#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAMTS5	11096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	28296456	28296456	+	Silent	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr21:28296456C>T	ENST00000284987.5	-	8	2830	c.2709G>A	c.(2707-2709)caG>caA	p.Q903Q	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	903	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GGTTTCCATCCTGGCACTGCA	0.537																																					p.Q903Q	Esophageal Squamous(53;683 1080 10100 14424 45938)	.											.	ADAMTS5	229	0			c.G2709A						.						94.0	79.0	84.0					21																	28296456		2203	4300	6503	SO:0001819	synonymous_variant	11096	exon8			TCCATCCTGGCAC	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2709G>A	21.37:g.28296456C>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	15.0	NM_007038	Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	37	CCDS13579.1																																																																																			.		0.537	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171648.1		
AEN	64782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	89169543	89169543	+	Nonsense_Mutation	SNP	C	C	T	rs199532354		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr15:89169543C>T	ENST00000332810.3	+	2	254	c.103C>T	c.(103-105)Cga>Tga	p.R35*	AEN_ENST00000379231.3_Nonsense_Mutation_p.R35*	NM_022767.3	NP_073604.3	Q8WTP8	AEN_HUMAN	apoptosis enhancing nuclease	35					intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			NS(1)|kidney(1)|large_intestine(1)|lung(4)	7						GAGAAGGAGCCGACAGCACCA	0.637																																					p.R35X		.											.	AEN	226	0			c.C103T						.						32.0	28.0	29.0					15																	89169543		2200	4299	6499	SO:0001587	stop_gained	64782	exon2			AGGAGCCGACAGC	BC020988	CCDS10344.1	15q26.1	2008-07-15	2008-07-15	2008-07-15	ENSG00000181026	ENSG00000181026			25722	protein-coding gene	gene with protein product		610177	"""interferon stimulated exonuclease gene 20kDa-like 1"""	ISG20L1		18264133, 16171785	Standard	NM_022767		Approved	FLJ12484, FLJ12562	uc002bmt.2	Q8WTP8	OTTHUMG00000148681	ENST00000332810.3:c.103C>T	15.37:g.89169543C>T	ENSP00000331944:p.Arg35*	Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	5.0	NM_022767	C9J571|Q9BSA5|Q9H9X7	Nonsense_Mutation	SNP	ENST00000332810.3	37	CCDS10344.1	.	.	.	.	.	.	.	.	.	.	C	39	7.883288	0.98542	.	.	ENSG00000181026	ENST00000332810;ENST00000379231	.	.	.	5.02	5.02	0.67125	.	1.364360	0.05327	N	0.527595	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	4.6706	17.3342	0.87275	0.0:1.0:0.0:0.0	.	.	.	.	X	35	.	ENSP00000331944:R35X	R	+	1	2	AEN	86970547	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.714000	0.54889	2.315000	0.78130	0.563000	0.77884	CGA	C|0.998;T|0.002		0.637	AEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309071.1	NM_022767	
AFG3L2	10939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	12356735	12356735	+	Silent	SNP	T	T	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr18:12356735T>G	ENST00000269143.3	-	9	1353	c.1122A>C	c.(1120-1122)ggA>ggC	p.G374G		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	374					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	AAAACTCAGATCCACTAACGG	0.542																																					p.G374G		.											.	AFG3L2	90	0			c.A1122C						.						193.0	145.0	162.0					18																	12356735		2203	4300	6503	SO:0001819	synonymous_variant	10939	exon9			CTCAGATCCACTA	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.1122A>C	18.37:g.12356735T>G		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	11.0	NM_006796	Q6P1L0	Silent	SNP	ENST00000269143.3	37	CCDS11859.1																																																																																			.		0.542	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74283386	74283387	+	Splice_Site	DEL	TG	TG	-	rs78527483		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:74283386_74283387delTG	ENST00000503124.1	+	9	1185	c.978delTG	c.(976-978)tat>ta	p.Y326fs	ALB_ENST00000295897.4_Splice_Site_p.Y476fs|ALB_ENST00000505649.1_Intron|ALB_ENST00000401494.3_Splice_Site_p.Y361fs|ALB_ENST00000509063.1_Splice_Site_p.Y476fs|ALB_ENST00000415165.2_Splice_Site_p.Y284fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGAAGACTATGTGAGTCttta	0.332																																					p.476_476del		.											.	ALB	96	0			c.1428_1428del						.																																			SO:0001630	splice_region_variant	213	exon11			AGACTATGTGAGT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.978+1TG>-	4.37:g.74283388_74283389delTG		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	23.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	37																																																																																				.		0.332	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	Frame_Shift_Del
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74285295	74285296	+	Frame_Shift_Ins	INS	-	-	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:74285295_74285296insC	ENST00000503124.1	+	11	1481_1482	c.1274_1275insC	c.(1273-1278)ttcgcafs	p.A426fs	ALB_ENST00000295897.4_Frame_Shift_Ins_p.A576fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Frame_Shift_Ins_p.A461fs|ALB_ENST00000509063.1_Frame_Shift_Ins_p.A576fs|ALB_ENST00000415165.2_Frame_Shift_Ins_p.A384fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATGGATGATTTCGCAGCTTTTG	0.411																																					p.F575fs		.											.	ALB	96	0			c.1724_1725insC						.																																			SO:0001589	frameshift_variant	213	exon13			ATGATTTCGCAGC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1275dupC	4.37:g.74285296_74285296dupC	ENSP00000421027:p.Ala426fs	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	18.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Ins	INS	ENST00000503124.1	37																																																																																				.		0.411	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ARHGAP11B	89839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	30926529	30926529	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr15:30926529A>G	ENST00000428041.2	+	4	599	c.454A>G	c.(454-456)Aag>Gag	p.K152E		NM_001039841.1	NP_001034930.1	Q3KRB8	RHGBB_HUMAN	Rho GTPase activating protein 11B	152	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	8		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CACAGAGGAAAAGAATAAAGC	0.413																																					p.K152E		.											.	ARHGAP11B	22	0			c.A454G						.						133.0	129.0	130.0					15																	30926529		2201	4300	6501	SO:0001583	missense	89839	exon4			GAGGAAAAGAATA	BC105788	CCDS32185.1	15q13.2	2011-07-13				ENSG00000187951		"""Rho GTPase activating proteins"""	15782	protein-coding gene	gene with protein product	"""GAP (1-8)"""		"""family with sequence similarity 7, member B1"""	FAM7B1		11829490	Standard	NM_001039841		Approved	B'-T	uc001zet.1	Q3KRB8		ENST00000428041.2:c.454A>G	15.37:g.30926529A>G	ENSP00000392760:p.Lys152Glu	Somatic	461.0	0.0		WXS	Illumina HiSeq	Phase_I	431.0	113.0	NM_001039841		Missense_Mutation	SNP	ENST00000428041.2	37	CCDS32185.1	.	.	.	.	.	.	.	.	.	.	.	8.092	0.774720	0.16051	.	.	ENSG00000187951	ENST00000428041	T	0.19250	2.16	1.53	1.53	0.23141	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.350015	0.10494	U	0.668138	T	0.24236	0.0587	L	0.53671	1.685	0.22034	N	0.999408	B	0.29212	0.237	B	0.39152	0.292	T	0.34153	-0.9840	10	0.39692	T	0.17	.	7.1208	0.25444	1.0:0.0:0.0:0.0	.	152	Q3KRB8	RHGBB_HUMAN	E	152	ENSP00000392760:K152E	ENSP00000392760:K152E	K	+	1	0	ARHGAP11B	28713821	1.000000	0.71417	0.951000	0.38953	0.463000	0.32649	4.023000	0.57211	0.949000	0.37715	0.136000	0.15936	AAG	.		0.413	ARHGAP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430729.1	NM_001039841	
ASXL2	55252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	25965885	25965885	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:25965885C>A	ENST00000435504.4	-	13	3614	c.3321G>T	c.(3319-3321)atG>atT	p.M1107I	ASXL2_ENST00000336112.4_Missense_Mutation_p.M1079I|ASXL2_ENST00000272341.4_Missense_Mutation_p.M590I|ASXL2_ENST00000404843.1_Missense_Mutation_p.M590I			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	1107					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAAACCCAGCATGAACCTCT	0.522																																					p.M1107I		.											.	ASXL2	23	0			c.G3321T						.						145.0	144.0	144.0					2																	25965885		1985	4165	6150	SO:0001583	missense	55252	exon12			ACCCAGCATGAAC			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.3321G>T	2.37:g.25965885C>A	ENSP00000391447:p.Met1107Ile	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	13.0	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	C	17.10	3.303628	0.60305	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.18174	2.24;2.24;2.23;2.23	6.07	6.07	0.98685	.	0.124467	0.64402	D	0.000001	T	0.40670	0.1126	M	0.69823	2.125	0.23724	N	0.997014	P;P	0.50528	0.77;0.936	B;P	0.61201	0.366;0.885	T	0.16748	-1.0392	10	0.31617	T	0.26	-17.8188	19.2077	0.93739	0.0:1.0:0.0:0.0	.	590;1107	Q76L83-2;Q76L83	.;ASXL2_HUMAN	I	1107;1079;590;590	ENSP00000391447:M1107I;ENSP00000337250:M1079I;ENSP00000383920:M590I;ENSP00000272341:M590I	ENSP00000272341:M590I	M	-	3	0	ASXL2	25819389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.451000	0.44952	2.884000	0.98904	0.655000	0.94253	ATG	.		0.522	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
BMPR1B	658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	96052422	96052422	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:96052422A>G	ENST00000515059.1	+	10	1118	c.835A>G	c.(835-837)Aca>Gca	p.T279A	BMPR1B_ENST00000264568.4_Missense_Mutation_p.T279A|BMPR1B_ENST00000440890.2_Missense_Mutation_p.T309A|BMPR1B_ENST00000394931.1_Missense_Mutation_p.T279A	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		GTACCTAATCACAGACTATCA	0.403																																					p.T309A		.											.	BMPR1B	1378	0			c.A925G						.						92.0	77.0	82.0					4																	96052422		2203	4300	6503	SO:0001583	missense	658	exon8			CTAATCACAGACT	D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.835A>G	4.37:g.96052422A>G	ENSP00000426617:p.Thr279Ala	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	33.0	NM_001256793	B2R953|B4DSV1|P78366	Missense_Mutation	SNP	ENST00000515059.1	37	CCDS3642.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.258231	0.80246	.	.	ENSG00000138696	ENST00000515059;ENST00000512312;ENST00000509540;ENST00000440890;ENST00000264568;ENST00000394931	D;D;D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.3;-3.3;-3.3	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97629	0.9223	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98565	1.0643	10	0.87932	D	0	.	16.6093	0.84858	1.0:0.0:0.0:0.0	.	279	O00238	BMR1B_HUMAN	A	279;279;279;309;279;279	ENSP00000426617:T279A;ENSP00000425444:T279A;ENSP00000421671:T279A;ENSP00000401907:T309A;ENSP00000264568:T279A;ENSP00000378389:T279A	ENSP00000264568:T279A	T	+	1	0	BMPR1B	96271445	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.274000	0.78538	2.324000	0.78689	0.533000	0.62120	ACA	.		0.403	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253609.3	NM_001203	
BPIFB4	149954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	31672781	31672781	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr20:31672781G>A	ENST00000375483.3	+	4	761	c.761G>A	c.(760-762)cGt>cAt	p.R254H		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	254						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TTGTACACCCGTGTGGCCATC	0.637																																					p.R254H		.											.	.	.	0			c.G761A						.						53.0	43.0	46.0					20																	31672781		2203	4300	6503	SO:0001583	missense	149954	exon4			ACACCCGTGTGGC	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.761G>A	20.37:g.31672781G>A	ENSP00000364632:p.Arg254His	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	12.0	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	G	12.42	1.932778	0.34096	.	.	ENSG00000186191	ENST00000375483	T	0.05580	3.42	3.39	3.39	0.38822	.	0.369375	0.23125	N	0.051659	T	0.06600	0.0169	N	0.22421	0.69	0.30416	N	0.778544	D	0.58620	0.983	P	0.50270	0.636	T	0.14671	-1.0464	10	0.16896	T	0.51	-0.4489	10.14	0.42730	0.0:0.0:1.0:0.0	.	254	P59827	BPIB4_HUMAN	H	254	ENSP00000364632:R254H	ENSP00000364632:R254H	R	+	2	0	BPIFB4	31136442	0.141000	0.22595	0.981000	0.43875	0.370000	0.29829	1.778000	0.38614	1.749000	0.51849	0.484000	0.47621	CGT	.		0.637	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
PRR34	55267	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	22	46449729	46449729	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr22:46449729G>T	ENST00000396008.2	-	1	295	c.245C>A	c.(244-246)cCg>cAg	p.P82Q	C22orf26_ENST00000333761.1_Missense_Mutation_p.P82Q|RP6-109B7.3_ENST00000451166.1_RNA|RP6-109B7.3_ENST00000416202.1_RNA|FLJ27365_ENST00000381051.2_5'Flank|RP6-109B7.3_ENST00000445441.1_RNA|RP6-109B7.5_ENST00000608644.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA			Q9NV39	PRR34_HUMAN		82	Pro-rich.												Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		GGGCAAACGCGGAGCACGGAG	0.761																																					p.P82Q		.											.	C22orf26	90	0			c.C245A						.						3.0	5.0	4.0					22																	46449729		1795	3757	5552	SO:0001583	missense	55267	exon1			AAACGCGGAGCAC																												ENST00000396008.2:c.245C>A	22.37:g.46449729G>T	ENSP00000379329:p.Pro82Gln	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	5.0	NM_018280	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	.	.	.	.	.	.	.	.	.	.	G	5.274	0.236055	0.10023	.	.	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.41758	0.99;0.99	3.25	1.07	0.20283	.	.	.	.	.	T	0.21550	0.0519	N	0.08118	0	0.20074	N	0.999937	P	0.52577	0.954	B	0.42738	0.396	T	0.10268	-1.0637	9	0.87932	D	0	.	4.5524	0.12120	0.6543:0.0:0.3457:0.0	.	82	Q9NV39	CV026_HUMAN	Q	82	ENSP00000379329:P82Q;ENSP00000327764:P82Q	ENSP00000327764:P82Q	P	-	2	0	C22orf26	44828393	0.998000	0.40836	0.652000	0.29579	0.155000	0.21991	0.404000	0.20999	0.184000	0.20083	-0.295000	0.09555	CCG	.		0.761	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
C2CD3	26005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73824849	73824849	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:73824849C>A	ENST00000334126.7	-	11	2045	c.1819G>T	c.(1819-1821)Gcc>Tcc	p.A607S	C2CD3_ENST00000313663.7_Missense_Mutation_p.A607S			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	607					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TTACTGGAGGCGAGTCGAACA	0.383																																					p.A607S		.											.	C2CD3	75	0			c.G1819T						.						129.0	126.0	127.0					11																	73824849		2200	4293	6493	SO:0001583	missense	26005	exon11			TGGAGGCGAGTCG	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1819G>T	11.37:g.73824849C>A	ENSP00000334379:p.Ala607Ser	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	5.0	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	C	27.0	4.788968	0.90367	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.12569	2.67;2.68	5.27	5.27	0.74061	C2 calcium-dependent membrane targeting (1);	0.058320	0.64402	D	0.000002	T	0.37156	0.0993	M	0.68952	2.095	0.37577	D	0.919663	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.30534	-0.9975	10	0.66056	D	0.02	-11.788	16.6638	0.85247	0.0:1.0:0.0:0.0	.	607;607	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	S	607	ENSP00000334379:A607S;ENSP00000323339:A607S	ENSP00000323339:A607S	A	-	1	0	C2CD3	73502497	1.000000	0.71417	0.998000	0.56505	0.922000	0.55478	5.933000	0.70130	2.466000	0.83321	0.455000	0.32223	GCC	.		0.383	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
C4orf17	84103	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	100463066	100463066	+	Splice_Site	SNP	G	G	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:100463066G>C	ENST00000326581.4	+	9	1242		c.e9-1			NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17											central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		CTCTATTTCAGAGGCTGAGCA	0.328																																					.		.											.	C4orf17	90	0			c.881-1G>C						.						26.0	28.0	28.0					4																	100463066		2200	4295	6495	SO:0001630	splice_region_variant	84103	exon9			ATTTCAGAGGCTG	AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.881-1G>C	4.37:g.100463066G>C		Somatic	232.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	10.0	NM_032149	Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Splice_Site	SNP	ENST00000326581.4	37	CCDS3649.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118326	0.37339	.	.	ENSG00000138813	ENST00000326581	.	.	.	5.32	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4052	0.49894	0.0:0.0:0.821:0.179	.	.	.	.	.	-1	.	.	.	+	.	.	C4orf17	100682089	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	2.399000	0.44495	2.764000	0.94973	0.650000	0.86243	.	.		0.328	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	NM_032149	Intron
CAMSAP3	57662	ucsc.edu;bcgsc.ca	37	19	7673101	7673101	+	Silent	SNP	G	G	A	rs199927493		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:7673101G>A	ENST00000160298.4	+	5	812	c.711G>A	c.(709-711)gcG>gcA	p.A237A	CAMSAP3_ENST00000446248.2_Silent_p.A264A	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	237	CH.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						GTGGGGCCGCGCTGGCCGCCA	0.637													g|||	1	0.000199681	0.0	0.0	5008	,	,		15982	0.0		0.0	False		,,,				2504	0.001				p.A264A		.											.	.	.	0			c.G792A						.		,	0,4162		0,0,2081	43.0	52.0	49.0		792,711	-9.8	0.3	19		49	12,8388		1,10,4189	no	coding-synonymous,coding-synonymous	CAMSAP3	NM_001080429.2,NM_020902.1	,	1,10,6270	AA,AG,GG		0.1429,0.0,0.0955	,	264/1277,237/1250	7673101	12,12550	2081	4200	6281	SO:0001819	synonymous_variant	57662	exon7			GGCCGCGCTGGCC	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.711G>A	19.37:g.7673101G>A		Somatic	53.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001080429	Q8NDF1	Silent	SNP	ENST00000160298.4	37	CCDS42489.1																																																																																			G|0.991;A|0.009		0.637	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459300.1	XM_048362	
CACNA1A	773	bcgsc.ca;mdanderson.org	37	19	13325091	13325091	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:13325091G>C	ENST00000360228.5	-	40	5895	c.5896C>G	c.(5896-5898)Cgg>Ggg	p.R1966G	CACNA1A_ENST00000573710.2_Missense_Mutation_p.R1967G	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1967					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TTGCTCTGCCGGTAGTACTCC	0.622																																					p.R1967G		.											.	CACNA1A	67	0			c.C5899G						.						37.0	41.0	40.0					19																	13325091		2177	4278	6455	SO:0001583	missense	773	exon40			TCTGCCGGTAGTA	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5896C>G	19.37:g.13325091G>C	ENSP00000353362:p.Arg1966Gly	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_1	17.0	4.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704417	0.48412	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	T	0.75821	-0.97	4.72	4.72	0.59763	Voltage-dependent calcium channel, alpha-1 subunit, IQ domain (1);	0.000000	0.64402	D	0.000003	D	0.84270	0.5435	M	0.75085	2.285	0.58432	D	0.999999	D;D;D;D	0.71674	0.998;0.997;0.997;0.998	D;D;D;D	0.81914	0.987;0.966;0.995;0.987	D	0.85992	0.1489	10	0.87932	D	0	.	11.6844	0.51476	0.0:0.0:0.8226:0.1774	.	1967;1972;1966;1967	O00555;E9PD31;Q9NS88;E7EVF2	CAC1A_HUMAN;.;.;.	G	1966;1972;1967;1967	ENSP00000353362:R1966G	ENSP00000317661:R1967G	R	-	1	2	CACNA1A	13186091	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.798000	0.47884	2.184000	0.69523	0.491000	0.48974	CGG	.		0.622	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CAPN11	11131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44147887	44147887	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr6:44147887C>A	ENST00000398776.1	+	14	1665	c.1627C>A	c.(1627-1629)Cac>Aac	p.H543N	CAPN11_ENST00000542245.1_Missense_Mutation_p.H543N	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	543	Domain III.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CACCGAGAAGCACAGCGAGTC	0.587																																					p.H543N		.											.	CAPN11	136	0			c.C1627A						.						25.0	25.0	25.0					6																	44147887		2055	4218	6273	SO:0001583	missense	11131	exon14			GAGAAGCACAGCG	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1627C>A	6.37:g.44147887C>A	ENSP00000381758:p.His543Asn	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	8.0	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	37	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.224609	0.58668	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	D;D	0.87809	-2.3;-2.3	4.67	3.8	0.43715	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.135690	0.34555	N	0.003869	T	0.78604	0.4309	L	0.43923	1.385	0.31109	N	0.7102	P;P	0.52692	0.891;0.955	P;P	0.52343	0.494;0.696	T	0.75303	-0.3365	10	0.45353	T	0.12	.	5.8402	0.18629	0.1908:0.7111:0.0:0.098	.	197;543	B4DT90;Q9UMQ6	.;CAN11_HUMAN	N	543	ENSP00000381758:H543N;ENSP00000441078:H543N	ENSP00000381758:H543N	H	+	1	0	CAPN11	44255865	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.729000	0.54999	1.333000	0.45449	0.609000	0.83330	CAC	.		0.587	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
CBLB	868	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	105586253	105586253	+	Splice_Site	DEL	C	C	-			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr3:105586253delC	ENST00000264122.4	-	2	490		c.e2+1		CBLB_ENST00000403724.1_Splice_Site|CBLB_ENST00000545639.1_Splice_Site|CBLB_ENST00000405772.1_Splice_Site|CBLB_ENST00000394027.3_Splice_Site	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase						cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						ACAGAACTTACCACTTTGTCC	0.443			Mis S		AML																																.	GBM(93;588 1337 9788 29341 43499)	.		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	CBLB	849	0			c.168+1G>-						.						162.0	151.0	155.0					3																	105586253		2203	4300	6503	SO:0001630	splice_region_variant	868	exon3			AACTTACCACTTT	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.168+1G>-	3.37:g.105586253delC		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	19.0	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Splice_Site	DEL	ENST00000264122.4	37	CCDS2948.1																																																																																			.		0.443	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	Intron
CD93	22918	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	20	23066708	23066708	+	Nonsense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr20:23066708G>T	ENST00000246006.4	-	1	269	c.122C>A	c.(121-123)tCg>tAg	p.S41*		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	41	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CAGCTTGCCCGAGTGGGCCGT	0.697																																					p.S41X		.											.	CD93	153	0			c.C122A						.						26.0	23.0	24.0					20																	23066708		2200	4296	6496	SO:0001587	stop_gained	22918	exon1			TTGCCCGAGTGGG	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.122C>A	20.37:g.23066708G>T	ENSP00000246006:p.Ser41*	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	4.0	NM_012072	O00274	Nonsense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	G	38	6.967644	0.97971	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	.	.	.	5.88	3.96	0.45880	.	0.558192	0.16514	N	0.211139	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-11.1266	11.0412	0.47831	0.1357:0.5987:0.2657:0.0	.	.	.	.	X	41	.	ENSP00000246006:S41X	S	-	2	0	CD93	23014708	0.975000	0.34042	0.998000	0.56505	0.961000	0.63080	1.617000	0.36943	0.817000	0.34445	-0.133000	0.14855	TCG	.		0.697	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
CEP85L	387119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	118887408	118887408	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr6:118887408C>A	ENST00000368491.3	-	3	925	c.304G>T	c.(304-306)Gtg>Ttg	p.V102L	CEP85L_ENST00000368488.5_Missense_Mutation_p.V105L|CEP85L_ENST00000360290.3_5'UTR|CEP85L_ENST00000392500.3_Missense_Mutation_p.V105L|CEP85L_ENST00000419517.2_Missense_Mutation_p.V102L|CEP85L_ENST00000472713.1_5'UTR	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	102						centrosome (GO:0005813)|cytoplasm (GO:0005737)											GACGGCATCACATGGGCAGTA	0.393																																					p.V105L		.											.	.	.	0			c.G313T						.						51.0	51.0	51.0					6																	118887408		2203	4300	6503	SO:0001583	missense	387119	exon4			GCATCACATGGGC	AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.304G>T	6.37:g.118887408C>A	ENSP00000357477:p.Val102Leu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	13.0	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862730	0.91511	.	.	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604;ENST00000392500;ENST00000419517	T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98	5.96	5.96	0.96718	.	0.150870	0.43747	D	0.000534	T	0.34687	0.0906	L	0.46819	1.47	0.45837	D	0.998704	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.68621	0.959;0.945;0.945;0.945	T	0.03423	-1.1038	10	0.87932	D	0	-12.4625	20.422	0.99049	0.0:1.0:0.0:0.0	.	105;102;105;102	Q5SZL2-2;G3V0H3;F8W6J2;Q5SZL2	.;.;.;CF204_HUMAN	L	102;105;105;105;102	ENSP00000357477:V102L;ENSP00000357474:V105L;ENSP00000392131:V105L;ENSP00000376288:V105L;ENSP00000393317:V102L	ENSP00000357474:V105L	V	-	1	0	C6orf204	118994101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.473000	0.73572	2.832000	0.97577	0.655000	0.94253	GTG	.		0.393	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
COL5A2	1290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	189907465	189907465	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:189907465G>C	ENST00000374866.3	-	49	3780	c.3506C>G	c.(3505-3507)cCt>cGt	p.P1169R		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1169					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			AAATGGTCCAGGGATTCCAGC	0.373																																					p.P1169R		.											.	COL5A2	92	0			c.C3506G						.						92.0	80.0	84.0					2																	189907465		2203	4300	6503	SO:0001583	missense	1290	exon49			GGTCCAGGGATTC	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3506C>G	2.37:g.189907465G>C	ENSP00000364000:p.Pro1169Arg	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	17.0	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	37	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.740792	0.30865	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.98684	-5.07	5.76	5.76	0.90799	.	0.000000	0.51477	D	0.000088	D	0.97791	0.9275	M	0.67397	2.05	0.41356	D	0.987395	P;P	0.42584	0.586;0.784	B;P	0.45167	0.377;0.472	D	0.96744	0.9549	10	0.31617	T	0.26	.	13.5317	0.61625	0.0713:0.0:0.9287:0.0	.	809;1169	Q5PR22;P05997	.;CO5A2_HUMAN	R	1169;809	ENSP00000364000:P1169R	ENSP00000364000:P1169R	P	-	2	0	COL5A2	189615710	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.742000	0.47434	2.871000	0.98454	0.655000	0.94253	CCT	.		0.373	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
COQ6	51004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	74428466	74428466	+	Nonsense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr14:74428466G>T	ENST00000334571.2	+	11	1277	c.1237G>T	c.(1237-1239)Gaa>Taa	p.E413*	ENTPD5_ENST00000557325.1_Intron|COQ6_ENST00000394026.4_Nonsense_Mutation_p.E388*|COQ6_ENST00000238709.4_Nonsense_Mutation_p.E338*|COQ6_ENST00000554920.1_Intron	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	413					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		CACAGGTTATGAAACAGAAAG	0.463																																					p.E413X		.											.	COQ6	90	0			c.G1237T						.						159.0	152.0	154.0					14																	74428466		2203	4300	6503	SO:0001587	stop_gained	51004	exon11			GGTTATGAAACAG	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.1237G>T	14.37:g.74428466G>T	ENSP00000333946:p.Glu413*	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	13.0	NM_182476	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Nonsense_Mutation	SNP	ENST00000334571.2	37	CCDS9823.1	.	.	.	.	.	.	.	.	.	.	G	38	7.084039	0.98051	.	.	ENSG00000119723	ENST00000394026;ENST00000555376;ENST00000238709;ENST00000334571;ENST00000556299	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-7.3024	19.2367	0.93864	0.0:0.0:1.0:0.0	.	.	.	.	X	388;338;338;413;101	.	ENSP00000238709:E338X	E	+	1	0	COQ6	73498219	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.411000	0.97342	2.776000	0.95493	0.655000	0.94253	GAA	.		0.463	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
CTDSPL2	51496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	44816346	44816346	+	Silent	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr15:44816346T>C	ENST00000260327.4	+	13	1938	c.1375T>C	c.(1375-1377)Ttg>Ctg	p.L459L	CTDSPL2_ENST00000558966.1_Silent_p.L459L|CTDSPL2_ENST00000396780.1_Silent_p.L387L|CTDSPL2_ENST00000558373.1_Silent_p.L387L	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	459							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		CAGATTTCGCTTGCATGATTT	0.388																																					p.L459L		.											.	CTDSPL2	90	0			c.T1375C						.						107.0	102.0	103.0					15																	44816346		2198	4298	6496	SO:0001819	synonymous_variant	51496	exon13			TTTCGCTTGCATG	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.1375T>C	15.37:g.44816346T>C		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	24.0	NM_016396	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Silent	SNP	ENST00000260327.4	37	CCDS10110.1																																																																																			.		0.388	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253851.1	NM_016396	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41268766	41268766	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr3:41268766A>C	ENST00000349496.5	+	7	1284	c.1004A>C	c.(1003-1005)aAa>aCa	p.K335T	CTNNB1_ENST00000396185.3_Missense_Mutation_p.K335T|CTNNB1_ENST00000405570.1_Missense_Mutation_p.K335T|CTNNB1_ENST00000396183.3_Missense_Mutation_p.K335T|CTNNB1_ENST00000453024.1_Missense_Mutation_p.K328T	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	335					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.K335I(8)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTTACGAAAAACTACTGTGG	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.K335T	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,Wilms_tumour,0	CTNNB1	24361	8	Substitution - Missense(8)	liver(7)|kidney(1)	c.A1004C						.						110.0	108.0	109.0					3																	41268766		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACGAAAAACTACT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1004A>C	3.37:g.41268766A>C	ENSP00000344456:p.Lys335Thr	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	24.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.732055	0.89390	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82121	0.4968	M	0.89287	3.02	0.80722	D	1	D;D	0.71674	0.981;0.998	D;D	0.76575	0.913;0.988	D	0.85665	0.1291	10	0.66056	D	0.02	-3.7939	15.5934	0.76558	1.0:0.0:0.0:0.0	.	263;335	B4DSW9;P35222	.;CTNB1_HUMAN	T	335;335;335;328;335	ENSP00000385604:K335T;ENSP00000379486:K335T;ENSP00000344456:K335T;ENSP00000411226:K328T;ENSP00000379488:K335T	ENSP00000344456:K335T	K	+	2	0	CTNNB1	41243770	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	AAA	.		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CYP26B1	56603	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	72374800	72374800	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:72374800C>A	ENST00000001146.2	-	1	367	c.164G>T	c.(163-165)gGc>gTc	p.G55V	CYP26B1_ENST00000546307.1_Missense_Mutation_p.G55V	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	55					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						GAGCGGGAAGCCCATGGATCC	0.701																																					p.G55V		.											.	CYP26B1	92	0			c.G164T						.						21.0	21.0	21.0					2																	72374800		2200	4297	6497	SO:0001583	missense	56603	exon1			GGGAAGCCCATGG		CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.164G>T	2.37:g.72374800C>A	ENSP00000001146:p.Gly55Val	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	11.0	NM_019885	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Missense_Mutation	SNP	ENST00000001146.2	37	CCDS1919.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036330	0.54896	.	.	ENSG00000003137	ENST00000001146;ENST00000546307;ENST00000474509	T;T;T	0.79749	-0.46;-1.3;-0.27	3.97	3.97	0.46021	.	0.000000	0.64402	D	0.000011	D	0.89501	0.6733	M	0.83852	2.665	0.58432	D	0.999998	D;D	0.76494	0.999;0.997	D;D	0.87578	0.998;0.992	D	0.91111	0.4922	10	0.87932	D	0	-3.3777	13.9139	0.63885	0.0:1.0:0.0:0.0	.	55;55	B7Z2K6;Q9NR63	.;CP26B_HUMAN	V	55	ENSP00000001146:G55V;ENSP00000443304:G55V;ENSP00000430888:G55V	ENSP00000001146:G55V	G	-	2	0	CYP26B1	72228308	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.324000	0.79115	2.225000	0.72522	0.462000	0.41574	GGC	.		0.701	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885	
EFTUD2	9343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42964016	42964016	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr17:42964016C>T	ENST00000426333.2	-	3	505	c.208G>A	c.(208-210)Gag>Aag	p.E70K	EFTUD2_ENST00000402521.3_Missense_Mutation_p.E35K|RN7SL405P_ENST00000582502.1_RNA|EFTUD2_ENST00000592576.1_Missense_Mutation_p.E70K|EFTUD2_ENST00000591382.1_Missense_Mutation_p.E70K|EFTUD2_ENST00000589211.1_5'Flank	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	70					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				TACACCTCCTCGGCTGTTGGG	0.532																																					p.E70K	Ovarian(10;65 485 10258 29980 30707)	.											.	EFTUD2	91	0			c.G208A						.						219.0	144.0	170.0					17																	42964016		2203	4300	6503	SO:0001583	missense	9343	exon3			CCTCCTCGGCTGT	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.208G>A	17.37:g.42964016C>T	ENSP00000392094:p.Glu70Lys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	12.0	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	37	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964151	0.74131	.	.	ENSG00000108883	ENST00000426333;ENST00000402521	T;T	0.70869	-0.52;-0.52	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	T	0.71384	0.3333	M	0.76574	2.34	0.80722	D	1	B;B	0.27765	0.188;0.188	B;B	0.21360	0.034;0.034	T	0.66559	-0.5893	10	0.19147	T	0.46	-18.5037	20.7342	0.99715	0.0:1.0:0.0:0.0	.	70;70	B4DMC0;Q15029	.;U5S1_HUMAN	K	70;35	ENSP00000392094:E70K;ENSP00000385873:E35K	ENSP00000385873:E35K	E	-	1	0	EFTUD2	40319542	1.000000	0.71417	0.981000	0.43875	0.805000	0.45488	7.433000	0.80362	2.906000	0.99361	0.655000	0.94253	GAG	.		0.532	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
EIF4E	1977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	99850252	99850252	+	Silent	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:99850252G>A	ENST00000450253.2	-	1	1536	c.12C>T	c.(10-12)gtC>gtT	p.V4V	AC019131.1_ENST00000459306.1_RNA|EIF4E_ENST00000504472.1_5'UTR|EIF4E_ENST00000280892.6_5'Flank|EIF4E_ENST00000504432.1_5'UTR|EIF4E_ENST00000505992.1_Silent_p.V4V|RP11-571L19.7_ENST00000583654.1_RNA	NM_001968.3	NP_001959.1	P06730	IF4E_HUMAN	eukaryotic translation initiation factor 4E	4					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of mitotic cell cycle (GO:0045931)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|mRNA cap binding complex (GO:0005845)|RISC complex (GO:0016442)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)|LUSC - Lung squamous cell carcinoma(721;0.00227)		TCACCGGTTCGACAGTCGCCA	0.612																																					p.V4V		.											.	EIF4E	1270	0			c.C12T						.						12.0	12.0	12.0					4																	99850252		2191	4282	6473	SO:0001819	synonymous_variant	1977	exon1			CGGTTCGACAGTC	M15353	CCDS34031.1, CCDS47109.1, CCDS54779.1	4q21-q25	2008-02-05			ENSG00000151247	ENSG00000151247			3287	protein-coding gene	gene with protein product		133440		EIF4EL1, EIF4F		9330633, 1916814	Standard	NM_001968		Approved	EIF4E1	uc011cea.1	P06730	OTTHUMG00000161090	ENST00000450253.2:c.12C>T	4.37:g.99850252G>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	12.0	NM_001130679	B7Z6V1|D6RCQ6|Q96E95	Silent	SNP	ENST00000450253.2	37	CCDS34031.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487573	0.26686	.	.	ENSG00000151247	ENST00000511644	.	.	.	4.53	3.69	0.42338	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7273	0.51716	0.0:0.8112:0.1888:0.0	.	.	.	.	X	1	.	.	R	-	1	2	EIF4E	100069275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.084000	0.41625	1.126000	0.42016	-0.171000	0.13296	CGA	.		0.612	EIF4E-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363739.1	NM_001968	
EIF4G2	1982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10824602	10824602	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:10824602T>C	ENST00000526148.1	-	11	1481	c.971A>G	c.(970-972)aAt>aGt	p.N324S	EIF4G2_ENST00000525681.1_Missense_Mutation_p.N324S|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000396525.2_Missense_Mutation_p.N324S|SNORD97_ENST00000459187.1_RNA|EIF4G2_ENST00000525995.1_5'Flank|EIF4G2_ENST00000339995.5_Missense_Mutation_p.N324S	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		ACGAATTTGATTGATCGTCTT	0.378																																					p.N324S		.											.	EIF4G2	91	0			c.A971G						.						81.0	76.0	78.0					11																	10824602		2201	4294	6495	SO:0001583	missense	1982	exon11			ATTTGATTGATCG	U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.971A>G	11.37:g.10824602T>C	ENSP00000433664:p.Asn324Ser	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	15.0	NM_001042559		Missense_Mutation	SNP	ENST00000526148.1	37	CCDS31428.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.153337	0.38021	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531416	T;T;T;T;T	0.21191	2.32;2.32;2.32;2.32;2.02	6.07	6.07	0.98685	.	0.127499	0.64402	D	0.000001	T	0.21103	0.0508	L	0.50333	1.59	0.34552	D	0.711409	B;B;B	0.26318	0.022;0.049;0.146	B;B;B	0.18871	0.023;0.016;0.016	T	0.20371	-1.0277	9	0.56958	D	0.05	-11.3161	12.4822	0.55850	0.0:0.0:0.1393:0.8607	.	324;324;397	P78344-2;P78344;B4DZF2	.;IF4G2_HUMAN;.	S	324;324;324;324;397;324	ENSP00000433664:N324S;ENSP00000433371:N324S;ENSP00000340281:N324S;ENSP00000379778:N324S;ENSP00000431583:N324S	ENSP00000340281:N324S	N	-	2	0	EIF4G2	10781178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.230000	0.51286	2.326000	0.78906	0.533000	0.62120	AAT	.		0.378	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386603.1	NM_001418	
ENTPD1	953	hgsc.bcm.edu;bcgsc.ca	37	10	97624496	97624496	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr10:97624496G>T	ENST00000371205.4	+	9	1487	c.1204G>T	c.(1204-1206)Gct>Tct	p.A402S	ENTPD1_ENST00000453258.2_Missense_Mutation_p.A409S|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000539125.1_Missense_Mutation_p.A264S|ENTPD1_ENST00000371203.5_Missense_Mutation_p.A264S|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1_ENST00000371207.3_Missense_Mutation_p.A414S|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000543964.1_Missense_Mutation_p.A294S|RP11-248J23.7_ENST00000491114.1_Silent_p.T17T			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	402					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		AACATCTTACGCTGGAGTAAA	0.453																																					p.A414S		.											.	ENTPD1	93	0			c.G1240T						.						132.0	105.0	114.0					10																	97624496		2203	4300	6503	SO:0001583	missense	953	exon9			TCTTACGCTGGAG	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.1204G>T	10.37:g.97624496G>T	ENSP00000360248:p.Ala402Ser	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_001164178	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Missense_Mutation	SNP	ENST00000371205.4	37	CCDS7444.1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.341222	0.41498	.	.	ENSG00000138185	ENST00000453258;ENST00000371207;ENST00000543964;ENST00000539125;ENST00000371203;ENST00000371205	T;T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81;2.81	5.28	-4.14	0.03892	.	1.377460	0.04341	N	0.354005	T	0.04363	0.0120	N	0.10972	0.075	0.09310	N	1	P;P;B;P	0.44627	0.839;0.807;0.053;0.839	B;B;B;B	0.38712	0.28;0.184;0.068;0.28	T	0.30504	-0.9976	10	0.16896	T	0.51	0.6554	3.9178	0.09230	0.3007:0.4481:0.1567:0.0944	.	414;414;409;402	B4DWB9;G3XAF6;P49961-2;P49961	.;.;.;ENTP1_HUMAN	S	409;414;294;264;264;402	ENSP00000390955:A409S;ENSP00000360250:A414S;ENSP00000442968:A294S;ENSP00000440027:A264S;ENSP00000360246:A264S;ENSP00000360248:A402S	ENSP00000360246:A264S	A	+	1	0	ENTPD1	97614486	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.205000	0.17356	-0.376000	0.07943	-0.137000	0.14449	GCT	.		0.453	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776	
EPHA2	1969	broad.mit.edu;mdanderson.org	37	1	16464616	16464616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr1:16464616C>T	ENST00000358432.5	-	5	1198	c.1044G>A	c.(1042-1044)tgG>tgA	p.W348*		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	348	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GAGGGGGCGTCCAGCGCAGCT	0.677																																					p.W348X		.											.	EPHA2	1419	0			c.G1044A						.						29.0	28.0	28.0					1																	16464616		2203	4299	6502	SO:0001587	stop_gained	1969	exon5			GGGCGTCCAGCGC	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.1044G>A	1.37:g.16464616C>T	ENSP00000351209:p.Trp348*	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	4.0	NM_004431	B5A968|Q8N3Z2	Nonsense_Mutation	SNP	ENST00000358432.5	37	CCDS169.1	.	.	.	.	.	.	.	.	.	.	C	37	6.337685	0.97485	.	.	ENSG00000142627	ENST00000358432	.	.	.	4.97	4.97	0.65823	.	0.000000	0.52532	D	0.000071	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1088	0.81244	0.0:1.0:0.0:0.0	.	.	.	.	X	348	.	ENSP00000351209:W348X	W	-	3	0	EPHA2	16337203	1.000000	0.71417	0.999000	0.59377	0.623000	0.37688	7.771000	0.85420	2.488000	0.83962	0.561000	0.74099	TGG	.		0.677	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
EWSR1	2130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	29664336	29664336	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr22:29664336C>G	ENST00000397938.2	+	1	330	c.11C>G	c.(10-12)aCg>aGg	p.T4R	EWSR1_ENST00000414183.2_Missense_Mutation_p.T4R|EWSR1_ENST00000332035.6_Missense_Mutation_p.T4R|EWSR1_ENST00000333395.6_Missense_Mutation_p.T4R|EWSR1_ENST00000331029.7_Missense_Mutation_p.T4R|EWSR1_ENST00000332050.6_Missense_Mutation_p.T4R|RHBDD3_ENST00000216085.7_5'Flank|EWSR1_ENST00000406548.1_Missense_Mutation_p.T4R	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	4	EAD (Gln/Pro/Thr-rich).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						ATGGCGTCCACGGGTGAGTAT	0.622			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																p.T4R		.		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	.	EWSR1	3375	0			c.C11G						.						174.0	169.0	171.0					22																	29664336		2203	4300	6503	SO:0001583	missense	2130	exon1			CGTCCACGGGTGA		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.11C>G	22.37:g.29664336C>G	ENSP00000381031:p.Thr4Arg	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	11.0	NM_013986	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	37	CCDS13851.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.173199	0.57584	.	.	ENSG00000182944	ENST00000444626;ENST00000332050;ENST00000397938;ENST00000436425;ENST00000447973;ENST00000406548;ENST00000437155;ENST00000415761;ENST00000331029;ENST00000414183;ENST00000333395;ENST00000455726;ENST00000332035	T;T;T;T;T;T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56	4.06	3.02	0.34903	.	0.336013	0.26345	U	0.024901	T	0.36026	0.0952	L	0.27053	0.805	0.37572	D	0.919475	P;D;D;P;P	0.76494	0.923;0.994;0.999;0.923;0.954	P;D;D;P;P	0.72625	0.657;0.92;0.978;0.657;0.814	T	0.35076	-0.9803	10	0.87932	D	0	.	7.0125	0.24871	0.0:0.8739:0.0:0.126	.	4;4;4;4;4	Q96FE8;B0QYK1;Q96MX4;Q01844;Q9BWA2	.;.;.;EWS_HUMAN;.	R	4	ENSP00000416171:T4R;ENSP00000330896:T4R;ENSP00000381031:T4R;ENSP00000406824:T4R;ENSP00000405947:T4R;ENSP00000385726:T4R;ENSP00000412670:T4R;ENSP00000330516:T4R;ENSP00000400142:T4R;ENSP00000327456:T4R;ENSP00000393637:T4R;ENSP00000331699:T4R	ENSP00000330516:T4R	T	+	2	0	EWSR1	27994336	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.882000	0.39648	1.964000	0.57103	0.467000	0.42956	ACG	.		0.622	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65149117	65149117	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr6:65149117G>T	ENST00000370621.3	-	27	6299	c.5773C>A	c.(5773-5775)Caa>Aaa	p.Q1925K	EYS_ENST00000370616.2_Missense_Mutation_p.Q1925K|EYS_ENST00000503581.1_Missense_Mutation_p.Q1925K			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1925	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTTGAGTCTTGCTTGACATAC	0.289																																					p.Q1925K		.											.	EYS	660	0			c.C5773A						.						60.0	53.0	55.0					6																	65149117		692	1590	2282	SO:0001583	missense	346007	exon27			AGTCTTGCTTGAC		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5773C>A	6.37:g.65149117G>T	ENSP00000359655:p.Gln1925Lys	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	16.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	4.459	0.085035	0.08583	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	T;T;T	0.68624	-0.34;-0.34;-0.34	4.33	1.35	0.21983	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.35219	0.0924	N	0.19112	0.55	0.41592	D	0.9888	B;B	0.34181	0.386;0.44	B;B	0.38378	0.178;0.272	T	0.20075	-1.0286	9	0.49607	T	0.09	.	9.4444	0.38688	0.0819:0.4505:0.4676:0.0	.	1925;1925	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	K	1925	ENSP00000424243:Q1925K;ENSP00000359655:Q1925K;ENSP00000359650:Q1925K	ENSP00000359650:Q1925K	Q	-	1	0	EYS	65205838	0.991000	0.36638	0.113000	0.21522	0.009000	0.06853	0.955000	0.29188	0.243000	0.21327	-0.274000	0.10170	CAA	.		0.289	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FBLN1	2192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	45960824	45960824	+	Intron	SNP	G	G	T	rs373139240		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr22:45960824G>T	ENST00000327858.6	+	15	1792				FBLN1_ENST00000442170.2_Missense_Mutation_p.R586S|FBLN1_ENST00000348697.2_Missense_Mutation_p.R586S	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1						embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		AGGACTGCAGGGTTCTTCCAT	0.542																																					p.R586S		.											.	FBLN1	515	0			c.G1758T						.	G	SER/ARG,	0,4406		0,0,2203	138.0	114.0	122.0		1758,	0.5	0.0	22		122	2,8598	2.2+/-6.3	0,2,4298	no	missense,intron	FBLN1	NM_006485.3,NM_006486.2	110,	0,2,6501	TT,TG,GG		0.0233,0.0,0.0154	,	586/602,	45960824	2,13004	2203	4300	6503	SO:0001627	intron_variant	2192	exon15			CTGCAGGGTTCTT		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1698-9567G>T	22.37:g.45960824G>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	15.0	NM_006485	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	6.256	0.415325	0.11870	0.0	2.33E-4	ENSG00000077942	ENST00000348697;ENST00000442170	D;D	0.82526	-1.58;-1.62	1.58	0.543	0.17179	.	.	.	.	.	T	0.65749	0.2721	L	0.27053	0.805	0.09310	N	1	B	0.15473	0.013	B	0.15052	0.012	T	0.46965	-0.9153	9	0.09590	T	0.72	.	3.9389	0.09318	0.2276:0.0:0.7724:0.0	.	586	B1AHL4	.	S	586	ENSP00000262723:R586S;ENSP00000393812:R586S	ENSP00000262723:R586S	R	+	3	2	FBLN1	44339488	0.005000	0.15991	0.000000	0.03702	0.001000	0.01503	1.122000	0.31295	0.233000	0.21120	-0.373000	0.07131	AGG	.		0.542	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
GABRQ	55879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	151821124	151821124	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chrX:151821124G>C	ENST00000370306.2	+	9	1299	c.1279G>C	c.(1279-1281)Gcc>Ccc	p.A427P		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	427					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGCCCAGCTGGCCACCTCGGA	0.662																																					p.A427P		.											.	GABRQ	133	0			c.G1279C						.						58.0	58.0	58.0					X																	151821124		2203	4300	6503	SO:0001583	missense	55879	exon9			CAGCTGGCCACCT	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1279G>C	X.37:g.151821124G>C	ENSP00000359329:p.Ala427Pro	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	44.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295250	0.81025	.	.	ENSG00000147402	ENST00000370306	T	0.80824	-1.42	4.49	4.49	0.54785	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.36815	N	0.002398	D	0.85008	0.5599	L	0.48642	1.525	0.36231	D	0.85261	D	0.89917	1.0	D	0.91635	0.999	D	0.87900	0.2690	10	0.62326	D	0.03	.	11.4043	0.49889	0.0:0.0:1.0:0.0	.	427	Q9UN88	GBRT_HUMAN	P	427	ENSP00000359329:A427P	ENSP00000359329:A427P	A	+	1	0	GABRQ	151571780	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.817000	0.55668	2.464000	0.83262	0.600000	0.82982	GCC	.		0.662	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
GAN	8139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81390417	81390417	+	Silent	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr16:81390417C>T	ENST00000568107.2	+	4	823	c.661C>T	c.(661-663)Ctg>Ttg	p.L221L		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	221	BACK.				cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				TATGTCAGCTCTGTGGGTTTC	0.413																																					p.L221L	GBM(106;1239 1507 7582 9741 33976)	.											.	GAN	92	0			c.C661T						.						121.0	110.0	114.0					16																	81390417		2202	4300	6502	SO:0001819	synonymous_variant	8139	exon4			TCAGCTCTGTGGG	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.661C>T	16.37:g.81390417C>T		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	46.0	NM_022041		Silent	SNP	ENST00000568107.2	37	CCDS10935.1																																																																																			.		0.413	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3		
GGN	199720	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	38877684	38877684	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:38877684A>G	ENST00000334928.6	-	3	350	c.218T>C	c.(217-219)cTg>cCg	p.L73P	GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank|AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000586301.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	73	Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGTGAGGGGCAGGGTCGAGGG	0.721																																					p.L73P		.											.	GGN	90	0			c.T218C						.						14.0	16.0	15.0					19																	38877684		2159	4230	6389	SO:0001583	missense	199720	exon3			AGGGGCAGGGTCG	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.218T>C	19.37:g.38877684A>G	ENSP00000334940:p.Leu73Pro	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	9.0	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	CCDS12516.1	.	.	.	.	.	.	.	.	.	.	A	12.20	1.865140	0.32977	.	.	ENSG00000179168	ENST00000334928;ENST00000392116	.	.	.	2.64	1.54	0.23209	.	0.789182	0.09980	N	0.731199	T	0.52008	0.1708	N	0.24115	0.695	0.48087	D	0.999587	D	0.71674	0.998	D	0.74023	0.982	T	0.46748	-0.9169	9	0.23891	T	0.37	-10.6402	5.4928	0.16785	0.7088:0.2912:0.0:0.0	.	73	Q86UU5	GGN_HUMAN	P	73	.	ENSP00000334940:L73P	L	-	2	0	GGN	43569524	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.684000	0.37649	0.380000	0.24823	0.459000	0.35465	CTG	.		0.721	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
GRPEL2	134266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	148725167	148725167	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr5:148725167C>G	ENST00000329271.3	+	1	175	c.65C>G	c.(64-66)gCg>gGg	p.A22G	GRPEL2_ENST00000416916.2_Missense_Mutation_p.A22G|GRPEL2_ENST00000513661.1_Missense_Mutation_p.A22G|GRPEL2-AS1_ENST00000521295.1_RNA	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)	22					cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGAGTGCCGCGTGGGAGAGC	0.682																																					p.A22G		.											.	GRPEL2	91	0			c.C65G						.						15.0	18.0	17.0					5																	148725167		2200	4299	6499	SO:0001583	missense	134266	exon1			GTGCCGCGTGGGA	AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.65C>G	5.37:g.148725167C>G	ENSP00000329558:p.Ala22Gly	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	18.0	NM_152407	B4DFA6|Q49AJ6	Missense_Mutation	SNP	ENST00000329271.3	37	CCDS4295.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699566	0.48307	.	.	ENSG00000164284	ENST00000513661;ENST00000329271;ENST00000416916	.	.	.	4.96	0.83	0.18854	.	0.904049	0.09399	N	0.807544	T	0.21103	0.0508	N	0.19112	0.55	0.09310	N	1	B;B	0.32396	0.369;0.093	B;B	0.34385	0.181;0.028	T	0.23940	-1.0174	9	0.36615	T	0.2	-3.3056	3.322	0.07053	0.1659:0.4169:0.3229:0.0943	.	22;22	B4DFA6;Q8TAA5	.;GRPE2_HUMAN	G	22	.	ENSP00000329558:A22G	A	+	2	0	GRPEL2	148705360	0.000000	0.05858	0.002000	0.10522	0.051000	0.14879	0.278000	0.18753	0.030000	0.15379	0.561000	0.74099	GCG	.		0.682	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252327.1	NM_152407	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	28419597	28419597	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr15:28419597A>C	ENST00000261609.7	-	65	10109	c.10001T>G	c.(10000-10002)gTc>gGc	p.V3334G		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGGCTCGTGGACAGAGGGCGT	0.517																																					p.V3334G		.											.	HERC2	234	0			c.T10001G						.						38.0	30.0	32.0					15																	28419597		2203	4297	6500	SO:0001583	missense	8924	exon65			TCGTGGACAGAGG	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10001T>G	15.37:g.28419597A>C	ENSP00000261609:p.Val3334Gly	Somatic	211.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	67.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	A	9.760	1.169822	0.21621	.	.	ENSG00000128731	ENST00000261609	T	0.39056	1.1	5.5	4.38	0.52667	.	0.063358	0.64402	D	0.000008	T	0.33933	0.0880	L	0.51422	1.61	0.80722	D	1	P	0.42456	0.78	B	0.38106	0.265	T	0.08659	-1.0711	10	0.23302	T	0.38	.	10.8049	0.46512	0.9259:0.0:0.074:0.0	.	3334	O95714	HERC2_HUMAN	G	3334	ENSP00000261609:V3334G	ENSP00000261609:V3334G	V	-	2	0	HERC2	26093192	1.000000	0.71417	0.964000	0.40570	0.108000	0.19459	7.473000	0.81007	2.091000	0.63221	0.482000	0.46254	GTC	.		0.517	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HIGD1A	25994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	42826810	42826810	+	Missense_Mutation	SNP	T	T	C	rs368330989		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr3:42826810T>C	ENST00000321331.7	-	4	352	c.235A>G	c.(235-237)Atg>Gtg	p.M79V	HIGD1A_ENST00000470543.1_5'UTR|HIGD1A_ENST00000418900.2_Missense_Mutation_p.M79V|HIGD1A_ENST00000452906.2_Missense_Mutation_p.M93V|HIGD1A_ENST00000430190.1_Missense_Mutation_p.Y84C	NM_001099669.1|NM_014056.3	NP_001093139.1|NP_054775.2	Q9Y241	HIG1A_HUMAN	HIG1 hypoxia inducible domain family, member 1A	79	HIG1. {ECO:0000255|PROSITE- ProRule:PRU00836}.				cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|protein complex (GO:0043234)|respiratory chain (GO:0070469)				lung(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.217)		GAATAGCCCATACCTAAAGAA	0.363																																					p.M93V		.											.	HIGD1A	226	0			c.A277G						.	T	VAL/MET,VAL/MET,VAL/MET	0,3628		0,0,1814	95.0	88.0	90.0		235,235,277	4.4	1.0	3		90	1,8155		0,1,4077	no	missense,missense,missense	HIGD1A	NM_014056.3,NM_001099669.1,NM_001099668.1	21,21,21	0,1,5891	CC,CT,TT		0.0123,0.0,0.0085	benign,benign,benign	79/94,79/94,93/108	42826810	1,11783	1814	4078	5892	SO:0001583	missense	25994	exon4			AGCCCATACCTAA	BC009583	CCDS43073.1, CCDS46806.1	3p22.1	2014-02-12	2009-03-17		ENSG00000181061	ENSG00000181061			29527	protein-coding gene	gene with protein product	"""hypoxia inducible gene 1"""		"""HIG1 domain family, member 1A"""			11042152, 11230166	Standard	NM_001099668		Approved	HIG1, DKFZP564K247	uc010hid.3	Q9Y241	OTTHUMG00000156277	ENST00000321331.7:c.235A>G	3.37:g.42826810T>C	ENSP00000319393:p.Met79Val	Somatic	648.0	0.0		WXS	Illumina HiSeq	Phase_I	538.0	108.0	NM_001099668	Q9UFZ2	Missense_Mutation	SNP	ENST00000321331.7	37	CCDS43073.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.358|0.358	-0.941198|-0.941198	0.02322|0.02322	0.0|0.0	1.23E-4|1.23E-4	ENSG00000181061|ENSG00000181061	ENST00000321331;ENST00000418900;ENST00000452906|ENST00000430190	T;T;T|.	0.27256|.	1.7;1.7;1.68|.	4.42|4.42	4.42|4.42	0.53409|0.53409	Hypoxia induced protein, domain (1);|.	0.086182|.	0.85682|.	D|.	0.000000|.	T|T	0.52125|0.52125	0.1715|0.1715	.|.	.|.	.|.	0.30552|0.30552	N|N	0.765356|0.765356	B;B|.	0.11235|.	0.004;0.0|.	B;B|.	0.13407|.	0.009;0.001|.	T|T	0.57505|0.57505	-0.7800|-0.7800	9|5	0.02654|0.62326	T|D	1|0.03	-6.03|-6.03	10.2143|10.2143	0.43160|0.43160	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	93;79|.	Q9Y241-2;Q9Y241|.	.;HIG1A_HUMAN|.	V|C	79;79;93|84	ENSP00000319393:M79V;ENSP00000402160:M79V;ENSP00000398064:M93V|.	ENSP00000319393:M79V|ENSP00000408289:Y84C	M|Y	-|-	1|2	0|0	HIGD1A|HIGD1A	42801814|42801814	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	2.221000|2.221000	0.42917|0.42917	1.987000|1.987000	0.57996|0.57996	0.402000|0.402000	0.26972|0.26972	ATG|TAT	.		0.363	HIGD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343686.1	NM_014056	
IL18BP	10068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71711533	71711533	+	Silent	SNP	C	C	T	rs369922984		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:71711533C>T	ENST00000393703.4	+	3	702	c.165C>T	c.(163-165)ccC>ccT	p.P55P	IL18BP_ENST00000337131.5_Silent_p.P55P|IL18BP_ENST00000393707.4_Silent_p.P55P|IL18BP_ENST00000531053.1_Silent_p.P55P|IL18BP_ENST00000497194.2_Silent_p.P55P|IL18BP_ENST00000393705.4_Silent_p.P55P|IL18BP_ENST00000404792.1_Silent_p.P55P|IL18BP_ENST00000260049.5_Silent_p.P55P	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein	55					cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						CCTCCCAGCCCCCAGTGTTCC	0.597																																					p.P55P		.											.	IL18BP	90	0			c.C165T						.	C	,,,,,,	0,4134		0,0,2067	76.0	85.0	82.0		165,165,165,165,165,165,165	-1.7	0.0	11		82	1,8445		0,1,4222	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	IL18BP	NM_001039659.1,NM_001039660.1,NM_001145055.1,NM_001145057.1,NM_005699.3,NM_173042.2,NM_173044.2	,,,,,,	0,1,6289	TT,TC,CC		0.0118,0.0,0.0079	,,,,,,	55/195,55/195,55/116,55/195,55/200,55/195,55/164	71711533	1,12579	2067	4223	6290	SO:0001819	synonymous_variant	10068	exon3			CCAGCCCCCAGTG	AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713	ENST00000393703.4:c.165C>T	11.37:g.71711533C>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	6.0	NM_001145057	B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Silent	SNP	ENST00000393703.4	37	CCDS8206.2																																																																																			.		0.597	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258012.2	NM_173042	
INTS2	57508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59947136	59947136	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr17:59947136T>C	ENST00000444766.3	-	21	3091	c.3016A>G	c.(3016-3018)Att>Gtt	p.I1006V	INTS2_ENST00000251334.6_Missense_Mutation_p.I998V	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	1006					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						GGATCTGCAATGTACATTTGG	0.413																																					p.I1006V		.											.	INTS2	206	0			c.A3016G						.						226.0	219.0	221.0					17																	59947136		1925	4140	6065	SO:0001583	missense	57508	exon21			CTGCAATGTACAT	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.3016A>G	17.37:g.59947136T>C	ENSP00000414237:p.Ile1006Val	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	22.0	NM_020748	Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	37	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338158	0.81911	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.59906	0.23	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.72407	0.3456	M	0.76838	2.35	0.80722	D	1	P	0.38863	0.65	P	0.54140	0.743	T	0.72636	-0.4233	9	.	.	.	-16.9128	14.2898	0.66270	0.0:0.0:0.0:1.0	.	1006	Q9H0H0	INT2_HUMAN	V	1006;1005	ENSP00000414237:I1006V	.	I	-	1	0	INTS2	57301918	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.673000	0.83973	1.975000	0.57531	0.528000	0.53228	ATT	.		0.413	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
KCNQ5	56479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	73843259	73843259	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr6:73843259G>A	ENST00000370398.1	+	10	1472	c.1363G>A	c.(1363-1365)Gag>Aag	p.E455K	KCNQ5_ENST00000355635.3_Missense_Mutation_p.E456K|KCNQ5_ENST00000414165.2_Intron|KCNQ5_ENST00000355194.4_Missense_Mutation_p.E455K|KCNQ5_ENST00000342056.2_Missense_Mutation_p.E474K|KCNQ5-AS1_ENST00000429832.1_RNA|KCNQ5_ENST00000403813.2_Missense_Mutation_p.E446K|KCNQ5_ENST00000402622.2_Missense_Mutation_p.E465K	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	455					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CATCACAGCCGAGGGCAGTCC	0.592																																					p.E474K	GBM(142;1375 1859 14391 23261 44706)	.											.	KCNQ5	158	0			c.G1420A						.						102.0	102.0	102.0					6																	73843259		2203	4300	6503	SO:0001583	missense	56479	exon11			ACAGCCGAGGGCA	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1363G>A	6.37:g.73843259G>A	ENSP00000359425:p.Glu455Lys	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	12.0	NM_001160133	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.356508|5.356508	0.95854|0.95854	.|.	.|.	ENSG00000185760|ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813|ENST00000427928	D;D;D;D;D;D|.	0.99660|.	-6.32;-6.32;-6.32;-6.32;-6.32;-6.32|.	5.59|5.59	5.59|5.59	0.84812|0.84812	Potassium channel, voltage dependent, KCNQ, C-terminal (1);|.	0.268023|.	0.35838|.	N|.	0.002948|.	T|T	0.57607|0.57607	0.2065|0.2065	L|L	0.41492|0.41492	1.28|1.28	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.49783|.	0.928;0.588;0.753;0.793|.	B;B;B;B|.	0.36534|.	0.216;0.225;0.194;0.227|.	T|T	0.52518|0.52518	-0.8565|-0.8565	10|5	0.52906|.	T|.	0.07|.	.|.	18.1396|18.1396	0.89634|0.89634	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	465;474;446;455|.	Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82|.	.;.;.;KCNQ5_HUMAN|.	K|Q	474;474;455;455;465;456;446|46	ENSP00000345055:E474K;ENSP00000347326:E455K;ENSP00000359425:E455K;ENSP00000385501:E465K;ENSP00000347853:E456K;ENSP00000384453:E446K|.	ENSP00000345055:E474K|.	E|R	+|+	1|2	0|0	KCNQ5|KCNQ5	73899980|73899980	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.979000|0.979000	0.70002|0.70002	7.582000|7.582000	0.82546|0.82546	2.797000|2.797000	0.96272|0.96272	0.563000|0.563000	0.77884|0.77884	GAG|CGA	.		0.592	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
KIAA0232	9778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6863165	6863165	+	Silent	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:6863165C>T	ENST00000307659.5	+	7	1511	c.1056C>T	c.(1054-1056)agC>agT	p.S352S	KIAA0232_ENST00000425103.1_Silent_p.S352S	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	352	Poly-Ser.						ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						GAAGTAGTAGCAGTAGCAGCA	0.463																																					p.S352S		.											.	KIAA0232	92	0			c.C1056T						.						73.0	75.0	74.0					4																	6863165		1915	4125	6040	SO:0001819	synonymous_variant	9778	exon7			TAGTAGCAGTAGC	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.1056C>T	4.37:g.6863165C>T		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	21.0	NM_014743	A7E2D2	Silent	SNP	ENST00000307659.5	37	CCDS43209.1																																																																																			.		0.463	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
KIAA1217	56243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	24508649	24508649	+	Silent	SNP	A	A	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr10:24508649A>G	ENST00000376454.3	+	2	195	c.165A>G	c.(163-165)tcA>tcG	p.S55S	KIAA1217_ENST00000376452.3_Silent_p.S55S|KIAA1217_ENST00000458595.1_Silent_p.S55S|KIAA1217_ENST00000376462.1_5'UTR	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	55					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GTCGTGGTTCAGTTTCCAAGT	0.488																																					p.S55S		.											.	KIAA1217	98	0			c.A165G						.						77.0	72.0	74.0					10																	24508649		2203	4300	6503	SO:0001819	synonymous_variant	56243	exon2			TGGTTCAGTTTCC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.165A>G	10.37:g.24508649A>G		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	22.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	37	CCDS31165.1																																																																																			.		0.488	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
KRT81	3887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52681386	52681386	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr12:52681386C>A	ENST00000327741.5	-	6	1088	c.1020G>T	c.(1018-1020)aaG>aaT	p.K340N	KRT86_ENST00000544024.1_Intron|KRT86_ENST00000423955.2_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	340	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		ATACCTGGCACTTGGCATTCT	0.582																																					p.K340N		.											.	KRT81	90	0			c.G1020T						.						94.0	81.0	85.0					12																	52681386		2203	4300	6503	SO:0001583	missense	3887	exon6			CTGGCACTTGGCA	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1020G>T	12.37:g.52681386C>A	ENSP00000369349:p.Lys340Asn	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	18.0	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	ENST00000327741.5	37	CCDS31805.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880810	0.72294	.	.	ENSG00000205426	ENST00000327741;ENST00000389388	D	0.90324	-2.65	4.7	4.7	0.59300	Filament (1);	0.000000	0.45867	U	0.000321	D	0.95503	0.8539	M	0.93420	3.415	0.37266	D	0.907216	D	0.89917	1.0	D	0.80764	0.994	D	0.96140	0.9099	10	0.72032	D	0.01	.	6.1684	0.20404	0.164:0.6956:0.0:0.1404	.	340	Q14533	KRT81_HUMAN	N	340	ENSP00000369349:K340N	ENSP00000369349:K340N	K	-	3	2	KRT81	50967653	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	-0.107000	0.10873	2.139000	0.66308	0.561000	0.74099	AAG	.		0.582	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
KRT78	196374	broad.mit.edu;mdanderson.org	37	12	53242690	53242690	+	Nonsense_Mutation	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr12:53242690G>A	ENST00000304620.4	-	1	88	c.25C>T	c.(25-27)Cag>Tag	p.Q9*	KRT78_ENST00000359499.4_5'Flank	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	9	Gly-rich.|Head.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						AAGCCCCTCTGGGCCCGGCAT	0.637																																					p.Q9X		.											.	KRT78	188	0			c.C25T						.						16.0	19.0	18.0					12																	53242690		2198	4294	6492	SO:0001587	stop_gained	196374	exon1			CCCTCTGGGCCCG	AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.25C>T	12.37:g.53242690G>A	ENSP00000306261:p.Gln9*	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	8.0	NM_173352	A8K4D6|Q5HYM7|Q7RTT2	Nonsense_Mutation	SNP	ENST00000304620.4	37	CCDS8840.1	.	.	.	.	.	.	.	.	.	.	G	37	6.381648	0.97520	.	.	ENSG00000170423	ENST00000304620	.	.	.	5.14	2.25	0.28309	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	3.9476	0.09355	0.1772:0.0:0.4876:0.3351	.	.	.	.	X	9	.	ENSP00000306261:Q9X	Q	-	1	0	KRT78	51528957	0.000000	0.05858	0.889000	0.34880	0.980000	0.70556	0.319000	0.19522	0.669000	0.31146	0.485000	0.47835	CAG	.		0.637	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406380.1	NM_173352	
LAMC1	3915	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183101589	183101589	+	Silent	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr1:183101589G>A	ENST00000258341.4	+	21	3878	c.3621G>A	c.(3619-3621)acG>acA	p.T1207T		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1207	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CCAATGATACGTCAACTGAGG	0.378																																					p.T1207T		.											.	LAMC1	252	0			c.G3621A						.						141.0	127.0	131.0					1																	183101589		2203	4300	6503	SO:0001819	synonymous_variant	3915	exon21			TGATACGTCAACT	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.3621G>A	1.37:g.183101589G>A		Somatic	103.0	1.0		WXS	Illumina HiSeq	Phase_I	101.0	37.0	NM_002293	Q5VYE7	Silent	SNP	ENST00000258341.4	37	CCDS1351.1																																																																																			.		0.378	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
LAMC3	10319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	133942439	133942439	+	Missense_Mutation	SNP	G	G	A	rs529385350		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr9:133942439G>A	ENST00000361069.4	+	14	2573	c.2440G>A	c.(2440-2442)Ggg>Agg	p.G814R	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	814	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.G814R(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCAGTGTAGCGGGAACGTGGA	0.642																																					p.G814R		.											LAMC3,NS,carcinoma,0	LAMC3	93	1	Substitution - Missense(1)	ovary(1)	c.G2440A						.						65.0	56.0	59.0					9																	133942439		2203	4300	6503	SO:0001583	missense	10319	exon14			TGTAGCGGGAACG	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.2440G>A	9.37:g.133942439G>A	ENSP00000354360:p.Gly814Arg	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	10.0	NM_006059	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.684891	0.47991	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.66995	-0.24	4.8	3.89	0.44902	EGF-like, laminin (3);	0.299825	0.35903	N	0.002908	T	0.76478	0.3993	H	0.95816	3.725	0.52501	D	0.999959	P	0.37525	0.598	B	0.41135	0.348	T	0.78881	-0.2029	10	0.54805	T	0.06	.	9.275	0.37694	0.168:0.0:0.832:0.0	.	814	Q9Y6N6	LAMC3_HUMAN	R	814	ENSP00000354360:G814R	ENSP00000347156:G814R	G	+	1	0	LAMC3	132932260	1.000000	0.71417	0.694000	0.30210	0.378000	0.30076	4.898000	0.63238	1.128000	0.42052	0.650000	0.86243	GGG	.		0.642	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
LDHAL6A	160287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18499168	18499168	+	Splice_Site	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:18499168G>T	ENST00000280706.2	+	6	1509	c.712G>T	c.(712-714)Ggc>Tgc	p.G238C	LDHAL6A_ENST00000396213.3_Splice_Site_p.G238C|TSG101_ENST00000536719.1_Intron	NM_144972.4	NP_659409.2	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A	238					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	L-lactate dehydrogenase activity (GO:0004459)			large_intestine(3)|lung(9)|urinary_tract(1)	13						TATCTACAGTGGCTATGAGAT	0.363																																					p.G238C		.											.	LDHAL6A	90	0			c.G712T						.						190.0	187.0	188.0					11																	18499168		2199	4293	6492	SO:0001630	splice_region_variant	160287	exon6			TACAGTGGCTATG	AK131523	CCDS7841.1	11p15.1	2011-01-27			ENSG00000166800	ENSG00000166800			28335	protein-coding gene	gene with protein product						12477932	Standard	NM_001144071		Approved	MGC23940, LDH6A	uc001mop.1	Q6ZMR3	OTTHUMG00000167724	ENST00000280706.2:c.711-1G>T	11.37:g.18499168G>T		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	16.0	NM_144972	D3DQY5	Missense_Mutation	SNP	ENST00000280706.2	37	CCDS7841.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766755	0.69878	.	.	ENSG00000166800	ENST00000396213;ENST00000280706	T;T	0.79749	-1.3;-1.3	3.89	3.89	0.44902	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.164274	0.39759	U	0.001278	D	0.91219	0.7233	M	0.93854	3.465	0.38191	D	0.939909	D	0.62365	0.991	D	0.65233	0.933	D	0.94666	0.7852	10	0.87932	D	0	.	14.8202	0.70068	0.0:0.0:1.0:0.0	.	238	Q6ZMR3	LDH6A_HUMAN	C	238	ENSP00000379516:G238C;ENSP00000280706:G238C	ENSP00000280706:G238C	G	+	1	0	LDHAL6A	18455744	1.000000	0.71417	0.114000	0.21550	0.753000	0.42808	6.550000	0.73905	1.859000	0.53934	0.563000	0.77884	GGC	.		0.363	LDHAL6A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395904.1	NM_144972	Missense_Mutation
LRRC37B	114659	broad.mit.edu;ucsc.edu	37	17	30351740	30351740	+	Nonsense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr17:30351740G>T	ENST00000341671.7	+	2	1695	c.1690G>T	c.(1690-1692)Gga>Tga	p.G564*	LRRC37B_ENST00000543378.2_Nonsense_Mutation_p.G482*|LRRC37B_ENST00000581786.1_3'UTR|LRRC37B_ENST00000394713.3_Nonsense_Mutation_p.G564*|LRRC37B_ENST00000327564.7_Nonsense_Mutation_p.G591*|LRRC37B_ENST00000584368.1_Nonsense_Mutation_p.G576*	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	564						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				AAATTTCCAAGGAAACTATAT	0.353																																					p.G564X		.											.	LRRC37B	92	0			c.G1690T						.						79.0	78.0	79.0					17																	30351740		2203	4300	6503	SO:0001587	stop_gained	114659	exon2			TTCCAAGGAAACT	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.1690G>T	17.37:g.30351740G>T	ENSP00000340519:p.Gly564*	Somatic	610.0	2.0		WXS	Illumina HiSeq	Phase_I	446.0	137.0	NM_052888	Q17RC9|Q5YKG6	Nonsense_Mutation	SNP	ENST00000341671.7	37	CCDS32609.1	.	.	.	.	.	.	.	.	.	.	N	19.40	3.820509	0.71028	.	.	ENSG00000185158	ENST00000543378;ENST00000327564;ENST00000394713;ENST00000341671	.	.	.	2.01	2.01	0.26516	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.5959	0.28048	0.0:0.0:1.0:0.0	.	.	.	.	X	482;591;564;564	.	ENSP00000332536:G591X	G	+	1	0	LRRC37B	27375853	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	2.375000	0.44283	1.434000	0.47414	0.291000	0.19559	GGA	.		0.353	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888	
LRRC8E	80131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7960521	7960521	+	Silent	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:7960521G>A	ENST00000306708.6	+	2	134	c.33G>A	c.(31-33)acG>acA	p.T11T		NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	11					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						AGCAGTTCACGGAACAGCAGC	0.622																																					p.T11T		.											.	LRRC8E	92	0			c.G33A						.						145.0	103.0	118.0					19																	7960521		2203	4300	6503	SO:0001819	synonymous_variant	80131	exon3			GTTCACGGAACAG		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.33G>A	19.37:g.7960521G>A		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	21.0	NM_001268284	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Silent	SNP	ENST00000306708.6	37	CCDS12189.1																																																																																			.		0.622	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061	
MAN2B1	4125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12757461	12757461	+	Silent	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:12757461T>C	ENST00000456935.2	-	24	3049	c.3009A>G	c.(3007-3009)tcA>tcG	p.S1003S	MAN2B1_ENST00000221363.4_Silent_p.S1002S|CTD-2192J16.22_ENST00000597692.1_Missense_Mutation_p.S190G	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	1003					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCCATTGAACTGAGGCCAGGA	0.617																																					p.S1003S		.											.	MAN2B1	94	0			c.A3009G						.						167.0	130.0	143.0					19																	12757461		2203	4300	6503	SO:0001819	synonymous_variant	4125	exon24			TTGAACTGAGGCC		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.3009A>G	19.37:g.12757461T>C		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	13.0	NM_000528	G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	37	CCDS32919.1																																																																																			.		0.617	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		
MAT1A	4143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	82036284	82036284	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr10:82036284A>C	ENST00000372213.3	-	6	876	c.616T>G	c.(616-618)Tct>Gct	p.S206A	MAT1A_ENST00000485270.1_5'Flank	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	206					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TGCTGCACAGAGATGACGATG	0.577																																					p.S206A		.											.	MAT1A	90	0			c.T616G						.						202.0	161.0	175.0					10																	82036284		2203	4300	6503	SO:0001583	missense	4143	exon6			GCACAGAGATGAC		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.616T>G	10.37:g.82036284A>C	ENSP00000361287:p.Ser206Ala	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	8.0	NM_000429	D3DWD5|Q5QP09	Missense_Mutation	SNP	ENST00000372213.3	37	CCDS7365.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.377786	0.61735	.	.	ENSG00000151224	ENST00000372213;ENST00000372206;ENST00000455001	D;D	0.86562	-2.14;-2.14	4.84	4.84	0.62591	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.93897	0.8047	H	0.96576	3.845	0.80722	D	1	B	0.20887	0.049	B	0.42214	0.38	D	0.93781	0.7084	10	0.72032	D	0.01	-28.2539	12.7009	0.57032	1.0:0.0:0.0:0.0	.	206	Q00266	METK1_HUMAN	A	206;206;143	ENSP00000361287:S206A;ENSP00000414961:S143A	ENSP00000361280:S206A	S	-	1	0	MAT1A	82026264	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	8.761000	0.91691	2.164000	0.68074	0.533000	0.62120	TCT	.		0.577	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
MUC2	4583	broad.mit.edu;bcgsc.ca	37	11	1092920	1092920	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:1092920C>A	ENST00000441003.2	+	30	4766	c.4739C>A	c.(4738-4740)aCc>aAc	p.T1580N	MUC2_ENST00000359061.5_Missense_Mutation_p.T1581N|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ggcacacagaccccaacatcg	0.632																																					p.T1580N		.											.	MUC2	90	0			c.C4739A						.						74.0	113.0	100.0					11																	1092920		1924	3573	5497	SO:0001583	missense	4583	exon30			CACAGACCCCAAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4739C>A	11.37:g.1092920C>A	ENSP00000415183:p.Thr1580Asn	Somatic	68.0	2.0		WXS	Illumina HiSeq	Phase_I	50.0	5.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.897	-0.228278	0.06022	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15952	2.38;2.53	1.75	-3.51	0.04696	.	7739.210000	0.00597	U	0.000365	T	0.08492	0.0211	.	.	.	0.09310	N	1	B	0.28026	0.198	B	0.17098	0.017	T	0.10776	-1.0615	9	0.27082	T	0.32	.	2.0197	0.03506	0.1703:0.3607:0.3305:0.1386	.	1580	E7EUV1	.	N	1580;1581	ENSP00000415183:T1580N;ENSP00000351956:T1581N	ENSP00000351956:T1581N	T	+	2	0	MUC2	1082920	0.001000	0.12720	0.000000	0.03702	0.071000	0.16799	1.304000	0.33482	-1.223000	0.02584	0.121000	0.15741	ACC	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MXRA5	25878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	3248697	3248697	+	Silent	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chrX:3248697G>A	ENST00000217939.6	-	3	460	c.306C>T	c.(304-306)ctC>ctT	p.L102L		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	102						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GAAGAGAGCTGAGGTCTCTTA	0.428																																					p.L102L		.											.	MXRA5	136	0			c.C306T						.						136.0	122.0	126.0					X																	3248697		2203	4300	6503	SO:0001819	synonymous_variant	25878	exon3			AGAGCTGAGGTCT	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.306C>T	X.37:g.3248697G>A		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	17.0	NM_015419	Q6P1M7|Q9Y3Y8	Silent	SNP	ENST00000217939.6	37	CCDS14124.1																																																																																			.		0.428	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
NCKAP1L	3071	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54910687	54910687	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr12:54910687T>C	ENST00000293373.6	+	11	1085	c.1006T>C	c.(1006-1008)Ttt>Ctt	p.F336L	NCKAP1L_ENST00000552211.1_3'UTR|NCKAP1L_ENST00000545638.2_Missense_Mutation_p.F286L	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	336					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TAGTGGCCAGTTTCATTGTCA	0.502																																					p.F336L		.											.	NCKAP1L	93	0			c.T1006C						.						125.0	117.0	120.0					12																	54910687		2203	4300	6503	SO:0001583	missense	3071	exon11			GGCCAGTTTCATT	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1006T>C	12.37:g.54910687T>C	ENSP00000293373:p.Phe336Leu	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	19.0	NM_005337	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.257099	0.39896	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.22134	1.97;1.97	5.19	5.19	0.71726	.	0.185508	0.51477	N	0.000097	T	0.08447	0.0210	N	0.03948	-0.315	0.37102	D	0.899939	B	0.06786	0.001	B	0.09377	0.004	T	0.13522	-1.0506	10	0.02654	T	1	-10.4278	13.278	0.60198	0.0:0.0:0.0:1.0	.	336	P55160	NCKPL_HUMAN	L	336;286	ENSP00000293373:F336L;ENSP00000445596:F286L	ENSP00000293373:F336L	F	+	1	0	NCKAP1L	53196954	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.527000	0.35975	2.084000	0.62774	0.482000	0.46254	TTT	.		0.502	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
NELL1	4745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	21592455	21592455	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:21592455G>T	ENST00000357134.5	+	18	2278	c.2126G>T	c.(2125-2127)tGg>tTg	p.W709L	NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000298925.5_Missense_Mutation_p.W737L|NELL1_ENST00000532434.1_Missense_Mutation_p.W662L|NELL1_ENST00000325319.5_Missense_Mutation_p.W652L	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	709	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GGAGACAATTGGACCCATAGC	0.448																																					p.W709L		.											.	NELL1	155	0			c.G2126T						.						197.0	186.0	190.0					11																	21592455		2203	4300	6503	SO:0001583	missense	4745	exon18			ACAATTGGACCCA	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2126G>T	11.37:g.21592455G>T	ENSP00000349654:p.Trp709Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	12.0	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.995299	0.93167	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	6.16	6.16	0.99307	von Willebrand factor, type C (3);	0.000000	0.85682	D	0.000000	D	0.92133	0.7506	H	0.94423	3.535	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.998;0.999;1.0;0.998	D	0.92447	0.5967	10	0.56958	D	0.05	-24.1435	20.8598	0.99761	0.0:0.0:1.0:0.0	.	652;737;254;662;709	F5H6I3;B3KXR2;Q8N9Z6;Q92832-2;Q92832	.;.;.;.;NELL1_HUMAN	L	737;709;652;662	ENSP00000298925:W737L;ENSP00000349654:W709L;ENSP00000317837:W652L;ENSP00000437170:W662L	ENSP00000298925:W737L	W	+	2	0	NELL1	21549031	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.447000	0.97595	2.937000	0.99478	0.650000	0.86243	TGG	.		0.448	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
NFU1	27247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	69650764	69650764	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:69650764C>A	ENST00000410022.2	-	3	457	c.252G>T	c.(250-252)agG>agT	p.R84S	NFU1_ENST00000394305.1_Intron|NFU1_ENST00000303698.3_Missense_Mutation_p.R60S|NFU1_ENST00000471185.1_Intron	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	84					iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						AATCCATGGTCCTTGTCTCAA	0.373																																					p.R84S		.											.	NFU1	90	0			c.G252T						.						100.0	100.0	100.0					2																	69650764		2203	4300	6503	SO:0001583	missense	27247	exon3			CATGGTCCTTGTC	AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.252G>T	2.37:g.69650764C>A	ENSP00000387219:p.Arg84Ser	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	25.0	NM_001002755	B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Missense_Mutation	SNP	ENST00000410022.2	37	CCDS33217.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.528097	0.44969	.	.	ENSG00000169599	ENST00000410022;ENST00000303698	T;T	0.62498	0.02;0.03	5.45	5.45	0.79879	NIF system FeS cluster assembly, NifU-like scaffold, N-terminal (4);	0.096119	0.64402	D	0.000001	T	0.42630	0.1211	N	0.05467	-0.045	0.80722	D	1	B;B	0.18310	0.007;0.027	B;B	0.22152	0.007;0.038	T	0.37174	-0.9717	10	0.48119	T	0.1	-0.0521	11.7654	0.51928	0.0:0.92:0.0:0.08	.	60;84	Q9UMS0-3;Q9UMS0	.;NFU1_HUMAN	S	84;60	ENSP00000387219:R84S;ENSP00000306965:R60S	ENSP00000306965:R60S	R	-	3	2	NFU1	69504268	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.088000	0.30877	2.566000	0.86566	0.638000	0.83543	AGG	.		0.373	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327279.3	NM_015700	
NOL6	65083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33465828	33465828	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr9:33465828C>T	ENST00000379471.2	-	19	2519	c.2432G>A	c.(2431-2433)aGc>aAc	p.S811N	NOL6_ENST00000464829.1_Intron|NOL6_ENST00000455041.2_Missense_Mutation_p.S759N			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	811					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CCCCTCTGGGCTCTGCACCTC	0.572																																					p.S811N		.											.	NOL6	92	0			c.G2432A						.						78.0	66.0	70.0					9																	33465828		2203	4300	6503	SO:0001583	missense	65083	exon19			TCTGGGCTCTGCA	AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.2432G>A	9.37:g.33465828C>T	ENSP00000368784:p.Ser811Asn	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	12.0	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	37		.	.	.	.	.	.	.	.	.	.	C	11.09	1.535200	0.27475	.	.	ENSG00000165271	ENST00000297990;ENST00000379471;ENST00000541373;ENST00000325914;ENST00000455041	T;T;T	0.43688	0.94;0.94;0.94	5.94	4.06	0.47325	.	0.123193	0.85682	N	0.000000	T	0.27169	0.0666	L	0.29908	0.895	0.40134	D	0.976759	B;B;B;B	0.18741	0.03;0.01;0.024;0.03	B;B;B;B	0.17098	0.017;0.006;0.01;0.017	T	0.08229	-1.0732	10	0.16420	T	0.52	.	8.618	0.33845	0.0:0.565:0.3433:0.0916	.	759;808;811;811	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4	.;.;.;NOL6_HUMAN	N	811;811;367;811;759	ENSP00000297990:S811N;ENSP00000368784:S811N;ENSP00000395915:S759N	ENSP00000297990:S811N	S	-	2	0	NOL6	33455828	1.000000	0.71417	0.999000	0.59377	0.355000	0.29361	1.888000	0.39708	1.513000	0.48852	0.563000	0.77884	AGC	.		0.572	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917	
NOTCH1	4851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139405212	139405212	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr9:139405212C>T	ENST00000277541.6	-	17	2708	c.2633G>A	c.(2632-2634)tGc>tAc	p.C878Y		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	878	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCCGTGCCGGCACGGGCTCAG	0.701			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.C878Y		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1	5459	0			c.G2633A						.						32.0	40.0	37.0					9																	139405212		2041	4168	6209	SO:0001583	missense	4851	exon17			TGCCGGCACGGGC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2633G>A	9.37:g.139405212C>T	ENSP00000277541:p.Cys878Tyr	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	17.0	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.828185	0.71143	.	.	ENSG00000148400	ENST00000277541	D	0.99445	-5.91	4.88	4.88	0.63580	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	H	0.99916	4.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96194	0.9140	10	0.87932	D	0	.	17.0189	0.86428	0.0:1.0:0.0:0.0	.	878	P46531	NOTC1_HUMAN	Y	878	ENSP00000277541:C878Y	ENSP00000277541:C878Y	C	-	2	0	NOTCH1	138525033	1.000000	0.71417	0.990000	0.47175	0.328000	0.28507	7.633000	0.83260	2.253000	0.74438	0.561000	0.74099	TGC	.		0.701	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
NPTX2	4885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98257930	98257930	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr7:98257930C>T	ENST00000265634.3	+	5	1450	c.1285C>T	c.(1285-1287)Ctt>Ttt	p.L429F		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	429	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			GGAGCGTCTCCTTGACTTGTA	0.577																																					p.L429F		.											.	NPTX2	515	0			c.C1285T						.						39.0	37.0	37.0					7																	98257930		2202	4300	6502	SO:0001583	missense	4885	exon5			CGTCTCCTTGACT		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1285C>T	7.37:g.98257930C>T	ENSP00000265634:p.Leu429Phe	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	12.0	NM_002523	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.643911	0.29246	.	.	ENSG00000106236	ENST00000265634	T	0.12147	2.71	5.94	5.06	0.68205	.	0.061993	0.64402	D	0.000006	T	0.04452	0.0122	N	0.00926	-1.1	0.35814	D	0.824057	B	0.06786	0.001	B	0.06405	0.002	T	0.27739	-1.0065	10	0.31617	T	0.26	-5.8534	8.9727	0.35917	0.1474:0.779:0.0:0.0736	.	429	P47972	NPTX2_HUMAN	F	429	ENSP00000265634:L429F	ENSP00000265634:L429F	L	+	1	0	NPTX2	98095866	0.675000	0.27558	0.980000	0.43619	0.796000	0.44982	1.270000	0.33086	1.531000	0.49152	0.561000	0.74099	CTT	.		0.577	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
NSRP1	84081	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	28506153	28506156	+	Frame_Shift_Del	DEL	AAGG	AAGG	-			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	AAGG	AAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr17:28506153_28506156delAAGG	ENST00000247026.5	+	5	409_412	c.346_349delAAGG	c.(346-351)aaggaafs	p.KE116fs	NSRP1_ENST00000540900.3_3'UTR	NM_001261467.1|NM_032141.3	NP_001248396.1|NP_115517.1	Q9H0G5	NSRP1_HUMAN	nuclear speckle splicing regulatory protein 1	116	Necessary for alternative splicing activity.				developmental process (GO:0032502)|mRNA processing (GO:0006397)|nucleocytoplasmic transport (GO:0006913)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	14						GATCAGAAAAAAGGAACAGGAAAA	0.304																																					p.116_117del		.											.	NSRP1	91	0			c.346_349del						.																																			SO:0001589	frameshift_variant	84081	exon5			AGAAAAAAGGAAC	AL136806	CCDS11255.1, CCDS74025.1	17q11.2	2011-05-24	2011-05-24	2011-05-24	ENSG00000126653	ENSG00000126653			25305	protein-coding gene	gene with protein product			"""coiled-coil domain containing 55"""	CCDC55		11230166	Standard	NM_032141		Approved	DKFZP434K1421, NSrp70	uc002heu.4	Q9H0G5	OTTHUMG00000132754	ENST00000247026.5:c.346_349delAAGG	17.37:g.28506153_28506156delAAGG	ENSP00000247026:p.Lys116fs	Somatic	290.0	0.0		WXS	Illumina HiSeq	Phase_I	256.0	58.0	NM_032141	Q6FI71	Frame_Shift_Del	DEL	ENST00000247026.5	37	CCDS11255.1																																																																																			.		0.304	NSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256121.2	NM_032141	
OR51I1	390063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5462429	5462429	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:5462429T>C	ENST00000380211.1	-	1	315	c.316A>G	c.(316-318)Atc>Gtc	p.I106V	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	106					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAGTGTGGATGAAGAACATC	0.458																																					p.I106V		.											.	OR51I1	69	0			c.A316G						.						141.0	121.0	128.0					11																	5462429		2201	4297	6498	SO:0001583	missense	390063	exon1			TGTGGATGAAGAA	BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.316A>G	11.37:g.5462429T>C	ENSP00000369559:p.Ile106Val	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	20.0	NM_001005288	B9EKW2|Q6IF33	Missense_Mutation	SNP	ENST00000380211.1	37	CCDS31382.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.820884	0.32237	.	.	ENSG00000167359	ENST00000317283;ENST00000321307;ENST00000380211	T	0.03004	4.08	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.110949	0.39687	N	0.001296	T	0.05181	0.0138	L	0.50847	1.595	0.26143	N	0.980245	B	0.21753	0.06	B	0.18263	0.021	T	0.19647	-1.0299	10	0.66056	D	0.02	.	10.0601	0.42270	0.0:0.0793:0.0:0.9207	.	106	Q9H343	O51I1_HUMAN	V	91;103;106	ENSP00000369559:I106V	ENSP00000348350:I91V	I	-	1	0	OR51I1	5419005	0.206000	0.23470	1.000000	0.80357	0.898000	0.52572	0.817000	0.27281	2.169000	0.68431	0.450000	0.29827	ATC	.		0.458	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143399.1	NM_001005288	
PADI1	29943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17565194	17565194	+	Silent	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr1:17565194C>T	ENST00000375471.4	+	13	1634	c.1542C>T	c.(1540-1542)gcC>gcT	p.A514A	PADI1_ENST00000413717.2_Silent_p.A71A|PADI1_ENST00000537499.1_Silent_p.A71A|PADI1_ENST00000536552.1_5'UTR	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	514					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GGGAGGCAGCCCAGTTTGATG	0.612																																					p.A514A	Esophageal Squamous(80;414 1257 4580 27746 50832)	.											.	PADI1	68	0			c.C1542T						.						42.0	39.0	40.0					1																	17565194		2203	4300	6503	SO:0001819	synonymous_variant	29943	exon13			GGCAGCCCAGTTT	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1542C>T	1.37:g.17565194C>T		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	18.0	NM_013358	A1L4K6|Q70SX6	Silent	SNP	ENST00000375471.4	37	CCDS178.1																																																																																			.		0.612	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006621.1	NM_013358	
PCDH10	57575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	134071449	134071449	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:134071449G>A	ENST00000264360.5	+	1	980	c.154G>A	c.(154-156)Ggg>Agg	p.G52R	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	52	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G52W(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TTCGGCTCGCGGGTTTCAGAC	0.522																																					p.G52R		.											.	PCDH10	92	1	Substitution - Missense(1)	lung(1)	c.G154A						.						100.0	101.0	100.0					4																	134071449		2203	4300	6503	SO:0001583	missense	57575	exon1			GCTCGCGGGTTTC	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.154G>A	4.37:g.134071449G>A	ENSP00000264360:p.Gly52Arg	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	19.0	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	0.290	-0.980606	0.02197	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.28069	1.63	4.77	-2.74	0.05932	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.568307	0.14595	N	0.310037	T	0.08044	0.0201	N	0.01284	-0.91	0.29296	N	0.869002	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.34950	-0.9808	10	0.19590	T	0.45	.	6.4676	0.21990	0.3755:0.3283:0.2962:0.0	.	52;52	Q9P2E7;Q96SF0	PCD10_HUMAN;.	R	52	ENSP00000264360:G52R	ENSP00000264360:G52R	G	+	1	0	PCDH10	134290899	1.000000	0.71417	0.994000	0.49952	0.913000	0.54294	1.734000	0.38166	-0.267000	0.09325	-0.378000	0.06908	GGG	.		0.522	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
PCDHA7	56141	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140214367	140214367	+	Frame_Shift_Del	DEL	C	C	-			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr5:140214367delC	ENST00000525929.1	+	1	399	c.399delC	c.(397-399)ttcfs	p.F133fs	PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Frame_Shift_Del_p.F133fs	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	133	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCGGTGTTCCCAGCGACAC	0.582																																					p.F133fs	NSCLC(160;258 2013 5070 22440 28951)	.											.	PCDHA7	94	0			c.399delC						.						106.0	101.0	103.0					5																	140214367		2203	4300	6503	SO:0001589	frameshift_variant	56141	exon1			GGTGTTCCCAGCG	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.399delC	5.37:g.140214367delC	ENSP00000436426:p.Phe133fs	Somatic	405.0	0.0		WXS	Illumina HiSeq	Phase_I	328.0	94.0	NM_031852	O75282	Frame_Shift_Del	DEL	ENST00000525929.1	37	CCDS54918.1																																																																																			.		0.582	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PDE3A	5139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	20766493	20766493	+	Silent	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr12:20766493C>A	ENST00000359062.3	+	3	1168	c.1128C>A	c.(1126-1128)gcC>gcA	p.A376A	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	376					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CCTTGAGAGCCGTGAGCAACT	0.552																																					p.A376A		.											.	PDE3A	94	0			c.C1128A						.						109.0	100.0	103.0					12																	20766493		2203	4300	6503	SO:0001819	synonymous_variant	5139	exon3			GAGAGCCGTGAGC		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1128C>A	12.37:g.20766493C>A		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	22.0	NM_000921	O60865|Q13348|Q17RD1	Silent	SNP	ENST00000359062.3	37	CCDS31754.1																																																																																			.		0.552	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
PLCB4	5332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	9449315	9449315	+	Nonsense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr20:9449315G>T	ENST00000378493.1	+	32	3325	c.3310G>T	c.(3310-3312)Gaa>Taa	p.E1104*	PLCB4_ENST00000334005.3_Nonsense_Mutation_p.E1104*|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000414679.2_Nonsense_Mutation_p.E1116*|PLCB4_ENST00000278655.4_Nonsense_Mutation_p.E1104*|PLCB4_ENST00000378473.3_Nonsense_Mutation_p.E1116*|PLCB4_ENST00000378501.2_Nonsense_Mutation_p.E1104*			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	1104					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						AGCAGAACGGGAAAGGTAAGT	0.418																																					p.E1116X		.											.	PLCB4	274	0			c.G3346T						.						109.0	98.0	102.0					20																	9449315		2203	4300	6503	SO:0001587	stop_gained	5332	exon35			GAACGGGAAAGGT		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.3310G>T	20.37:g.9449315G>T	ENSP00000367754:p.Glu1104*	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	18.0	NM_001172646	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Nonsense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	G	44	11.195880	0.99529	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.9433	0.97172	0.0:0.0:1.0:0.0	.	.	.	.	X	1104;1116;1104;1104;1104;952	.	ENSP00000278655:E1104X	E	+	1	0	PLCB4	9397315	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.054000	0.93866	2.716000	0.92895	0.655000	0.94253	GAA	.		0.418	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PNLDC1	154197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160237044	160237044	+	Missense_Mutation	SNP	G	G	T	rs137878641	byFrequency	TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr6:160237044G>T	ENST00000610273.1	+	13	1177	c.1006G>T	c.(1006-1008)Gcg>Tcg	p.A336S	PNLDC1_ENST00000392167.3_Missense_Mutation_p.A347S	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	336						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GATTGTTCACGCGAGCAGGTG	0.448																																					p.A336S		.											.	PNLDC1	90	0			c.G1006T						.						124.0	108.0	114.0					6																	160237044		2203	4300	6503	SO:0001583	missense	154197	exon13			GTTCACGCGAGCA	AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.1006G>T	6.37:g.160237044G>T	ENSP00000476448:p.Ala336Ser	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	11.0	NM_173516	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	ENST00000610273.1	37	CCDS5271.1	.	.	.	.	.	.	.	.	.	.	G	7.262	0.605325	0.14002	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	T;T	0.20463	2.07;2.07	4.78	0.623	0.17654	Ribonuclease H-like (1);	0.721130	0.12837	N	0.435169	T	0.06096	0.0158	L	0.35644	1.08	0.09310	N	1	B;P	0.48230	0.405;0.907	B;B	0.43052	0.115;0.406	T	0.32455	-0.9906	10	0.12103	T	0.63	.	12.0983	0.53767	0.0:0.0:0.3997:0.6002	.	347;336	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	S	336;347	ENSP00000275275:A336S;ENSP00000376007:A347S	ENSP00000275275:A336S	A	+	1	0	PNLDC1	160157034	0.557000	0.26546	0.002000	0.10522	0.039000	0.13416	2.252000	0.43196	-0.070000	0.12908	-0.558000	0.04189	GCG	G|0.999;A|0.001		0.448	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_173516	
POSTN	10631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	38162065	38162065	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr13:38162065C>T	ENST00000379747.4	-	5	617	c.500G>A	c.(499-501)aGt>aAt	p.S167N	POSTN_ENST00000541179.1_Missense_Mutation_p.S167N|POSTN_ENST00000379743.4_Missense_Mutation_p.S167N|POSTN_ENST00000379742.4_Missense_Mutation_p.S167N|POSTN_ENST00000541481.1_Missense_Mutation_p.S167N|POSTN_ENST00000379749.4_Missense_Mutation_p.S167N	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	167	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		AATCATGTGACTATGTAAAGC	0.323																																					p.S167N		.											.	POSTN	516	0			c.G500A						.						109.0	106.0	107.0					13																	38162065		2203	4295	6498	SO:0001583	missense	10631	exon5			ATGTGACTATGTA	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.500G>A	13.37:g.38162065C>T	ENSP00000369071:p.Ser167Asn	Somatic	356.0	0.0		WXS	Illumina HiSeq	Phase_I	317.0	102.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	C	6.583	0.475857	0.12521	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.82	4.03	0.46877	FAS1 domain (5);	0.230310	0.53938	D	0.000058	T	0.72087	0.3417	N	0.02916	-0.46	0.24834	N	0.992509	B;B;B;B;B;B;B	0.13145	0.007;0.003;0.004;0.003;0.005;0.002;0.004	B;B;B;B;B;B;B	0.18561	0.022;0.013;0.012;0.013;0.013;0.007;0.012	T	0.62163	-0.6912	10	0.48119	T	0.1	-19.1093	5.578	0.17235	0.0:0.4952:0.3483:0.1564	.	167;167;167;167;167;167;167	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	N	167;167;167;167;167;167;84	ENSP00000437959:S167N;ENSP00000369073:S167N;ENSP00000369071:S167N;ENSP00000369067:S167N;ENSP00000369066:S167N;ENSP00000437953:S167N	ENSP00000369066:S167N	S	-	2	0	POSTN	37060065	1.000000	0.71417	0.967000	0.41034	0.005000	0.04900	4.633000	0.61318	0.745000	0.32763	-0.499000	0.04595	AGT	.		0.323	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
PPIG	9360	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170460700	170460700	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:170460700G>T	ENST00000260970.3	+	4	285	c.65G>T	c.(64-66)gGa>gTa	p.G22V	PPIG_ENST00000462903.1_Missense_Mutation_p.G22V|PPIG_ENST00000448752.2_Missense_Mutation_p.G22V|PPIG_ENST00000409714.3_Missense_Mutation_p.G22V	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	22	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	TTTTCAGCTGGAAGAGTTGTC	0.323																																					p.G22V		.											.	PPIG	92	0			c.G65T						.						126.0	127.0	126.0					2																	170460700		2202	4300	6502	SO:0001583	missense	9360	exon4			CAGCTGGAAGAGT	X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.65G>T	2.37:g.170460700G>T	ENSP00000260970:p.Gly22Val	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	26.0	NM_004792	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Missense_Mutation	SNP	ENST00000260970.3	37	CCDS2235.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.709286	0.89018	.	.	ENSG00000138398	ENST00000260970;ENST00000530133;ENST00000409714;ENST00000462903;ENST00000448752;ENST00000418888;ENST00000414307	D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.13	5.13	0.70059	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	D	0.94716	0.8295	H	0.97491	4.015	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.96502	0.9372	10	0.87932	D	0	-19.8119	18.9436	0.92613	0.0:0.0:1.0:0.0	.	22;22;22;22	E9PG73;Q2NKQ6;Q13427-2;Q13427	.;.;.;PPIG_HUMAN	V	22	ENSP00000260970:G22V;ENSP00000386245:G22V;ENSP00000435987:G22V;ENSP00000407083:G22V;ENSP00000394202:G22V;ENSP00000402222:G22V	ENSP00000260970:G22V	G	+	2	0	PPIG	170168946	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.694000	0.98686	2.541000	0.85698	0.591000	0.81541	GGA	.		0.323	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255264.2		
PRDM9	56979	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	23526529	23526529	+	Silent	SNP	A	A	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr5:23526529A>G	ENST00000296682.3	+	11	1514	c.1332A>G	c.(1330-1332)ccA>ccG	p.P444P		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	444					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ATCCAGATCCACACAGCCGTA	0.468										HNSCC(3;0.000094)																											p.P444P		.											.	PRDM9	139	0			c.A1332G						.						72.0	71.0	71.0					5																	23526529		2203	4300	6503	SO:0001819	synonymous_variant	56979	exon11			AGATCCACACAGC	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1332A>G	5.37:g.23526529A>G		Somatic	115.0	1.0		WXS	Illumina HiSeq	Phase_I	87.0	25.0	NM_020227	B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	CCDS43307.1																																																																																			.		0.468	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
PRKCQ	5588	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	6498670	6498670	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr10:6498670G>T	ENST00000263125.5	-	15	1712	c.1613C>A	c.(1612-1614)aCc>aAc	p.T538N	PRKCQ_ENST00000539722.1_Missense_Mutation_p.T413N|PRKCQ_ENST00000397176.2_Missense_Mutation_p.T538N	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	538	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CCCACAGAAGGTATTCGTCTT	0.493																																					p.T538N	Ovarian(50;572 1126 10530 25349 30594)	.											.	PRKCQ	1380	0			c.C1613A						.						274.0	209.0	231.0					10																	6498670		2203	4300	6503	SO:0001583	missense	5588	exon15			CAGAAGGTATTCG	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1613C>A	10.37:g.6498670G>T	ENSP00000263125:p.Thr538Asn	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	16.0	NM_006257	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.81|17.81	3.481039|3.481039	0.63849|0.63849	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|T;T;T	.|0.67171	.|-0.25;-0.25;-0.25	5.4|5.4	5.4|5.4	0.78164|0.78164	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.84005|0.84005	0.5377|0.5377	M|M	0.82630|0.82630	2.6|2.6	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999	.|D;D;D;D	.|0.91635	.|0.998;0.994;0.999;0.997	D|D	0.86216|0.86216	0.1628|0.1628	5|10	.|0.87932	.|D	.|0	.|.	19.1852|19.1852	0.93641|0.93641	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|413;310;538;538	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	T|N	311|538;538;413	.|ENSP00000263125:T538N;ENSP00000380361:T538N;ENSP00000441752:T413N	.|ENSP00000263125:T538N	P|T	-|-	1|2	0|0	PRKCQ|PRKCQ	6538676|6538676	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.085000|0.085000	0.17905|0.17905	9.551000|9.551000	0.98112|0.98112	2.510000|2.510000	0.84645|0.84645	0.557000|0.557000	0.71058|0.71058	CCT|ACC	.		0.493	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
PRMT9	90826	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	148579096	148579097	+	Frame_Shift_Ins	INS	-	-	AGGCTTTTTAGTTGCA			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr4:148579096_148579097insAGGCTTTTTAGTTGCA	ENST00000322396.6	-	8	1418_1419	c.1176_1177insTGCAACTAAAAAGCCT	c.(1174-1179)cctgatfs	p.D393fs	PRMT10_ENST00000541232.1_Frame_Shift_Ins_p.D280fs|TMEM184C_ENST00000508208.1_Intron	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		393	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						CCAATCTTATCAGGCTTTTTAG	0.332																																					p.D393_K394delinsCNX		.											.	PRMT10	91	0			c.1177_1178insTGCAACTAAAAAGCCT						.																																			SO:0001589	frameshift_variant	90826	exon8			TCTTATCAGGCTT																												ENST00000322396.6:c.1161_1176dupTGCAACTAAAAAGCCT	4.37:g.148579096_148579097insAGGCTTTTTAGTTGCA	ENSP00000314396:p.Asp393fs	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	21.0	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Nonsense_Mutation	INS	ENST00000322396.6	37	CCDS3771.1																																																																																			.		0.332	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
PRUNE2	158471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	79320343	79320343	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr9:79320343C>T	ENST00000376718.3	-	8	6970	c.6847G>A	c.(6847-6849)Gat>Aat	p.D2283N	PRUNE2_ENST00000428286.1_Missense_Mutation_p.D1924N	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2283					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AGCAAAGCATCAGGAACCAAG	0.473																																					p.D2283N		.											.	PRUNE2	157	0			c.G6847A						.						56.0	51.0	53.0					9																	79320343		1568	3582	5150	SO:0001583	missense	158471	exon8			AAGCATCAGGAAC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6847G>A	9.37:g.79320343C>T	ENSP00000365908:p.Asp2283Asn	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	16.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	17.04	3.288435	0.59976	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.53857	0.6;0.62	5.66	3.77	0.43336	.	0.797388	0.11280	N	0.580461	T	0.49304	0.1549	M	0.62723	1.935	0.23346	N	0.997861	B	0.18461	0.028	B	0.15052	0.012	T	0.38628	-0.9652	10	0.32370	T	0.25	-1.1507	10.0639	0.42292	0.0:0.7902:0.1368:0.073	.	2283	Q8WUY3	PRUN2_HUMAN	N	2283;1924;2282	ENSP00000365908:D2283N;ENSP00000397425:D1924N	ENSP00000365908:D2283N	D	-	1	0	PRUNE2	78510163	0.002000	0.14202	0.001000	0.08648	0.758000	0.43043	1.527000	0.35975	0.691000	0.31592	0.655000	0.94253	GAT	.		0.473	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PSMA1	5682	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	14535383	14535383	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:14535383G>C	ENST00000396394.2	-	6	790	c.394C>G	c.(394-396)Ctc>Gtc	p.L132V	PSMA1_ENST00000419365.2_Intron|PSMA1_ENST00000396393.1_Missense_Mutation_p.L132V|PSMA1_ENST00000530457.1_Missense_Mutation_p.L107V|PSMA1_ENST00000418988.2_Missense_Mutation_p.L138V|PSMA1_ENST00000524606.1_5'Flank|PSMA1_ENST00000555531.1_Intron	NM_002786.3	NP_002777.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1	132					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						GCAATAAGGAGACCAACACCA	0.318																																					p.L138V		.											.	PSMA1	92	0			c.C412G						.						74.0	72.0	72.0					11																	14535383		2200	4294	6494	SO:0001583	missense	5682	exon7			TAAGGAGACCAAC	X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000396394.2:c.394C>G	11.37:g.14535383G>C	ENSP00000379676:p.Leu132Val	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	17.0	NM_148976	A8K400|Q53YE8|Q9BRV9	Missense_Mutation	SNP	ENST00000396394.2	37	CCDS7816.1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902099	0.72754	.	.	ENSG00000129084	ENST00000396394;ENST00000396393;ENST00000530457;ENST00000418988	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.4	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.53722	0.1814	H	0.94698	3.57	0.80722	D	1	D;D	0.54601	0.959;0.967	P;P	0.53360	0.602;0.724	T	0.69224	-0.5201	10	0.72032	D	0.01	-9.63	14.0814	0.64925	0.0727:0.0:0.9273:0.0	.	138;132	P25786-2;P25786	.;PSA1_HUMAN	V	132;132;107;138	ENSP00000379676:L132V;ENSP00000379675:L132V;ENSP00000441166:L107V;ENSP00000414359:L138V	ENSP00000379675:L132V	L	-	1	0	PSMA1	14491959	1.000000	0.71417	0.999000	0.59377	0.923000	0.55619	3.492000	0.53259	1.287000	0.44583	0.591000	0.81541	CTC	.		0.318	PSMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386421.3	NM_002786	
RAG1	5896	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	36596559	36596559	+	Missense_Mutation	SNP	G	G	T	rs138101978		TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:36596559G>T	ENST00000299440.5	+	2	1817	c.1705G>T	c.(1705-1707)Gct>Tct	p.A569S		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	569					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				TTTGGTGTCTGCTTTGATGGA	0.478									Familial Hemophagocytic Lymphohistiocytosis																												p.A569S	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	.											.	RAG1	230	0			c.G1705T						.	G	SER/ALA	0,4404		0,0,2202	111.0	94.0	100.0		1705	5.8	0.6	11	dbSNP_134	100	2,8594	2.2+/-6.3	0,2,4296	no	missense	RAG1	NM_000448.2	99	0,2,6498	TT,TG,GG		0.0233,0.0,0.0154	benign	569/1044	36596559	2,12998	2202	4298	6500	SO:0001583	missense	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GTGTCTGCTTTGA	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1705G>T	11.37:g.36596559G>T	ENSP00000299440:p.Ala569Ser	Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	62.0	18.0	NM_000448	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135925	0.77662	0.0	2.33E-4	ENSG00000166349	ENST00000534663;ENST00000299440	D;D	0.87029	-2.2;-2.2	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.95739	0.8614	H	0.94734	3.575	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.96249	0.9182	10	0.87932	D	0	.	20.133	0.98004	0.0:0.0:1.0:0.0	.	569	P15918	RAG1_HUMAN	S	569	ENSP00000434610:A569S;ENSP00000299440:A569S	ENSP00000299440:A569S	A	+	1	0	RAG1	36553135	1.000000	0.71417	0.609000	0.28983	0.997000	0.91878	7.647000	0.83462	2.760000	0.94817	0.644000	0.83932	GCT	G|1.000;T|0.000		0.478	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
SCN1B	6324	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35524522	35524522	+	Silent	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:35524522C>T	ENST00000262631.5	+	3	464	c.327C>T	c.(325-327)acC>acT	p.T109T	SCN1B_ENST00000415950.3_Silent_p.T109T|SCN1B_ENST00000596348.1_3'UTR|CTD-2527I21.9_ENST00000601692.1_RNA|SCN1B_ENST00000595652.1_Intron	NM_001037.4	NP_001028.1	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta subunit	109	Ig-like C2-type.				axon guidance (GO:0007411)|cardiac conduction (GO:0061337)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|corticospinal neuron axon guidance (GO:0021966)|locomotion (GO:0040011)|membrane depolarization (GO:0051899)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during Purkinje myocyte cell action potential (GO:0086047)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|intercalated disc (GO:0014704)|node of Ranvier (GO:0033268)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)|voltage-gated sodium channel activity involved in Purkinje myocyte action potential (GO:0086062)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	11	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTCATCACCAATGTCACCT	0.572																																					p.T109T		.											.	SCN1B	91	0			c.C327T						.						196.0	164.0	175.0					19																	35524522		2203	4300	6503	SO:0001819	synonymous_variant	6324	exon3			CATCACCAATGTC		CCDS12441.1, CCDS46047.1	19q13.12	2014-09-17	2012-02-28		ENSG00000105711	ENSG00000105711		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10586	protein-coding gene	gene with protein product		600235	"""sodium channel, voltage-gated, type I, beta polypeptide"", ""sodium channel, voltage-gated, type I, beta"""			8394762	Standard	NM_001037		Approved		uc002nxo.2	Q07699	OTTHUMG00000182472	ENST00000262631.5:c.327C>T	19.37:g.35524522C>T		Somatic	73.0	1.0		WXS	Illumina HiSeq	Phase_I	65.0	26.0	NM_001037	Q5TZZ4|Q6TN97	Silent	SNP	ENST00000262631.5	37	CCDS12441.1																																																																																			.		0.572	SCN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461567.1		
SCN2A	6326	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	166229735	166229735	+	Splice_Site	SNP	G	G	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:166229735G>C	ENST00000375437.2	+	21	4140	c.3850G>C	c.(3850-3852)Gtc>Ctc	p.V1284L	SCN2A_ENST00000283256.6_Splice_Site_p.V1284L|SCN2A_ENST00000357398.3_Splice_Site_p.V1284L|SCN2A_ENST00000375427.2_Splice_Site_p.V1284L	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1284					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCTGTATAGGTCTCACTGGT	0.393																																					p.V1284L		.											.	SCN2A	142	0			c.G3850C						.						142.0	142.0	142.0					2																	166229735		2203	4300	6503	SO:0001630	splice_region_variant	6326	exon20			GTATAGGTCTCAC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3850-1G>C	2.37:g.166229735G>C		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	21.0	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643486	0.87859	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.97279	-4.32;-4.32;-4.32;-4.32	5.78	5.78	0.91487	Ion transport (1);	0.190914	0.36815	N	0.002394	D	0.97974	0.9333	M	0.72894	2.215	0.58432	D	0.999996	D;D	0.71674	0.998;0.996	D;D	0.85130	0.971;0.997	D	0.97450	1.0027	9	.	.	.	.	13.5635	0.61804	0.0711:0.0:0.9289:0.0	.	1284;1284	Q99250-2;Q99250	.;SCN2A_HUMAN	L	1284	ENSP00000364586:V1284L;ENSP00000349973:V1284L;ENSP00000283256:V1284L;ENSP00000364576:V1284L	.	V	+	1	0	SCN2A	165937981	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.872000	0.75536	2.894000	0.99253	0.655000	0.94253	GTC	.		0.393	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	Missense_Mutation
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47162395	47162395	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr3:47162395G>A	ENST00000409792.3	-	3	3773	c.3731C>T	c.(3730-3732)cCa>cTa	p.P1244L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1244					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCCACATGTGGTATCTCACA	0.443			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.P1244L		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.C3731T						.						110.0	110.0	110.0					3																	47162395		2203	4300	6503	SO:0001583	missense	29072	exon3			ACATGTGGTATCT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.3731C>T	3.37:g.47162395G>A	ENSP00000386759:p.Pro1244Leu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	7.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	9.177	1.022546	0.19433	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.87809	-2.3;1.57	5.28	5.28	0.74379	.	0.104145	0.43260	D	0.000581	T	0.78285	0.4259	N	0.08118	0	0.35744	D	0.818904	B;B	0.19817	0.039;0.039	B;B	0.16722	0.016;0.01	T	0.78069	-0.2348	10	0.87932	D	0	.	19.111	0.93317	0.0:0.0:1.0:0.0	.	1244;1244	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	1244;1244;1244;1200	ENSP00000386759:P1244L;ENSP00000416401:P1200L	ENSP00000386759:P1244L	P	-	2	0	SETD2	47137399	0.922000	0.31269	0.309000	0.25155	0.008000	0.06430	3.949000	0.56668	2.756000	0.94617	0.655000	0.94253	CCA	.		0.443	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SEZ6L2	26470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	29891311	29891311	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr16:29891311G>A	ENST00000308713.5	-	9	1974	c.1447C>T	c.(1447-1449)Cca>Tca	p.P483S	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.P413S|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.P439S|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.P369S	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	483	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTGCCCCTGGGCGATACTCA	0.592																																					p.P483S		.											.	SEZ6L2	92	0			c.C1447T						.						89.0	77.0	81.0					16																	29891311		2197	4300	6497	SO:0001583	missense	26470	exon9			CCCCTGGGCGATA	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1447C>T	16.37:g.29891311G>A	ENSP00000312550:p.Pro483Ser	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	14.0	NM_001243332	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026869	0.75390	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.26	5.26	0.73747	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.56097	D	0.000028	T	0.61751	0.2372	L	0.40543	1.245	0.42829	D	0.994015	B;B;D;P;P;B	0.53312	0.008;0.01;0.959;0.879;0.901;0.008	B;B;P;B;P;B	0.50049	0.012;0.012;0.629;0.399;0.534;0.013	T	0.64672	-0.6352	10	0.59425	D	0.04	.	13.3502	0.60597	0.0:0.0:0.8416:0.1584	.	439;483;369;413;483;413	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	S	413;483;369;439	ENSP00000310206:P413S;ENSP00000312550:P483S;ENSP00000319215:P369S;ENSP00000439412:P439S	ENSP00000312550:P483S	P	-	1	0	SEZ6L2	29798812	0.964000	0.33143	1.000000	0.80357	0.869000	0.49853	1.419000	0.34793	2.735000	0.93741	0.655000	0.94253	CCA	.		0.592	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
SIGLEC9	27180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51630358	51630358	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:51630358G>A	ENST00000250360.3	+	4	887	c.820G>A	c.(820-822)Gtt>Att	p.V274I	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.V274I	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	274	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GGTCTGTGCAGTTGATGCAGT	0.587																																					p.V274I		.											.	SIGLEC9	91	0			c.G820A						.						107.0	103.0	104.0					19																	51630358		2203	4300	6503	SO:0001583	missense	27180	exon4			TGTGCAGTTGATG	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.820G>A	19.37:g.51630358G>A	ENSP00000250360:p.Val274Ile	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	8.0	NM_001198558	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	8.166	0.790530	0.16258	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.12672	2.66;2.66	.	.	.	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.114660	0.07119	N	0.843648	T	0.10680	0.0261	L	0.36672	1.1	0.09310	N	1	B	0.26002	0.139	B	0.21360	0.034	T	0.37244	-0.9714	8	0.62326	D	0.03	.	.	.	.	.	274	Q9Y336	SIGL9_HUMAN	I	274	ENSP00000413861:V274I;ENSP00000250360:V274I	ENSP00000250360:V274I	V	+	1	0	SIGLEC9	56322170	0.523000	0.26274	0.105000	0.21289	0.118000	0.20060	0.064000	0.14437	0.088000	0.17205	0.089000	0.15464	GTT	.		0.587	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
SLC47A1	55244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19459199	19459199	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr17:19459199A>G	ENST00000270570.4	+	9	916	c.830A>G	c.(829-831)tAt>tGt	p.Y277C	SLC47A1_ENST00000575023.1_Intron|SLC47A1_ENST00000457293.1_Missense_Mutation_p.Y277C|SNORA59B_ENST00000458926.1_RNA|SLC47A1_ENST00000571335.1_Missense_Mutation_p.Y82C|SLC47A1_ENST00000436810.2_Missense_Mutation_p.Y254C|SLC47A1_ENST00000542886.1_Silent_p.L244L|SLC47A1_ENST00000395585.1_Missense_Mutation_p.Y277C	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	277					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	TGGTGGGCCTATGAGGTCGGG	0.642																																					p.Y277C		.											.	SLC47A1	90	0			c.A830G						.						41.0	37.0	39.0					17																	19459199		2203	4300	6503	SO:0001583	missense	55244	exon9			GGGCCTATGAGGT		CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.830A>G	17.37:g.19459199A>G	ENSP00000270570:p.Tyr277Cys	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	7.0	NM_018242	Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Missense_Mutation	SNP	ENST00000270570.4	37	CCDS11209.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.492914	0.64074	.	.	ENSG00000142494	ENST00000436810;ENST00000270570;ENST00000457293;ENST00000395585;ENST00000455670	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.54	5.54	0.83059	.	0.110737	0.64402	D	0.000005	T	0.62405	0.2425	M	0.92880	3.355	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0	D;D;D;D;D	0.85130	0.984;0.997;0.99;0.994;0.987	T	0.70769	-0.4782	10	0.87932	D	0	-9.0532	10.161	0.42851	0.8514:0.0:0.0:0.1486	.	11;254;11;277;277	E7ENC3;E7EX57;B4DDH5;Q96FL8;Q96FL8-3	.;.;.;S47A1_HUMAN;.	C	254;277;277;277;11	ENSP00000407155:Y254C;ENSP00000270570:Y277C;ENSP00000415586:Y277C;ENSP00000378951:Y277C	ENSP00000270570:Y277C	Y	+	2	0	SLC47A1	19399791	0.036000	0.19791	0.999000	0.59377	0.994000	0.84299	0.423000	0.21313	2.104000	0.64026	0.533000	0.62120	TAT	.		0.642	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132250.1	NM_018242	
SOX2	6657	ucsc.edu;mdanderson.org	37	3	181431520	181431520	+	3'UTR	SNP	T	T	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr3:181431520T>G	ENST00000325404.1	+	0	1799					NM_003106.3	NP_003097.1	P48431	SOX2_HUMAN	SRY (sex determining region Y)-box 2						adenohypophysis development (GO:0021984)|cell cycle arrest (GO:0007050)|cerebral cortex development (GO:0021987)|chromatin organization (GO:0006325)|detection of mechanical stimulus involved in equilibrioception (GO:0050973)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|diencephalon morphogenesis (GO:0048852)|endodermal cell fate specification (GO:0001714)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|eye development (GO:0001654)|forebrain development (GO:0030900)|forebrain neuron differentiation (GO:0021879)|glial cell fate commitment (GO:0021781)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|male genitalia development (GO:0030539)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|osteoblast differentiation (GO:0001649)|pigment biosynthetic process (GO:0046148)|pituitary gland development (GO:0021983)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to growth factor (GO:0070848)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|retina morphogenesis in camera-type eye (GO:0060042)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	10	all_cancers(143;1.22e-16)|Ovarian(172;0.0283)		all cancers(12;1.82e-48)|Epithelial(37;9.85e-40)|OV - Ovarian serous cystadenocarcinoma(80;7.37e-23)|Lung(8;2.01e-21)|GBM - Glioblastoma multiforme(1;2.13e-08)			CCAATAATATTTAGAGCTAGT	0.338			A		"""NSCLC, oesophageal squamous carcinoma"""		MICROPHTHALMIA AND ESOPHAGEAL ATRESIA SYNDROME																														.		.		Dom	yes		3	3q26.3-q27	6657	SRY (sex determining region Y)-box 2	yes	E	.	SOX2	650	0			.						.																																			SO:0001624	3_prime_UTR_variant	6657	.			TAATATTTAGAGC	BC013923	CCDS3239.1	3q26.3-q27	2014-09-17						"""SRY (sex determining region Y)-boxes"""	11195	protein-coding gene	gene with protein product		184429				7849401	Standard	NM_003106		Approved		uc003fkx.3	P48431		ENST00000325404.1:c.*418T>G	3.37:g.181431520T>G		Somatic	251.0	0.0		WXS	Illumina HiSeq	.	198.0	61.0	.	Q14537	RNA	SNP	ENST00000325404.1	37	CCDS3239.1																																																																																			.		0.338	SOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350419.1	NM_003106	
SPANXC	64663	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	140335728	140335728	+	Silent	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chrX:140335728G>T	ENST00000358993.2	-	2	254	c.216C>A	c.(214-216)gcC>gcA	p.A72A		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	72						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					TGTTCTCTCGGGCGTGGTCAT	0.448																																					p.A72A		.											.	SPANXC	62	0			c.C216A						.						158.0	127.0	138.0					X																	140335728		2136	4132	6268	SO:0001819	synonymous_variant	64663	exon2			CTCTCGGGCGTGG	AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.216C>A	X.37:g.140335728G>T		Somatic	219.0	0.0		WXS	Illumina HiSeq	Phase_I	308.0	165.0	NM_022661	Q32WL9|Q5JX88	Silent	SNP	ENST00000358993.2	37	CCDS14673.1																																																																																			.		0.448	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058590.1	NM_022661	
SPANXD	64648	broad.mit.edu;bcgsc.ca	37	X	140785700	140785700	+	Silent	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chrX:140785700G>T	ENST00000370515.3	-	2	549	c.216C>A	c.(214-216)gcC>gcA	p.A72A		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	72						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					TGTTCTTTCGGGCGTGGTCAT	0.438																																					p.A72A		.											.	.	.	0			c.C216A						.						226.0	193.0	204.0					X																	140785700		2202	4289	6491	SO:0001819	synonymous_variant	171489	exon2			CTTTCGGGCGTGG	AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.216C>A	X.37:g.140785700G>T		Somatic	397.0	0.0		WXS	Illumina HiSeq	Phase_I	552.0	95.0	NM_145665	Q5JWI1	Silent	SNP	ENST00000370515.3	37	CCDS14675.1																																																																																			.		0.438	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058598.1		
TFAP2E	339488	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36060160	36060160	+	Silent	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr1:36060160C>T	ENST00000373235.3	+	7	1420	c.1212C>T	c.(1210-1212)gcC>gcT	p.A404A		NM_178548.3	NP_848643.2			transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)											endometrium(1)|large_intestine(1)	2		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				CCCTCACTGCCTTCCAGAACT	0.557																																					p.A404A		.											.	TFAP2E	90	0			c.C1212T						.						112.0	97.0	102.0					1																	36060160		2203	4300	6503	SO:0001819	synonymous_variant	339488	exon7			CACTGCCTTCCAG	BC041175	CCDS393.2	1p34.3	2008-02-05			ENSG00000116819	ENSG00000116819			30774	protein-coding gene	gene with protein product		614428				14636996	Standard	NM_178548		Approved	AP2E	uc010ohy.2	Q6VUC0	OTTHUMG00000004388	ENST00000373235.3:c.1212C>T	1.37:g.36060160C>T		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	10.0	NM_178548		Silent	SNP	ENST00000373235.3	37	CCDS393.2																																																																																			.		0.557	TFAP2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012732.1	NM_178548	
SPRR1B	6699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153004986	153004986	+	Silent	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr1:153004986G>A	ENST00000307098.4	+	2	230	c.165G>A	c.(163-165)gaG>gaA	p.E55E	SPRR1B_ENST00000392661.3_Intron	NM_003125.2	NP_003116.2	P22528	SPR1B_HUMAN	small proline-rich protein 1B	55	6 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.C41_P64delCHPKVPEPCHPKVPEPCQPKVPEP(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|ovary(2)|skin(2)	9	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGTGCCCGAGCCCTGCCAGC	0.627																																					p.E55E		.											.	SPRR1B	69	1	Deletion - In frame(1)	ovary(1)	c.G165A						.						111.0	111.0	111.0					1																	153004986		2203	4298	6501	SO:0001819	synonymous_variant	6699	exon2			GCCCGAGCCCTGC	M84757	CCDS30863.1	1q21-q22	2010-06-25	2010-06-25		ENSG00000169469	ENSG00000169469			11260	protein-coding gene	gene with protein product	"""cornifin"""	182266		SPRR1		8325635, 1438308	Standard	NM_003125		Approved	GADD33	uc001fba.3	P22528	OTTHUMG00000013869	ENST00000307098.4:c.165G>A	1.37:g.153004986G>A		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	9.0	NM_003125	B2R5H7|P22529|P22530|Q5T524	Silent	SNP	ENST00000307098.4	37	CCDS30863.1																																																																																			.		0.627	SPRR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038906.1	NM_003125	
TFG	10342	broad.mit.edu;mdanderson.org	37	3	100467366	100467366	+	Silent	SNP	T	T	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr3:100467366T>G	ENST00000240851.4	+	8	1534	c.1194T>G	c.(1192-1194)ggT>ggG	p.G398G	TFG_ENST00000490574.1_Silent_p.G398G|TFG_ENST00000418917.2_Silent_p.G394G|TFG_ENST00000476228.1_Silent_p.G394G|TFG_ENST00000481203.1_3'UTR	NM_001195478.1|NM_001195479.1|NM_006070.5	NP_001182407.1|NP_001182408.1|NP_006061.2	Q92734	TFG_HUMAN	TRK-fused gene	398					cell death (GO:0008219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	signal transducer activity (GO:0004871)		TFG/NR4A3(2)|TFG/NTRK1_ENST00000392302(5)|TFG/ALK(9)	large_intestine(4)|lung(2)|prostate(1)|stomach(1)	8						CTGGACCTGGTTATCGATAAG	0.478			T	"""NTRK1, ALK"""	"""papillary thyroid, ALCL, NSCLC"""																																p.G398G		.		Dom	yes		3	3q11-q12	10342	TRK-fused gene		"""E, L"""	.	TFG	861	0			c.T1194G						.						60.0	56.0	57.0					3																	100467366		2202	4299	6501	SO:0001819	synonymous_variant	10342	exon8			ACCTGGTTATCGA	BC009241	CCDS2939.1, CCDS56266.1	3q12.2	2013-03-13	2001-12-04		ENSG00000114354	ENSG00000114354			11758	protein-coding gene	gene with protein product		602498				9169129, 23479643	Standard	NM_001007565		Approved	TF6, FLJ36137, SPG57	uc003dui.3	Q92734	OTTHUMG00000159085	ENST00000240851.4:c.1194T>G	3.37:g.100467366T>G		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	6.0	NM_006070	D3DN49|G5E9V1|Q15656|Q969I2	Silent	SNP	ENST00000240851.4	37	CCDS2939.1																																																																																			.		0.478	TFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353242.1	NM_006070	
TLN2	83660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	63031555	63031555	+	Silent	SNP	A	A	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr15:63031555A>G	ENST00000561311.1	+	30	3926	c.3696A>G	c.(3694-3696)ccA>ccG	p.P1232P	TLN2_ENST00000306829.6_Silent_p.P1232P|TLN2_ENST00000559908.1_3'UTR			Q9Y4G6	TLN2_HUMAN	talin 2	1232					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGCTACCTCCAAGCACGAAGC	0.562																																					p.P1232P		.											.	TLN2	573	0			c.A3696G						.						78.0	68.0	71.0					15																	63031555		2203	4300	6503	SO:0001819	synonymous_variant	83660	exon28			ACCTCCAAGCACG	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3696A>G	15.37:g.63031555A>G		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	7.0	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																			.		0.562	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
TMPRSS13	84000	ucsc.edu;bcgsc.ca	37	11	117782522	117782522	+	Missense_Mutation	SNP	A	A	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr11:117782522A>T	ENST00000430170.2	-	6	950	c.863T>A	c.(862-864)aTc>aAc	p.I288N	TMPRSS13_ENST00000526090.1_Missense_Mutation_p.I288N|TMPRSS13_ENST00000528626.1_Missense_Mutation_p.I253N|TMPRSS13_ENST00000524993.1_Missense_Mutation_p.I288N|TMPRSS13_ENST00000445164.2_Missense_Mutation_p.I288N	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	288	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		GTATCTCAAGATTGAGAAGCT	0.567																																					p.I288N		.											.	TMPRSS13	91	0			c.T863A						.						81.0	86.0	84.0					11																	117782522		1900	4128	6028	SO:0001583	missense	84000	exon6			CTCAAGATTGAGA	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.863T>A	11.37:g.117782522A>T	ENSP00000387702:p.Ile288Asn	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Missense_Mutation	SNP	ENST00000430170.2	37	CCDS58185.1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.748483	0.49257	.	.	ENSG00000137747	ENST00000528626;ENST00000336500;ENST00000524993;ENST00000430170;ENST00000445164;ENST00000526090	T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17	5.24	5.24	0.73138	.	1.700520	0.02826	N	0.126159	T	0.59238	0.2179	L	0.31926	0.97	0.26198	N	0.979495	D;B	0.54964	0.969;0.066	P;B	0.47827	0.558;0.034	T	0.53136	-0.8481	10	0.26408	T	0.33	.	13.9588	0.64166	1.0:0.0:0.0:0.0	.	283;288	Q9BYE2-4;E9PRA0	.;.	N	253;283;288;288;288;288	ENSP00000435813:I253N;ENSP00000434279:I288N;ENSP00000387702:I288N;ENSP00000394114:I288N;ENSP00000436502:I288N	ENSP00000337113:I283N	I	-	2	0	TMPRSS13	117287732	0.999000	0.42202	0.417000	0.26559	0.362000	0.29581	5.563000	0.67352	1.978000	0.57642	0.459000	0.35465	ATC	.		0.567	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
TPO	7173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1499804	1499804	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:1499804C>T	ENST00000345913.4	+	12	2141	c.2050C>T	c.(2050-2052)Cgt>Tgt	p.R684C	TPO_ENST00000329066.4_Missense_Mutation_p.R684C|TPO_ENST00000346956.3_Missense_Mutation_p.R684C|TPO_ENST00000349624.3_Missense_Mutation_p.R511C|TPO_ENST00000382201.3_Missense_Mutation_p.R627C|TPO_ENST00000337415.3_Missense_Mutation_p.R684C|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Missense_Mutation_p.R511C	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	684					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.R684C(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TGCACAGAGGCGTGAGCTGGA	0.577																																					p.R684C		.											TPO,NS,carcinoma,0	TPO	332	1	Substitution - Missense(1)	ovary(1)	c.C2050T						.						78.0	63.0	68.0					2																	1499804		2203	4300	6503	SO:0001583	missense	7173	exon12			CAGAGGCGTGAGC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2050C>T	2.37:g.1499804C>T	ENSP00000318820:p.Arg684Cys	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	12.0	NM_001206744	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	C	7.302	0.613147	0.14066	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607	T;T;T;T;T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76;-0.76	4.52	4.52	0.55395	.	1.024840	0.07679	N	0.936752	T	0.71837	0.3387	M	0.80332	2.49	0.80722	D	1	B;P;B;B	0.36789	0.028;0.57;0.051;0.035	B;B;B;B	0.24269	0.01;0.052;0.014;0.017	T	0.72093	-0.4394	10	0.49607	T	0.09	-9.0606	8.7369	0.34534	0.0:0.8284:0.0:0.1716	.	684;511;627;684	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	C	684;684;684;511;684;627;511;613;158	ENSP00000337263:R684C;ENSP00000318820:R684C;ENSP00000263886:R684C;ENSP00000332044:R511C;ENSP00000329869:R684C;ENSP00000371636:R627C;ENSP00000371633:R511C;ENSP00000405788:R613C;ENSP00000419461:R158C	ENSP00000329869:R684C	R	+	1	0	TPO	1478811	0.036000	0.19791	0.197000	0.23402	0.084000	0.17831	0.320000	0.19540	2.239000	0.73571	0.561000	0.74099	CGT	.		0.577	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TSTA3	7264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144695934	144695934	+	Silent	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr8:144695934G>A	ENST00000425753.2	-	8	820	c.717C>T	c.(715-717)ccC>ccT	p.P239P	TSTA3_ENST00000529064.1_Silent_p.P239P	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	239					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			AGAGGATGATGGGCTCCACTT	0.607																																					p.P239P		.											.	TSTA3	91	0			c.C717T						.						33.0	30.0	31.0					8																	144695934		2083	4025	6108	SO:0001819	synonymous_variant	7264	exon8			GATGATGGGCTCC	U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.717C>T	8.37:g.144695934G>A		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	43.0	NM_003313	B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Silent	SNP	ENST00000425753.2	37	CCDS6408.1																																																																																			.		0.607	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382263.1	NM_003313	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179439946	179439946	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:179439946A>C	ENST00000591111.1	-	276	66214	c.65990T>G	c.(65989-65991)aTc>aGc	p.I21997S	TTN_ENST00000342992.6_Missense_Mutation_p.I21070S|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.I14765S|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.I14698S|TTN_ENST00000589042.1_Missense_Mutation_p.I23638S|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.I14573S|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21997	Ig-like 115.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTGATAGATGCCACGGAG	0.517																																					p.I23638S		.											.	TTN	636	0			c.T70913G						.						36.0	36.0	36.0					2																	179439946		1996	4184	6180	SO:0001583	missense	7273	exon326			TGATAGATGCCAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65990T>G	2.37:g.179439946A>C	ENSP00000465570:p.Ile21997Ser	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	15.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	13.11	2.140505	0.37825	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63744	-0.06;0.18;0.16;0.15	5.6	5.6	0.85130	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.69637	0.3133	L	0.29908	0.895	0.58432	D	0.999996	D;D;D;D	0.71674	0.994;0.997;0.997;0.998	P;D;D;D	0.69824	0.892;0.939;0.939;0.966	T	0.73616	-0.3926	9	0.87932	D	0	.	15.7826	0.78272	1.0:0.0:0.0:0.0	.	14573;14698;14765;21997	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	21070;14573;14765;14698;14571	ENSP00000343764:I21070S;ENSP00000434586:I14573S;ENSP00000340554:I14765S;ENSP00000352154:I14698S	ENSP00000340554:I14765S	I	-	2	0	TTN	179148192	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.281000	0.95811	2.142000	0.66516	0.477000	0.44152	ATC	.		0.517	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
VPS13C	54832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	62226473	62226473	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr15:62226473A>C	ENST00000261517.5	-	49	5886	c.5813T>G	c.(5812-5814)tTt>tGt	p.F1938C	VPS13C_ENST00000395898.3_Missense_Mutation_p.F1895C|VPS13C_ENST00000395896.4_Missense_Mutation_p.F1938C|VPS13C_ENST00000249837.3_Missense_Mutation_p.F1895C	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GTGAAAGTCAAATTGGAGACT	0.313																																					p.F1938C		.											.	VPS13C	92	0			c.T5813G						.						129.0	140.0	136.0					15																	62226473		2203	4298	6501	SO:0001583	missense	54832	exon49			AAGTCAAATTGGA	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.5813T>G	15.37:g.62226473A>C	ENSP00000261517:p.Phe1938Cys	Somatic	280.0	0.0		WXS	Illumina HiSeq	Phase_I	236.0	10.0	NM_020821		Missense_Mutation	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	A	15.05	2.719375	0.48728	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.17370	2.28;2.28;2.28	5.19	4.04	0.47022	.	0.112294	0.64402	D	0.000009	T	0.36908	0.0984	M	0.69823	2.125	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.998;0.999	D;D;D;P	0.70016	0.967;0.951;0.967;0.894	T	0.08785	-1.0705	10	0.87932	D	0	.	9.2205	0.37373	0.7103:0.0:0.0:0.2897	.	1895;1938;1895;1938	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	C	1895;1938;1938;1938	ENSP00000249837:F1895C;ENSP00000261517:F1938C;ENSP00000379233:F1938C	ENSP00000249837:F1895C	F	-	2	0	VPS13C	60013765	1.000000	0.71417	0.969000	0.41365	0.633000	0.38033	3.665000	0.54532	0.773000	0.33404	0.528000	0.53228	TTT	.		0.313	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
VPS72	6944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151158055	151158055	+	Silent	SNP	C	C	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr1:151158055C>A	ENST00000354473.4	-	3	348	c.312G>T	c.(310-312)ccG>ccT	p.P104P	VPS72_ENST00000496809.1_5'UTR			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	104					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGCTACCAGCCGGGGTGTTGA	0.498																																					p.P104P	Pancreas(109;1131 2287 3209 24201)	.											.	VPS72	154	0			c.G312T						.						194.0	192.0	192.0					1																	151158055		2203	4300	6503	SO:0001819	synonymous_variant	6944	exon3			ACCAGCCGGGGTG	D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.312G>T	1.37:g.151158055C>A		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	36.0	NM_001271087	A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Silent	SNP	ENST00000354473.4	37	CCDS59201.1																																																																																			.		0.498	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000034394.3	NM_005997	
VSIG4	11326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	65253415	65253415	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chrX:65253415T>C	ENST00000374737.4	-	2	421	c.313A>G	c.(313-315)Atg>Gtg	p.M105V	VSIG4_ENST00000412866.2_Missense_Mutation_p.M105V|VSIG4_ENST00000455586.2_Missense_Mutation_p.M105V	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	105	Ig-like 1.				complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CGGTCATCCATCTCCAGGGTG	0.542																																					p.M105V		.											.	VSIG4	130	0			c.A313G						.						138.0	118.0	125.0					X																	65253415		2203	4300	6503	SO:0001583	missense	11326	exon2			CATCCATCTCCAG	AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.313A>G	X.37:g.65253415T>C	ENSP00000363869:p.Met105Val	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	27.0	NM_001100431	Q6UXI4	Missense_Mutation	SNP	ENST00000374737.4	37	CCDS14383.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.16|13.16	2.155569|2.155569	0.38021|0.38021	.|.	.|.	ENSG00000155659|ENSG00000155659	ENST00000427538|ENST00000374737;ENST00000455586;ENST00000412866	.|T;T;T	.|0.63913	.|-0.07;-0.07;-0.07	4.88|4.88	4.88|4.88	0.63580|0.63580	.|Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.153579	.|0.46442	.|D	.|0.000293	T|T	0.63319|0.63319	0.2501|0.2501	M|M	0.68317|0.68317	2.08|2.08	0.34905|0.34905	D|D	0.746931|0.746931	.|B;B;B;B;B	.|0.31009	.|0.211;0.137;0.303;0.284;0.202	.|B;B;B;B;B	.|0.41860	.|0.202;0.096;0.368;0.177;0.204	T|T	0.65833|0.65833	-0.6072|-0.6072	5|10	.|0.15066	.|T	.|0.55	-15.2845|-15.2845	9.9597|9.9597	0.41688|0.41688	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|105;105;95;105;105	.|C9J1L3;Q9Y279-2;C9JH67;Q9Y279-3;Q9Y279	.|.;.;.;.;VSIG4_HUMAN	G|V	31|105	.|ENSP00000363869:M105V;ENSP00000411581:M105V;ENSP00000394143:M105V	.|ENSP00000363869:M105V	D|M	-|-	2|1	0|0	VSIG4|VSIG4	65170140|65170140	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.752000|0.752000	0.42762|0.42762	3.569000|3.569000	0.53827|0.53827	1.614000|1.614000	0.50241|0.50241	0.481000|0.481000	0.45027|0.45027	GAT|ATG	.		0.542	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056986.1	NM_007268	
WNT2	7472	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	116960721	116960721	+	Silent	SNP	G	G	A	rs139486726	byFrequency	TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr7:116960721G>A	ENST00000265441.3	-	2	509	c.210C>T	c.(208-210)gcC>gcT	p.A70A	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	70					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CTGTCCACTCGGCCACGCCCT	0.602													G|||	2	0.000399361	0.0	0.0	5008	,	,		19823	0.002		0.0	False		,,,				2504	0.0				p.A70A		.											.	WNT2	1011	0			c.C210T						.	G		2,4404	4.2+/-10.8	0,2,2201	75.0	58.0	64.0		210	-10.6	0.1	7	dbSNP_134	64	0,8600		0,0,4300	no	coding-synonymous	WNT2	NM_003391.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		70/361	116960721	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	7472	exon2			CCACTCGGCCACG	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.210C>T	7.37:g.116960721G>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	13.0	NM_003391	A4D0V1|Q75N05|Q9UDP9	Silent	SNP	ENST00000265441.3	37	CCDS5771.1																																																																																			G|1.000;A|0.000		0.602	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
ZCCHC2	54877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	60241963	60241963	+	Silent	SNP	T	T	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr18:60241963T>G	ENST00000269499.5	+	13	3067	c.2649T>G	c.(2647-2649)ccT>ccG	p.P883P	ZCCHC2_ENST00000586834.1_Silent_p.P562P	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	883						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						AAATGGTGCCTCAAATTGAGG	0.527																																					p.P883P		.											.	ZCCHC2	432	0			c.T2649G						.						109.0	106.0	107.0					18																	60241963		2022	4196	6218	SO:0001819	synonymous_variant	54877	exon13			GGTGCCTCAAATT	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.2649T>G	18.37:g.60241963T>G		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	25.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Silent	SNP	ENST00000269499.5	37	CCDS45880.1																																																																																			.		0.527	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
ZNF230	7773	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	44515439	44515440	+	Frame_Shift_Ins	INS	-	-	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr19:44515439_44515440insA	ENST00000429154.2	+	5	1476_1477	c.1248_1249insA	c.(1249-1251)aaafs	p.K417fs		NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	417					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				TCCACTGCCGGAAAAAACCCTT	0.431																																					p.R416fs	GBM(175;914 2069 22996 47111 52600)	.											.	ZNF230	90	0			c.1248_1249insA						.																																			SO:0001589	frameshift_variant	7773	exon5			CTGCCGGAAAAAA	U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.1254dupA	19.37:g.44515445_44515445dupA	ENSP00000409318:p.Lys417fs	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	24.0	NM_006300	O15322|Q504X7|Q86W84|Q9P1U6	Frame_Shift_Ins	INS	ENST00000429154.2	37	CCDS33044.1																																																																																			.		0.431	ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460456.1		
ZNF362	149076	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	33760792	33760792	+	Silent	SNP	C	C	G			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr1:33760792C>G	ENST00000539719.1	+	8	1202	c.1032C>G	c.(1030-1032)ccC>ccG	p.P344P	ZNF362_ENST00000373428.5_Silent_p.P344P	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				ACAAGTGTCCCAACTGCTACC	0.627											OREG0013342	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P344P	Pancreas(162;1431 2676 35353 38425)	.											.	ZNF362	68	0			c.C1032G						.						117.0	112.0	114.0					1																	33760792		2203	4300	6503	SO:0001819	synonymous_variant	149076	exon8			GTGTCCCAACTGC		CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.1032C>G	1.37:g.33760792C>G		Somatic	226.0	1.0	842	WXS	Illumina HiSeq	Phase_I	171.0	40.0	NM_152493	Q8WYU4	Silent	SNP	ENST00000539719.1	37	CCDS377.1																																																																																			.		0.627	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011857.2	NM_152493	
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	88494198	88494198	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr16:88494198G>T	ENST00000437464.1	+	1	320	c.320G>T	c.(319-321)aGg>aTg	p.R107M	ZNF469_ENST00000565624.1_Missense_Mutation_p.R107M	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	107	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GCTCCCTCAAGGCTGGCGGGC	0.697																																					p.R107M		.											.	.	.	0			c.G320T						.						1.0	2.0	2.0					16																	88494198		318	1018	1336	SO:0001583	missense	84627	exon1			CCTCAAGGCTGGC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.320G>T	16.37:g.88494198G>T	ENSP00000402343:p.Arg107Met	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	9.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	8.841	0.942279	0.18281	.	.	ENSG00000225614	ENST00000437464	T	0.24723	1.84	3.96	0.734	0.18294	.	.	.	.	.	T	0.21590	0.0520	N	0.14661	0.345	0.09310	N	1	D	0.62365	0.991	P	0.56216	0.794	T	0.11203	-1.0597	9	0.72032	D	0.01	.	3.6988	0.08375	0.2895:0.0:0.5394:0.1711	.	107	Q96JG9	ZN469_HUMAN	M	107	ENSP00000402343:R107M	ENSP00000402343:R107M	R	+	2	0	ZNF469	87021699	0.983000	0.35010	0.000000	0.03702	0.023000	0.10783	2.279000	0.43435	-0.112000	0.11979	-0.643000	0.03959	AGG	.		0.697	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
ZNF608	57507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	123979216	123979216	+	Silent	SNP	G	G	A			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr5:123979216G>A	ENST00000306315.5	-	6	4719	c.4284C>T	c.(4282-4284)agC>agT	p.S1428S	ZNF608_ENST00000513985.1_5'UTR|ZNF608_ENST00000504926.1_Silent_p.S1001S	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1428							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CAGGAGACTTGCTGCGGTATT	0.428																																					p.S1428S		.											ZNF608,NS,carcinoma,-1	ZNF608	229	0			c.C4284T						.						194.0	161.0	173.0					5																	123979216		2203	4300	6503	SO:0001819	synonymous_variant	57507	exon6			AGACTTGCTGCGG	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.4284C>T	5.37:g.123979216G>A		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	27.0	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Silent	SNP	ENST00000306315.5	37	CCDS34219.1																																																																																			.		0.428	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
ZNF804A	91752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	185800549	185800549	+	Silent	SNP	T	T	C			TCGA-K7-A6G5-01A-11D-A30V-10	TCGA-K7-A6G5-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1ba1022c-bdf7-464b-a527-f69dd5bac5be	9878f24b-c9b2-4b3b-9cf2-d4ad1132ee86	g.chr2:185800549T>C	ENST00000302277.6	+	4	1020	c.426T>C	c.(424-426)gtT>gtC	p.V142V		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	142							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CAACAACTGTTACTGTGAGAG	0.353																																					p.V142V		.											.	ZNF804A	163	0			c.T426C						.						57.0	56.0	56.0					2																	185800549		2203	4298	6501	SO:0001819	synonymous_variant	91752	exon4			AACTGTTACTGTG	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.426T>C	2.37:g.185800549T>C		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	19.0	NM_194250	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	CCDS2291.1																																																																																			.		0.353	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
