#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A1BG	1	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58863684	58863684	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr19:58863684G>A	ENST00000263100.3	-	4	639	c.578C>T	c.(577-579)tCt>tTt	p.S193F	CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000593374.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	193	Ig-like V-type 2.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		GCTGGGCTCAGAGAGGGCGCC	0.627																																					p.S193F		.											.	A1BG	90	0			c.C578T						.						100.0	89.0	93.0					19																	58863684		2203	4300	6503	SO:0001583	missense	1	exon4			GGCTCAGAGAGGG		CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.578C>T	19.37:g.58863684G>A	ENSP00000263100:p.Ser193Phe	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	12.0	NM_130786	A8K052|Q68CK0|Q8IYJ6|Q96P39	Missense_Mutation	SNP	ENST00000263100.3	37	CCDS12976.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721617	0.48728	.	.	ENSG00000121410	ENST00000263100;ENST00000453054	T	0.13307	2.6	3.39	3.39	0.38822	Immunoglobulin-like fold (1);	0.000000	0.43110	D	0.000603	T	0.40196	0.1107	M	0.88704	2.975	0.18873	N	0.999982	D	0.89917	1.0	D	0.85130	0.997	T	0.16689	-1.0394	10	0.87932	D	0	.	10.5741	0.45217	0.0:0.0:1.0:0.0	.	193	P04217	A1BG_HUMAN	F	193;71	ENSP00000263100:S193F	ENSP00000263100:S193F	S	-	2	0	A1BG	63555496	0.032000	0.19561	0.101000	0.21167	0.005000	0.04900	0.939000	0.28978	2.203000	0.70933	0.563000	0.77884	TCT	.		0.627	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1	NM_130786	
AP2M1	1173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183898651	183898651	+	Missense_Mutation	SNP	G	G	T	rs375328073		TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr3:183898651G>T	ENST00000292807.5	+	6	592	c.444G>T	c.(442-444)caG>caT	p.Q148H	EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000411763.2_Missense_Mutation_p.Q173H|AP2M1_ENST00000382456.3_Missense_Mutation_p.Q146H|AP2M1_ENST00000461733.1_3'UTR|AP2M1_ENST00000439647.1_Missense_Mutation_p.Q146H	NM_004068.3	NP_004059.2	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	148					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of protein localization to plasma membrane (GO:1903077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AAGAAGAGCAGTCACAGATCA	0.517																																					p.Q146H		.											.	AP2M1	90	0			c.G438T						.						147.0	156.0	153.0					3																	183898651		2045	4204	6249	SO:0001583	missense	1173	exon5			AGAGCAGTCACAG	U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203			564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1		8595912	Standard	NM_004068		Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000292807.5:c.444G>T	3.37:g.183898651G>T	ENSP00000292807:p.Gln148His	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	19.0	NM_001025205	A6NE12|D3DNT1|P20172|P53679	Missense_Mutation	SNP	ENST00000292807.5	37	CCDS43177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.54|15.54	2.864449|2.864449	0.51482|0.51482	.|.	.|.	ENSG00000161203|ENSG00000161203	ENST00000382456;ENST00000411763;ENST00000292807;ENST00000540821;ENST00000539646;ENST00000448139;ENST00000439647;ENST00000432591|ENST00000431779	T;T;T;T|.	0.65549|.	-0.16;-0.16;-0.15;-0.16|.	5.54|5.54	0.825|0.825	0.18824|0.18824	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63271|0.63271	0.2497|0.2497	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.51240|.	0.753;0.905;0.773;0.943|.	B;B;P;P|.	0.48089|.	0.297;0.358;0.566;0.561|.	T|T	0.60692|0.60692	-0.7213|-0.7213	10|6	0.51188|0.49607	T|T	0.08|0.09	.|.	10.0459|10.0459	0.42186|0.42186	0.3244:0.0:0.6756:0.0|0.3244:0.0:0.6756:0.0	.|.	18;148;173;146|.	B4DTI4;Q96CW1;E9PFW3;Q96CW1-2|.	.;AP2M1_HUMAN;.;.|.	H|F	146;173;148;88;133;150;146;148|179	ENSP00000371894:Q146H;ENSP00000403362:Q173H;ENSP00000292807:Q148H;ENSP00000409081:Q146H|.	ENSP00000292807:Q148H|ENSP00000404326:V179F	Q|V	+|+	3|1	2|0	AP2M1|AP2M1	185381345|185381345	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.943000|0.943000	0.58893|0.58893	2.026000|2.026000	0.41069|0.41069	-0.031000|-0.031000	0.13781|0.13781	-0.768000|-0.768000	0.03414|0.03414	CAG|GTC	.		0.517	AP2M1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346013.1	NM_004068	
ATP11C	286410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	138878508	138878508	+	Missense_Mutation	SNP	T	T	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chrX:138878508T>A	ENST00000327569.3	-	12	1237	c.1139A>T	c.(1138-1140)gAt>gTt	p.D380V	ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000359686.2_Missense_Mutation_p.D380V|ATP11C_ENST00000370557.1_Missense_Mutation_p.D377V|ATP11C_ENST00000361648.2_Missense_Mutation_p.D380V|ATP11C_ENST00000370543.1_Missense_Mutation_p.D380V	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	380					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					AAAGTCCTTATCCCATGAGAT	0.363																																					p.D380V		.											.	ATP11C	198	0			c.A1139T						.						62.0	55.0	57.0					X																	138878508		2203	4300	6503	SO:0001583	missense	286410	exon12			TCCTTATCCCATG	AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1139A>T	X.37:g.138878508T>A	ENSP00000332756:p.Asp380Val	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	26.0	NM_001010986	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	ENST00000327569.3	37	CCDS14668.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.358385	0.82243	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.90563	0.7042	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94021	0.7292	10	0.87932	D	0	.	14.2923	0.66286	0.0:0.0:0.0:1.0	.	380;380	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	V	377;380;380;380;380	ENSP00000359588:D377V;ENSP00000355165:D380V;ENSP00000332756:D380V;ENSP00000359574:D380V;ENSP00000352715:D380V	ENSP00000332756:D380V	D	-	2	0	ATP11C	138706174	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	1.973000	0.57446	0.486000	0.48141	GAT	.		0.363	ATP11C-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354945.1	NM_173694	
ATP1A3	478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	42486221	42486221	+	Missense_Mutation	SNP	T	T	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr19:42486221T>A	ENST00000302102.5	-	9	1181	c.1031A>T	c.(1030-1032)aAg>aTg	p.K344M	ATP1A3_ENST00000543770.1_Missense_Mutation_p.K355M|ATP1A3_ENST00000545399.1_Missense_Mutation_p.K357M|ATP1A3_ENST00000602133.1_Missense_Mutation_p.K314M	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	344					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						caggcagttcttccGGGCCAT	0.602																																					p.K357M		.											.	ATP1A3	92	0			c.A1070T						.						132.0	121.0	125.0					19																	42486221		2203	4300	6503	SO:0001583	missense	478	exon9			CAGTTCTTCCGGG		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.1031A>T	19.37:g.42486221T>A	ENSP00000302397:p.Lys344Met	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	294.0	19.0	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.316293	0.81469	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96	4.21	4.21	0.49690	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.97445	0.9164	H	0.98388	4.22	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.994;0.999;0.999;0.999	D	0.97914	1.0310	10	0.87932	D	0	.	11.5777	0.50873	0.0:0.0:0.0:1.0	.	357;355;344;344	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	M	344;344;357;314;88;355	ENSP00000302397:K344M;ENSP00000411503:K344M;ENSP00000444688:K357M;ENSP00000437577:K355M	ENSP00000302397:K344M	K	-	2	0	ATP1A3	47178061	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.841000	0.86834	1.910000	0.55303	0.459000	0.35465	AAG	.		0.602	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
BTAF1	9044	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	93749020	93749020	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr10:93749020A>G	ENST00000265990.6	+	20	2845	c.2537A>G	c.(2536-2538)aAc>aGc	p.N846S	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	846					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				ACAGAGACCAACCAGGAGTGG	0.413																																					p.N846S		.											.	BTAF1	92	0			c.A2537G						.						89.0	86.0	87.0					10																	93749020		2203	4300	6503	SO:0001583	missense	9044	exon20			AGACCAACCAGGA	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.2537A>G	10.37:g.93749020A>G	ENSP00000265990:p.Asn846Ser	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	9.0	NM_003972	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	A	4.050	0.006909	0.07866	.	.	ENSG00000095564	ENST00000265990	D	0.89552	-2.53	4.91	4.91	0.64330	Domain of unknown function DUF3535 (1);Armadillo-type fold (1);	0.092168	0.85682	D	0.000000	T	0.73697	0.3620	N	0.04636	-0.2	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.67968	-0.5533	10	0.17369	T	0.5	-0.9041	9.458	0.38767	0.9195:0.0:0.0805:0.0	.	846;846	Q2M1V9;O14981	.;BTAF1_HUMAN	S	846	ENSP00000265990:N846S	ENSP00000265990:N846S	N	+	2	0	BTAF1	93739000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.183000	0.50918	1.988000	0.58038	0.477000	0.44152	AAC	.		0.413	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
C8orf74	203076	broad.mit.edu;bcgsc.ca	37	8	10530197	10530197	+	Missense_Mutation	SNP	G	G	A	rs374988450		TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr8:10530197G>A	ENST00000304519.5	+	1	51	c.22G>A	c.(22-24)Gga>Aga	p.G8R	C8orf74_ENST00000524025.1_3'UTR|RP1L1_ENST00000329335.3_Intron	NM_001040032.1	NP_001035121	Q6P047	CH074_HUMAN	chromosome 8 open reading frame 74	8										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13				COAD - Colon adenocarcinoma(149;0.0811)		AACACCCCAGGGAGTGAAAGA	0.552																																					p.G8R		.											.	.	.	0			c.G22A						.						35.0	35.0	35.0					8																	10530197		1911	4115	6026	SO:0001583	missense	203076	exon1			CCCCAGGGAGTGA	BC038534	CCDS47800.1	8p23.1	2012-04-17			ENSG00000171060	ENSG00000171060			32296	protein-coding gene	gene with protein product							Standard	NM_001040032		Approved		uc003wtd.1	Q6P047	OTTHUMG00000163807	ENST00000304519.5:c.22G>A	8.37:g.10530197G>A	ENSP00000307129:p.Gly8Arg	Somatic	98.0	2.0		WXS	Illumina HiSeq	Phase_I	151.0	11.0	NM_001040032	A2RUD6	Missense_Mutation	SNP	ENST00000304519.5	37	CCDS47800.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.20|15.20	2.764072|2.764072	0.49574|0.49574	.|.	.|.	ENSG00000171060|ENSG00000171060	ENST00000521818|ENST00000304519	.|T	.|0.31769	.|1.48	4.73|4.73	4.73|4.73	0.59995|0.59995	.|.	0.172556|0.172556	0.28104|0.28104	N|N	0.016592|0.016592	T|T	0.39809|0.39809	0.1092|0.1092	N|N	0.24115|0.24115	0.695|0.695	0.30683|0.30683	N|N	0.752166|0.752166	.|D	.|0.89917	.|1.0	.|D	.|0.79108	.|0.992	T|T	0.31336|0.31336	-0.9947|-0.9947	6|10	.|0.41790	.|T	.|0.15	.|.	13.6445|13.6445	0.62272|0.62272	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|8	.|Q6P047	.|CH074_HUMAN	E|R	6|8	.|ENSP00000307129:G8R	.|ENSP00000307129:G8R	G|G	+|+	2|1	0|0	C8orf74|C8orf74	10567607|10567607	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.235000|0.235000	0.25334|0.25334	4.859000|4.859000	0.62954|0.62954	2.355000|2.355000	0.79922|0.79922	0.289000|0.289000	0.19496|0.19496	GGG|GGA	.		0.552	C8orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375675.1	NM_001040032	
CASP6	839	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	110615726	110615726	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr4:110615726G>C	ENST00000265164.2	-	5	515	c.438C>G	c.(436-438)gaC>gaG	p.D146E	AC004067.5_ENST00000608733.1_RNA|CASP6_ENST00000510324.1_5'UTR|CASP6_ENST00000352981.3_Missense_Mutation_p.D57E	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	146					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		TGTGACACTTGTCTCCTTTGA	0.383																																					p.D146E		.											.	CASP6	660	0			c.C438G						.						101.0	90.0	94.0					4																	110615726		2203	4300	6503	SO:0001583	missense	839	exon5			ACACTTGTCTCCT	U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.438C>G	4.37:g.110615726G>C	ENSP00000265164:p.Asp146Glu	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	271.0	16.0	NM_001226	Q9BQE7	Missense_Mutation	SNP	ENST00000265164.2	37	CCDS3684.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.866945	0.72065	.	.	ENSG00000138794	ENST00000352981;ENST00000265164;ENST00000503684	T;T;T	0.52983	0.64;0.64;0.64	5.31	4.47	0.54385	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.087933	0.85682	D	0.000000	T	0.56108	0.1963	M	0.74881	2.28	0.80722	D	1	B;B	0.31837	0.073;0.342	B;B	0.42282	0.098;0.382	T	0.60974	-0.7156	10	0.87932	D	0	.	11.6539	0.51306	0.1452:0.0:0.8548:0.0	.	57;146	P55212-2;P55212	.;CASP6_HUMAN	E	57;146;128	ENSP00000285333:D57E;ENSP00000265164:D146E;ENSP00000427669:D128E	ENSP00000265164:D146E	D	-	3	2	CASP6	110835175	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.760000	0.55235	1.361000	0.45981	0.650000	0.86243	GAC	.		0.383	CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254866.1	NM_001226	
CHN2	1124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	29407578	29407578	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr7:29407578C>T	ENST00000222792.6	+	3	649	c.119C>T	c.(118-120)cCc>cTc	p.P40L	CHN2_ENST00000435288.2_Missense_Mutation_p.P40L|CHN2_ENST00000495789.2_Missense_Mutation_p.P53L|CHN2_ENST00000539406.1_Missense_Mutation_p.P115L|CHN2_ENST00000546235.1_Missense_Mutation_p.P25L|CHN2_ENST00000539389.1_Missense_Mutation_p.P40L	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	40					positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						GCACCTCGTCCCAAGAGAATC	0.413																																					p.P40L	Ovarian(1;44 48 13232 18918 31480)	.											.	CHN2	229	0			c.C119T						.						114.0	111.0	112.0					7																	29407578		2203	4300	6503	SO:0001583	missense	1124	exon3			CTCGTCCCAAGAG	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.119C>T	7.37:g.29407578C>T	ENSP00000222792:p.Pro40Leu	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	6.0	NM_004067	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475941	0.84640	.	.	ENSG00000106069	ENST00000439384;ENST00000539406;ENST00000222792;ENST00000435288;ENST00000409350;ENST00000495789;ENST00000539389;ENST00000546235	T;T;T;T;T;T;T;T	0.71817	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.6;-0.02	5.12	5.12	0.69794	.	0.250879	0.40144	N	0.001168	D	0.83769	0.5326	M	0.76574	2.34	0.80722	D	1	D;D;D;B;D	0.89917	1.0;0.998;1.0;0.081;0.998	D;D;D;B;D	0.97110	1.0;0.981;0.998;0.033;0.981	D	0.85912	0.1441	10	0.87932	D	0	.	16.3346	0.83053	0.0:1.0:0.0:0.0	.	25;53;115;40;40	B7Z1W9;B7Z1V0;F5H003;B3VCG1;P52757	.;.;.;.;CHIO_HUMAN	L	115;115;40;40;53;53;40;25	ENSP00000409843:P115L;ENSP00000444063:P115L;ENSP00000222792:P40L;ENSP00000400282:P40L;ENSP00000386968:P53L;ENSP00000438587:P53L;ENSP00000440526:P40L;ENSP00000442812:P25L	ENSP00000222792:P40L	P	+	2	0	CHN2	29374103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.472000	0.66768	2.388000	0.81334	0.585000	0.79938	CCC	.		0.413	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
CNOT6	57472	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	179956354	179956354	+	Silent	SNP	A	A	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr5:179956354A>G	ENST00000393356.1	+	4	502	c.78A>G	c.(76-78)ggA>ggG	p.G26G	CNOT6_ENST00000502447.1_3'UTR|CNOT6_ENST00000261951.4_Silent_p.G26G			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	26					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		CAGCAAATGGAAAGAAATCCC	0.393																																					p.G26G		.											.	CNOT6	90	0			c.A78G						.						75.0	85.0	82.0					5																	179956354		2203	4300	6503	SO:0001819	synonymous_variant	57472	exon2			AAATGGAAAGAAA	AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.78A>G	5.37:g.179956354A>G		Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	316.0	25.0	NM_015455	A7MD46|D3DWR0	Silent	SNP	ENST00000393356.1	37	CCDS4455.1																																																																																			.		0.393	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253532.1	NM_015455	
CNST	163882	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	246811218	246811218	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:246811218A>G	ENST00000366513.4	+	9	1984	c.1715A>G	c.(1714-1716)gAc>gGc	p.D572G	CNST_ENST00000366512.3_Missense_Mutation_p.D572G|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	572					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						CAAGACGACGACTCCGATCTC	0.413																																					p.D572G		.											.	CNST	90	0			c.A1715G						.						133.0	139.0	137.0					1																	246811218		2203	4300	6503	SO:0001583	missense	163882	exon9			ACGACGACTCCGA	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.1715A>G	1.37:g.246811218A>G	ENSP00000355470:p.Asp572Gly	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	9.0	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	37	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.059340	0.36373	.	.	ENSG00000162852	ENST00000366513;ENST00000366512	T;T	0.27104	1.86;1.69	5.39	3.03	0.35002	.	0.076047	0.47852	N	0.000217	T	0.24431	0.0592	M	0.64404	1.975	0.80722	D	1	B;B	0.27997	0.197;0.197	B;B	0.28465	0.09;0.09	T	0.05582	-1.0876	10	0.87932	D	0	-21.7352	6.2464	0.20820	0.783:0.0:0.0756:0.1414	.	572;572	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	G	572	ENSP00000355470:D572G;ENSP00000355469:D572G	ENSP00000355469:D572G	D	+	2	0	CNST	244877841	1.000000	0.71417	0.378000	0.26068	0.195000	0.23768	3.907000	0.56348	0.423000	0.26033	0.383000	0.25322	GAC	.		0.413	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
CORIN	10699	hgsc.bcm.edu;broad.mit.edu	37	4	47663761	47663761	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr4:47663761G>T	ENST00000273857.4	-	12	1701	c.1702C>A	c.(1702-1704)Caa>Aaa	p.Q568K	CORIN_ENST00000505909.1_Missense_Mutation_p.Q531K|CORIN_ENST00000508498.1_Missense_Mutation_p.Q429K|CORIN_ENST00000502252.1_Missense_Mutation_p.Q501K|CORIN_ENST00000504584.1_Missense_Mutation_p.Q531K	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	568	FZ 2. {ECO:0000255|PROSITE- ProRule:PRU00090}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						AGGCAGGTTTGATTGTCTGAA	0.398																																					p.Q568K		.											.	CORIN	91	0			c.C1702A						.						117.0	112.0	114.0					4																	47663761		2203	4300	6503	SO:0001583	missense	10699	exon12			AGGTTTGATTGTC	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1702C>A	4.37:g.47663761G>T	ENSP00000273857:p.Gln568Lys	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	6.0	NM_006587	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	ENST00000273857.4	37	CCDS3477.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530200	0.45073	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87	5.9	4.03	0.46877	Frizzled domain (5);	0.376630	0.28677	N	0.014501	T	0.69433	0.3110	L	0.39245	1.2	0.37790	D	0.927328	B;P;B;B	0.38617	0.134;0.64;0.015;0.009	B;B;B;B	0.40602	0.077;0.334;0.015;0.038	T	0.74515	-0.3640	10	0.46703	T	0.11	.	16.0384	0.80648	0.0:0.2534:0.7466:0.0	.	531;531;501;568	B7Z4R1;B4E2W9;B4E1Y7;Q9Y5Q5	.;.;.;CORIN_HUMAN	K	568;429;501;531;531	ENSP00000273857:Q568K;ENSP00000425597:Q429K;ENSP00000424212:Q501K;ENSP00000425401:Q531K;ENSP00000423216:Q531K	ENSP00000273857:Q568K	Q	-	1	0	CORIN	47358518	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	0.817000	0.27281	1.458000	0.47871	0.650000	0.86243	CAA	.		0.398	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216906.2		
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	3072177	3072177	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr8:3072177A>G	ENST00000520002.1	-	31	5267	c.4712T>C	c.(4711-4713)aTa>aCa	p.I1571T	CSMD1_ENST00000537824.1_Missense_Mutation_p.I1570T|CSMD1_ENST00000542608.1_Missense_Mutation_p.I1570T|CSMD1_ENST00000602723.1_Missense_Mutation_p.I1571T|CSMD1_ENST00000400186.3_Missense_Mutation_p.I1571T|CSMD1_ENST00000539096.1_Missense_Mutation_p.I1570T|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602557.1_Missense_Mutation_p.I1571T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1571	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCCATTCATTATATTTCCTGG	0.433																																					p.I1570T		.											.	CSMD1	86	0			c.T4709C						.						73.0	69.0	70.0					8																	3072177		1915	4076	5991	SO:0001583	missense	64478	exon30			TTCATTATATTTC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4712T>C	8.37:g.3072177A>G	ENSP00000430733:p.Ile1571Thr	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	9.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	A	23.2	4.386921	0.82902	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3	5.53	5.53	0.82687	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.81795	0.4898	M	0.79343	2.45	0.58432	D	0.999999	D;P;P	0.63046	0.992;0.863;0.84	D;P;P	0.72338	0.977;0.756;0.557	D	0.84104	0.0397	10	0.66056	D	0.02	.	15.6592	0.77169	1.0:0.0:0.0:0.0	.	1571;1571;1571	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	T	1571;1571;1433;1570;1570;1570	ENSP00000383047:I1571T;ENSP00000430733:I1571T;ENSP00000441462:I1570T;ENSP00000446243:I1570T;ENSP00000441675:I1570T	ENSP00000320445:I1433T	I	-	2	0	CSMD1	3059584	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	9.065000	0.93941	2.095000	0.63458	0.482000	0.46254	ATA	.		0.433	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CTDSPL	10217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	37988645	37988645	+	Silent	SNP	A	A	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr3:37988645A>C	ENST00000273179.5	+	2	203	c.177A>C	c.(175-177)ccA>ccC	p.P59P	CTDSPL_ENST00000443503.2_Silent_p.P59P	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	59						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		AGGCCCCTCCACCCAGCAGCC	0.567																																					p.P59P		.											.	CTDSPL	90	0			c.A177C						.						76.0	75.0	75.0					3																	37988645		2203	4300	6503	SO:0001819	synonymous_variant	10217	exon2			CCCTCCACCCAGC	D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.177A>C	3.37:g.37988645A>C		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	5.0	NM_001008392	Q3ZTU0|Q70KI4|Q7Z5Q2	Silent	SNP	ENST00000273179.5	37	CCDS33734.1																																																																																			.		0.567	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342392.1	NM_005808	
CSRNP1	64651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	39184867	39184867	+	Silent	SNP	C	C	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr3:39184867C>G	ENST00000273153.5	-	5	1626	c.1449G>C	c.(1447-1449)gtG>gtC	p.V483V	CSRNP1_ENST00000514182.1_Silent_p.V483V	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	483					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						TGCTGGGTGGCACTGAGGTGC	0.557																																					p.V483V		.											.	CSRNP1	230	0			c.G1449C						.						50.0	48.0	49.0					3																	39184867		2203	4300	6503	SO:0001819	synonymous_variant	64651	exon5			GGGTGGCACTGAG	AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.1449G>C	3.37:g.39184867C>G		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	9.0	NM_033027	Q69YY5	Silent	SNP	ENST00000273153.5	37	CCDS2682.1																																																																																			.		0.557	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254061.1	NM_033027	
CYP3A5	1577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99273802	99273802	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr7:99273802T>C	ENST00000222982.4	-	2	200	c.101A>G	c.(100-102)aAg>aGg	p.K34R	CYP3A5_ENST00000439761.1_Missense_Mutation_p.K34R|CYP3A5_ENST00000480723.1_5'UTR|CYP3A5_ENST00000339843.2_3'UTR|CYP3A5_ENST00000343703.5_Missense_Mutation_p.K24R	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	34					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	TCCCAGTCTCTTAAAAAGTCC	0.453																																					p.K34R		.											.	CYP3A5	90	0			c.A101G						.						115.0	105.0	108.0					7																	99273802		2203	4300	6503	SO:0001583	missense	1577	exon2			AGTCTCTTAAAAA	L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.101A>G	7.37:g.99273802T>C	ENSP00000222982:p.Lys34Arg	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	273.0	28.0	NM_001190484	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Missense_Mutation	SNP	ENST00000222982.4	37	CCDS5672.1	.	.	.	.	.	.	.	.	.	.	T	8.763	0.923980	0.18056	.	.	ENSG00000106258	ENST00000222982;ENST00000343703;ENST00000439761	T;T;T	0.09445	2.98;2.98;2.98	3.78	2.49	0.30216	.	0.000000	0.85682	D	0.000000	T	0.13586	0.0329	L	0.49350	1.555	0.80722	D	1	B;B;B	0.28082	0.029;0.2;0.017	B;B;B	0.40228	0.194;0.323;0.095	T	0.06320	-1.0833	10	0.66056	D	0.02	.	6.6367	0.22887	0.0:0.0:0.2448:0.7552	.	24;34;34	F5H4S0;B7Z5I7;P20815	.;.;CP3A5_HUMAN	R	34;24;34	ENSP00000222982:K34R;ENSP00000342969:K24R;ENSP00000401269:K34R	ENSP00000222982:K34R	K	-	2	0	CYP3A5	99111738	1.000000	0.71417	0.809000	0.32408	0.042000	0.13812	1.054000	0.30455	1.476000	0.48215	0.374000	0.22700	AAG	.		0.453	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1		
DCAF12L2	340578	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	125298989	125298989	+	Nonsense_Mutation	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chrX:125298989G>A	ENST00000360028.2	-	1	945	c.919C>T	c.(919-921)Cga>Tga	p.R307*	DCAF12L2_ENST00000538699.1_Nonsense_Mutation_p.R307*			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	307								p.R307R(2)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						ACATTCTCTCGGCAGTAGGGC	0.607																																					p.R307X		.											.	DCAF12L2	113	2	Substitution - coding silent(2)	lung(2)	c.C919T						.						101.0	104.0	103.0					X																	125298989		2203	4300	6503	SO:0001587	stop_gained	340578	exon1			TCTCTCGGCAGTA	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.919C>T	X.37:g.125298989G>A	ENSP00000353128:p.Arg307*	Somatic	133.0	1.0		WXS	Illumina HiSeq	Phase_I	174.0	26.0	NM_001013628	B2RN42	Nonsense_Mutation	SNP	ENST00000360028.2	37	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	35	5.456407	0.96223	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	.	.	.	4.71	1.64	0.23874	.	0.565745	0.13201	N	0.405979	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6512	0.22963	0.0:0.1664:0.4675:0.3661	.	.	.	.	X	307	.	ENSP00000353128:R307X	R	-	1	2	DCAF12L2	125126670	1.000000	0.71417	0.977000	0.42913	0.992000	0.81027	1.121000	0.31283	0.065000	0.16485	0.544000	0.68410	CGA	.		0.607	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
DENND5B	160518	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	31552686	31552686	+	Silent	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr12:31552686C>A	ENST00000389082.5	-	16	3234	c.2970G>T	c.(2968-2970)ctG>ctT	p.L990L	DENND5B_ENST00000306833.6_Silent_p.L1025L|DENND5B_ENST00000536562.1_Silent_p.L1025L	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	990	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GAACAGTGGTCAGCTTCCCCA	0.453																																					p.L990L		.											.	DENND5B	24	0			c.G2970T						.						109.0	102.0	104.0					12																	31552686		2074	4252	6326	SO:0001819	synonymous_variant	160518	exon16			AGTGGTCAGCTTC	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2970G>T	12.37:g.31552686C>A		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	11.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	ENST00000389082.5	37	CCDS44857.1																																																																																			.		0.453	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
EIF3B	8662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2406209	2406209	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr7:2406209A>C	ENST00000360876.4	+	8	1395	c.1339A>C	c.(1339-1341)Agc>Cgc	p.S447R	EIF3B_ENST00000397011.2_Missense_Mutation_p.S447R	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GGATACGCTTAGCATCTATGA	0.483																																					p.S447R		.											.	EIF3B	68	0			c.A1339C						.						84.0	83.0	83.0					7																	2406209		2203	4300	6503	SO:0001583	missense	8662	exon8			ACGCTTAGCATCT	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1339A>C	7.37:g.2406209A>C	ENSP00000354125:p.Ser447Arg	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	17.0	NM_001037283		Missense_Mutation	SNP	ENST00000360876.4	37	CCDS5332.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.899914	0.91962	.	.	ENSG00000106263	ENST00000314800;ENST00000360876;ENST00000397011;ENST00000489558	T;T	0.04917	3.53;3.53	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	M	0.73753	2.245	0.80722	D	1	D	0.59767	0.986	D	0.63877	0.919	T	0.00529	-1.1687	10	0.87932	D	0	-34.6695	15.7372	0.77853	1.0:0.0:0.0:0.0	.	447	P55884	EIF3B_HUMAN	R	447;447;447;371	ENSP00000354125:S447R;ENSP00000380206:S447R	ENSP00000316638:S447R	S	+	1	0	EIF3B	2372735	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	9.107000	0.94261	2.120000	0.65058	0.529000	0.55759	AGC	.		0.483	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1		
ENTHD1	150350	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	40216999	40216999	+	Splice_Site	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr22:40216999T>C	ENST00000325157.6	-	5	1081	c.831A>G	c.(829-831)gcA>gcG	p.A277A		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	277										breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					CCAATTTACCTGCACCCGAAA	0.388																																					p.A277A		.											.	ENTHD1	93	0			c.A831G						.						110.0	102.0	104.0					22																	40216999		2203	4300	6503	SO:0001630	splice_region_variant	150350	exon5			TTTACCTGCACCC	AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.832+1A>G	22.37:g.40216999T>C		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	7.0	NM_152512	B0QYD5|Q5H9F7|Q96LK3	Silent	SNP	ENST00000325157.6	37	CCDS13998.1																																																																																			.		0.388	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321302.1	NM_152512	Silent
EPM2A	7957	hgsc.bcm.edu;broad.mit.edu	37	6	145948714	145948714	+	Silent	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr6:145948714G>A	ENST00000367519.3	-	4	1359	c.834C>T	c.(832-834)tgC>tgT	p.C278C		NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)	278	Tyrosine-protein phosphatase.				autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)			kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		GGAGCCAGCCGCAGACAGCCG	0.627																																					p.C278C		.											.	EPM2A	415	0			c.C834T	GRCh37	HM0660	EPM2A	M		.						49.0	51.0	50.0					6																	145948714		2203	4300	6503	SO:0001819	synonymous_variant	7957	exon4			CCAGCCGCAGACA	AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.834C>T	6.37:g.145948714G>A		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_005670	B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	Silent	SNP	ENST00000367519.3	37	CCDS5206.1	.	.	.	.	.	.	.	.	.	.	G	9.640	1.138831	0.21123	.	.	ENSG00000112425	ENST00000435470	.	.	.	5.72	-3.8	0.04307	.	.	.	.	.	T	0.52533	0.1740	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62464	-0.6849	4	.	.	.	-23.8817	15.1704	0.72869	0.5853:0.0:0.4147:0.0	.	.	.	.	V	198	.	.	A	-	2	0	EPM2A	145990407	0.672000	0.27530	0.387000	0.26183	0.922000	0.55478	-0.036000	0.12185	-0.644000	0.05465	-0.259000	0.10710	GCG	.		0.627	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042564.1		
FGR	2268	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	27949607	27949607	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:27949607G>T	ENST00000374005.3	-	4	563	c.275C>A	c.(274-276)aCt>aAt	p.T92N	FGR_ENST00000374004.1_Missense_Mutation_p.T92N|FGR_ENST00000399173.1_Missense_Mutation_p.T92N|FGR_ENST00000545953.1_Missense_Mutation_p.T92N|FGR_ENST00000468038.1_5'Flank	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	92	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GTCATCCTCAGTTCGAGCCTC	0.557																																					p.T92N		.											.	FGR	547	0			c.C275A						.						208.0	148.0	168.0					1																	27949607		2203	4300	6503	SO:0001583	missense	2268	exon4			TCCTCAGTTCGAG	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.275C>A	1.37:g.27949607G>T	ENSP00000363117:p.Thr92Asn	Somatic	221.0	1.0		WXS	Illumina HiSeq	Phase_I	320.0	17.0	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	37	CCDS305.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740071	0.89573	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81	5.41	5.41	0.78517	Src homology-3 domain (4);	0.000000	0.56097	D	0.000028	T	0.45054	0.1323	N	0.11927	0.2	0.50171	D	0.999851	P	0.35011	0.48	P	0.48189	0.57	T	0.46400	-0.9194	10	0.41790	T	0.15	.	17.0669	0.86561	0.0:0.0:1.0:0.0	.	92	P09769	FGR_HUMAN	N	92	ENSP00000363117:T92N;ENSP00000445302:T92N;ENSP00000382126:T92N;ENSP00000363116:T92N;ENSP00000363115:T92N;ENSP00000407670:T92N	ENSP00000363115:T92N	T	-	2	0	FGR	27822194	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	6.762000	0.74950	2.691000	0.91804	0.650000	0.86243	ACT	.		0.557	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
BRINP3	339479	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	190068069	190068069	+	Silent	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:190068069G>A	ENST00000367462.3	-	8	1611	c.1380C>T	c.(1378-1380)tgC>tgT	p.C460C	BRINP3_ENST00000534846.1_Silent_p.C358C	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	460					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											TGCAGGTGCCGCAGCGGGTGC	0.617																																					p.C460C		.											.	FAM5C	228	0			c.C1380T						.						77.0	77.0	77.0					1																	190068069		2203	4300	6503	SO:0001819	synonymous_variant	339479	exon8			GGTGCCGCAGCGG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1380C>T	1.37:g.190068069G>A		Somatic	117.0	1.0		WXS	Illumina HiSeq	Phase_I	139.0	9.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	CCDS1373.1																																																																																			.		0.617	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
GNAS	2778	hgsc.bcm.edu;broad.mit.edu	37	20	57415270	57415270	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr20:57415270T>C	ENST00000313949.7	+	1	498	c.109T>C	c.(109-111)Tgc>Cgc	p.C37R	GNAS_ENST00000371075.3_Missense_Mutation_p.C37R|GNAS_ENST00000371098.2_Missense_Mutation_p.C37R|GNAS-AS1_ENST00000424094.2_RNA|GNAS-AS1_ENST00000443966.1_RNA|GNAS-AS1_ENST00000598163.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTGGCTCTCCTGCTCCATCGC	0.711			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.C37R	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	GNAS	4767	0			c.T109C						.						23.0	29.0	27.0					20																	57415270		2201	4293	6494	SO:0001583	missense	2778	exon1			CTCTCCTGCTCCA	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.109T>C	20.37:g.57415270T>C	ENSP00000323571:p.Cys37Arg	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	4.0	NM_016592	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000313949.7	37	CCDS13471.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.682219	0.47991	.	.	ENSG00000087460	ENST00000313949;ENST00000371098;ENST00000371075	.	.	.	3.72	3.72	0.42706	.	.	.	.	.	T	0.55657	0.1934	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.58808	-0.7571	8	0.87932	D	0	.	9.0937	0.36625	0.0:0.0:0.0:1.0	.	37	O95467	GNAS3_HUMAN	R	37	.	ENSP00000323571:C37R	C	+	1	0	GNAS	56848665	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.026000	0.49689	1.935000	0.56089	0.377000	0.23210	TGC	.		0.711	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080418.7	NM_000516	
IL6	3569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	22767126	22767126	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr7:22767126C>T	ENST00000404625.1	+	3	542	c.83C>T	c.(82-84)gCc>gTc	p.A28V	IL6_ENST00000401630.3_Intron|IL6_ENST00000258743.5_Missense_Mutation_p.A28V|IL6_ENST00000420258.2_Missense_Mutation_p.A82V|IL6_ENST00000407492.1_Intron|IL6_ENST00000401651.1_Intron|AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000406575.1_Missense_Mutation_p.A28V			P05231	IL6_HUMAN	interleukin 6	28					acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	GCCTTCCCTGCCCCAGTACCC	0.602																																					p.A28V	Esophageal Squamous(47;342 1214 13936 33513)	.											.	IL6	514	0			c.C83T						.						60.0	62.0	62.0					7																	22767126		2203	4300	6503	SO:0001583	missense	3569	exon2			TCCCTGCCCCAGT	M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.83C>T	7.37:g.22767126C>T	ENSP00000385675:p.Ala28Val	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	7.0	NM_000600	Q9UCU2|Q9UCU3|Q9UCU4	Missense_Mutation	SNP	ENST00000404625.1	37	CCDS5375.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497180	0.44352	.	.	ENSG00000136244	ENST00000404625;ENST00000426291;ENST00000258743;ENST00000420258;ENST00000406575	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;0.91;-0.94	5.62	2.83	0.33086	.	0.410931	0.30830	N	0.008781	T	0.55481	0.1923	L	0.29908	0.895	0.09310	N	1	B;P;P	0.39216	0.077;0.664;0.495	B;B;B	0.32928	0.028;0.155;0.065	T	0.52586	-0.8556	10	0.87932	D	0	-9.9549	5.6418	0.17569	0.1567:0.6783:0.0:0.165	.	82;28;28	B4DNQ5;B5MC14;P05231	.;.;IL6_HUMAN	V	28;28;28;82;28	ENSP00000385675:A28V;ENSP00000405150:A28V;ENSP00000258743:A28V;ENSP00000405994:A82V;ENSP00000385227:A28V	ENSP00000258743:A28V	A	+	2	0	IL6	22733651	0.001000	0.12720	0.005000	0.12908	0.003000	0.03518	0.134000	0.15932	0.403000	0.25479	0.555000	0.69702	GCC	.		0.602	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250225.2	NM_000600	
IKZF1	10320	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	50444279	50444279	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr7:50444279C>A	ENST00000331340.3	+	4	364	c.209C>A	c.(208-210)gCc>gAc	p.A70D	IKZF1_ENST00000349824.4_Missense_Mutation_p.A70D|IKZF1_ENST00000359197.5_Missense_Mutation_p.A70D|IKZF1_ENST00000440768.2_Missense_Mutation_p.A70D|IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000357364.4_Missense_Mutation_p.A70D|IKZF1_ENST00000439701.1_Missense_Mutation_p.A70D|IKZF1_ENST00000343574.5_Intron|IKZF1_ENST00000438033.1_Intron	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	70					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				AATGGGCGTGCCTGTGAAATG	0.468			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.A70D		.		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	IKZF1	1242	131	Unknown(131)	haematopoietic_and_lymphoid_tissue(131)	c.C209A						.						148.0	155.0	152.0					7																	50444279		1980	4160	6140	SO:0001583	missense	10320	exon4			GGCGTGCCTGTGA	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.209C>A	7.37:g.50444279C>A	ENSP00000331614:p.Ala70Asp	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	12.0	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	37		.	.	.	.	.	.	.	.	.	.	C	14.24	2.475096	0.43942	.	.	ENSG00000185811	ENST00000359197;ENST00000440768;ENST00000349824;ENST00000357364;ENST00000331340;ENST00000439701	T;T;T;T;T;T	0.06608	3.38;3.28;4.4;3.46;3.38;3.38	4.45	2.54	0.30619	.	0.061157	0.64402	D	0.000005	T	0.16171	0.0389	.	.	.	0.58432	D	0.999997	P;P	0.52577	0.953;0.954	P;P	0.56434	0.798;0.588	T	0.00773	-1.1572	9	0.34782	T	0.22	-6.8227	14.4497	0.67376	0.0:0.7214:0.2786:0.0	.	70;70	Q13422-7;Q13422	.;IKZF1_HUMAN	D	70	ENSP00000352123:A70D;ENSP00000401507:A70D;ENSP00000342485:A70D;ENSP00000349928:A70D;ENSP00000331614:A70D;ENSP00000413025:A70D	ENSP00000331614:A70D	A	+	2	0	IKZF1	50411773	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.910000	0.63321	0.390000	0.25115	0.313000	0.20887	GCC	.		0.468	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
GPR22	2845	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	107115727	107115727	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr7:107115727C>A	ENST00000304402.4	+	3	2565	c.1222C>A	c.(1222-1224)Cct>Act	p.P408T	COG5_ENST00000393603.2_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000297135.3_Intron|COG5_ENST00000347053.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	408					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						TTGGATAGATCCTAAAAGAAA	0.343																																					p.P408T		.											.	GPR22	92	0			c.C1222A						.						37.0	42.0	41.0					7																	107115727		2197	4285	6482	SO:0001583	missense	2845	exon3			ATAGATCCTAAAA	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.1222C>A	7.37:g.107115727C>A	ENSP00000302676:p.Pro408Thr	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	7.0	NM_005295	O14554	Missense_Mutation	SNP	ENST00000304402.4	37	CCDS5744.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191150	0.58017	.	.	ENSG00000172209	ENST00000304402	T	0.29917	1.55	5.83	5.83	0.93111	.	0.163823	0.56097	D	0.000039	T	0.45196	0.1330	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.08330	-1.0727	10	0.15066	T	0.55	-10.6011	20.114	0.97919	0.0:1.0:0.0:0.0	.	408	Q99680	GPR22_HUMAN	T	408	ENSP00000302676:P408T	ENSP00000302676:P408T	P	+	1	0	GPR22	106902963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.763000	0.94921	0.585000	0.79938	CCT	.		0.343	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1		
IQGAP2	10788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	75893275	75893275	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr5:75893275G>T	ENST00000274364.6	+	10	1216	c.919G>T	c.(919-921)Gtg>Ttg	p.V307L	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	307					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GCAGGCTGCAGTGGACCATAT	0.532																																					p.V307L		.											.	IQGAP2	96	0			c.G919T						.						104.0	99.0	101.0					5																	75893275		2203	4300	6503	SO:0001583	missense	10788	exon10			GCTGCAGTGGACC	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.919G>T	5.37:g.75893275G>T	ENSP00000274364:p.Val307Leu	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	13.0	NM_006633	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	ENST00000274364.6	37	CCDS34188.1	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350147	0.41599	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.30981	4.22;1.51;4.17	5.88	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.33352	0.0860	L	0.41906	1.305	0.80722	D	1	P	0.40794	0.729	P	0.50352	0.638	T	0.01879	-1.1255	10	0.02654	T	1	-25.8355	15.9192	0.79547	0.0749:0.0:0.9251:0.0	.	307	Q13576	IQGA2_HUMAN	L	307;280;257	ENSP00000274364:V307L;ENSP00000423672:V280L;ENSP00000421097:V257L	ENSP00000274364:V307L	V	+	1	0	IQGAP2	75929031	1.000000	0.71417	0.966000	0.40874	0.668000	0.39293	5.952000	0.70282	2.788000	0.95919	0.650000	0.86243	GTG	.		0.532	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368877.1	NM_006633	
IWS1	55677	hgsc.bcm.edu;broad.mit.edu	37	2	128247456	128247457	+	Frame_Shift_Ins	INS	-	-	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr2:128247456_128247457insT	ENST00000295321.4	-	11	2369_2370	c.2110_2111insA	c.(2110-2112)aggfs	p.R704fs	AC010976.2_ENST00000596439.1_RNA|AC010976.2_ENST00000599001.1_RNA|AC010976.2_ENST00000595561.1_RNA|AC010976.2_ENST00000598065.1_RNA|AC010976.2_ENST00000454503.2_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	704	Interaction with SUPT6H and ALYREF.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TCTCTGCTCCCTTTCTTCTCTT	0.381																																					p.R704fs		.											.	IWS1	91	0			c.2111_2112insA						.																																			SO:0001589	frameshift_variant	55677	exon11			TGCTCCCTTTCTT	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.2111dupA	2.37:g.128247459_128247459dupT	ENSP00000295321:p.Arg704fs	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	11.0	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Frame_Shift_Ins	INS	ENST00000295321.4	37	CCDS2146.1																																																																																			.		0.381	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
KCNH6	81033	hgsc.bcm.edu;bcgsc.ca	37	17	61613103	61613103	+	Missense_Mutation	SNP	G	G	A	rs370829183		TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr17:61613103G>A	ENST00000583023.1	+	6	1186	c.1175G>A	c.(1174-1176)cGc>cAc	p.R392H	KCNH6_ENST00000456941.2_Missense_Mutation_p.R392H|KCNH6_ENST00000581784.1_Missense_Mutation_p.R392H|KCNH6_ENST00000314672.5_Missense_Mutation_p.R392H|KCNH6_ENST00000580652.1_Missense_Mutation_p.R392H	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	392					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AAGCTGGACCGCTACTCTGAG	0.607																																					p.R392H		.											.	KCNH6	91	0			c.G1175A						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	78.0	69.0	72.0		1175,1175	4.4	1.0	17		72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KCNH6	NM_030779.2,NM_173092.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	392/995,392/906	61613103	1,13005	2203	4300	6503	SO:0001583	missense	81033	exon6			TGGACCGCTACTC	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1175G>A	17.37:g.61613103G>A	ENSP00000463533:p.Arg392His	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	10.0	NM_030779	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648974	0.29336	0.0	1.16E-4	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.98474	-4.95;-4.95	4.36	4.36	0.52297	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98448	0.9483	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D	0.76494	0.979;0.991;0.999;0.991;0.981	P;P;D;P;P	0.74023	0.864;0.817;0.982;0.869;0.761	D	0.98732	1.0713	10	0.42905	T	0.14	.	17.0722	0.86577	0.0:0.0:1.0:0.0	.	269;392;392;392;392	B4DPJ3;B4DKC0;Q9H252-2;Q9H252;Q9H252-3	.;.;.;KCNH6_HUMAN;.	H	392	ENSP00000318212:R392H;ENSP00000396900:R392H	ENSP00000318212:R392H	R	+	2	0	KCNH6	58966835	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	9.657000	0.98554	2.244000	0.73946	0.313000	0.20887	CGC	.		0.607	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443853.1	NM_030779	
KDM5D	8284	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	Y	21901515	21901515	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chrY:21901515T>C	ENST00000317961.4	-	6	827	c.556A>G	c.(556-558)Aaa>Gaa	p.K186E	KDM5D_ENST00000541639.1_Missense_Mutation_p.K186E|KDM5D_ENST00000382806.2_Missense_Mutation_p.K129E	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	186					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	TCCTTATCTTTTACCTCATTG	0.403																																					p.K186E		.											.	KDM5D	560	0			c.A556G						.						94.0	109.0	105.0					Y																	21901515		597	1931	2528	SO:0001583	missense	8284	exon6			TATCTTTTACCTC	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.556A>G	Y.37:g.21901515T>C	ENSP00000322408:p.Lys186Glu	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	5.0	NM_001146705	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Missense_Mutation	SNP	ENST00000317961.4	37	CCDS14794.1																																																																																			.		0.403	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653	
NWD2	57495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	37447618	37447618	+	Silent	SNP	A	A	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr4:37447618A>T	ENST00000309447.5	+	7	4856	c.4008A>T	c.(4006-4008)ggA>ggT	p.G1336G		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1336										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						CCCTGGATGGATCCGATTGTG	0.428																																					p.G1336G		.											.	.	.	0			c.A4008T						.						79.0	63.0	68.0					4																	37447618		692	1591	2283	SO:0001819	synonymous_variant	57495	exon7			GGATGGATCCGAT																												ENST00000309447.5:c.4008A>T	4.37:g.37447618A>T		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	6.0	NM_001144990	A8MRU1	Silent	SNP	ENST00000309447.5	37	CCDS47040.1																																																																																			.		0.428	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
KLB	152831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39448160	39448160	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr4:39448160C>T	ENST00000257408.4	+	4	1911	c.1814C>T	c.(1813-1815)tCg>tTg	p.S605L		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	605	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GATTGGGCCTCGGTCCTTCCC	0.542																																					p.S605L		.											.	KLB	69	0			c.C1814T						.						108.0	113.0	112.0					4																	39448160		2203	4300	6503	SO:0001583	missense	152831	exon4			GGGCCTCGGTCCT	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1814C>T	4.37:g.39448160C>T	ENSP00000257408:p.Ser605Leu	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	9.0	NM_175737	Q2M3K8	Missense_Mutation	SNP	ENST00000257408.4	37	CCDS3451.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914619	0.33815	.	.	ENSG00000134962	ENST00000257408	T	0.31769	1.48	5.68	3.69	0.42338	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.138816	0.49305	D	0.000151	T	0.09642	0.0237	N	0.02315	-0.6	0.26490	N	0.974953	B;B	0.11235	0.004;0.004	B;B	0.08055	0.003;0.003	T	0.13818	-1.0495	10	0.25106	T	0.35	-18.3494	2.9688	0.05916	0.0:0.4901:0.2795:0.2304	.	596;605	B7ZL50;Q86Z14	.;KLOTB_HUMAN	L	605	ENSP00000257408:S605L	ENSP00000257408:S605L	S	+	2	0	KLB	39124555	0.941000	0.31946	0.956000	0.39512	0.957000	0.61999	3.160000	0.50739	2.683000	0.91414	0.484000	0.47621	TCG	.		0.542	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
KRT73	319101	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	53004991	53004991	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr12:53004991C>A	ENST00000305748.3	-	6	1141	c.1107G>T	c.(1105-1107)aaG>aaT	p.K369N	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	369	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCTTCACCTGCTTCTTCACAC	0.547																																					p.K369N		.											.	KRT73	157	0			c.G1107T						.						139.0	121.0	127.0					12																	53004991		2203	4300	6503	SO:0001583	missense	319101	exon6			CACCTGCTTCTTC	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.1107G>T	12.37:g.53004991C>A	ENSP00000307014:p.Lys369Asn	Somatic	127.0	1.0		WXS	Illumina HiSeq	Phase_I	163.0	13.0	NM_175068	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	37	CCDS8834.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536879	0.65085	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	T;D	0.89552	-0.96;-2.53	5.61	4.72	0.59763	Filament (1);	0.000000	0.56097	D	0.000035	D	0.90487	0.7020	L	0.41236	1.265	0.37016	D	0.89598	D	0.71674	0.998	D	0.74674	0.984	D	0.90744	0.4652	10	0.36615	T	0.2	.	11.1401	0.48398	0.0:0.8061:0.0:0.1939	.	369	Q86Y46	K2C73_HUMAN	N	369;114	ENSP00000307014:K369N;ENSP00000449081:K114N	ENSP00000307014:K369N	K	-	3	2	KRT73	51291258	0.284000	0.24287	1.000000	0.80357	0.914000	0.54420	-0.369000	0.07533	1.524000	0.49035	0.555000	0.69702	AAG	.		0.547	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
KRTAP5-2	440021	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1619335	1619335	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr11:1619335C>T	ENST00000412090.1	-	1	189	c.146G>A	c.(145-147)tGt>tAt	p.C49Y	KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	49						keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACATCCCCCACAGCTGGAGCT	0.677																																					p.C49Y		.											.	KRTAP5-2	44	0			c.G146A						.						45.0	55.0	52.0					11																	1619335		2201	4283	6484	SO:0001583	missense	440021	exon1			CCCCCACAGCTGG	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.146G>A	11.37:g.1619335C>T	ENSP00000400041:p.Cys49Tyr	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	17.0	NM_001004325	A9JTZ1	Missense_Mutation	SNP	ENST00000412090.1	37	CCDS31331.1	.	.	.	.	.	.	.	.	.	.	c	11.31	1.600950	0.28534	.	.	ENSG00000205867	ENST00000412090	T	0.00958	5.5	2.77	0.0567	0.14320	.	.	.	.	.	T	0.02012	0.0063	M	0.88775	2.98	0.09310	N	1	B	0.15141	0.012	B	0.14578	0.011	T	0.30794	-0.9966	9	0.35671	T	0.21	.	7.3669	0.26779	0.0:0.7692:0.0:0.2308	.	49	Q701N4	KRA52_HUMAN	Y	49	ENSP00000400041:C49Y	ENSP00000400041:C49Y	C	-	2	0	KRTAP5-2	1575911	0.975000	0.34042	0.015000	0.15790	0.501000	0.33797	1.170000	0.31883	-0.053000	0.13289	0.388000	0.25769	TGT	.		0.677	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
LBX1	10660	broad.mit.edu;mdanderson.org	37	10	102988554	102988554	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr10:102988554C>A	ENST00000370193.2	-	1	997	c.19G>T	c.(19-21)Ggc>Tgc	p.G7C	LBX1-AS1_ENST00000547077.1_RNA|LBX1-AS1_ENST00000546988.1_RNA	NM_006562.4	NP_006553.2	P52954	LBX1_HUMAN	ladybird homeobox 1	7					anatomical structure morphogenesis (GO:0009653)|heart looping (GO:0001947)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neuron fate determination (GO:0048664)|regulation of transcription from RNA polymerase II promoter involved in spinal cord association neuron specification (GO:0021920)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(4)|ovary(1)	7		Colorectal(252;0.234)		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)		GCCGCCTTGCCGTCCTCCTTG	0.756																																					p.G7C		.											.	LBX1	90	0			c.G19T						.						16.0	18.0	17.0					10																	102988554		2199	4292	6491	SO:0001583	missense	10660	exon1			CCTTGCCGTCCTC	X90828	CCDS31270.1	10q24.32	2011-06-20	2007-02-15		ENSG00000138136	ENSG00000138136		"""Homeoboxes / ANTP class : NKL subclass"""	16960	protein-coding gene	gene with protein product		604255	"""ladybird homeobox homolog 1 (Drosophila)"""			8645601	Standard	XM_005269443		Approved	LBX1H, HPX6	uc001ksx.3	P52954	OTTHUMG00000018927	ENST00000370193.2:c.19G>T	10.37:g.102988554C>A	ENSP00000359212:p.Gly7Cys	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	5.0	NM_006562	B9EGA2|Q05BB2	Missense_Mutation	SNP	ENST00000370193.2	37	CCDS31270.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124058	0.56613	.	.	ENSG00000138136	ENST00000370193	D	0.94046	-3.34	4.21	2.31	0.28768	.	0.132906	0.50627	D	0.000101	D	0.88377	0.6420	N	0.22421	0.69	0.41309	D	0.987096	P	0.51653	0.947	P	0.48654	0.585	D	0.84951	0.0871	10	0.49607	T	0.09	.	7.0469	0.25050	0.0:0.7741:0.0:0.2259	.	7	P52954	LBX1_HUMAN	C	7	ENSP00000359212:G7C	ENSP00000359212:G7C	G	-	1	0	LBX1	102978544	0.929000	0.31497	0.999000	0.59377	0.856000	0.48823	0.998000	0.29744	0.414000	0.25790	0.561000	0.74099	GGC	.		0.756	LBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049928.3	NM_006562	
LYPD3	27076	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	43968547	43968547	+	Silent	SNP	G	G	A	rs368122649		TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr19:43968547G>A	ENST00000244333.3	-	2	229	c.141C>T	c.(139-141)aaC>aaT	p.N47N		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	47	UPAR/Ly6 1.				cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				TCTTCATCTTGTTCGGGGAGC	0.672																																					p.N47N		.											.	LYPD3	91	0			c.C141T						.	G		0,4406		0,0,2203	64.0	51.0	55.0		141	-8.2	0.8	19		55	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LYPD3	NM_014400.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		47/347	43968547	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	27076	exon2			CATCTTGTTCGGG	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.141C>T	19.37:g.43968547G>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	12.0	NM_014400	Q9UJ74	Silent	SNP	ENST00000244333.3	37	CCDS12620.1																																																																																			.		0.672	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
MACC1	346389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20201371	20201371	+	Splice_Site	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr7:20201371C>T	ENST00000400331.5	-	4	423	c.115G>A	c.(115-117)Gaa>Aaa	p.E39K	MACC1_ENST00000471019.1_5'Flank|MACC1_ENST00000332878.4_Splice_Site_p.E39K|MACC1_ENST00000589011.1_Splice_Site_p.E39K	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	39					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						ATTCCCATACCTGTAATATTG	0.338																																					p.E39K		.											.	MACC1	93	0			c.G115A						.						111.0	111.0	111.0					7																	20201371		2201	4298	6499	SO:0001630	splice_region_variant	346389	exon4			CCATACCTGTAAT		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.115+1G>A	7.37:g.20201371C>T		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	7.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733500	0.30684	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.09630	2.96;2.96	5.51	5.51	0.81932	.	0.427052	0.22900	N	0.054274	T	0.11665	0.0284	L	0.36672	1.1	0.36053	D	0.840926	B	0.23058	0.079	B	0.24269	0.052	T	0.18461	-1.0336	9	.	.	.	.	18.5358	0.91010	0.0:1.0:0.0:0.0	.	39	Q6ZN28	MACC1_HUMAN	K	39	ENSP00000383185:E39K;ENSP00000328410:E39K	.	E	-	1	0	MACC1	20167896	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	4.563000	0.60823	2.750000	0.94351	0.655000	0.94253	GAA	.		0.338	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	Missense_Mutation
MSH3	4437	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	80063794	80063794	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr5:80063794C>G	ENST00000265081.6	+	14	2019	c.1939C>G	c.(1939-1941)Cac>Gac	p.H647D		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	647					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		AACTTTATATCACCTAAAGTC	0.323								Mismatch excision repair (MMR)																													p.H647D	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3	661	0			c.C1939G						.						67.0	69.0	68.0					5																	80063794		2203	4299	6502	SO:0001583	missense	4437	exon14			TTATATCACCTAA	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.1939C>G	5.37:g.80063794C>G	ENSP00000265081:p.His647Asp	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	9.0	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	C	8.922	0.961380	0.18583	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.90261	-2.64	5.66	3.89	0.44902	DNA mismatch repair protein MutS, core (3);	0.342267	0.40144	N	0.001177	T	0.82167	0.4978	N	0.14661	0.345	0.09310	N	1	P	0.39920	0.695	B	0.43331	0.416	T	0.71941	-0.4440	9	.	.	.	-1.8806	7.0908	0.25283	0.1389:0.7176:0.0:0.1436	.	647	P20585	MSH3_HUMAN	D	647;638	ENSP00000265081:H647D	.	H	+	1	0	MSH3	80099550	1.000000	0.71417	0.211000	0.23655	0.692000	0.40212	2.413000	0.44618	0.864000	0.35578	0.609000	0.83330	CAC	.		0.323	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
NDUFV3	4731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	44324091	44324091	+	Intron	SNP	A	A	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr21:44324091A>G	ENST00000340344.4	+	3	235				NDUFV3_ENST00000460259.1_3'UTR|NDUFV3_ENST00000354250.2_Silent_p.Q323Q	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		GGCAGCTGCAAGCCAGTCCTC	0.647																																					p.Q323Q		.											.	NDUFV3	92	0			c.A969G						.						32.0	39.0	37.0					21																	44324091		2199	4300	6499	SO:0001627	intron_variant	4731	exon3			GCTGCAAGCCAGT		CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.170-4883A>G	21.37:g.44324091A>G		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	6.0	NM_021075	A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Silent	SNP	ENST00000340344.4	37	CCDS33573.1																																																																																			.		0.647	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195448.2		
NLRP8	126205	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	56499259	56499259	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr19:56499259C>G	ENST00000291971.3	+	10	3198	c.3127C>G	c.(3127-3129)Cta>Gta	p.L1043V	NLRP8_ENST00000590542.1_Missense_Mutation_p.L1024V	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	1043					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AAGTGACTGCCTATCCCAGAT	0.507																																					p.L1043V		.											.	NLRP8	361	0			c.C3127G						.						117.0	98.0	104.0					19																	56499259		2203	4300	6503	SO:0001583	missense	126205	exon10			GACTGCCTATCCC	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.3127C>G	19.37:g.56499259C>G	ENSP00000291971:p.Leu1043Val	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	6.0	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	C	6.093	0.385410	0.11524	.	.	ENSG00000179709	ENST00000291971	T	0.75154	-0.91	1.44	0.356	0.16074	.	.	.	.	.	T	0.65923	0.2738	N	0.08118	0	0.09310	N	1	D;P	0.71674	0.998;0.461	D;B	0.73708	0.981;0.116	T	0.54403	-0.8299	9	0.33940	T	0.23	.	3.8138	0.08808	0.0:0.7566:0.0:0.2434	.	1024;1043	Q86W28-2;Q86W28	.;NALP8_HUMAN	V	1043	ENSP00000291971:L1043V	ENSP00000291971:L1043V	L	+	1	2	NLRP8	61191071	0.007000	0.16637	0.026000	0.17262	0.102000	0.19082	0.299000	0.19138	0.183000	0.20059	0.386000	0.25728	CTA	.		0.507	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
OR2V2	285659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	180582509	180582509	+	Silent	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr5:180582509C>T	ENST00000328275.1	+	1	567	c.567C>T	c.(565-567)gcC>gcT	p.A189A		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGAAGCTGGCCTGTGTAGACA	0.463																																					p.A189A		.											.	OR2V2	69	0			c.C567T						.						343.0	331.0	335.0					5																	180582509		2203	4300	6503	SO:0001819	synonymous_variant	285659	exon1			GCTGGCCTGTGTA	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.567C>T	5.37:g.180582509C>T		Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	249.0	20.0	NM_206880	Q6IFL6|Q8NGV1	Silent	SNP	ENST00000328275.1	37	CCDS4461.1																																																																																			.		0.463	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253529.1		
P2RY4	5030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	69479048	69479048	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chrX:69479048C>A	ENST00000374519.2	-	1	606	c.427G>T	c.(427-429)Gca>Tca	p.A143S		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	143					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						CAGCGTAGTGCCCGAAGTGGG	0.597																																					p.A143S		.											.	P2RY4	540	0			c.G427T						.						52.0	48.0	49.0					X																	69479048		2203	4300	6503	SO:0001583	missense	5030	exon1			GTAGTGCCCGAAG	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.427G>T	X.37:g.69479048C>A	ENSP00000363643:p.Ala143Ser	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	13.0	NM_002565	Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	ENST00000374519.2	37	CCDS14398.1	.	.	.	.	.	.	.	.	.	.	C	0.553	-0.848501	0.02651	.	.	ENSG00000186912	ENST00000374519	T	0.36699	1.24	4.2	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.300514	0.31747	U	0.007130	T	0.09949	0.0244	N	0.00991	-1.07	0.39697	D	0.971137	B	0.02656	0.0	B	0.09377	0.004	T	0.26189	-1.0110	10	0.02654	T	1	.	8.8321	0.35091	0.4384:0.5616:0.0:0.0	.	143	P51582	P2RY4_HUMAN	S	143	ENSP00000363643:A143S	ENSP00000363643:A143S	A	-	1	0	P2RY4	69395773	0.948000	0.32251	0.342000	0.25602	0.862000	0.49288	2.415000	0.44635	0.877000	0.35895	0.517000	0.50305	GCA	.		0.597	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057058.2	NM_002565	
PAQR4	124222	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	3021213	3021213	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr16:3021213G>T	ENST00000318782.8	+	2	652	c.222G>T	c.(220-222)caG>caT	p.Q74H	PAQR4_ENST00000574988.1_Missense_Mutation_p.Q7H|PKMYT1_ENST00000431515.2_Intron|PKMYT1_ENST00000571102.1_5'Flank|PAQR4_ENST00000293978.8_Intron|PAQR4_ENST00000576565.1_Missense_Mutation_p.Q7H|PAQR4_ENST00000572687.1_Intron	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	74						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						CCTGGGGTCAGCTGGGCAAGG	0.612																																					p.Q74H		.											.	PAQR4	68	0			c.G222T						.						50.0	50.0	50.0					16																	3021213		2198	4300	6498	SO:0001583	missense	124222	exon2			GGGTCAGCTGGGC		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.222G>T	16.37:g.3021213G>T	ENSP00000321804:p.Gln74His	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	8.0	NM_152341	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Missense_Mutation	SNP	ENST00000318782.8	37	CCDS10485.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251369	0.39797	.	.	ENSG00000162073	ENST00000318782	T	0.29917	1.55	4.73	3.77	0.43336	.	0.062767	0.64402	D	0.000004	T	0.38825	0.1055	L	0.58101	1.795	0.52501	D	0.999955	D	0.55385	0.971	P	0.52267	0.694	T	0.12016	-1.0564	10	0.38643	T	0.18	-16.781	10.7839	0.46395	0.095:0.0:0.905:0.0	.	74	Q8N4S7	PAQR4_HUMAN	H	74	ENSP00000321804:Q74H	ENSP00000321804:Q74H	Q	+	3	2	PAQR4	2961214	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.467000	0.53078	0.978000	0.38470	0.462000	0.41574	CAG	.		0.612	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1	NM_152341	
PARD3	56288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	34671814	34671814	+	Silent	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr10:34671814G>A	ENST00000374789.3	-	9	1378	c.1053C>T	c.(1051-1053)ccC>ccT	p.P351P	PARD3_ENST00000374790.3_Silent_p.P307P|PARD3_ENST00000545260.1_Silent_p.P307P|PARD3_ENST00000544292.1_Silent_p.P81P|PARD3_ENST00000545693.1_Silent_p.P351P|PARD3_ENST00000350537.4_Silent_p.P351P|PARD3_ENST00000374788.3_Silent_p.P351P|PARD3_ENST00000374776.1_Silent_p.P351P|PARD3_ENST00000374794.3_Silent_p.P307P|PARD3_ENST00000340077.5_Silent_p.P351P|PARD3_ENST00000346874.4_Silent_p.P351P|PARD3_ENST00000374773.1_Silent_p.P351P	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	351	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				ACCAAATGATGGGTGTACGCA	0.403																																					p.P351P		.											.	PARD3	92	0			c.C1053T						.						150.0	139.0	142.0					10																	34671814		2203	4300	6503	SO:0001819	synonymous_variant	56288	exon9			AATGATGGGTGTA	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1053C>T	10.37:g.34671814G>A		Somatic	229.0	0.0		WXS	Illumina HiSeq	Phase_I	249.0	16.0	NM_001184788	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Silent	SNP	ENST00000374789.3	37	CCDS7178.1																																																																																			.		0.403	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	55719518	55719518	+	Silent	SNP	G	G	A	rs370200250		TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr10:55719518G>A	ENST00000320301.6	-	23	3490	c.3096C>T	c.(3094-3096)atC>atT	p.I1032I	PCDH15_ENST00000361849.3_Silent_p.I1032I|PCDH15_ENST00000395432.2_Silent_p.I995I|PCDH15_ENST00000395433.1_Silent_p.I1010I|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395430.1_Silent_p.I1032I|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000409834.1_Silent_p.I643I|PCDH15_ENST00000395438.1_Silent_p.I1032I|PCDH15_ENST00000414778.1_Silent_p.I1037I|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Silent_p.I1039I|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Silent_p.I961I|PCDH15_ENST00000395445.1_Silent_p.I1039I	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1032	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGAAGCGTGGGATCTCACCAG	0.413										HNSCC(58;0.16)																											p.I1037I		.											.	PCDH15	193	0			c.C3111T						.						82.0	73.0	76.0					10																	55719518		2203	4300	6503	SO:0001819	synonymous_variant	65217	exon24			GCGTGGGATCTCA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3096C>T	10.37:g.55719518G>A		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	8.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																			.		0.413	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
PGD	5226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	10468143	10468143	+	Silent	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:10468143C>T	ENST00000270776.8	+	6	503	c.465C>T	c.(463-465)acC>acT	p.T155T	PGD_ENST00000541529.1_Silent_p.T133T|PGD_ENST00000538557.1_Silent_p.T142T	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	155					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	ACATCAAGACCATCTTCCAAG	0.498																																					p.T155T		.											.	PGD	91	0			c.C465T						.						200.0	197.0	198.0					1																	10468143		2203	4300	6503	SO:0001819	synonymous_variant	5226	exon6			CAAGACCATCTTC	BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.465C>T	1.37:g.10468143C>T		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	10.0	NM_002631	A8K2Y9|B4DQJ8|Q9BWD8	Silent	SNP	ENST00000270776.8	37	CCDS113.1																																																																																			.		0.498	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005398.1	NM_002631	
PGGT1B	5229	broad.mit.edu;bcgsc.ca	37	5	114572220	114572220	+	Splice_Site	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr5:114572220C>A	ENST00000419445.1	-	5	500		c.e5-1		PGGT1B_ENST00000379615.3_Splice_Site	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit						negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		TGCACAAAAACTGAAAATAAT	0.373																																					.		.											.	PGGT1B	90	0			c.480-1G>T						.						68.0	63.0	65.0					5																	114572220		2202	4300	6502	SO:0001630	splice_region_variant	5229	exon6			CAAAAACTGAAAA		CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.480-1G>T	5.37:g.114572220C>A		Somatic	111.0	1.0		WXS	Illumina HiSeq	Phase_I	145.0	9.0	NM_005023	Q5MJP9	Splice_Site	SNP	ENST00000419445.1	37	CCDS4116.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284815	0.80803	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8934	0.92414	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PGGT1B	114600119	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	7.759000	0.85235	2.457000	0.83068	0.591000	0.81541	.	.		0.373	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250855.2	NM_005023	Intron
PRPF8	10594	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	1554786	1554786	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr17:1554786T>C	ENST00000572621.1	-	40	6837	c.6572A>G	c.(6571-6573)cAg>cGg	p.Q2191R	PRPF8_ENST00000575116.1_5'Flank|RILP_ENST00000301336.6_5'Flank|PRPF8_ENST00000304992.6_Missense_Mutation_p.Q2191R			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	2191	MPN.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GGTGACATCCTGGGGTGATAA	0.537																																					p.Q2191R		.											.	PRPF8	525	0			c.A6572G						.						121.0	109.0	113.0					17																	1554786		2203	4300	6503	SO:0001583	missense	10594	exon41			ACATCCTGGGGTG	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.6572A>G	17.37:g.1554786T>C	ENSP00000460348:p.Gln2191Arg	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	7.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	37	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	T	12.54	1.969587	0.34754	.	.	ENSG00000174231	ENST00000304992	T	0.54675	0.56	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.64057	0.2564	M	0.82630	2.6	0.80722	D	1	B	0.32893	0.389	B	0.43274	0.414	T	0.61931	-0.6961	10	0.19147	T	0.46	.	15.7744	0.78198	0.0:0.0:0.0:1.0	.	2191	Q6P2Q9	PRP8_HUMAN	R	2191	ENSP00000304350:Q2191R	ENSP00000304350:Q2191R	Q	-	2	0	PRPF8	1501536	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.779000	0.85648	2.122000	0.65172	0.533000	0.62120	CAG	.		0.537	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
RNF20	56254	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	104303192	104303192	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr9:104303192T>C	ENST00000389120.3	+	5	653	c.563T>C	c.(562-564)aTt>aCt	p.I188T		NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	188					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GTGTCCCAGATTGTGACTGTT	0.522																																					p.I188T		.											.	RNF20	231	0			c.T563C						.						77.0	82.0	80.0					9																	104303192		2203	4300	6503	SO:0001583	missense	56254	exon5			CCCAGATTGTGAC	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.563T>C	9.37:g.104303192T>C	ENSP00000373772:p.Ile188Thr	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	7.0	NM_019592	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	37	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.450996	0.26074	.	.	ENSG00000155827	ENST00000389120	T	0.77750	-1.12	4.69	4.69	0.59074	.	0.114258	0.64402	D	0.000016	T	0.66963	0.2843	L	0.38175	1.15	0.48087	D	0.999589	P	0.34662	0.462	B	0.27887	0.084	T	0.68918	-0.5282	10	0.45353	T	0.12	-9.6461	14.0986	0.65039	0.0:0.0:0.0:1.0	.	188	Q5VTR2	BRE1A_HUMAN	T	188	ENSP00000373772:I188T	ENSP00000373772:I188T	I	+	2	0	RNF20	103343013	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	5.286000	0.65639	1.887000	0.54652	0.374000	0.22700	ATT	.		0.522	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
RUNX1T1	862	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	93026974	93026974	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr8:93026974G>A	ENST00000523629.1	-	4	755	c.301C>T	c.(301-303)Cct>Tct	p.P101S	RUNX1T1_ENST00000436581.2_Missense_Mutation_p.P112S|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.P64S|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.P64S|RUNX1T1_ENST00000522163.1_5'Flank|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.P64S|RUNX1T1_ENST00000521553.1_Missense_Mutation_p.P64S|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.P74S|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.P74S|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.P101S	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	101					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GAAGAGGAAGGCCCATTGCTG	0.537																																					p.P160S		.											.	RUNX1T1	1196	0			c.C478T						.						59.0	61.0	60.0					8																	93026974		2203	4300	6503	SO:0001583	missense	862	exon4			AGGAAGGCCCATT	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.301C>T	8.37:g.93026974G>A	ENSP00000428543:p.Pro101Ser	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	7.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735715	0.89482	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992;ENST00000521054;ENST00000519847;ENST00000517792;ENST00000522467;ENST00000517919;ENST00000521733;ENST00000520556;ENST00000521319;ENST00000520583;ENST00000523168;ENST00000518823	T;T;T;T;T;T;T;T;T;T;T	0.55234	1.14;1.08;1.14;1.02;1.02;1.02;0.81;1.08;0.54;0.53;1.18	6.05	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.68622	0.3021	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.999	T	0.68213	-0.5468	10	0.39692	T	0.17	-11.3328	15.6276	0.76874	0.0658:0.0:0.9342:0.0	.	112;112;74;101;74	E7EPN4;B7Z4P4;B2R6I9;Q06455;Q06455-2	.;.;.;MTG8_HUMAN;.	S	101;74;101;64;64;64;112;74;64;101;64;101;64;101;101;74;64;64;101;101;74	ENSP00000428543:P101S;ENSP00000379520:P74S;ENSP00000265814:P101S;ENSP00000353504:P64S;ENSP00000390137:P64S;ENSP00000428742:P64S;ENSP00000402257:P112S;ENSP00000430728:P74S;ENSP00000429728:P64S;ENSP00000431094:P101S;ENSP00000427763:P64S	ENSP00000265814:P101S	P	-	1	0	RUNX1T1	93096150	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.823000	0.99369	1.576000	0.49790	0.650000	0.86243	CCT	.		0.537	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
SCRIB	23513	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144891130	144891130	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr8:144891130C>A	ENST00000320476.3	-	15	1770	c.1764G>T	c.(1762-1764)caG>caT	p.Q588H	SCRIB_ENST00000377533.3_Missense_Mutation_p.Q507H|SCRIB_ENST00000356994.2_Missense_Mutation_p.Q588H	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	588	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GGGCCTCAGGCTGCCCCTCCT	0.647																																					p.Q588H	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB	228	0			c.G1764T						.						58.0	59.0	59.0					8																	144891130		2203	4300	6503	SO:0001583	missense	23513	exon15			CTCAGGCTGCCCC	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1764G>T	8.37:g.144891130C>A	ENSP00000322938:p.Gln588His	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	5.0	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	c	9.457	1.092161	0.20471	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.36157	1.48;1.46;1.27	4.79	0.634	0.17718	.	.	.	.	.	T	0.37652	0.1011	L	0.56769	1.78	0.19300	N	0.99998	P;P	0.51240	0.943;0.928	P;P	0.50440	0.547;0.641	T	0.19549	-1.0302	9	0.45353	T	0.12	.	3.4687	0.07559	0.1626:0.4286:0.3163:0.0925	.	588;588	Q14160;Q14160-3	SCRIB_HUMAN;.	H	588;588;507	ENSP00000349486:Q588H;ENSP00000322938:Q588H;ENSP00000366756:Q507H	ENSP00000322938:Q588H	Q	-	3	2	SCRIB	144963118	0.136000	0.22515	0.087000	0.20705	0.065000	0.16274	-0.133000	0.10451	-0.189000	0.10482	-0.494000	0.04653	CAG	.		0.647	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
SEC22C	9117	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	42610528	42610528	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr3:42610528A>C	ENST00000264454.3	-	2	154	c.11T>G	c.(10-12)aTc>aGc	p.I4S	SEC22C_ENST00000417572.1_Missense_Mutation_p.I4S|SEC22C_ENST00000273156.7_Missense_Mutation_p.I4S|SEC22C_ENST00000423701.2_Missense_Mutation_p.I4S|SEC22C_ENST00000536332.1_5'UTR|SEC22C_ENST00000493107.1_5'UTR			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	4					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		GGCAAAAAAGATCACGGACAT	0.507																																					p.I4S		.											.	SEC22C	90	0			c.T11G						.						69.0	61.0	63.0					3																	42610528		2203	4300	6503	SO:0001583	missense	9117	exon2			AAAAAGATCACGG	AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.11T>G	3.37:g.42610528A>C	ENSP00000264454:p.Ile4Ser	Somatic	250.0	0.0		WXS	Illumina HiSeq	Phase_I	304.0	21.0	NM_001201584	O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	ENST00000264454.3	37	CCDS2700.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.578789	0.86645	.	.	ENSG00000093183	ENST00000423701;ENST00000273156;ENST00000417572;ENST00000264454;ENST00000456515;ENST00000450981;ENST00000416880;ENST00000420163	T;T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.41	5.41	0.78517	Longin (1);Longin-like (1);	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	L	0.48362	1.52	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.998;0.997;0.999	T	0.51325	-0.8720	10	0.87932	D	0	-5.9336	15.4347	0.75137	1.0:0.0:0.0:0.0	.	4;4;4	Q9BRL7-3;Q9BRL7;Q9BRL7-2	.;SC22C_HUMAN;.	S	4	ENSP00000414576:I4S;ENSP00000273156:I4S;ENSP00000407564:I4S;ENSP00000264454:I4S;ENSP00000391170:I4S;ENSP00000397170:I4S;ENSP00000391957:I4S;ENSP00000408242:I4S	ENSP00000264454:I4S	I	-	2	0	SEC22C	42585532	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.671000	0.91174	2.040000	0.60383	0.533000	0.62120	ATC	.		0.507	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254734.1	NM_004206	
SH3PXD2A	9644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	105362908	105362908	+	Silent	SNP	G	G	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr10:105362908G>T	ENST00000369774.4	-	15	2343	c.2067C>A	c.(2065-2067)tcC>tcA	p.S689S	SH3PXD2A_ENST00000538130.1_Silent_p.S524S|SH3PXD2A_ENST00000540321.1_Silent_p.S556S|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000355946.2_Silent_p.S661S|SH3PXD2A_ENST00000315994.6_5'UTR			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	689	Ser-rich.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		ATGAGGAAAAGGAGGCTGAGG	0.547																																					p.S661S		.											.	SH3PXD2A	226	0			c.C1983A						.						118.0	135.0	129.0					10																	105362908		2203	4300	6503	SO:0001819	synonymous_variant	9644	exon14			GGAAAAGGAGGCT	AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2067C>A	10.37:g.105362908G>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	6.0	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Silent	SNP	ENST00000369774.4	37		.	.	.	.	.	.	.	.	.	.	G	4.225	0.040538	0.08196	.	.	ENSG00000107957	ENST00000420222	.	.	.	5.42	3.22	0.36961	.	.	.	.	.	T	0.60248	0.2254	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57860	-0.7738	4	.	.	.	-31.4903	10.6452	0.45615	0.1865:0.0:0.8135:0.0	.	.	.	.	I	616	.	.	L	-	1	0	SH3PXD2A	105352898	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	2.843000	0.48238	1.291000	0.44653	0.561000	0.74099	CTT	.		0.547	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
SH3TC2	79628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	148407630	148407630	+	Silent	SNP	G	G	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr5:148407630G>T	ENST00000515425.1	-	11	1766	c.1665C>A	c.(1663-1665)atC>atA	p.I555I	SH3TC2_ENST00000512049.1_Silent_p.I548I|SH3TC2_ENST00000538184.1_Silent_p.I102I|SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000394358.2_Silent_p.I440I	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	555					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGAATGTGGATGGCCTCCT	0.542																																					p.I555I		.											.	SH3TC2	92	0			c.C1665A						.						110.0	105.0	106.0					5																	148407630		2203	4300	6503	SO:0001819	synonymous_variant	79628	exon11			AATGTGGATGGCC	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1665C>A	5.37:g.148407630G>T		Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	262.0	17.0	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Silent	SNP	ENST00000515425.1	37	CCDS4293.1																																																																																			.		0.542	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
SLAMF1	6504	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	160589594	160589594	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:160589594G>A	ENST00000302035.6	-	5	1185	c.836C>T	c.(835-837)aCg>aTg	p.T279M	SLAMF1_ENST00000355199.3_Missense_Mutation_p.T279M|SLAMF1_ENST00000538290.1_Intron|SLAMF1_ENST00000235739.5_Missense_Mutation_p.T249M	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	279					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.T279K(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GGCATAGATCGTAAGGCTTTT	0.438																																					p.T279M		.											.	SLAMF1	154	1	Substitution - Missense(1)	endometrium(1)	c.C836T						.						265.0	264.0	264.0					1																	160589594		2203	4300	6503	SO:0001583	missense	6504	exon5			TAGATCGTAAGGC	U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.836C>T	1.37:g.160589594G>A	ENSP00000306190:p.Thr279Met	Somatic	98.0	1.0		WXS	Illumina HiSeq	Phase_I	103.0	8.0	NM_003037	Q5W172|Q9HBE8	Missense_Mutation	SNP	ENST00000302035.6	37	CCDS1207.1	.	.	.	.	.	.	.	.	.	.	G	13.88	2.368198	0.42003	.	.	ENSG00000117090	ENST00000302035;ENST00000235739;ENST00000355199	T;T;T	0.56444	0.46;0.46;0.46	4.19	4.19	0.49359	.	0.194999	0.34200	N	0.004165	T	0.67458	0.2895	M	0.83852	2.665	0.45216	D	0.998226	D	0.89917	1.0	D	0.91635	0.999	T	0.70974	-0.4726	10	0.66056	D	0.02	-17.8434	12.3258	0.55009	0.0:0.0:1.0:0.0	.	279	Q13291	SLAF1_HUMAN	M	279;249;279	ENSP00000306190:T279M;ENSP00000235739:T249M;ENSP00000347333:T279M	ENSP00000235739:T249M	T	-	2	0	SLAMF1	158856218	1.000000	0.71417	0.935000	0.37517	0.225000	0.24961	3.802000	0.55553	2.632000	0.89209	0.563000	0.77884	ACG	.		0.438	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060454.1		
SPATA7	55812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	88904449	88904449	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr14:88904449A>G	ENST00000393545.4	+	12	1772	c.1483A>G	c.(1483-1485)Att>Gtt	p.I495V	SPATA7_ENST00000356583.5_Missense_Mutation_p.I463V|SPATA7_ENST00000556553.1_Missense_Mutation_p.I463V|SPATA7_ENST00000045347.7_Intron	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	495					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						TTTCATGCCTATTTATAAATC	0.358																																					p.I495V		.											.	SPATA7	91	0			c.A1483G						.						56.0	56.0	56.0					14																	88904449		2203	4300	6503	SO:0001583	missense	55812	exon12			ATGCCTATTTATA	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.1483A>G	14.37:g.88904449A>G	ENSP00000377176:p.Ile495Val	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	11.0	NM_018418	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	37	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.283952	0.00251	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583	T;T;T	0.26223	1.76;1.75;1.76	5.87	-11.7	0.00046	.	1.626990	0.03178	N	0.171715	T	0.10852	0.0265	N	0.16307	0.4	0.09310	N	1	B;B;B	0.11235	0.002;0.004;0.0	B;B;B	0.11329	0.002;0.006;0.001	T	0.19484	-1.0304	10	0.02654	T	1	1.7256	9.5377	0.39233	0.3402:0.299:0.3608:0.0	.	463;463;495	A8K3L6;Q9P0W8-2;Q9P0W8	.;.;SPAT7_HUMAN	V	463;495;463	ENSP00000451128:I463V;ENSP00000377176:I495V;ENSP00000348991:I463V	ENSP00000348991:I463V	I	+	1	0	SPATA7	87974202	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.078000	0.03413	-3.883000	0.00095	-2.357000	0.00240	ATT	.		0.358	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
SRGAP2	23380	broad.mit.edu;bcgsc.ca	37	1	206634640	206634640	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:206634640G>T	ENST00000414007.1	+	19	2671	c.2671G>T	c.(2671-2673)Gct>Tct	p.A891S				O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	1031	Ser-rich.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					TGTCAAGATGGCTGCCCCGGT	0.622																																					.		.											.	.	.	0			.						.						77.0	84.0	82.0					1																	206634640		2046	4192	6238	SO:0001583	missense	23380	.			AAGATGGCTGCCC	AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.2671G>T	1.37:g.206634640G>T	ENSP00000390898:p.Ala891Ser	Somatic	308.0	1.0		WXS	Illumina HiSeq	Phase_I	396.0	35.0	.		Missense_Mutation	SNP	ENST00000414007.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.48|16.48	3.135720|3.135720	0.56828|0.56828	.|.	.|.	ENSG00000163486|ENSG00000163486	ENST00000414007|ENST00000295713	T|.	0.08720|.	3.06|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.237949|.	0.38959|.	N|.	0.001510|.	T|T	0.79969|0.79969	0.4538|0.4538	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.77507|0.77507	-0.2562|-0.2562	6|3	0.54805|.	T|.	0.06|.	.|.	20.1253|20.1253	0.97977|0.97977	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	S|V	891|944	ENSP00000390898:A891S|.	ENSP00000390898:A891S|.	A|G	+|+	1|2	0|0	SRGAP2|SRGAP2	204701263|204701263	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.194000|4.194000	0.58393|0.58393	2.832000|2.832000	0.97577|0.97577	0.655000|0.655000	0.94253|0.94253	GCT|GGC	.		0.622	SRGAP2-201	KNOWN	basic	protein_coding	protein_coding		NM_015326	
STARD7	56910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	96861116	96861116	+	Silent	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr2:96861116C>T	ENST00000337288.5	-	2	845	c.462G>A	c.(460-462)cgG>cgA	p.R154R	STARD7_ENST00000462501.1_5'UTR	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7	154	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.					mitochondrion (GO:0005739)	lipid binding (GO:0008289)			endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						TAATTGGGCGCCGCCACAGCT	0.493																																					p.R154R		.											.	STARD7	68	0			c.G462A						.						107.0	83.0	91.0					2																	96861116		2203	4299	6502	SO:0001819	synonymous_variant	56910	exon2			TGGGCGCCGCCAC	AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.462G>A	2.37:g.96861116C>T		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	13.0	NM_020151	D3DXG9|Q53T44|Q6GU43|Q969M6	Silent	SNP	ENST00000337288.5	37	CCDS2017.2																																																																																			.		0.493	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252848.2		
SYNE3	161176	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	95916270	95916270	+	Missense_Mutation	SNP	C	C	T	rs201231576	byFrequency	TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr14:95916270C>T	ENST00000334258.5	-	7	1461	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K	SYNE3_ENST00000554873.1_Missense_Mutation_p.E240K|SYNE3_ENST00000553340.1_Missense_Mutation_p.E483K|SYNE3_ENST00000557275.1_Missense_Mutation_p.E483K	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	483					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						ACGGTTACCTCGATCTGGGGC	0.662																																					p.E483K		.											.	.	.	0			c.G1447A						.						26.0	26.0	26.0					14																	95916270		2166	4235	6401	SO:0001583	missense	161176	exon7			TTACCTCGATCTG	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1447G>A	14.37:g.95916270C>T	ENSP00000334308:p.Glu483Lys	Somatic	294.0	0.0		WXS	Illumina HiSeq	Phase_I	336.0	22.0	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496696	0.64186	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.17054	3.35;2.3;3.34;2.78	5.17	4.25	0.50352	.	0.000000	0.42682	D	0.000675	T	0.24005	0.0581	M	0.76574	2.34	0.54753	D	0.999987	P;D;P	0.56968	0.898;0.978;0.836	P;P;B	0.44946	0.465;0.465;0.275	T	0.05784	-1.0864	10	0.29301	T	0.29	-28.0853	12.6477	0.56744	0.0:0.8329:0.1671:0.0	.	483;483;483	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	K	483;240;483;483	ENSP00000334308:E483K;ENSP00000452154:E240K;ENSP00000450562:E483K;ENSP00000450774:E483K	ENSP00000334308:E483K	E	-	1	0	C14orf49	94986023	0.995000	0.38212	0.998000	0.56505	0.868000	0.49771	1.651000	0.37302	1.103000	0.41568	0.591000	0.81541	GAG	.		0.662	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
SYT3	84258	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	51129160	51129160	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr19:51129160A>G	ENST00000338916.4	-	5	2029	c.1396T>C	c.(1396-1398)Ttc>Ctc	p.F466L	SYT3_ENST00000593901.1_Missense_Mutation_p.F466L|SYT3_ENST00000544769.1_Missense_Mutation_p.F466L|SYT3_ENST00000600079.1_Missense_Mutation_p.F466L	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	466	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		TCACCTGAGAAGCCAGTGAGG	0.647																																					p.F466L		.											.	SYT3	155	0			c.T1396C						.						53.0	47.0	49.0					19																	51129160		2203	4300	6503	SO:0001583	missense	84258	exon5			CTGAGAAGCCAGT	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1396T>C	19.37:g.51129160A>G	ENSP00000340914:p.Phe466Leu	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	10.0	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.170708	0.38315	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.68624	-0.34;-0.34	4.13	4.13	0.48395	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.171365	0.37053	U	0.002266	T	0.31295	0.0792	N	0.00661	-1.28	0.46298	D	0.998974	B	0.33512	0.415	B	0.35607	0.206	T	0.27640	-1.0068	10	0.13470	T	0.59	.	8.9115	0.35557	0.8117:0.1883:0.0:0.0	.	466	Q9BQG1	SYT3_HUMAN	L	466	ENSP00000340914:F466L;ENSP00000438883:F466L	ENSP00000340914:F466L	F	-	1	0	SYT3	55820972	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.832000	0.48152	1.662000	0.50781	0.454000	0.30748	TTC	.		0.647	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	19499468	19499468	+	Silent	SNP	C	C	T			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:19499468C>T	ENST00000375254.3	-	25	3438	c.3411G>A	c.(3409-3411)gaG>gaA	p.E1137E	UBR4_ENST00000375226.2_Silent_p.E1137E|UBR4_ENST00000375267.2_Silent_p.E1137E|UBR4_ENST00000375217.2_Silent_p.E1137E	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1137					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TAGAAAAATGCTCATCCAAAG	0.483																																					p.E1137E		.											.	UBR4	612	0			c.G3411A						.						87.0	81.0	83.0					1																	19499468		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon25			AAAATGCTCATCC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3411G>A	1.37:g.19499468C>T		Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	12.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																			.		0.483	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
UNC5D	137970	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	35608295	35608295	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr8:35608295T>C	ENST00000404895.2	+	13	2459	c.2131T>C	c.(2131-2133)Tac>Cac	p.Y711H	UNC5D_ENST00000420357.1_Missense_Mutation_p.Y644H|UNC5D_ENST00000453357.2_Missense_Mutation_p.Y706H|UNC5D_ENST00000287272.2_Missense_Mutation_p.Y642H|UNC5D_ENST00000449677.1_Missense_Mutation_p.Y287H|UNC5D_ENST00000416672.1_Missense_Mutation_p.Y716H	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	711	Interaction with DCC. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CTTGAGAGTTTACTGTGTGGA	0.433																																					p.Y711H		.											.	UNC5D	96	0			c.T2131C						.						201.0	174.0	183.0					8																	35608295		2203	4300	6503	SO:0001583	missense	137970	exon13			AGAGTTTACTGTG	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2131T>C	8.37:g.35608295T>C	ENSP00000385143:p.Tyr711His	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	284.0	23.0	NM_080872	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	T	16.38	3.106869	0.56291	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.66815	-0.2;0.2;0.16;-0.2;-0.23;1.69	5.9	5.9	0.94986	.	0.052466	0.85682	D	0.000000	T	0.61578	0.2358	L	0.52364	1.645	0.58432	D	0.999998	P;B;B	0.35050	0.482;0.202;0.128	B;B;B	0.30029	0.11;0.097;0.045	T	0.64833	-0.6314	10	0.62326	D	0.03	-22.5614	16.3317	0.83023	0.0:0.0:0.0:1.0	.	287;706;711	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	H	711;644;642;716;706;287	ENSP00000385143:Y711H;ENSP00000392739:Y644H;ENSP00000287272:Y642H;ENSP00000412652:Y716H;ENSP00000394303:Y706H;ENSP00000397211:Y287H	ENSP00000287272:Y642H	Y	+	1	0	UNC5D	35727837	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.937000	0.70162	2.264000	0.75181	0.533000	0.62120	TAC	.		0.433	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
WNK4	65266	broad.mit.edu;bcgsc.ca	37	17	40937151	40937151	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr17:40937151C>A	ENST00000246914.5	+	5	1228	c.1207C>A	c.(1207-1209)Ccc>Acc	p.P403T		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	403	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		GGTGAAGATACCCGAGGTGAA	0.607																																					p.P403T	Esophageal Squamous(6;201 374 4964 23855 42828)	.											.	WNK4	336	0			c.C1207A						.						68.0	64.0	66.0					17																	40937151		2203	4300	6503	SO:0001583	missense	65266	exon5			AAGATACCCGAGG	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.1207C>A	17.37:g.40937151C>A	ENSP00000246914:p.Pro403Thr	Somatic	108.0	1.0		WXS	Illumina HiSeq	Phase_I	140.0	7.0	NM_032387	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	37	CCDS11439.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.431186	0.83776	.	.	ENSG00000126562	ENST00000246914;ENST00000316085	T	0.65178	-0.14	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.139758	0.33253	N	0.005101	T	0.79257	0.4415	M	0.76433	2.335	0.52501	D	0.999959	D;D	0.67145	0.996;0.996	D;D	0.70487	0.969;0.969	T	0.82121	-0.0614	10	0.87932	D	0	-15.8745	18.1781	0.89768	0.0:1.0:0.0:0.0	.	403;403	B0LPI0;Q96J92	.;WNK4_HUMAN	T	403;175	ENSP00000246914:P403T	ENSP00000246914:P403T	P	+	1	0	WNK4	38190677	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.811000	0.86092	2.374000	0.81015	0.555000	0.69702	CCC	.		0.607	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1		
YIF1B	90522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38796124	38796124	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr19:38796124G>C	ENST00000339413.6	-	8	858	c.813C>G	c.(811-813)atC>atG	p.I271M	YIF1B_ENST00000591784.1_Missense_Mutation_p.I240M|YIF1B_ENST00000337679.8_3'UTR|YIF1B_ENST00000329420.8_Missense_Mutation_p.I256M|YIF1B_ENST00000392124.3_Missense_Mutation_p.I240M|YIF1B_ENST00000592246.1_Missense_Mutation_p.I205M|YIF1B_ENST00000592694.1_Missense_Mutation_p.I240M	NM_001039672.2|NM_001039673.2	NP_001034761.1|NP_001034762.1	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B (S. cerevisiae)	271						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)	10	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CGTCTGCCAAGATCTTCAGCC	0.642																																					p.I271M		.											.	YIF1B	68	0			c.C813G						.						13.0	16.0	15.0					19																	38796124		2184	4273	6457	SO:0001583	missense	90522	exon8			TGCCAAGATCTTC	AL833382	CCDS12512.1, CCDS33010.1, CCDS46066.1, CCDS46067.1	19q13.2	2008-02-05							30511	protein-coding gene	gene with protein product						12975309	Standard	NM_001039672		Approved	FinGER8	uc002ohz.2	Q5BJH7		ENST00000339413.6:c.813C>G	19.37:g.38796124G>C	ENSP00000343435:p.Ile271Met	Somatic	242.0	0.0		WXS	Illumina HiSeq	Phase_I	281.0	23.0	NM_001039672	H7BXS8|Q5JPC2|Q8WY70|Q96C02|Q96IC4	Missense_Mutation	SNP	ENST00000339413.6	37	CCDS33010.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238318	0.79800	.	.	ENSG00000167645	ENST00000339413;ENST00000329420;ENST00000392124	T;T;T	0.48836	0.8;0.81;0.81	4.96	4.96	0.65561	.	0.067243	0.64402	D	0.000010	T	0.62780	0.2456	M	0.62723	1.935	0.80722	D	1	P;P;P	0.52463	0.773;0.81;0.953	P;P;P	0.59357	0.515;0.647;0.856	T	0.65561	-0.6138	10	0.59425	D	0.04	-9.6626	15.7029	0.77555	0.0:0.0:1.0:0.0	.	240;271;268	Q5BJH7-2;Q5BJH7;Q5BJH7-3	.;YIF1B_HUMAN;.	M	271;256;240	ENSP00000343435:I271M;ENSP00000329559:I256M;ENSP00000375971:I240M	ENSP00000329559:I256M	I	-	3	3	YIF1B	43487964	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	3.311000	0.51919	2.304000	0.77564	0.462000	0.41574	ATC	.		0.642	YIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460511.1	NM_033557	
ZC3H11A	9877	hgsc.bcm.edu;broad.mit.edu	37	1	203797536	203797536	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:203797536T>C	ENST00000545588.1	+	4	4111	c.284T>C	c.(283-285)cTa>cCa	p.L95P	ZC3H11A_ENST00000332127.4_Missense_Mutation_p.L95P|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.L95P|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.L95P|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.L95P	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	95					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGCCTTTTCCTACCTCCGAGC	0.363																																					p.L95P		.											.	ZC3H11A	515	0			c.T284C						.						52.0	48.0	49.0					1																	203797536		2203	4300	6503	SO:0001583	missense	9877	exon7			TTTTCCTACCTCC		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.284T>C	1.37:g.203797536T>C	ENSP00000438527:p.Leu95Pro	Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	214.0	11.0	NM_014827	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	37	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232622	0.79688	.	.	ENSG00000058673	ENST00000453771;ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.02	5.02	0.67125	.	0.251367	0.34411	N	0.003994	T	0.68384	0.2995	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.69150	-0.5221	10	0.45353	T	0.12	-14.2846	14.0227	0.64565	0.0:0.0:0.0:1.0	.	95	O75152	ZC11A_HUMAN	P	95;95;41;95;95;95;95	ENSP00000356183:L95P;ENSP00000356181:L95P;ENSP00000333253:L95P;ENSP00000438527:L95P;ENSP00000356179:L95P	ENSP00000333253:L95P	L	+	2	0	ZC3H11A	202064159	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.629000	0.83207	2.001000	0.58596	0.533000	0.62120	CTA	.		0.363	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827	
ZNF629	23361	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	30794703	30794703	+	Nonsense_Mutation	SNP	T	T	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr16:30794703T>A	ENST00000262525.4	-	3	1153	c.946A>T	c.(946-948)Aag>Tag	p.K316*		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	316					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			CGGTATGGCTTCTCGCCCGCG	0.632																																					p.K316X		.											.	.	.	0			c.A946T						.						65.0	74.0	71.0					16																	30794703		2193	4299	6492	SO:0001587	stop_gained	23361	exon3			ATGGCTTCTCGCC	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.946A>T	16.37:g.30794703T>A	ENSP00000262525:p.Lys316*	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	14.0	NM_001080417	Q15938	Nonsense_Mutation	SNP	ENST00000262525.4	37	CCDS45463.1	.	.	.	.	.	.	.	.	.	.	T	36	5.843208	0.97016	.	.	ENSG00000102870	ENST00000262525	.	.	.	5.59	5.59	0.84812	.	0.000000	0.47455	D	0.000223	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-38.8667	14.74	0.69445	0.0:0.0:0.0:1.0	.	.	.	.	X	316	.	ENSP00000262525:K316X	K	-	1	0	ZNF629	30702204	0.047000	0.20315	1.000000	0.80357	0.997000	0.91878	0.651000	0.24873	2.125000	0.65367	0.459000	0.35465	AAG	.		0.632	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
ZYG11B	79699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	53279323	53279323	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A5RF-01A-11D-A28X-10	TCGA-K7-A5RF-10B-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9ee0fd7-4827-4171-adec-2f21b3075a50	77617e95-e25c-432e-b8f7-1bb14530e30f	g.chr1:53279323G>A	ENST00000294353.6	+	11	1956	c.1811G>A	c.(1810-1812)gGa>gAa	p.G604E	ZYG11B_ENST00000443756.2_Missense_Mutation_p.G534E|ZYG11B_ENST00000545132.1_3'UTR	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	604										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						TTTGCAGCTGGAATTATTGCC	0.408																																					p.G604E		.											.	ZYG11B	94	0			c.G1811A						.						116.0	105.0	109.0					1																	53279323		2203	4300	6503	SO:0001583	missense	79699	exon11			CAGCTGGAATTAT	AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.1811G>A	1.37:g.53279323G>A	ENSP00000294353:p.Gly604Glu	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	14.0	NM_024646	Q8N2X3|Q9H8L8	Missense_Mutation	SNP	ENST00000294353.6	37	CCDS30717.1	.	.	.	.	.	.	.	.	.	.	G	32	5.143609	0.94603	.	.	ENSG00000162378	ENST00000443756;ENST00000294353	T;T	0.49720	0.77;0.77	5.37	5.37	0.77165	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73768	0.3629	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.78409	-0.2215	10	0.87932	D	0	.	19.1012	0.93275	0.0:0.0:1.0:0.0	.	534;604	B4DK95;Q9C0D3	.;ZY11B_HUMAN	E	534;604	ENSP00000400522:G534E;ENSP00000294353:G604E	ENSP00000294353:G604E	G	+	2	0	ZYG11B	53051911	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.116000	0.94341	2.504000	0.84457	0.655000	0.94253	GGA	.		0.408	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024749.1	NM_024646	
