4	151211142	1.000000	0.71417	0.998000	0.56505	0.857000	0.48899	1.713000	0.37951	0.898000	0.36418	0.383000	0.25322	AAG	.		0.547	SPRR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034663.1	NM_173080	
STAB1	23166	ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52547186	52547186	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:52547186G>T	ENST00000321725.6	+	30	3275	c.3199G>T	c.(3199-3201)Gcc>Tcc	p.A1067S		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1067	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GGAGGAGCTGGCCCGGCTGGG	0.577																																					p.A1067S		.											.	STAB1	139	0			c.G3199T						.						16.0	17.0	16.0					3																	52547186		2181	4288	6469	SO:0001583	missense	23166	exon30			GAGCTGGCCCGGC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3199G>T	3.37:g.52547186G>T	ENSP00000312946:p.Ala1067Ser	Somatic	148.0	2.0		WXS	Illumina HiSeq	.	113.0	32.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	8.716	0.913186	0.17907	.	.	ENSG00000010327	ENST00000321725	D	0.90069	-2.61	5.84	2.85	0.33270	FAS1 domain (5);	0.561696	0.18304	N	0.145301	T	0.76765	0.4033	N	0.21373	0.66	0.28450	N	0.916376	B	0.28208	0.203	B	0.27170	0.077	T	0.63019	-0.6730	10	0.08837	T	0.75	-19.1089	7.4826	0.27415	0.0:0.2417:0.4465:0.3118	.	1067	Q9NY15	STAB1_HUMAN	S	1067	ENSP00000312946:A1067S	ENSP00000312946:A1067S	A	+	1	0	STAB1	52522226	0.359000	0.24955	0.996000	0.52242	0.100000	0.18952	0.717000	0.25851	1.459000	0.47892	-0.311000	0.09066	GCC	.		0.577	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
STEAP3	55240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	120005515	120005515	+	Silent	SNP	C	C	A	rs372658109		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:120005515C>A	ENST00000354888.5	+	4	1257	c.753C>A	c.(751-753)ccC>ccA	p.P251P	STEAP3_ENST00000393110.2_Silent_p.P261P|STEAP3_ENST00000393108.2_Silent_p.P251P|STEAP3_ENST00000393106.2_Silent_p.P251P|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000409811.1_Silent_p.P251P|STEAP3_ENST00000450943.2_Silent_p.P251P|STEAP3_ENST00000393107.2_Silent_p.P251P|STEAP3_ENST00000425223.2_Silent_p.P251P	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	251					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						TCAAGCTGCCCGTGTCCGTGG	0.627																																					p.P261P		.											.	STEAP3	91	0			c.C783A						.						120.0	115.0	116.0					2																	120005515		2203	4300	6503	SO:0001819	synonymous_variant	55240	exon4			GCTGCCCGTGTCC	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.753C>A	2.37:g.120005515C>A		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	21.0	NM_182915	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	ENST00000354888.5	37	CCDS2125.1																																																																																			.		0.627	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	NM_018234	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	64593080	64593089	+	Frame_Shift_Del	DEL	TAAAAAATTG	TAAAAAATTG	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	TAAAAAATTG	TAAAAAATTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr14:64593080_64593089delTAAAAAATTG	ENST00000344113.4	+	72	13802_13811	c.13590_13599delTAAAAAATTG	c.(13588-13599)gataaaaaattgfs	p.DKKL4530fs	SYNE2_ENST00000358025.3_Frame_Shift_Del_p.DKKL4530fs|SYNE2_ENST00000394768.2_Frame_Shift_Del_p.DKKL915fs|SYNE2_ENST00000357395.3_Frame_Shift_Del_p.DKKL915fs|SYNE2_ENST00000554584.1_Frame_Shift_Del_p.DKKL4481fs|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Frame_Shift_Del_p.DKKL1164fs	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4530					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCAATTTGGATAAAAAATTGTTTGAACTAT	0.41																																					p.4530_4533del		.											.	SYNE2	164	0			c.13590_13599del						.																																			SO:0001589	frameshift_variant	23224	exon72			TTTGGATAAAAAA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13590_13599delTAAAAAATTG	14.37:g.64593080_64593089delTAAAAAATTG	ENSP00000341781:p.Asp4530fs	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	18.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Frame_Shift_Del	DEL	ENST00000344113.4	37	CCDS41963.1																																																																																			.		0.410	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TAAR1	134864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	132966704	132966704	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:132966704T>C	ENST00000275216.1	-	1	438	c.439A>G	c.(439-441)Agt>Ggt	p.S147G		NM_138327.1	NP_612200.1	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	147					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)	18	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)|Dextroamphetamine(DB01576)|Methamphetamine(DB01577)|Propylhexedrine(DB06714)	ACACTCCAACTAATGAAGATC	0.393																																					p.S147G		.											.	TAAR1	90	0			c.A439G						.						58.0	57.0	57.0					6																	132966704		2203	4300	6503	SO:0001583	missense	134864	exon1			TCCAACTAATGAA	AY180374	CCDS5158.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146399	ENSG00000146399		"""GPCR / Class A : Trace amine associated receptors"""	17734	protein-coding gene	gene with protein product		609333	"""trace amine receptor 1"""	TRAR1		11459929, 15718104	Standard	NM_138327		Approved	TAR1, TA1	uc003qdm.1	Q96RJ0	OTTHUMG00000015583	ENST00000275216.1:c.439A>G	6.37:g.132966704T>C	ENSP00000275216:p.Ser147Gly	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	17.0	NM_138327	Q2M1W5|Q3MIH8|Q5VUQ1	Missense_Mutation	SNP	ENST00000275216.1	37	CCDS5158.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019627	0.54576	.	.	ENSG00000146399	ENST00000275216	T	0.72051	-0.62	5.73	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	0.043249	0.85682	D	0.000000	T	0.59569	0.2203	M	0.82132	2.575	0.38986	D	0.95904	B	0.33841	0.428	B	0.39068	0.289	T	0.58317	-0.7657	10	0.45353	T	0.12	-9.8524	9.6416	0.39842	0.0:0.1977:0.0:0.8023	.	147	Q96RJ0	TAAR1_HUMAN	G	147	ENSP00000275216:S147G	ENSP00000275216:S147G	S	-	1	0	TAAR1	133008397	0.963000	0.33076	0.684000	0.30055	0.952000	0.60782	2.005000	0.40864	0.113000	0.18004	0.454000	0.30748	AGT	.		0.393	TAAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042259.1	NM_138327	
TADA2B	93624	ucsc.edu;bcgsc.ca	37	4	7056061	7056061	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:7056061C>T	ENST00000310074.7	+	2	732	c.543C>T	c.(541-543)gcC>gcT	p.A181A	TADA2B_ENST00000512388.1_Silent_p.A106A|TADA2B_ENST00000515646.1_Silent_p.A89A	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	181					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						ACCAGGATGCCGAGACGCTCA	0.607																																					p.A181A		.											.	TADA2B	68	0			c.C543T						.						38.0	41.0	40.0					4																	7056061		2039	4189	6228	SO:0001819	synonymous_variant	93624	exon2			GGATGCCGAGACG	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.543C>T	4.37:g.7056061C>T		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	52.0	6.0	NM_152293	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Silent	SNP	ENST00000310074.7	37	CCDS47007.1																																																																																			.		0.607	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293	
TDRD6	221400	bcgsc.ca;mdanderson.org	37	6	46660241	46660241	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:46660241A>T	ENST00000316081.6	+	1	4376	c.4376A>T	c.(4375-4377)gAa>gTa	p.E1459V	TDRD6_ENST00000544460.1_Missense_Mutation_p.E1459V	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1459					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GACAGATGGGAAGTTATTCTT	0.363																																					p.E1459V		.											.	TDRD6	138	0			c.A4376T						.						98.0	96.0	97.0					6																	46660241		2203	4300	6503	SO:0001583	missense	221400	exon1			GATGGGAAGTTAT	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.4376A>T	6.37:g.46660241A>T	ENSP00000346065:p.Glu1459Val	Somatic	37.0	1.0		WXS	Illumina HiSeq	Phase_1	31.0	10.0	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	16.74	3.205624	0.58234	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.19105	2.17;2.17	5.77	5.77	0.91146	.	0.379543	0.28021	N	0.016918	T	0.26448	0.0646	M	0.62723	1.935	0.37510	D	0.917118	D;D	0.76494	0.999;0.999	D;D	0.72338	0.977;0.949	T	0.10730	-1.0617	10	0.12766	T	0.61	-28.8214	12.2436	0.54558	0.9319:0.0:0.0681:0.0	.	1459;1459	F5H5M3;O60522	.;TDRD6_HUMAN	V	1459	ENSP00000443299:E1459V;ENSP00000346065:E1459V	ENSP00000346065:E1459V	E	+	2	0	TDRD6	46768200	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.884000	0.48562	2.326000	0.78906	0.533000	0.62120	GAA	.		0.363	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
TEK	7010	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	27206621	27206621	+	Silent	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:27206621C>A	ENST00000380036.4	+	15	2848	c.2406C>A	c.(2404-2406)gcC>gcA	p.A802A	TEK_ENST00000519097.1_Silent_p.A654A|TEK_ENST00000406359.4_Silent_p.A759A	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	802					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GGACTCTGGCCCTAAACAGGA	0.403																																					p.A802A		.											.	TEK	1584	0			c.C2406A						.						70.0	69.0	69.0					9																	27206621		2203	4300	6503	SO:0001819	synonymous_variant	7010	exon15			TCTGGCCCTAAAC	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2406C>A	9.37:g.27206621C>A		Somatic	50.0	1.0		WXS	Illumina HiSeq	Phase_I	29.0	10.0	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Silent	SNP	ENST00000380036.4	37	CCDS6519.1																																																																																			.		0.403	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
TFAP2D	83741	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	50740396	50740396	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:50740396C>T	ENST00000008391.3	+	8	1406	c.1178C>T	c.(1177-1179)gCa>gTa	p.A393V		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					GCAATATGTGCAGCTCTAAGC	0.443																																					p.A393V		.											.	TFAP2D	159	0			c.C1178T						.						61.0	60.0	60.0					6																	50740396		2203	4300	6503	SO:0001583	missense	83741	exon8			TATGTGCAGCTCT	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1178C>T	6.37:g.50740396C>T	ENSP00000008391:p.Ala393Val	Somatic	63.0	1.0		WXS	Illumina HiSeq	Phase_I	48.0	19.0	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.775813	0.90195	.	.	ENSG00000008197	ENST00000008391	D	0.97279	-4.32	5.46	5.46	0.80206	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98868	0.9617	M	0.92412	3.305	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.99679	1.0998	10	0.87932	D	0	-20.4346	19.3034	0.94151	0.0:1.0:0.0:0.0	.	393	Q7Z6R9	AP2D_HUMAN	V	393	ENSP00000008391:A393V	ENSP00000008391:A393V	A	+	2	0	TFAP2D	50848355	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.577000	0.86979	0.467000	0.42956	GCA	.		0.443	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
THBS2	7058	ucsc.edu;bcgsc.ca;mdanderson.org	37	6	169637837	169637837	+	Missense_Mutation	SNP	C	C	T	rs577676627		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:169637837C>T	ENST00000366787.3	-	9	1432	c.1183G>A	c.(1183-1185)Gtg>Atg	p.V395M	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	395	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CCACACGTCACGGAGCACTGG	0.652													c|||	1	0.000199681	0.0	0.0	5008	,	,		17713	0.001		0.0	False		,,,				2504	0.0				p.V395M	Esophageal Squamous(91;219 1934 18562 44706)	.											.	THBS2	95	0			c.G1183A						.						86.0	68.0	74.0					6																	169637837		2203	4299	6502	SO:0001583	missense	7058	exon9			ACGTCACGGAGCA		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1183G>A	6.37:g.169637837C>T	ENSP00000355751:p.Val395Met	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	19.0	5.0	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	37	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	c	16.47	3.131294	0.56828	.	.	ENSG00000186340	ENST00000366787	T	0.64991	-0.13	4.75	3.88	0.44766	.	0.763359	0.10430	U	0.675598	T	0.66327	0.2778	M	0.85197	2.74	0.38305	D	0.94309	D	0.54772	0.968	P	0.50934	0.654	T	0.70641	-0.4816	10	0.87932	D	0	-34.4517	13.0279	0.58825	0.0:0.921:0.0:0.079	.	395	P35442	TSP2_HUMAN	M	395	ENSP00000355751:V395M	ENSP00000355751:V395M	V	-	1	0	THBS2	169379762	0.995000	0.38212	0.110000	0.21437	0.165000	0.22458	3.661000	0.54503	0.987000	0.38709	0.552000	0.68991	GTG	.		0.652	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
TLE4	7091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	82267541	82267541	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:82267541C>A	ENST00000376552.2	+	7	1442	c.424C>A	c.(424-426)Cat>Aat	p.H142N	TLE4_ENST00000455913.1_3'UTR|TLE4_ENST00000265284.6_Missense_Mutation_p.H117N|TLE4_ENST00000376544.3_Missense_Mutation_p.H142N|TLE4_ENST00000376537.4_Missense_Mutation_p.H142N|TLE4_ENST00000376520.4_Missense_Mutation_p.H142N|TLE4_ENST00000376534.4_De_novo_Start_InFrame	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	142	Gly/Pro-rich (GP domain).				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						ATCACATGGACATGGTCTCCC	0.552																																					p.H142N		.											.	TLE4	524	0			c.C424A						.						110.0	119.0	116.0					9																	82267541		2057	4188	6245	SO:0001583	missense	7091	exon7			CATGGACATGGTC	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.424C>A	9.37:g.82267541C>A	ENSP00000365735:p.His142Asn	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	16.0	NM_007005	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	37	CCDS43837.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707990	0.68615	.	.	ENSG00000106829	ENST00000376552;ENST00000376544;ENST00000376520;ENST00000399288;ENST00000435650;ENST00000414465;ENST00000376537;ENST00000265284;ENST00000425506;ENST00000428713;ENST00000490347	T;T;T;T;T;T;T;T;T	0.52057	0.7;0.68;0.74;0.85;0.73;0.82;0.8;1.35;1.62	6.17	6.17	0.99709	.	0.096408	0.64402	D	0.000001	T	0.61022	0.2314	M	0.78049	2.395	0.80722	D	1	P;B;B;B	0.40875	0.731;0.027;0.38;0.059	P;B;B;B	0.44860	0.462;0.015;0.197;0.038	T	0.61053	-0.7140	10	0.52906	T	0.07	-20.9074	20.8794	0.99867	0.0:1.0:0.0:0.0	.	117;142;142;142	F8W6T6;Q04727-2;Q04727-3;Q04727	.;.;.;TLE4_HUMAN	N	142;142;142;156;156;128;142;117;140;127;12	ENSP00000365735:H142N;ENSP00000365727:H142N;ENSP00000365703:H142N;ENSP00000415423:H156N;ENSP00000365720:H142N;ENSP00000265284:H117N;ENSP00000412567:H140N;ENSP00000409313:H127N;ENSP00000417844:H12N	ENSP00000265284:H117N	H	+	1	0	TLE4	81457361	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.155000	0.77445	2.941000	0.99782	0.655000	0.94253	CAT	.		0.552	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
TMEM132B	114795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	125834213	125834213	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:125834213C>T	ENST00000299308.3	+	2	276	c.268C>T	c.(268-270)Cca>Tca	p.P90S	TMEM132B_ENST00000418253.2_3'UTR	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	90						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CAGCTATGGCCCATTTTCAGT	0.498																																					p.P90S		.											.	TMEM132B	185	0			c.C268T						.						107.0	105.0	106.0					12																	125834213		1872	4105	5977	SO:0001583	missense	114795	exon2			TATGGCCCATTTT	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.268C>T	12.37:g.125834213C>T	ENSP00000299308:p.Pro90Ser	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	20.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288066	0.80803	.	.	ENSG00000139364	ENST00000299308	T	0.11495	2.77	5.41	5.41	0.78517	.	.	.	.	.	T	0.26122	0.0637	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.00422	-1.1749	9	0.49607	T	0.09	.	19.1923	0.93672	0.0:1.0:0.0:0.0	.	90	Q14DG7	T132B_HUMAN	S	90	ENSP00000299308:P90S	ENSP00000299308:P90S	P	+	1	0	TMEM132B	124400166	0.998000	0.40836	0.975000	0.42487	0.910000	0.53928	3.491000	0.53252	2.514000	0.84764	0.591000	0.81541	CCA	.		0.498	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
TMEM214	54867	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	27260450	27260450	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:27260450G>A	ENST00000238788.9	+	9	1094	c.1032G>A	c.(1030-1032)caG>caA	p.Q344Q	TMEM214_ENST00000404032.3_Silent_p.Q299Q	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	344					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						AGCTGTGTCAGCTCTACCCCC	0.542																																					p.Q344Q		.											.	TMEM214	115	0			c.G1032A						.						99.0	105.0	103.0					2																	27260450		1974	4163	6137	SO:0001819	synonymous_variant	54867	exon9			GTGTCAGCTCTAC		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.1032G>A	2.37:g.27260450G>A		Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	55.0	25.0	NM_017727	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Silent	SNP	ENST00000238788.9	37	CCDS42664.1	.	.	.	.	.	.	.	.	.	.	G	8.083	0.772831	0.16051	.	.	ENSG00000119777	ENST00000425720	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	T	0.74222	0.3688	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72168	-0.4372	4	.	.	.	-8.6689	17.5913	0.87997	0.0:0.0:1.0:0.0	.	.	.	.	N	103	.	.	S	+	2	0	TMEM214	27113954	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	1.423000	0.34837	2.700000	0.92200	0.561000	0.74099	AGC	.		0.542	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
TMPRSS7	344805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111764772	111764772	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:111764772G>C	ENST00000452346.2	+	5	676	c.673G>C	c.(673-675)Gac>Cac	p.D225H	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.D112H			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	225	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGTGGACATGGACTCTGTGGT	0.473																																					p.D112H		.											.	TMPRSS7	70	0			c.G334C						.						241.0	214.0	222.0					3																	111764772		692	1591	2283	SO:0001583	missense	344805	exon4			GACATGGACTCTG	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.673G>C	3.37:g.111764772G>C	ENSP00000398236:p.Asp225His	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	45.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	G	21.4	4.150002	0.78001	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127;ENST00000460599	T;T;T	0.35973	1.28;1.28;1.28	5.06	5.06	0.68205	.	.	.	.	.	T	0.40619	0.1124	N	0.08118	0	0.50039	D	0.999841	D	0.89917	1.0	D	0.91635	0.999	T	0.48031	-0.9070	9	0.52906	T	0.07	.	15.8068	0.78520	0.0:0.0:1.0:0.0	.	112	Q7RTY8-2	.	H	225;212;212;112;88	ENSP00000398236:D225H;ENSP00000411645:D112H;ENSP00000447563:D88H	ENSP00000411645:D112H	D	+	1	0	TMPRSS7	113247462	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.709000	0.84645	2.763000	0.94921	0.655000	0.94253	GAC	.		0.473	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
TNKS1BP1	85456	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	57080487	57080489	+	In_Frame_Del	DEL	CCC	CCC	-	rs564910885	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr11:57080487_57080489delCCC	ENST00000532437.1	-	4	1984_1986	c.1673_1675delGGG	c.(1672-1677)ggggag>gag	p.G558del	TNKS1BP1_ENST00000358252.3_In_Frame_Del_p.G558del|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	558	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GGTTGACTCTCCCCATCGCCCTT	0.591																																					p.558_559del		.											.	TNKS1BP1	91	0			c.1673_1675del						.																																			SO:0001651	inframe_deletion	85456	exon5			GACTCTCCCCATC	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1673_1675delGGG	11.37:g.57080487_57080489delCCC	ENSP00000437271:p.Gly558del	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	15.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	In_Frame_Del	DEL	ENST00000532437.1	37	CCDS7951.1																																																																																			.		0.591	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
TNKS	8658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	9538246	9538246	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:9538246A>T	ENST00000310430.6	+	5	1069	c.1043A>T	c.(1042-1044)gAa>gTa	p.E348V	TNKS_ENST00000518281.1_Missense_Mutation_p.E111V|TNKS_ENST00000518027.1_3'UTR|TNKS_ENST00000520408.1_Missense_Mutation_p.E348V	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	348					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		AGTGGTAATGAAGAAAAACTA	0.303																																					p.E348V		.											.	TNKS	660	0			c.A1043T						.						81.0	87.0	85.0					8																	9538246		2203	4300	6503	SO:0001583	missense	8658	exon5			GTAATGAAGAAAA	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.1043A>T	8.37:g.9538246A>T	ENSP00000311579:p.Glu348Val	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	46.0	NM_003747	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	A	18.20	3.570510	0.65765	.	.	ENSG00000173273	ENST00000520408;ENST00000310430;ENST00000518281	T;T;T	0.62639	0.01;0.01;0.01	5.83	5.83	0.93111	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.77025	0.4070	M	0.69358	2.11	0.80722	D	1	D;P	0.71674	0.998;0.956	D;P	0.71184	0.972;0.809	T	0.77130	-0.2701	10	0.45353	T	0.12	.	16.1967	0.82036	1.0:0.0:0.0:0.0	.	348;348	E7EWY6;O95271	.;TNKS1_HUMAN	V	348;348;111	ENSP00000428299:E348V;ENSP00000311579:E348V;ENSP00000429890:E111V	ENSP00000311579:E348V	E	+	2	0	TNKS	9575656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.483000	0.90442	2.217000	0.71921	0.477000	0.44152	GAA	.		0.303	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
TOB1	10140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	48940660	48940661	+	Frame_Shift_Ins	INS	-	-	GC	rs372275994		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:48940660_48940661insGC	ENST00000268957.3	-	3	1146_1147	c.718_719insGC	c.(718-720)ccafs	p.P240fs	TOB1_ENST00000509385.1_5'Flank|TOB1_ENST00000499247.2_Frame_Shift_Ins_p.P240fs	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	240	Poly-Gln.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			ctgttgctgtggctgctgctgG	0.55																																					p.P240fs	NSCLC(144;643 1919 24513 29423 40686)	.											.	TOB1	226	0			c.719_720insGC						.																																			SO:0001589	frameshift_variant	10140	exon2			TGCTGTGGCTGCT	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.717_718dupGC	17.37:g.48940661_48940662dupGC	ENSP00000268957:p.Pro240fs	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	9.0	NM_005749	B2R9T0|D3DTY3|Q4KMQ0	Frame_Shift_Ins	INS	ENST00000268957.3	37	CCDS11576.1																																																																																			.		0.550	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1		
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7578264	7578270	+	Frame_Shift_Del	DEL	GATAAGA	GATAAGA	-	rs370216745|rs587780071		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	GATAAGA	GATAAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:7578264_7578270delGATAAGA	ENST00000269305.4	-	6	768_774	c.579_585delTCTTATC	c.(577-585)catcttatcfs	p.HLI193fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.L194R(47)|p.I195F(20)|p.L194F(17)|p.I195N(12)|p.I195S(10)|p.L194P(8)|p.0?(8)|p.L194H(8)|p.R196*(7)|p.I195fs*14(6)|p.I195fs*52(6)|p.?(6)|p.L101R(5)|p.L62R(5)|p.L194L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I195M(3)|p.P191fs*53(2)|p.I102S(2)|p.L194fs*15(2)|p.I102T(2)|p.H193H(2)|p.I63T(2)|p.I63S(2)|p.L194V(1)|p.L194fs*14(1)|p.P191fs*6(1)|p.I102fs*52(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.L101H(1)|p.I63fs*14(1)|p.I195fs*50(1)|p.I102M(1)|p.I102F(1)|p.I63F(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.I63fs*>28(1)|p.L62H(1)|p.L194I(1)|p.I63M(1)|p.I195L(1)|p.L194fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTCCACTCGGATAAGATGCTGAGGAG	0.551		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.193_195del	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,-2	TP53	70225	286	Substitution - Missense(221)|Deletion - Frameshift(15)|Insertion - Frameshift(10)|Whole gene deletion(8)|Substitution - Nonsense(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(6)|Substitution - coding silent(6)|Complex - frameshift(1)	ovary(52)|breast(42)|lung(35)|large_intestine(34)|haematopoietic_and_lymphoid_tissue(18)|upper_aerodigestive_tract(14)|oesophagus(14)|skin(14)|biliary_tract(13)|urinary_tract(11)|stomach(10)|central_nervous_system(8)|liver(6)|bone(4)|pancreas(4)|endometrium(3)|soft_tissue(2)|eye(1)|prostate(1)	c.579_585del						.																																			SO:0001589	frameshift_variant	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CACTCGGATAAGA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.579_585delTCTTATC	17.37:g.7578264_7578270delGATAAGA	ENSP00000269305:p.His193fs	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	9.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.551	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP63	8626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	189526152	189526152	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:189526152C>T	ENST00000264731.3	+	4	505	c.416C>T	c.(415-417)gCg>gTg	p.A139V	TP63_ENST00000437221.1_Missense_Mutation_p.A45V|TP63_ENST00000392461.3_Missense_Mutation_p.A45V|TP63_ENST00000320472.5_Missense_Mutation_p.A139V|TP63_ENST00000449992.1_Intron|TP63_ENST00000354600.5_Missense_Mutation_p.A45V|TP63_ENST00000392463.2_Missense_Mutation_p.A45V|TP63_ENST00000456148.1_Missense_Mutation_p.A45V|TP63_ENST00000382063.4_Intron|TP63_ENST00000418709.2_Missense_Mutation_p.A139V|TP63_ENST00000392460.3_Missense_Mutation_p.A139V|TP63_ENST00000440651.2_Missense_Mutation_p.A139V	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	139					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		ACAGACCACGCGCAGAACAGC	0.612										HNSCC(45;0.13)																											p.A139V		.											.	TP63	421	0			c.C416T						.						184.0	137.0	153.0					3																	189526152		2203	4300	6503	SO:0001583	missense	8626	exon4			ACCACGCGCAGAA	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.416C>T	3.37:g.189526152C>T	ENSP00000264731:p.Ala139Val	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	15.0	NM_001114979	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	C	35	5.567392	0.96540	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000354600;ENST00000434928;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000456148	D;D;D;D;D;D;T;D;D;D;D	0.99793	-6.51;-6.77;-6.76;-6.76;-6.53;-6.43;-1.13;-6.63;-6.66;-6.64;-6.46	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.99483	0.9816	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.997;0.997;0.989;0.999;0.998;0.999	D;D;P;P;P;P;D;D;D	0.69307	0.949;0.963;0.908;0.815;0.815;0.522;0.963;0.919;0.963	D	0.99250	1.0887	9	.	.	.	-3.5143	19.122	0.93367	0.0:1.0:0.0:0.0	.	139;139;45;45;45;45;139;139;139	Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;P63_HUMAN;.	V	139;139;139;139;139;45;45;45;45;45;45	ENSP00000264731:A139V;ENSP00000407144:A139V;ENSP00000317510:A139V;ENSP00000376253:A139V;ENSP00000394337:A139V;ENSP00000346614:A45V;ENSP00000401661:A45V;ENSP00000392488:A45V;ENSP00000376256:A45V;ENSP00000376254:A45V;ENSP00000389485:A45V	.	A	+	2	0	TP63	191008846	1.000000	0.71417	0.934000	0.37439	0.991000	0.79684	7.487000	0.81328	2.770000	0.95276	0.655000	0.94253	GCG	.		0.612	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
TRAF1	7185	ucsc.edu;bcgsc.ca	37	9	123675908	123675908	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:123675908C>G	ENST00000373887.3	-	5	2848	c.403G>C	c.(403-405)Gag>Cag	p.E135Q	TRAF1_ENST00000546084.1_Missense_Mutation_p.E13Q|TRAF1_ENST00000540010.1_Missense_Mutation_p.E135Q	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	135					apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						GGCCCAGACTCCAGGCCACAG	0.632																																					p.E135Q		.											.	TRAF1	229	0			c.G403C						.						36.0	38.0	38.0					9																	123675908		2203	4300	6503	SO:0001583	missense	7185	exon5			CAGACTCCAGGCC	AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.403G>C	9.37:g.123675908C>G	ENSP00000362994:p.Glu135Gln	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_005658	B4DJ77|Q658U1|Q8NF13	Missense_Mutation	SNP	ENST00000373887.3	37	CCDS6825.1	.	.	.	.	.	.	.	.	.	.	C	5.588	0.293245	0.10567	.	.	ENSG00000056558	ENST00000373887;ENST00000540010;ENST00000546084	T;T;T	0.44881	1.52;1.52;0.91	4.98	4.06	0.47325	.	1.224790	0.05583	N	0.573196	T	0.23330	0.0564	N	0.14661	0.345	0.09310	N	1	B	0.25609	0.13	B	0.19148	0.024	T	0.29671	-1.0004	10	0.12766	T	0.61	-17.4459	3.7725	0.08647	0.1718:0.5688:0.1663:0.0931	.	135	Q13077	TRAF1_HUMAN	Q	135;135;13	ENSP00000362994:E135Q;ENSP00000443183:E135Q;ENSP00000438583:E13Q	ENSP00000362994:E135Q	E	-	1	0	TRAF1	122715729	0.044000	0.20184	0.023000	0.16930	0.636000	0.38137	2.868000	0.48436	1.191000	0.43056	0.455000	0.32223	GAG	.		0.632	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053843.1	NM_005658	
TRDMT1	1787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	17202313	17202313	+	Silent	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:17202313A>G	ENST00000377799.3	-	6	497	c.450T>C	c.(448-450)tcT>tcC	p.S150S	TRDMT1_ENST00000412821.3_Silent_p.S126S|TRDMT1_ENST00000488990.1_Intron|TRDMT1_ENST00000351358.4_Silent_p.S104S|TRDMT1_ENST00000457442.2_Silent_p.S69S|TRDMT1_ENST00000358282.7_3'UTR|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000377766.5_Missense_Mutation_p.S79P	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	150	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	CAGAGGTTGGAGATAATAGAA	0.284																																					p.S150S		.											.	TRDMT1	227	0			c.T450C						.						25.0	25.0	25.0					10																	17202313		2201	4289	6490	SO:0001819	synonymous_variant	1787	exon6			GGTTGGAGATAAT	AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.450T>C	10.37:g.17202313A>G		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	38.0	NM_004412	B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Silent	SNP	ENST00000377799.3	37	CCDS7114.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.63|15.63	2.889911|2.889911	0.52014|0.52014	.|.	.|.	ENSG00000107614|ENSG00000107614	ENST00000436968|ENST00000377766;ENST00000313936	.|T	.|0.44482	.|0.92	5.79|5.79	3.29|3.29	0.37713|0.37713	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48892|0.48892	0.1525|0.1525	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49051|0.49051	-0.8979|-0.8979	4|7	.|0.72032	.|D	.|0.01	-23.1687|-23.1687	7.4582|7.4582	0.27278|0.27278	0.7095:0.1486:0.0:0.142|0.7095:0.1486:0.0:0.142	.|.	.|.	.|.	.|.	P|P	58|79;84	.|ENSP00000324263:S84P	.|ENSP00000324263:S84P	L|S	-|-	2|1	0|0	TRDMT1|TRDMT1	17242319|17242319	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	2.014000|2.014000	0.40951|0.40951	0.977000|0.977000	0.38444|0.38444	0.455000|0.455000	0.32223|0.32223	CTC|TCC	.		0.284	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047024.3	NM_004412	
TRIP10	9322	broad.mit.edu;bcgsc.ca	37	19	6750013	6750022	+	Frame_Shift_Del	DEL	AGCCCCAGAT	AGCCCCAGAT	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	AGCCCCAGAT	AGCCCCAGAT	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:6750013_6750022delAGCCCCAGAT	ENST00000313244.9	+	12	1366_1375	c.1331_1340delAGCCCCAGAT	c.(1330-1341)gagccccagatcfs	p.EPQI444fs	TRIP10_ENST00000313285.8_Frame_Shift_Del_p.EPQI388fs|CTD-3128G10.6_ENST00000594056.1_RNA|TRIP10_ENST00000596758.1_Frame_Shift_Del_p.EPQI388fs|TRIP10_ENST00000600428.1_Frame_Shift_Del_p.EPQI280fs			Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10	444	Interaction with CDC42.|Interaction with PDE6G. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|cell communication (GO:0007154)|endocytosis (GO:0006897)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	16						GCCAGCTTGGAGCCCCAGATCGCTGAAACC	0.548																																					p.388_391del		.											.	TRIP10	228	0			c.1163_1172del						.																																			SO:0001589	frameshift_variant	9322	exon11			GCTTGGAGCCCCA	AB072596	CCDS12172.1, CCDS74271.1, CCDS74272.1	19p13.3	2008-02-05			ENSG00000125733	ENSG00000125733			12304	protein-coding gene	gene with protein product	"""Cdc42-interacting protein"""	604504	"""salt tolerator"""	STOT		7776974, 9210375, 11294612	Standard	XM_005259683		Approved	STP, HSTP, CIP4	uc002mfr.3	Q15642	OTTHUMG00000150255	ENST00000313244.9:c.1331_1340delAGCCCCAGAT	19.37:g.6750013_6750022delAGCCCCAGAT	ENSP00000320117:p.Glu444fs	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	9.0	NM_004240	B2R8A6|B7WP22|D6W645|O15184|Q53G22|Q5TZN1|Q6FI24|Q8NFL1|Q8TCY1|Q8TDX3|Q96RJ1	Frame_Shift_Del	DEL	ENST00000313244.9	37																																																																																				.		0.548	TRIP10-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000317129.2		
TRPS1	7227	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	116427295	116427295	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:116427295G>T	ENST00000220888.5	-	6	2961	c.2802C>A	c.(2800-2802)aaC>aaA	p.N934K	TRPS1_ENST00000519076.1_Missense_Mutation_p.N688K|TRPS1_ENST00000395715.3_Missense_Mutation_p.N947K|TRPS1_ENST00000520276.1_Missense_Mutation_p.N938K			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	934					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			GTTTAATGATGTTTAAAGGCC	0.368									Langer-Giedion syndrome																												p.N947K		.											.	TRPS1	229	0			c.C2841A						.						103.0	99.0	100.0					8																	116427295		1871	4107	5978	SO:0001583	missense	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AATGATGTTTAAA	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2802C>A	8.37:g.116427295G>T	ENSP00000220888:p.Asn934Lys	Somatic	173.0	2.0		WXS	Illumina HiSeq	Phase_I	122.0	53.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.00|16.00	2.997300|2.997300	0.54147|0.54147	.|.	.|.	ENSG00000104447|ENSG00000104447	ENST00000518018|ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	.|D;D;D;D	.|0.99660	.|-6.32;-6.32;-6.32;-6.32	5.48|5.48	5.48|5.48	0.80851|0.80851	.|Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99055|0.99055	0.9676|0.9676	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;1.0	.|D;D;D	.|0.85130	.|0.997;0.977;0.997	D|D	0.98350|0.98350	1.0543|1.0543	5|10	.|0.62326	.|D	.|0.03	.|.	12.6631|12.6631	0.56826|0.56826	0.0756:0.0:0.9244:0.0|0.0756:0.0:0.9244:0.0	.|.	.|938;934;947	.|Q9UHF7-3;Q9UHF7;Q9UHF7-2	.|.;TRPS1_HUMAN;.	N|K	59|947;934;688;938	.|ENSP00000379065:N947K;ENSP00000220888:N934K;ENSP00000428910:N688K;ENSP00000428680:N938K	.|ENSP00000220888:N934K	H|N	-|-	1|3	0|2	TRPS1|TRPS1	116496471|116496471	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.475000|6.475000	0.73582|0.73582	2.572000|2.572000	0.86782|0.86782	0.655000|0.655000	0.94253|0.94253	CAT|AAC	.		0.368	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
TSTD2	158427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	100365038	100365038	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:100365038A>G	ENST00000341170.4	-	10	1646	c.1264T>C	c.(1264-1266)Tgt>Cgt	p.C422R		NM_139246.4	NP_640339.4	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 2	422										large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	15						CGGGCTCCACAGTATGAACAC	0.517																																					p.C422R		.											.	TSTD2	92	0			c.T1264C						.						57.0	57.0	57.0					9																	100365038		2203	4300	6503	SO:0001583	missense	158427	exon10			CTCCACAGTATGA	AF258575	CCDS6727.2	9q22.33	2013-09-20	2009-08-12	2009-08-12	ENSG00000136925	ENSG00000136925			30087	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 97"""	C9orf97		12477932	Standard	NM_139246		Approved	PP4189	uc004axn.3	Q5T7W7	OTTHUMG00000020328	ENST00000341170.4:c.1264T>C	9.37:g.100365038A>G	ENSP00000342499:p.Cys422Arg	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	26.0	NM_139246	A6NMJ4|A8K584|Q6ZQZ6|Q8IYM3|Q8WY73|Q96ML6|Q96MU1	Missense_Mutation	SNP	ENST00000341170.4	37	CCDS6727.2	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307103	0.81247	.	.	ENSG00000136925	ENST00000375173;ENST00000375172;ENST00000341170	T;T	0.33654	1.4;1.4	5.75	5.75	0.90469	Rhodanese-like (2);	0.000000	0.85682	D	0.000000	T	0.68696	0.3029	M	0.93197	3.39	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.77686	-0.2495	10	0.66056	D	0.02	-12.5258	16.0276	0.80553	1.0:0.0:0.0:0.0	.	422	Q5T7W7	TSTD2_HUMAN	R	18;196;422	ENSP00000364316:C18R;ENSP00000342499:C422R	ENSP00000342499:C422R	C	-	1	0	TSTD2	99404859	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	8.850000	0.92190	2.326000	0.78906	0.533000	0.62120	TGT	.		0.517	TSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053325.4	NM_139246	
TTLL12	23170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	43575637	43575637	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr22:43575637G>A	ENST00000216129.6	-	5	891	c.828C>T	c.(826-828)gcC>gcT	p.A276A		NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	276					cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GGTAGTGCTCGGCGGGCGGCT	0.622																																					p.A276A		.											.	TTLL12	90	0			c.C828T						.						54.0	58.0	57.0					22																	43575637		2203	4300	6503	SO:0001819	synonymous_variant	23170	exon5			GTGCTCGGCGGGC	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.828C>T	22.37:g.43575637G>A		Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	9.0	NM_015140	Q20WK5|Q9UGU3	Silent	SNP	ENST00000216129.6	37	CCDS14047.1																																																																																			.		0.622	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140	
TUBGCP6	85378	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50682494	50682494	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr22:50682494T>C	ENST00000248846.5	-	1	499	c.395A>G	c.(394-396)tAc>tGc	p.Y132C	HDAC10_ENST00000498366.1_5'Flank|TUBGCP6_ENST00000439308.2_Missense_Mutation_p.Y132C|MAPK12_ENST00000497036.1_5'Flank			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	132					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GTTAAGGAAGTAGTCTCGTTT	0.542																																					p.Y132C		.											.	TUBGCP6	93	0			c.A395G						.						92.0	86.0	88.0					22																	50682494		2202	4300	6502	SO:0001583	missense	85378	exon1			AGGAAGTAGTCTC	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.395A>G	22.37:g.50682494T>C	ENSP00000248846:p.Tyr132Cys	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	6.0	NM_020461	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	T	15.19	2.758663	0.49468	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.32023	1.79;1.47	3.97	1.74	0.24563	.	0.517011	0.21365	N	0.075729	T	0.40196	0.1107	L	0.36672	1.1	0.42683	D	0.993555	D;D;D	0.89917	1.0;0.999;0.999	D;P;D	0.74023	0.982;0.885;0.91	T	0.15407	-1.0438	10	0.72032	D	0.01	.	8.8049	0.34932	0.3144:0.0:0.0:0.6856	.	132;132;132	A7E2V7;B2RWN4;Q96RT7	.;.;GCP6_HUMAN	C	132	ENSP00000248846:Y132C;ENSP00000397387:Y132C	ENSP00000248846:Y132C	Y	-	2	0	TUBGCP6	49024621	1.000000	0.71417	0.012000	0.15200	0.600000	0.36913	1.743000	0.38258	0.172000	0.19760	0.459000	0.35465	TAC	.		0.542	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
VAPA	9218	broad.mit.edu;mdanderson.org	37	18	9914271	9914271	+	Silent	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr18:9914271G>T	ENST00000400000.2	+	1	273	c.18G>T	c.(16-18)ggG>ggT	p.G6G	VAPA_ENST00000340541.4_Silent_p.G6G|RP11-474N24.6_ENST00000609787.1_lincRNA	NM_003574.5|NM_194434.2	NP_003565.4|NP_919415.2	Q9P0L0	VAPA_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa	6					cell death (GO:0008219)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein localization to endoplasmic reticulum (GO:0070972)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein heterodimerization activity (GO:0046982)|signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(1)|lung(2)|prostate(1)	4						CCGCCTCAGGGGCCATGGCGA	0.721																																					p.G6G		.											.	VAPA	90	0			c.G18T						.						18.0	19.0	19.0					18																	9914271		1916	4116	6032	SO:0001819	synonymous_variant	9218	exon1			CTCAGGGGCCATG		CCDS11847.2, CCDS11848.2	18p11.2	2008-07-28	2002-08-29		ENSG00000101558	ENSG00000101558			12648	protein-coding gene	gene with protein product		605703	"""VAMP (vesicle-associated membrane protein)-associated protein A (33kD)"""			9920726, 9657962	Standard	NM_003574		Approved	hVAP-33, VAP-A	uc002koj.3	Q9P0L0	OTTHUMG00000131603	ENST00000400000.2:c.18G>T	18.37:g.9914271G>T		Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	5.0	NM_003574	A6NDZ0|D3DUI3|O75453|Q5U0E7|Q9UBZ2	Silent	SNP	ENST00000400000.2	37	CCDS11848.2																																																																																			.		0.721	VAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254490.1		
VAV1	7409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6833726	6833726	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:6833726C>A	ENST00000602142.1	+	18	1795	c.1713C>A	c.(1711-1713)ttC>ttA	p.F571L	VAV1_ENST00000304076.2_Missense_Mutation_p.F571L|VAV1_ENST00000599806.1_Missense_Mutation_p.F516L|VAV1_ENST00000596764.1_Missense_Mutation_p.F539L|VAV1_ENST00000539284.1_Missense_Mutation_p.F474L	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	571					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCGTAGATTTCCCAGGAACTA	0.537																																					p.F571L		.											.	VAV1	1276	0			c.C1713A						.						141.0	140.0	140.0					19																	6833726		2203	4300	6503	SO:0001583	missense	7409	exon18			AGATTTCCCAGGA		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1713C>A	19.37:g.6833726C>A	ENSP00000472929:p.Phe571Leu	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	15.0	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	37	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	C	3.188	-0.166388	0.06461	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.74209	0.16;-0.82	3.95	-0.242	0.13039	.	1.240100	0.05538	N	0.565122	T	0.50582	0.1624	N	0.08118	0	0.09310	N	0.999999	B;B;B;B	0.23249	0.082;0.002;0.049;0.0	B;B;B;B	0.18561	0.022;0.004;0.01;0.001	T	0.32107	-0.9919	10	0.11485	T	0.65	.	7.1926	0.25834	0.0:0.5028:0.0:0.4972	.	474;571;516;571	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	L	571;474	ENSP00000302269:F571L;ENSP00000443242:F474L	ENSP00000302269:F571L	F	+	3	2	VAV1	6784726	0.032000	0.19561	0.010000	0.14722	0.015000	0.08874	0.104000	0.15313	0.010000	0.14839	0.491000	0.48974	TTC	.		0.537	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
WFS1	7466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6303650	6303650	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:6303650A>C	ENST00000226760.1	+	8	2298	c.2128A>C	c.(2128-2130)Act>Cct	p.T710P	WFS1_ENST00000503569.1_Missense_Mutation_p.T710P	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	710					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		CGTCCGCGTGACTGACATCGA	0.642																																					p.T710P		.											.	WFS1	91	0			c.A2128C						.						39.0	34.0	36.0					4																	6303650		2203	4300	6503	SO:0001583	missense	7466	exon8			CGCGTGACTGACA	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.2128A>C	4.37:g.6303650A>C	ENSP00000226760:p.Thr710Pro	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	11.0	NM_001145853	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	ENST00000226760.1	37	CCDS3386.1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.959340	0.34565	.	.	ENSG00000109501	ENST00000503569;ENST00000226760;ENST00000540337	D;D	0.97575	-4.44;-4.44	5.49	5.49	0.81192	.	0.050606	0.85682	D	0.000000	D	0.97986	0.9337	M	0.75447	2.3	0.48087	D	0.999588	D	0.71674	0.998	D	0.65010	0.931	D	0.98602	1.0659	10	0.62326	D	0.03	-39.7433	14.7629	0.69619	1.0:0.0:0.0:0.0	.	710	O76024	WFS1_HUMAN	P	710;710;88	ENSP00000423337:T710P;ENSP00000226760:T710P	ENSP00000226760:T710P	T	+	1	0	WFS1	6354551	1.000000	0.71417	0.975000	0.42487	0.213000	0.24496	3.589000	0.53972	2.092000	0.63282	0.459000	0.35465	ACT	.		0.642	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206863.1		
XPOT	11260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	64814173	64814173	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:64814173C>A	ENST00000332707.5	+	8	1244	c.715C>A	c.(715-717)Cta>Ata	p.L239I		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	239	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		AATAGAAGTTCTACGGGAAGA	0.318																																					p.L239I		.											.	XPOT	652	0			c.C715A						.						69.0	72.0	71.0					12																	64814173		2203	4298	6501	SO:0001583	missense	11260	exon8			GAAGTTCTACGGG	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.715C>A	12.37:g.64814173C>A	ENSP00000327821:p.Leu239Ile	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	25.0	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	C	33	5.226256	0.95173	.	.	ENSG00000184575	ENST00000332707	T	0.68765	-0.35	4.89	4.89	0.63831	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.135823	0.51477	D	0.000099	T	0.78641	0.4315	M	0.64404	1.975	0.80722	D	1	D	0.61080	0.989	P	0.62740	0.906	T	0.77624	-0.2518	9	.	.	.	.	18.9398	0.92601	0.0:1.0:0.0:0.0	.	239	O43592	XPOT_HUMAN	I	239	ENSP00000327821:L239I	.	L	+	1	2	XPOT	63100440	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.657000	0.83745	2.649000	0.89929	0.655000	0.94253	CTA	.		0.318	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	88967620	88967620	+	Silent	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:88967620C>A	ENST00000375963.3	-	2	667	c.495G>T	c.(493-495)acG>acT	p.T165T	ZCCHC6_ENST00000375947.1_5'UTR|ZCCHC6_ENST00000375960.2_Silent_p.T165T|ZCCHC6_ENST00000375961.2_Silent_p.T165T|ZCCHC6_ENST00000277141.6_5'UTR	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	165					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CCATTTCTGACGTGGTTTCTA	0.403																																					p.T165T		.											.	ZCCHC6	92	0			c.G495T						.						155.0	157.0	156.0					9																	88967620		2203	4300	6503	SO:0001819	synonymous_variant	79670	exon2			TTCTGACGTGGTT	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.495G>T	9.37:g.88967620C>A		Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	37.0	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Silent	SNP	ENST00000375963.3	37	CCDS35057.1																																																																																			.		0.403	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	77768145	77768145	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:77768145G>A	ENST00000521891.2	+	10	9436	c.8988G>A	c.(8986-8988)atG>atA	p.M2996I	ZFHX4_ENST00000518282.1_Missense_Mutation_p.M2970I|ZFHX4_ENST00000455469.2_Missense_Mutation_p.M2951I|ZFHX4_ENST00000050961.6_Missense_Mutation_p.M2951I	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2951					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGCCTTTCATGATCAATCAAG	0.473										HNSCC(33;0.089)																											p.M2996I		.											.	ZFHX4	98	0			c.G8988A						.						45.0	44.0	44.0					8																	77768145		1909	4123	6032	SO:0001583	missense	79776	exon10			TTTCATGATCAAT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8988G>A	8.37:g.77768145G>A	ENSP00000430497:p.Met2996Ile	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	20.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830677	0.32329	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.48201	0.82;0.87;0.84;0.83	5.17	5.17	0.71159	.	0.000000	0.53938	U	0.000049	T	0.54967	0.1891	N	0.24115	0.695	0.54753	D	0.999981	P;P;P	0.51653	0.913;0.947;0.947	P;P;D	0.68192	0.746;0.871;0.956	T	0.47736	-0.9094	10	0.24483	T	0.36	.	18.8517	0.92235	0.0:0.0:1.0:0.0	.	2951;2951;2996	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	I	2996;2980;2951;2951;2970	ENSP00000430497:M2996I;ENSP00000399605:M2951I;ENSP00000050961:M2951I;ENSP00000430848:M2970I	ENSP00000050961:M2951I	M	+	3	0	ZFHX4	77930700	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	7.665000	0.83852	2.687000	0.91594	0.643000	0.83706	ATG	.		0.473	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZNF28	7576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53303883	53303883	+	Silent	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:53303883A>G	ENST00000457749.2	-	4	1334	c.1215T>C	c.(1213-1215)caT>caC	p.H405H	ZNF28_ENST00000414252.2_Silent_p.H352H|ZNF28_ENST00000438150.2_Silent_p.H352H|ZNF28_ENST00000360272.4_Silent_p.H352H	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TCTCTCCAGTATGAATCCTCT	0.373																																					p.H405H		.											.	ZNF28	91	0			c.T1215C						.						105.0	112.0	110.0					19																	53303883		2203	4300	6503	SO:0001819	synonymous_variant	7576	exon4			TCCAGTATGAATC	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1215T>C	19.37:g.53303883A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	30.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Silent	SNP	ENST00000457749.2	37	CCDS33093.2																																																																																			.		0.373	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
ZNF582	147948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56896171	56896171	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:56896171C>T	ENST00000301310.4	-	5	773	c.615G>A	c.(613-615)ggG>ggA	p.G205G	ZNF582_ENST00000586929.1_Silent_p.G205G|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TAAAGGCCTTCCCACATTCCT	0.338																																					p.G205G	Ovarian(183;1887 2032 4349 30507 51343)	.											.	ZNF582	138	0			c.G615A						.						68.0	70.0	69.0					19																	56896171		2203	4300	6503	SO:0001819	synonymous_variant	147948	exon5			GGCCTTCCCACAT	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.615G>A	19.37:g.56896171C>T		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	16.0	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Silent	SNP	ENST00000301310.4	37	CCDS33121.1																																																																																			.		0.338	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
ZNF697	90874	bcgsc.ca;mdanderson.org	37	1	120165473	120165473	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:120165473C>A	ENST00000421812.2	-	3	1612	c.1493G>T	c.(1492-1494)tGc>tTc	p.C498F		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	498					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GCTCTTGCCGCACTCGATGCA	0.647																																					p.C498F		.											.	ZNF697	23	0			c.G1493T						.						31.0	34.0	33.0					1																	120165473		2201	4299	6500	SO:0001583	missense	90874	exon3			TTGCCGCACTCGA	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1493G>T	1.37:g.120165473C>A	ENSP00000396857:p.Cys498Phe	Somatic	42.0	2.0		WXS	Illumina HiSeq	Phase_1	50.0	22.0	NM_001080470	Q96IT2	Missense_Mutation	SNP	ENST00000421812.2	37	CCDS44202.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.416478	0.62511	.	.	ENSG00000143067	ENST00000421812	D	0.85861	-2.04	5.39	5.39	0.77823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39759	N	0.001271	D	0.95468	0.8528	H	0.98664	4.295	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	D	0.96875	0.9642	10	0.87932	D	0	-28.4608	17.0362	0.86476	0.0:1.0:0.0:0.0	.	498	Q5TEC3	ZN697_HUMAN	F	498	ENSP00000396857:C498F	ENSP00000396857:C498F	C	-	2	0	ZNF697	119966996	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	7.700000	0.84556	2.713000	0.92767	0.655000	0.94253	TGC	.		0.647	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286	
ZNF845	91664	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	53855612	53855612	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:53855612delG	ENST00000595091.1	+	5	1903	c.1684delG	c.(1684-1686)gggfs	p.G562fs	ZNF845_ENST00000458035.1_Frame_Shift_Del_p.G562fs			Q96IR2	ZN845_HUMAN	zinc finger protein 845	562					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						AGCCTTTCGTGGGCAGTCAGC	0.423																																					p.G562fs		.											.	.	.	0			c.1684delG						.			4,4240		1,2,2119	88.0	76.0	80.0			-1.5	0.0	19		79	12,8228		6,0,4114	no	frameshift	ZNF845	NM_138374.1		7,2,6233	A1A1,A1R,RR		0.1456,0.0943,0.1282			53855612	16,12468	692	1591	2283	SO:0001589	frameshift_variant	91664	exon4			TTTCGTGGGCAGT	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1684delG	19.37:g.53855612delG	ENSP00000470005:p.Gly562fs	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	25.0	NM_138374		Frame_Shift_Del	DEL	ENST00000595091.1	37	CCDS46170.1																																																																																			.		0.423	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
ZSCAN5B	342933	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	56704398	56704398	+	Silent	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:56704398T>A	ENST00000586855.2	-	2	337	c.24A>T	c.(22-24)tcA>tcT	p.S8S	ZSCAN5B_ENST00000358992.3_Silent_p.S8S			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	8					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CCTGACCCCATGAGAGTGTCC	0.502																																					p.S8S		.											.	ZSCAN5B	24	0			c.A24T						.						33.0	28.0	30.0					19																	56704398		692	1591	2283	SO:0001819	synonymous_variant	342933	exon1			ACCCCATGAGAGT		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.24A>T	19.37:g.56704398T>A		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	6.0	NM_001080456		Silent	SNP	ENST00000586855.2	37	CCDS46203.1																																																																																			.		0.502	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456	
