#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AAK1	22848	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	69741794	69741794	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:69741794G>T	ENST00000409085.4	-	13	1961	c.1585C>A	c.(1585-1587)Cag>Aag	p.Q529K	AAK1_ENST00000406297.3_Missense_Mutation_p.Q529K|RN7SL604P_ENST00000492589.2_RNA|AAK1_ENST00000409068.1_Missense_Mutation_p.Q529K	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	529	Gln-rich.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						TAGAAATTCTGCATTAGCTGC	0.522																																					p.Q529K		.											.	AAK1	333	0			c.C1585A						.						46.0	48.0	47.0					2																	69741794		2195	4300	6495	SO:0001583	missense	22848	exon13			AATTCTGCATTAG	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.1585C>A	2.37:g.69741794G>T	ENSP00000386456:p.Gln529Lys	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	5.0	NM_014911	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075907	0.55646	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.36699	1.24;1.24;1.24	5.43	5.43	0.79202	.	0.426268	0.23708	N	0.045357	T	0.40595	0.1123	N	0.24115	0.695	0.35959	D	0.83448	P;P;P	0.52577	0.924;0.954;0.713	P;D;P	0.67900	0.9;0.954;0.761	T	0.08848	-1.0702	10	0.02654	T	1	-9.2741	16.0855	0.81045	0.0:0.0:1.0:0.0	.	529;529;529	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	K	529	ENSP00000386342:Q529K;ENSP00000386456:Q529K;ENSP00000385181:Q529K	ENSP00000385181:Q529K	Q	-	1	0	AAK1	69595298	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	3.503000	0.53340	2.822000	0.97130	0.650000	0.86243	CAG	.		0.522	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
AARS	16	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70299543	70299543	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr16:70299543A>G	ENST00000261772.8	-	10	1388	c.1245T>C	c.(1243-1245)taT>taC	p.Y415Y	AARS_ENST00000564359.1_5'Flank|RN7SL407P_ENST00000583724.1_RNA	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		CATAGGTGTCATAGAGGAGCC	0.517																																					p.Y415Y		.											.	AARS	91	0			c.T1245C						.						96.0	93.0	94.0					16																	70299543		2198	4300	6498	SO:0001819	synonymous_variant	16	exon10			GGTGTCATAGAGG	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.1245T>C	16.37:g.70299543A>G		Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	32.0	NM_001605		Silent	SNP	ENST00000261772.8	37	CCDS32474.1																																																																																			.		0.517	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
ABCA7	10347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1052055	1052055	+	Missense_Mutation	SNP	G	G	A	rs530537679		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:1052055G>A	ENST00000263094.6	+	22	3308	c.3077G>A	c.(3076-3078)cGc>cAc	p.R1026H	ABCA7_ENST00000433129.1_Missense_Mutation_p.R1026H|ABCA7_ENST00000435683.2_Missense_Mutation_p.R888H	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1026	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTTCCTGCGCCGTCACCTG	0.672													G|||	1	0.000199681	0.0	0.0014	5008	,	,		10625	0.0		0.0	False		,,,				2504	0.0				p.R1026H		.											.	ABCA7	98	0			c.G3077A						.						52.0	36.0	42.0					19																	1052055		2180	4281	6461	SO:0001583	missense	10347	exon22			TCCTGCGCCGTCA	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.3077G>A	19.37:g.1052055G>A	ENSP00000263094:p.Arg1026His	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	21.0	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	g	21.6	4.175052	0.78564	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.90004	-2.6;-2.6	4.44	2.09	0.27110	ABC transporter-like (1);	.	.	.	.	D	0.91178	0.7221	M	0.68593	2.085	0.29532	N	0.852681	D;D	0.89917	0.999;1.0	D;D	0.65773	0.938;0.925	D	0.84058	0.0373	9	0.87932	D	0	.	4.2618	0.10744	0.5206:0.0:0.4794:0.0	.	888;1026	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	H	1026	ENSP00000263094:R1026H;ENSP00000414062:R1026H	ENSP00000263094:R1026H	R	+	2	0	ABCA7	1003055	1.000000	0.71417	0.558000	0.28319	0.848000	0.48234	6.230000	0.72301	0.855000	0.35359	0.550000	0.68814	CGC	.		0.672	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
ABLIM2	84448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	8031435	8031435	+	Silent	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:8031435G>A	ENST00000341937.5	-	11	1180	c.1116C>T	c.(1114-1116)agC>agT	p.S372S	ABLIM2_ENST00000361581.5_Silent_p.S372S|ABLIM2_ENST00000361737.5_Silent_p.S383S|ABLIM2_ENST00000428004.2_Silent_p.S383S|ABLIM2_ENST00000505872.1_Silent_p.S372S|ABLIM2_ENST00000407564.3_Silent_p.S372S|ABLIM2_ENST00000296372.8_Silent_p.S372S|ABLIM2_ENST00000546334.1_Silent_p.S383S|ABLIM2_ENST00000545242.1_Silent_p.S372S|ABLIM2_ENST00000514025.1_Silent_p.S140S|ABLIM2_ENST00000447017.2_Silent_p.S372S|ABLIM2_ENST00000515079.1_5'UTR|ABLIM2_ENST00000318888.4_Silent_p.S140S	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	372					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						AGCGCCCGAGGCTAACCGACC	0.617																																					p.S383S		.											.	ABLIM2	47	0			c.C1149T						.						36.0	48.0	44.0					4																	8031435		2010	4108	6118	SO:0001819	synonymous_variant	84448	exon12			CCCGAGGCTAACC	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.1116C>T	4.37:g.8031435G>A		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	23.0	NM_001130087	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Silent	SNP	ENST00000341937.5	37	CCDS47013.1																																																																																			.		0.617	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083	
ACAD8	27034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134131002	134131002	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:134131002A>G	ENST00000281182.4	+	7	876	c.770A>G	c.(769-771)aAc>aGc	p.N257S	ACAD8_ENST00000374752.4_Missense_Mutation_p.N130S|ACAD8_ENST00000537423.1_Missense_Mutation_p.N180S|ACAD8_ENST00000543332.1_Missense_Mutation_p.N159S|ACAD8_ENST00000524547.1_3'UTR	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	257					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	CCTGTGGCCAACAGAATTGGG	0.577																																					p.N257S	GBM(65;238 1125 33403 41853 48889)	.											.	ACAD8	90	0			c.A770G						.						64.0	59.0	60.0					11																	134131002		2201	4296	6497	SO:0001583	missense	27034	exon7			TGGCCAACAGAAT	AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.770A>G	11.37:g.134131002A>G	ENSP00000281182:p.Asn257Ser	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	29.0	NM_014384	B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	ENST00000281182.4	37	CCDS8498.1	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898592	0.72639	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000543332;ENST00000374752;ENST00000537915	D;D;D;D	0.99214	-5.57;-5.57;-5.57;-5.57	5.44	5.44	0.79542	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase/oxidase C-terminal (1);	0.040366	0.85682	D	0.000000	D	0.98868	0.9617	M	0.88704	2.975	0.80722	D	1	P;P;P	0.45902	0.509;0.782;0.868	B;B;B	0.42188	0.12;0.379;0.196	D	0.99616	1.0982	10	0.87932	D	0	.	15.4831	0.75542	1.0:0.0:0.0:0.0	.	180;130;257	B7Z5W4;Q6ZWP6;Q9UKU7	.;.;ACAD8_HUMAN	S	257;180;159;130;219	ENSP00000281182:N257S;ENSP00000443763:N180S;ENSP00000438302:N159S;ENSP00000363884:N130S	ENSP00000281182:N257S	N	+	2	0	ACAD8	133636212	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.448000	0.80631	2.069000	0.61940	0.459000	0.35465	AAC	.		0.577	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384	
ACAP2	23527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195013010	195013010	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:195013010A>T	ENST00000326793.6	-	19	2167	c.1937T>A	c.(1936-1938)aTt>aAt	p.I646N		NM_012287.5	NP_036419.3	Q15057	ACAP2_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2	646					cellular response to nerve growth factor stimulus (GO:1990090)|protein localization to endosome (GO:0036010)|regulation of ARF GTPase activity (GO:0032312)	endosome membrane (GO:0010008)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	27						TACAGCCTGAATAAGTGGTGT	0.378																																					p.I646N		.											.	ACAP2	136	0			c.T1937A						.						160.0	157.0	158.0					3																	195013010		2203	4300	6503	SO:0001583	missense	23527	exon19			GCCTGAATAAGTG		CCDS33924.1	3q29	2013-01-10	2008-09-22	2008-09-22	ENSG00000114331	ENSG00000114331		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16469	protein-coding gene	gene with protein product		607766	"""centaurin, beta 2"""	CENTB2		11050434, 11062263	Standard	NM_012287		Approved	KIAA0041, CNT-B2	uc003fun.4	Q15057	OTTHUMG00000155885	ENST00000326793.6:c.1937T>A	3.37:g.195013010A>T	ENSP00000324287:p.Ile646Asn	Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	39.0	NM_012287	A8K2V4|Q8N5Z8|Q9UQR3	Missense_Mutation	SNP	ENST00000326793.6	37	CCDS33924.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.580179	0.86645	.	.	ENSG00000114331	ENST00000326793	T	0.64803	-0.12	5.75	5.75	0.90469	Ankyrin repeat-containing domain (3);	0.207707	0.49916	D	0.000132	T	0.67392	0.2888	N	0.25485	0.75	0.58432	D	0.999997	D	0.60160	0.987	D	0.63703	0.917	T	0.71133	-0.4681	10	0.66056	D	0.02	.	15.2475	0.73517	1.0:0.0:0.0:0.0	.	646	Q15057	ACAP2_HUMAN	N	646	ENSP00000324287:I646N	ENSP00000324287:I646N	I	-	2	0	ACAP2	196494299	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.737000	0.91562	2.201000	0.70794	0.533000	0.62120	ATT	.		0.378	ACAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342126.2	NM_012287	
AGXT	189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	241813413	241813413	+	Missense_Mutation	SNP	C	C	T	rs180177248		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:241813413C>T	ENST00000307503.3	+	6	1001	c.614C>T	c.(613-615)tCg>tTg	p.S205L		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	205			S -> P (in HP1). {ECO:0000269|PubMed:2039493}.		cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	ATCCTGTACTCGGGCTCCCAG	0.622																																					p.S205L		.											.	AGXT	90	0			c.C614T						.						112.0	97.0	102.0					2																	241813413		2203	4300	6503	SO:0001583	missense	189	exon6			TGTACTCGGGCTC	D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.614C>T	2.37:g.241813413C>T	ENSP00000302620:p.Ser205Leu	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	22.0	NM_000030	Q53QU6	Missense_Mutation	SNP	ENST00000307503.3	37	CCDS2543.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616531	0.46736	.	.	ENSG00000172482	ENST00000307503	D	0.86230	-2.09	4.1	4.1	0.47936	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.377799	0.29572	N	0.011764	D	0.94719	0.8296	M	0.91038	3.17	0.52501	D	0.999952	D	0.89917	1.0	D	0.87578	0.998	D	0.96145	0.9103	10	0.87932	D	0	-9.0683	16.6951	0.85333	0.0:1.0:0.0:0.0	.	205	P21549	SPYA_HUMAN	L	205	ENSP00000302620:S205L	ENSP00000302620:S205L	S	+	2	0	AGXT	241462086	0.998000	0.40836	0.213000	0.23690	0.006000	0.05464	4.052000	0.57420	2.008000	0.58898	0.579000	0.79373	TCG	.		0.622	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257186.1	NM_000030	
AHI1	54806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	135715921	135715921	+	Silent	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:135715921A>C	ENST00000367800.4	-	21	3318	c.3102T>G	c.(3100-3102)acT>acG	p.T1034T	AHI1_ENST00000417892.2_Silent_p.T388T|AHI1_ENST00000457866.2_Silent_p.T1034T|AHI1_ENST00000327035.6_Silent_p.T1034T	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	1034					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		CACCGGTCTGAGTGAAACCAA	0.378																																					p.T1034T		.											.	AHI1	227	0			c.T3102G						.						101.0	100.0	100.0					6																	135715921		1868	4106	5974	SO:0001819	synonymous_variant	54806	exon22			GGTCTGAGTGAAA	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.3102T>G	6.37:g.135715921A>C		Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	36.0	NM_001134832	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Silent	SNP	ENST00000367800.4	37	CCDS47483.1	.	.	.	.	.	.	.	.	.	.	A	6.050	0.377504	0.11466	.	.	ENSG00000135541	ENST00000367799;ENST00000529865	.	.	.	5.6	4.39	0.52855	.	.	.	.	.	T	0.21881	0.0527	.	.	.	0.29387	N	0.862889	.	.	.	.	.	.	T	0.12785	-1.0534	4	.	.	.	0.0401	9.7582	0.40515	0.9194:0.0:0.0806:0.0	.	.	.	.	R	534;101	.	.	L	-	2	0	AHI1	135757614	0.420000	0.25457	0.319000	0.25293	0.712000	0.41017	1.199000	0.32235	1.008000	0.39264	0.533000	0.62120	CTC	.		0.378	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
ANK1	286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	41547821	41547821	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:41547821A>T	ENST00000347528.4	-	33	4111	c.4028T>A	c.(4027-4029)cTg>cAg	p.L1343Q	ANK1_ENST00000396942.1_Missense_Mutation_p.L1343Q|ANK1_ENST00000396945.1_Missense_Mutation_p.L1343Q|ANK1_ENST00000352337.4_Missense_Mutation_p.L1343Q|ANK1_ENST00000289734.7_Missense_Mutation_p.L1343Q|ANK1_ENST00000265709.8_Missense_Mutation_p.L1384Q|ANK1_ENST00000379758.2_Missense_Mutation_p.L1343Q	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1343	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CGCCTTGCGCAGAAACGACAG	0.597																																					p.L1384Q		.											.	ANK1	716	0			c.T4151A						.						133.0	111.0	119.0					8																	41547821		2203	4300	6503	SO:0001583	missense	286	exon34			TTGCGCAGAAACG	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.4028T>A	8.37:g.41547821A>T	ENSP00000339620:p.Leu1343Gln	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	37.0	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.495553	0.85069	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87;1.87	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000002	T	0.48624	0.1510	M	0.65975	2.015	0.58432	D	0.999998	D;D;P;P;D;D	0.71674	0.996;0.985;0.956;0.956;0.996;0.998	D;P;P;P;D;D	0.72625	0.978;0.864;0.729;0.562;0.978;0.929	T	0.51387	-0.8712	10	0.87932	D	0	.	14.1776	0.65552	1.0:0.0:0.0:0.0	.	1384;1343;1343;1343;1343;659	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.;.;ANK1_HUMAN;.;.;.	Q	1343;1343;1343;1343;1343;1343;1384;1343	ENSP00000339620:L1343Q;ENSP00000289734:L1343Q;ENSP00000369082:L1343Q;ENSP00000380149:L1343Q;ENSP00000380147:L1343Q;ENSP00000309131:L1343Q;ENSP00000265709:L1384Q	ENSP00000265709:L1384Q	L	-	2	0	ANK1	41666978	1.000000	0.71417	0.975000	0.42487	0.866000	0.49608	9.026000	0.93700	2.123000	0.65237	0.460000	0.39030	CTG	.		0.597	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
ANKMY1	51281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	241463387	241463387	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:241463387T>A	ENST00000272972.3	-	7	1694	c.1480A>T	c.(1480-1482)Agc>Tgc	p.S494C	ANKMY1_ENST00000373318.2_Missense_Mutation_p.S353C|ANKMY1_ENST00000403283.1_Missense_Mutation_p.S432C|ANKMY1_ENST00000405523.3_Missense_Mutation_p.S353C|ANKMY1_ENST00000391987.1_Missense_Mutation_p.S494C|ANKMY1_ENST00000401804.1_Missense_Mutation_p.S583C|ANKMY1_ENST00000373320.4_Missense_Mutation_p.S264C|ANKMY1_ENST00000361678.4_Missense_Mutation_p.S353C|ANKMY1_ENST00000405002.1_Missense_Mutation_p.S264C|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000406958.1_Missense_Mutation_p.S255C|ANKMY1_ENST00000536462.1_Missense_Mutation_p.S306C	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	494							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		TTCAGCAAGCTGTGGGACTGG	0.592																																					p.S494C		.											.	ANKMY1	90	0			c.A1480T						.						91.0	83.0	86.0					2																	241463387		2203	4300	6503	SO:0001583	missense	51281	exon7			GCAAGCTGTGGGA	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1480A>T	2.37:g.241463387T>A	ENSP00000272972:p.Ser494Cys	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	18.0	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	37	CCDS2536.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.769843	0.49680	.	.	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T;T	0.60424	2.65;3.48;0.19;1.96;0.19;4.12;2.2;0.21;1.76;1.82;2.06	4.06	2.89	0.33648	Ankyrin repeat-containing domain (1);	0.873356	0.09919	N	0.738663	T	0.61664	0.2365	L	0.34521	1.04	0.09310	N	1	D;D;D;D;D;D;D	0.89917	0.993;1.0;0.999;0.999;0.999;0.999;0.993	P;D;D;P;D;D;P	0.68353	0.72;0.957;0.935;0.907;0.948;0.947;0.72	T	0.46693	-0.9173	10	0.42905	T	0.14	-21.5812	6.4404	0.21847	0.0:0.1202:0.0:0.8798	.	494;306;264;353;255;353;494	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;B5MBY4;Q9P2S6-2;Q9P2S6	.;.;.;.;.;.;ANKY1_HUMAN	C	353;255;494;353;494;264;432;583;306;353;264	ENSP00000362415:S353C;ENSP00000384555:S255C;ENSP00000272972:S494C;ENSP00000355097:S353C;ENSP00000375847:S494C;ENSP00000362417:S264C;ENSP00000383968:S432C;ENSP00000385887:S583C;ENSP00000444707:S306C;ENSP00000385635:S353C;ENSP00000385145:S264C	ENSP00000272972:S494C	S	-	1	0	ANKMY1	241112060	0.000000	0.05858	0.008000	0.14137	0.019000	0.09904	-0.265000	0.08644	0.683000	0.31428	0.402000	0.26972	AGC	.		0.592	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
ARHGAP31	57514	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	119120710	119120710	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:119120710G>A	ENST00000264245.4	+	10	1643	c.1111G>A	c.(1111-1113)Ggt>Agt	p.G371S		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	371					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AGTTACCACCGGTGGATTTTT	0.522																																					p.G371S	Pancreas(7;176 297 5394 51128 51241)	.											.	ARHGAP31	92	0			c.G1111A						.						32.0	36.0	35.0					3																	119120710		1926	4132	6058	SO:0001583	missense	57514	exon10			ACCACCGGTGGAT		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.1111G>A	3.37:g.119120710G>A	ENSP00000264245:p.Gly371Ser	Somatic	199.0	1.0		WXS	Illumina HiSeq	Phase_I	143.0	57.0	NM_020754	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	37	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628540	0.87560	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.10477	2.87	5.48	5.48	0.80851	.	0.154473	0.45867	D	0.000331	T	0.25531	0.0621	M	0.64997	1.995	0.58432	D	0.999992	D	0.63880	0.993	P	0.54706	0.759	T	0.00065	-1.2148	10	0.44086	T	0.13	.	18.5258	0.90971	0.0:0.0:1.0:0.0	.	371	Q2M1Z3	RHG31_HUMAN	S	371	ENSP00000264245:G371S	ENSP00000264245:G371S	G	+	1	0	ARHGAP31	120603400	1.000000	0.71417	0.980000	0.43619	0.997000	0.91878	4.545000	0.60698	2.850000	0.98022	0.655000	0.94253	GGT	.		0.522	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
ARHGAP33	115703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36269405	36269405	+	Missense_Mutation	SNP	C	C	T	rs374221923		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:36269405C>T	ENST00000007510.4	+	5	454	c.310C>T	c.(310-312)Cgt>Tgt	p.R104C	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.R104C|ARHGAP33_ENST00000378944.5_5'UTR|ARHGAP33_ENST00000221905.1_3'UTR			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	104	PX; atypical.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CGATGACTTTCGTTCCCTGGA	0.652																																					p.R104C		.											.	ARHGAP33	229	0			c.C310T						.	C	,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	102.0	101.0	101.0		,310	5.3	1.0	19		101	0,8600		0,0,4300	no	utr-5,missense	ARHGAP33	NM_001172630.1,NM_052948.3	,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,probably-damaging	,104/1127	36269405	1,13005	2203	4300	6503	SO:0001583	missense	115703	exon5			GACTTTCGTTCCC	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.310C>T	19.37:g.36269405C>T	ENSP00000007510:p.Arg104Cys	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	14.0	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	C	26.0	4.699052	0.88830	2.27E-4	0.0	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000221905	T;T;T	0.26660	1.72;1.72;1.72	5.34	5.34	0.76211	.	0.000000	0.64402	D	0.000004	T	0.43077	0.1231	L	0.38649	1.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.983	T	0.28618	-1.0038	10	0.59425	D	0.04	.	17.8148	0.88628	0.0:1.0:0.0:0.0	.	122;104	O14559-12;O14559-11	.;.	C	104;104;122	ENSP00000007510:R104C;ENSP00000320038:R104C;ENSP00000221905:R122C	ENSP00000007510:R104C	R	+	1	0	ARHGAP33	40961245	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.908000	0.56355	2.483000	0.83821	0.655000	0.94253	CGT	.		0.652	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	27102066	27102066	+	Splice_Site	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:27102066A>T	ENST00000324856.7	+	19	5364		c.e19-1		ARID1A_ENST00000540690.1_Splice_Site|ARID1A_ENST00000374152.2_Splice_Site|ARID1A_ENST00000457599.2_Splice_Site	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)						androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGTTTATTTCAGGAACCCCGG	0.532			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																.		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	0			c.4343-2A>T						.						56.0	50.0	52.0					1																	27102066		2203	4300	6503	SO:0001630	splice_region_variant	8289	exon19			TATTTCAGGAACC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4994-1A>T	1.37:g.27102066A>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	20.0	NM_139135	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Splice_Site	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.290461	0.80914	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000430799	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6916	0.69091	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARID1A	26974653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.971000	0.93419	2.065000	0.61736	0.533000	0.62120	.	.		0.532	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	Intron
ARMC3	219681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	23244758	23244758	+	Silent	SNP	C	C	T	rs570281393		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr10:23244758C>T	ENST00000298032.5	+	4	273	c.189C>T	c.(187-189)ctC>ctT	p.L63L	ARMC3_ENST00000376528.4_5'UTR|ARMC3_ENST00000409049.3_Silent_p.L63L|ARMC3_ENST00000464017.1_3'UTR|ARMC3_ENST00000409983.3_Silent_p.L63L	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	63						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAACAACCCTCCTTGAACTTG	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		19398	0.0		0.0	False		,,,				2504	0.001				p.L63L		.											.	ARMC3	90	0			c.C189T						.						120.0	118.0	119.0					10																	23244758		2203	4300	6503	SO:0001819	synonymous_variant	219681	exon4			AACCCTCCTTGAA	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.189C>T	10.37:g.23244758C>T		Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	88.0	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Silent	SNP	ENST00000298032.5	37	CCDS7142.1																																																																																			.		0.388	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
ASAP3	55616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	23759654	23759654	+	Missense_Mutation	SNP	C	C	T	rs199574094		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:23759654C>T	ENST00000336689.3	-	22	2283	c.2239G>A	c.(2239-2241)Gag>Aag	p.E747K	ASAP3_ENST00000437606.2_Missense_Mutation_p.E738K|ASAP3_ENST00000495646.1_Missense_Mutation_p.E251K	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	747					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						TCCTCACTCTCGCCCTGAGGG	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		18777	0.0		0.001	False		,,,				2504	0.0				p.E747K		.											.	ASAP3	155	0			c.G2239A						.	C	LYS/GLU,LYS/GLU	0,4406		0,0,2203	93.0	98.0	96.0		2212,2239	1.6	1.0	1		96	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	ASAP3	NM_001143778.1,NM_017707.3	56,56	0,6,6497	TT,TC,CC		0.0698,0.0,0.0461	benign,benign	738/895,747/904	23759654	6,13000	2203	4300	6503	SO:0001583	missense	55616	exon22			CACTCTCGCCCTG	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2239G>A	1.37:g.23759654C>T	ENSP00000338769:p.Glu747Lys	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	23.0	NM_017707	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	ENST00000336689.3	37	CCDS235.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	12.82	2.052754	0.36181	0.0	6.98E-4	ENSG00000088280	ENST00000538685;ENST00000495646;ENST00000336689;ENST00000465372;ENST00000437606	T;T;T	0.49720	2.19;0.77;0.77	4.54	1.59	0.23543	.	6.293130	0.00357	N	0.000030	T	0.27933	0.0688	N	0.14661	0.345	0.22648	N	0.998896	B;B;B;B	0.27498	0.18;0.003;0.069;0.048	B;B;B;B	0.16289	0.015;0.007;0.011;0.007	T	0.23119	-1.0197	10	0.02654	T	1	.	8.7545	0.34637	0.0828:0.3004:0.6168:0.0	.	738;637;270;747	Q8TDY4-3;B4DRP2;Q9NXH7;Q8TDY4	.;.;.;ASAP3_HUMAN	K	270;251;747;74;738	ENSP00000436150:E251K;ENSP00000338769:E747K;ENSP00000408826:E738K	ENSP00000338769:E747K	E	-	1	0	ASAP3	23632241	0.998000	0.40836	0.991000	0.47740	0.401000	0.30781	0.724000	0.25954	0.250000	0.21479	-0.311000	0.09066	GAG	C|0.999;T|0.000		0.612	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
ASB15	142685	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	123269106	123269106	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:123269106C>T	ENST00000451558.1	+	12	1579	c.1058C>T	c.(1057-1059)gCg>gTg	p.A353V	ASB15_ENST00000434204.1_Missense_Mutation_p.A353V|ASB15_ENST00000451215.1_Missense_Mutation_p.A353V|ASB15_ENST00000275699.3_Missense_Mutation_p.A353V|ASB15_ENST00000540573.1_Missense_Mutation_p.A353V			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	353					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						AGGAAGACTGCGCTGTATTTT	0.443																																					p.A353V		.											.	ASB15	228	0			c.C1058T						.						168.0	152.0	158.0					7																	123269106		2203	4300	6503	SO:0001583	missense	142685	exon8			AGACTGCGCTGTA	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.1058C>T	7.37:g.123269106C>T	ENSP00000397655:p.Ala353Val	Somatic	214.0	2.0		WXS	Illumina HiSeq	Phase_I	235.0	70.0	NM_080928	Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	ENST00000451558.1	37	CCDS34742.1	.	.	.	.	.	.	.	.	.	.	C	33	5.210454	0.95069	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000451215;ENST00000540573;ENST00000542545;ENST00000275699	T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38	6.17	6.17	0.99709	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.80428	0.4621	M	0.63208	1.945	0.58432	D	0.999998	D	0.71674	0.998	D	0.64321	0.924	T	0.79060	-0.1958	10	0.59425	D	0.04	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	353	Q8WXK1	ASB15_HUMAN	V	353;353;353;353;142;353	ENSP00000397655:A353V;ENSP00000390963:A353V;ENSP00000416433:A353V;ENSP00000438643:A353V;ENSP00000275699:A353V	ENSP00000275699:A353V	A	+	2	0	ASB15	123056342	0.998000	0.40836	0.969000	0.41365	0.964000	0.63967	5.766000	0.68843	2.941000	0.99782	0.655000	0.94253	GCG	.		0.443	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1		
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	23980759	23980759	+	Missense_Mutation	SNP	T	T	C	rs201429059		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:23980759T>C	ENST00000238789.5	-	25	3950	c.3607A>G	c.(3607-3609)Atg>Gtg	p.M1203V	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	1203						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCATTGGTCATAGATAAGTCT	0.448													T|||	1	0.000199681	0.0	0.0	5008	,	,		19034	0.0		0.0	False		,,,				2504	0.001				p.M1203V		.											.	ATAD2B	68	0			c.A3607G						.	T	VAL/MET,VAL/MET	1,3919		0,1,1959	144.0	141.0	142.0		3592,3607	3.1	1.0	2		142	1,8289		0,1,4144	yes	missense,missense	ATAD2B	NM_001242338.1,NM_017552.2	21,21	0,2,6103	CC,CT,TT		0.0121,0.0255,0.0164	benign,benign	1198/1454,1203/1459	23980759	2,12208	1960	4145	6105	SO:0001583	missense	54454	exon25			TGGTCATAGATAA	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.3607A>G	2.37:g.23980759T>C	ENSP00000238789:p.Met1203Val	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	49.0	NM_017552	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	.	.	.	.	.	.	.	.	.	.	T	5.775	0.327444	0.10956	2.55E-4	1.21E-4	ENSG00000119778	ENST00000238789;ENST00000546030	D	0.91124	-2.79	5.62	3.11	0.35812	.	0.625902	0.17751	N	0.163256	T	0.76343	0.3974	N	0.12182	0.205	0.29304	N	0.86848	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.62300	-0.6883	10	0.22706	T	0.39	.	1.8178	0.03104	0.1345:0.1453:0.1401:0.5801	.	1203;1198	Q9ULI0;Q9ULI0-2	ATD2B_HUMAN;.	V	1203;371	ENSP00000238789:M1203V	ENSP00000238789:M1203V	M	-	1	0	ATAD2B	23834263	0.981000	0.34729	1.000000	0.80357	0.993000	0.82548	0.954000	0.29175	1.084000	0.41184	0.460000	0.39030	ATG	.		0.448	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
ATP2B1	490	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	89998055	89998055	+	Silent	SNP	G	G	A	rs112647159		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:89998055G>A	ENST00000428670.3	-	16	2967	c.2511C>T	c.(2509-2511)agC>agT	p.S837S	ATP2B1_ENST00000359142.3_Silent_p.S837S|ATP2B1_ENST00000261173.2_Silent_p.S837S|ATP2B1_ENST00000348959.3_Silent_p.S837S|ATP2B1_ENST00000393164.2_Silent_p.S580S			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	837					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						CTTTAACAATGCTTGTAAAGT	0.348																																					p.S837S		.											.	ATP2B1	516	0			c.C2511T						.						116.0	109.0	111.0					12																	89998055		2203	4300	6503	SO:0001819	synonymous_variant	490	exon15			AACAATGCTTGTA	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2511C>T	12.37:g.89998055G>A		Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	56.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	ENST00000428670.3	37	CCDS9035.1																																																																																			G|0.500;A|0.500		0.348	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
B3GAT2	135152	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	71665601	71665601	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:71665601G>T	ENST00000230053.6	-	1	1140	c.532C>A	c.(532-534)Ccc>Acc	p.P178T		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	178					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						AGCACGCCGGGCTGCGCGCGC	0.721																																					p.P178T		.											.	B3GAT2	93	0			c.C532A						.						8.0	9.0	8.0					6																	71665601		1928	3777	5705	SO:0001583	missense	135152	exon1			CGCCGGGCTGCGC	AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.532C>A	6.37:g.71665601G>T	ENSP00000230053:p.Pro178Thr	Somatic	113.0	1.0		WXS	Illumina HiSeq	Phase_I	129.0	38.0	NM_080742	Q5JS09|Q8TF38|Q96NK4	Missense_Mutation	SNP	ENST00000230053.6	37	CCDS4974.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207031	0.58343	.	.	ENSG00000112309	ENST00000230053	T	0.41758	0.99	4.18	4.18	0.49190	.	0.064491	0.64402	D	0.000010	T	0.17408	0.0418	N	0.21194	0.64	0.50632	D	0.999886	B	0.02656	0.0	B	0.09377	0.004	T	0.03315	-1.1049	10	0.33940	T	0.23	-30.8583	16.2562	0.82517	0.0:0.0:1.0:0.0	.	178	Q9NPZ5	B3GA2_HUMAN	T	178	ENSP00000230053:P178T	ENSP00000230053:P178T	P	-	1	0	B3GAT2	71722322	0.910000	0.30920	1.000000	0.80357	0.919000	0.55068	0.940000	0.28992	2.153000	0.67306	0.591000	0.81541	CCC	.		0.721	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742	
BCAS3	54828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59445783	59445783	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:59445783G>A	ENST00000390652.5	+	24	2597	c.2566G>A	c.(2566-2568)Gag>Aag	p.E856K	BCAS3_ENST00000588462.1_Missense_Mutation_p.E856K|BCAS3_ENST00000585744.1_Missense_Mutation_p.E627K|BCAS3_ENST00000407086.3_Missense_Mutation_p.E841K|RP11-332H18.5_ENST00000585765.1_RNA|BCAS3_ENST00000588874.1_Missense_Mutation_p.E612K|BCAS3_ENST00000585812.1_3'UTR|BCAS3_ENST00000408905.3_Missense_Mutation_p.E841K|BCAS3_ENST00000589222.1_Missense_Mutation_p.E841K	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GCACACGGAGGAGGGCCTCCG	0.642																																					p.E856K		.											.	BCAS3	495	0			c.G2566A						.						47.0	57.0	54.0					17																	59445783		2078	4205	6283	SO:0001583	missense	54828	exon24			ACGGAGGAGGGCC	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2566G>A	17.37:g.59445783G>A	ENSP00000375067:p.Glu856Lys	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	18.0	NM_001099432		Missense_Mutation	SNP	ENST00000390652.5	37	CCDS45749.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.901051	0.33535	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000408905	T;T;T	0.32023	1.48;1.49;1.47	5.92	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.38532	0.1044	N	0.24115	0.695	0.50313	D	0.999862	D;D;D;P;D	0.58268	0.974;0.982;0.974;0.956;0.974	D;P;D;D;D	0.70487	0.969;0.831;0.969;0.931;0.969	T	0.10989	-1.0606	10	0.10377	T	0.69	.	16.7192	0.85406	0.0:0.0:0.8698:0.1302	.	841;856;841;856;841	Q9H6U6-3;Q9H6U6-8;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;BCAS3_HUMAN;.	K	856;841;841	ENSP00000375067:E856K;ENSP00000385323:E841K;ENSP00000386173:E841K	ENSP00000375067:E856K	E	+	1	0	BCAS3	56800565	1.000000	0.71417	0.996000	0.52242	0.253000	0.25986	9.187000	0.94912	1.505000	0.48720	0.555000	0.69702	GAG	.		0.642	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449578.1	NM_017679	
BPIFA1	51297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	31828158	31828158	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr20:31828158delC	ENST00000354297.4	+	5	619	c.548delC	c.(547-549)tccfs	p.S183fs	BPIFA1_ENST00000375422.2_Frame_Shift_Del_p.S183fs|BPIFA1_ENST00000375413.4_Frame_Shift_Del_p.S183fs	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	183					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										TGCACCCATTCCCCTGGAAGC	0.537																																					p.S183fs		.											.	.	.	0			c.548delC						.						185.0	177.0	180.0					20																	31828158		2203	4300	6503	SO:0001589	frameshift_variant	51297	exon5			CCCATTCCCCTGG	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.548delC	20.37:g.31828158delC	ENSP00000346251:p.Ser183fs	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	17.0	NM_016583	A8K9R3|E1P5M9|Q9NZT0	Frame_Shift_Del	DEL	ENST00000354297.4	37	CCDS13217.1																																																																																			.		0.537	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852	
RITA1	84934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	113629261	113629261	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:113629261G>T	ENST00000548278.1	+	4	1141	c.449G>T	c.(448-450)gGt>gTt	p.G150V	C12orf52_ENST00000549621.1_Missense_Mutation_p.G150V|C12orf52_ENST00000552495.1_Missense_Mutation_p.G174V|RP11-545P7.4_ENST00000552525.1_RNA	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		150	Interaction with RBPJ/RBPSUH.				negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)			large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						ACCCCCAGGGGTAGCCACTCG	0.682																																					p.G150V		.											.	C12orf52	90	0			c.G449T						.																																			SO:0001583	missense	84934	exon4			CCAGGGGTAGCCA																												ENST00000548278.1:c.449G>T	12.37:g.113629261G>T	ENSP00000449841:p.Gly150Val	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	16.0	NM_032848	B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Missense_Mutation	SNP	ENST00000548278.1	37	CCDS9166.1	.	.	.	.	.	.	.	.	.	.	G	10.97	1.500355	0.26861	.	.	ENSG00000139405	ENST00000549621;ENST00000548278;ENST00000552495;ENST00000436053;ENST00000299731;ENST00000266813	T;T;T	0.33865	1.41;1.41;1.39	4.6	-0.693	0.11298	.	0.482752	0.19095	N	0.122844	T	0.27832	0.0685	M	0.64997	1.995	0.30687	N	0.751767	B;B;B	0.22683	0.041;0.073;0.041	B;B;B	0.26864	0.074;0.074;0.074	T	0.24693	-1.0153	10	0.56958	D	0.05	-7.5702	0.7008	0.00907	0.2938:0.1666:0.3683:0.1713	.	150;174;150	Q96K30-2;F8VRG5;Q96K30	.;.;RITA_HUMAN	V	150;150;174;150;150;147	ENSP00000448289:G150V;ENSP00000449841:G150V;ENSP00000448680:G174V	ENSP00000266813:G147V	G	+	2	0	C12orf52	112113644	0.335000	0.24748	0.232000	0.24009	0.008000	0.06430	0.463000	0.21972	0.178000	0.19917	-0.961000	0.02630	GGT	.		0.682	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405239.1		
C17orf47	284083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56620661	56620661	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:56620661A>T	ENST00000321691.3	-	1	1068	c.887T>A	c.(886-888)cTt>cAt	p.L296H	RP11-112H10.4_ENST00000580769.1_RNA|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000412945.3_5'Flank|SEPT4_ENST00000457347.2_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA	NM_001038704.2	NP_001033793	Q8NEP4	CQ047_HUMAN	chromosome 17 open reading frame 47	296										NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	24	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATACTTATGAAGAGACTCAGG	0.468																																					p.L296H		.											.	C17orf47	135	0			c.T887A						.						87.0	80.0	82.0					17																	56620661		2203	4300	6503	SO:0001583	missense	284083	exon1			TTATGAAGAGACT		CCDS32691.1	17q23.2	2012-10-11			ENSG00000181013	ENSG00000181013			26844	protein-coding gene	gene with protein product							Standard	NM_001038704		Approved	FLJ40121	uc002iwq.2	Q8NEP4	OTTHUMG00000179244	ENST00000321691.3:c.887T>A	17.37:g.56620661A>T	ENSP00000354874:p.Leu296His	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	55.0	NM_001038704	Q8N821	Missense_Mutation	SNP	ENST00000321691.3	37	CCDS32691.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.751565	0.49257	.	.	ENSG00000181013	ENST00000321691	T	0.33216	1.42	4.9	-2.06	0.07298	.	1.925310	0.02226	N	0.064424	T	0.24470	0.0593	N	0.08118	0	0.09310	N	1	D	0.63046	0.992	P	0.54431	0.752	T	0.09751	-1.0660	10	0.38643	T	0.18	-3.0E-4	4.622	0.12460	0.3417:0.3329:0.3254:0.0	.	296	Q8NEP4	CQ047_HUMAN	H	296	ENSP00000354874:L296H	ENSP00000354874:L296H	L	-	2	0	C17orf47	53975660	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.315000	0.08081	-0.330000	0.08514	0.379000	0.24179	CTT	.		0.468	C17orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445443.1	NM_001038704	
C21orf58	54058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	47722400	47722400	+	Splice_Site	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr21:47722400T>A	ENST00000291691.7	-	7	1948	c.812A>T	c.(811-813)cAg>cTg	p.Q271L	C21orf58_ENST00000397679.1_Splice_Site_p.Q165L|C21orf58_ENST00000472607.1_5'UTR|C21orf58_ENST00000397680.1_Splice_Site_p.Q165L|C21orf58_ENST00000397683.1_Splice_Site_p.Q165L|C21orf58_ENST00000397682.3_Splice_Site_p.Q165L	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	271										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		TAAGCCTACCTGCAGGGCTGG	0.572																																					p.Q271L		.											.	C21orf58	91	0			c.A812T						.						25.0	23.0	24.0					21																	47722400		2203	4299	6502	SO:0001630	splice_region_variant	54058	exon7			CCTACCTGCAGGG		CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.813+1A>T	21.37:g.47722400T>A		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	57.0	NM_058180	B3KPI1	Missense_Mutation	SNP	ENST00000291691.7	37	CCDS13735.1	.	.	.	.	.	.	.	.	.	.	T	10.88	1.476108	0.26511	.	.	ENSG00000160298	ENST00000397683;ENST00000417060;ENST00000397682;ENST00000291691;ENST00000397679;ENST00000397680	T;T;T;T;T;T	0.46819	0.86;0.87;0.86;0.86;0.86;0.86	3.8	1.36	0.22044	.	1.397300	0.04488	N	0.378914	T	0.61286	0.2335	L	0.54323	1.7	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.78314	0.991;0.991;0.991	T	0.52034	-0.8629	10	0.41790	T	0.15	4.3196	5.1767	0.15139	0.0:0.1025:0.1822:0.7153	.	271;165;271	P58505;Q8N7N9;P58505-2	CU058_HUMAN;.;.	L	165;233;165;271;165;165	ENSP00000380799:Q165L;ENSP00000402356:Q233L;ENSP00000380798:Q165L;ENSP00000291691:Q271L;ENSP00000380796:Q165L;ENSP00000380797:Q165L	ENSP00000291691:Q271L	Q	-	2	0	C21orf58	46546828	1.000000	0.71417	0.973000	0.42090	0.065000	0.16274	4.404000	0.59735	0.284000	0.22305	0.379000	0.24179	CAG	.		0.572	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207283.1	NM_058180	Missense_Mutation
CACNA1E	777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	181701627	181701627	+	Missense_Mutation	SNP	C	C	A	rs374689888		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:181701627C>A	ENST00000367573.2	+	20	2405	c.2405C>A	c.(2404-2406)gCg>gAg	p.A802E	CACNA1E_ENST00000367570.1_Missense_Mutation_p.A802E|CACNA1E_ENST00000367567.4_Missense_Mutation_p.A409E|CACNA1E_ENST00000357570.5_Missense_Mutation_p.A753E|CACNA1E_ENST00000358338.5_Missense_Mutation_p.A734E|CACNA1E_ENST00000526775.1_Missense_Mutation_p.A783E|CACNA1E_ENST00000360108.3_Missense_Mutation_p.A783E	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	802					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGAGAGGAGGCGCCGACCATG	0.657																																					p.A802E		.											.	CACNA1E	95	0			c.C2405A						.						38.0	57.0	50.0					1																	181701627		1763	3295	5058	SO:0001583	missense	777	exon20			AGGAGGCGCCGAC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2405C>A	1.37:g.181701627C>A	ENSP00000356545:p.Ala802Glu	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	57.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	0.506	-0.868753	0.02570	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96011	-3.81;-3.8;-3.81;-3.8;-3.88;-3.8;-3.81	3.82	3.82	0.43975	.	38.321500	0.00166	N	0.000000	D	0.92179	0.7520	N	0.03608	-0.345	0.35702	D	0.81569	D;D;D	0.63880	0.975;0.993;0.975	P;P;P	0.58013	0.686;0.831;0.686	D	0.84652	0.0701	10	0.02654	T	1	.	11.5128	0.50502	0.0:1.0:0.0:0.0	.	783;802;802	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	E	802;783;753;734;409;783;802	ENSP00000356542:A802E;ENSP00000434814:A783E;ENSP00000350183:A753E;ENSP00000351101:A734E;ENSP00000356539:A409E;ENSP00000353222:A783E;ENSP00000356545:A802E	ENSP00000350183:A753E	A	+	2	0	CACNA1E	179968250	.	.	0.990000	0.47175	0.056000	0.15407	.	.	2.437000	0.82529	0.561000	0.74099	GCG	.		0.657	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CACNG8	59283	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	54485674	54485674	+	Silent	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:54485674G>T	ENST00000270458.2	+	4	952	c.849G>T	c.(847-849)ccG>ccT	p.P283P	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	283	Gly-rich.				calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		CCAGCGAGCCGTCGCCGTCGC	0.746																																					p.P283P		.											.	CACNG8	90	0			c.G849T						.						1.0	2.0	1.0					19																	54485674		1088	2434	3522	SO:0001819	synonymous_variant	59283	exon4			CGAGCCGTCGCCG	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.849G>T	19.37:g.54485674G>T		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	9.0	NM_031895	Q9BXT0|Q9BY23	Silent	SNP	ENST00000270458.2	37	CCDS33104.1																																																																																			.		0.746	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139361.3		
CARD11	84433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2951897	2951897	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:2951897T>C	ENST00000396946.4	-	23	3456	c.3053A>G	c.(3052-3054)cAg>cGg	p.Q1018R		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1018	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CTCCGTCTTCTGCCTTCTGAG	0.587			Mis		DLBCL																																p.Q1018R		.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	870	0			c.A3053G						.						197.0	142.0	160.0					7																	2951897		2203	4300	6503	SO:0001583	missense	84433	exon23			GTCTTCTGCCTTC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3053A>G	7.37:g.2951897T>C	ENSP00000380150:p.Gln1018Arg	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	43.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	T	14.67	2.604639	0.46423	.	.	ENSG00000198286	ENST00000396946	T	0.16324	2.35	4.62	4.62	0.57501	.	0.085870	0.48286	D	0.000193	T	0.12646	0.0307	L	0.35414	1.06	0.54753	D	0.999981	B	0.15930	0.015	B	0.10450	0.005	T	0.07908	-1.0748	10	0.11794	T	0.64	-37.6983	12.6016	0.56501	0.0:0.0:0.0:1.0	.	1018	Q9BXL7	CAR11_HUMAN	R	1018	ENSP00000380150:Q1018R	ENSP00000380150:Q1018R	Q	-	2	0	CARD11	2918423	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.968000	0.76086	1.723000	0.51488	0.482000	0.46254	CAG	.		0.587	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
CCDC27	148870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	3686347	3686347	+	Splice_Site	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:3686347C>A	ENST00000294600.2	+	11	1828	c.1744C>A	c.(1744-1746)Ctc>Atc	p.L582I		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	582										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TTGCTCACAGCTCGAGAGGTT	0.517																																					p.L582I		.											.	CCDC27	91	0			c.C1744A						.						163.0	126.0	139.0					1																	3686347		2203	4300	6503	SO:0001630	splice_region_variant	148870	exon11			TCACAGCTCGAGA		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1744-1C>A	1.37:g.3686347C>A		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	26.0	NM_152492	Q5TBV3|Q96M50	Missense_Mutation	SNP	ENST00000294600.2	37	CCDS50.1	.	.	.	.	.	.	.	.	.	.	C	13.26	2.183952	0.38609	.	.	ENSG00000162592	ENST00000294600	T	0.27402	1.67	4.79	3.86	0.44501	.	0.463546	0.18117	N	0.151161	T	0.43366	0.1244	M	0.64997	1.995	0.25438	N	0.988122	D	0.62365	0.991	P	0.56563	0.801	T	0.23084	-1.0198	9	.	.	.	-3.1819	9.4366	0.38643	0.0:0.898:0.0:0.102	.	582	Q2M243	CCD27_HUMAN	I	582	ENSP00000294600:L582I	.	L	+	1	0	CCDC27	3676207	1.000000	0.71417	0.246000	0.24233	0.015000	0.08874	1.650000	0.37292	0.978000	0.38470	0.655000	0.94253	CTC	.		0.517	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009740.1	NM_152492	Missense_Mutation
CCKBR	887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6292577	6292577	+	Missense_Mutation	SNP	C	C	T	rs201876764		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:6292577C>T	ENST00000334619.2	+	5	1341	c.1148C>T	c.(1147-1149)gCc>gTc	p.A383V	CCKBR_ENST00000532715.1_Missense_Mutation_p.A299V|CCKBR_ENST00000525462.1_Missense_Mutation_p.A452V	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	383					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TACGCCTCGGCCTGTGTCAAC	0.632																																					p.A383V		.											.	CCKBR	574	0			c.C1148T						.						129.0	108.0	115.0					11																	6292577		2201	4296	6497	SO:0001583	missense	887	exon5			CCTCGGCCTGTGT	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.1148C>T	11.37:g.6292577C>T	ENSP00000335544:p.Ala383Val	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	30.0	NM_176875	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	ENST00000334619.2	37	CCDS7761.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928070	0.92389	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.72835	-0.69;-0.69;-0.69	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.057241	0.64402	D	0.000001	D	0.86104	0.5853	M	0.86502	2.82	0.54753	D	0.999987	D;D	0.76494	0.999;0.998	D;D	0.74674	0.984;0.969	D	0.88527	0.3100	10	0.72032	D	0.01	.	17.3923	0.87435	0.0:1.0:0.0:0.0	.	452;383	P32239-2;P32239	.;GASR_HUMAN	V	383;299;452	ENSP00000335544:A383V;ENSP00000432079:A299V;ENSP00000435534:A452V	ENSP00000335544:A383V	A	+	2	0	CCKBR	6249153	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.770000	0.85390	2.425000	0.82216	0.557000	0.71058	GCC	.		0.632	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257230.2	NM_176875	
CDH11	1009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	65016064	65016064	+	Silent	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr16:65016064G>A	ENST00000268603.4	-	8	1755	c.1140C>T	c.(1138-1140)ccC>ccT	p.P380P	CDH11_ENST00000394156.3_Silent_p.P380P|CDH11_ENST00000566827.1_Silent_p.P254P	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	380	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		AGAACATAGGGGGCTCATCAG	0.527			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.P380P		.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	CDH11,NS,carcinoma,-1	CDH11	852	0			c.C1140T						.						165.0	138.0	147.0					16																	65016064		2203	4300	6503	SO:0001819	synonymous_variant	1009	exon8			CATAGGGGGCTCA	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1140C>T	16.37:g.65016064G>A		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	43.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	37	CCDS10803.1																																																																																			.		0.527	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CDH7	1005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	63530135	63530135	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr18:63530135T>A	ENST00000397968.2	+	11	2272	c.1846T>A	c.(1846-1848)Tgt>Agt	p.C616S	CDH7_ENST00000323011.3_Missense_Mutation_p.C616S|CDH7_ENST00000536984.2_Missense_Mutation_p.C616S|RP11-389J22.1_ENST00000581987.1_RNA	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	616					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CATACTCGCCTGTGTCTTGAC	0.507																																					p.C616S		.											.	CDH7	94	0			c.T1846A						.						90.0	85.0	87.0					18																	63530135		2203	4300	6503	SO:0001583	missense	1005	exon11			CTCGCCTGTGTCT	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1846T>A	18.37:g.63530135T>A	ENSP00000381058:p.Cys616Ser	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	28.0	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261269	0.59431	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.60299	0.2;0.51;0.2	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.74650	0.3744	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.78314	0.858;0.991	T	0.77048	-0.2732	10	0.56958	D	0.05	.	15.3548	0.74418	0.0:0.0:0.0:1.0	.	616;616	F5H5X9;Q9ULB5	.;CADH7_HUMAN	S	616	ENSP00000319166:C616S;ENSP00000443030:C616S;ENSP00000381058:C616S	ENSP00000319166:C616S	C	+	1	0	CDH7	61681115	1.000000	0.71417	0.996000	0.52242	0.141000	0.21300	8.013000	0.88655	2.044000	0.60594	0.482000	0.46254	TGT	.		0.507	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
CDHR2	54825	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	176016107	176016107	+	Frame_Shift_Del	DEL	G	G	-	rs373435992		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:176016107delG	ENST00000510636.1	+	22	3206	c.2932delG	c.(2932-2934)gggfs	p.G978fs	CDHR2_ENST00000261944.5_Frame_Shift_Del_p.G978fs|CDHR2_ENST00000506348.1_Frame_Shift_Del_p.G978fs	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	978	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G978W(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CTCTAAGGACGGGGCCACCAT	0.577																																					p.G978fs		.											.	CDHR2	70	1	Substitution - Missense(1)	lung(1)	c.2932delG						.						227.0	218.0	221.0					5																	176016107		2203	4300	6503	SO:0001589	frameshift_variant	54825	exon22			AAGGACGGGGCCA	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2932delG	5.37:g.176016107delG	ENSP00000424565:p.Gly978fs	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	23.0	NM_017675	A1L3U4|A6NC80|Q9NXP8	Frame_Shift_Del	DEL	ENST00000510636.1	37	CCDS34297.1																																																																																			.		0.577	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
CDKN1C	1028	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	2906437	2906437	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:2906437C>T	ENST00000414822.3	-	1	674	c.283G>A	c.(283-285)Gtg>Atg	p.V95M	CDKN1C_ENST00000440480.2_Missense_Mutation_p.V84M|CDKN1C_ENST00000430149.2_Missense_Mutation_p.V95M|CDKN1C_ENST00000313407.6_Missense_Mutation_p.V84M|CDKN1C_ENST00000380725.1_Missense_Mutation_p.V84M	NM_000076.2	NP_000067.1	P49918	CDN1C_HUMAN	cyclin-dependent kinase inhibitor 1C (p57, Kip2)	95					adrenal gland development (GO:0030325)|aging (GO:0007568)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|digestive system development (GO:0055123)|embryonic placenta morphogenesis (GO:0060669)|genetic imprinting (GO:0071514)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|myeloid cell differentiation (GO:0030099)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of kinase activity (GO:0033673)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron maturation (GO:0042551)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|skeletal system development (GO:0001501)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)			central_nervous_system(1)|lung(1)	2		all_epithelial(84;0.000187)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|Breast(177;0.00328)|all_neural(188;0.00681)|all_lung(207;0.157)|Lung NSC(207;0.216)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCCACCTGCACCGTCTCGCGG	0.736																																					p.V95M	GBM(111;59 1151 2497 5746 16112 18241 29216)	.											.	CDKN1C	838	0			c.G283A						.						8.0	6.0	7.0					11																	2906437		1997	3974	5971	SO:0001583	missense	1028	exon1			CCTGCACCGTCTC	D64137	CCDS7738.1, CCDS44519.1	11p15.5	2014-09-17	2004-02-13		ENSG00000129757	ENSG00000129757			1786	protein-coding gene	gene with protein product		600856	"""Beckwith-Wiedemann syndrome"""	BWCR, BWS		7729684	Standard	NM_000076		Approved	P57, KIP2	uc001lws.4	P49918	OTTHUMG00000010040	ENST00000414822.3:c.283G>A	11.37:g.2906437C>T	ENSP00000413720:p.Val95Met	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	17.0	NM_000076		Missense_Mutation	SNP	ENST00000414822.3	37	CCDS7738.1	.	.	.	.	.	.	.	.	.	.	c	18.27	3.586003	0.66105	.	.	ENSG00000129757	ENST00000380725;ENST00000414822;ENST00000440480;ENST00000313407;ENST00000430149	D;D;D;D;D	0.91464	-2.04;-2.51;-2.85;-2.85;-2.51	2.43	2.43	0.29744	.	.	.	.	.	D	0.92277	0.7550	L	0.61218	1.895	0.36664	D	0.878095	D;D	0.61080	0.989;0.989	P;D	0.69654	0.862;0.965	D	0.91945	0.5566	9	0.72032	D	0.01	.	5.3125	0.15837	0.1973:0.498:0.3046:0.0	.	84;95	A6NK88;P49918	.;CDN1C_HUMAN	M	84;95;84;84;95	ENSP00000370101:V84M;ENSP00000413720:V95M;ENSP00000411257:V84M;ENSP00000321019:V84M;ENSP00000411552:V95M	ENSP00000321019:V84M	V	-	1	0	CDKN1C	2863013	0.912000	0.30974	1.000000	0.80357	0.943000	0.58893	2.608000	0.46308	1.407000	0.46875	0.298000	0.19748	GTG	.		0.736	CDKN1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000027774.2	NM_000076	
CEP170B	283638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105349414	105349414	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr14:105349414G>C	ENST00000414716.3	+	8	848	c.620G>C	c.(619-621)gGc>gCc	p.G207A	CEP170B_ENST00000453495.1_Missense_Mutation_p.G208A|CEP170B_ENST00000556508.1_Missense_Mutation_p.G137A|CEP170B_ENST00000418279.1_Missense_Mutation_p.G137A	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	207						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GAGCTCCACGGCTTCCGCGCC	0.692																																					p.G207A		.											.	.	.	0			c.G620C						.						6.0	8.0	8.0					14																	105349414		1908	4073	5981	SO:0001583	missense	283638	exon8			TCCACGGCTTCCG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.620G>C	14.37:g.105349414G>C	ENSP00000404151:p.Gly207Ala	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	13.0	NM_001112726	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	g	10.57	1.388079	0.25118	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	3.25	2.33	0.28932	.	1.378270	0.04536	N	0.387270	T	0.31009	0.0783	L	0.48362	1.52	0.09310	N	1	B;B;B	0.26708	0.157;0.004;0.001	B;B;B	0.29785	0.107;0.003;0.003	T	0.26087	-1.0113	10	0.12103	T	0.63	-17.2276	5.2461	0.15498	0.1595:0.2094:0.6311:0.0	.	207;207;137	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	A	137;207;208;137	ENSP00000451249:G137A;ENSP00000404151:G207A;ENSP00000407238:G208A;ENSP00000415006:G137A	ENSP00000404151:G207A	G	+	2	0	KIAA0284	104420459	0.039000	0.19947	0.014000	0.15608	0.144000	0.21451	2.394000	0.44450	0.667000	0.31107	0.401000	0.26515	GGC	.		0.692	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
CFI	3426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	110685711	110685711	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:110685711A>C	ENST00000394634.2	-	3	671	c.464T>G	c.(463-465)cTt>cGt	p.L155R	CFI_ENST00000512148.1_Missense_Mutation_p.L155R|CFI_ENST00000394635.3_Missense_Mutation_p.L155R|CFI_ENST00000510800.1_Missense_Mutation_p.L155R	NM_000204.3	NP_000195	P05156	CFAI_HUMAN	complement factor I	155	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|skin(2)|stomach(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		CCCAAGGTCAAGGCAGGCCAC	0.418																																					p.L155R		.											.	CFI	90	0			c.T464G						.						220.0	199.0	206.0					4																	110685711		2203	4300	6503	SO:0001583	missense	3426	exon3			AGGTCAAGGCAGG	J02770	CCDS34049.1	4q25	2014-09-17	2006-02-10	2006-02-10		ENSG00000205403	3.4.21.45	"""Complement system"""	5394	protein-coding gene	gene with protein product	"""Konglutinogen-activating factor"", ""C3b-inactivator"""	217030	"""I factor (complement)"""	IF		2956252	Standard	NM_000204		Approved	FI, C3b-INA, KAF	uc003hzr.4	P05156		ENST00000394634.2:c.464T>G	4.37:g.110685711A>C	ENSP00000378130:p.Leu155Arg	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	32.0	NM_000204	O60442	Missense_Mutation	SNP	ENST00000394634.2	37	CCDS34049.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.924959	0.34002	.	.	ENSG00000205403	ENST00000394635;ENST00000394634;ENST00000540104;ENST00000512148;ENST00000536228;ENST00000510800	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	5.86	0.0617	0.14341	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.251480	0.05616	N	0.578929	T	0.06917	0.0176	N	0.00602	-1.34	0.09310	N	1	B;B;B	0.14012	0.002;0.007;0.009	B;B;B	0.15052	0.007;0.007;0.012	T	0.31779	-0.9931	10	0.17369	T	0.5	-0.8633	3.4879	0.07626	0.2996:0.4315:0.0717:0.1972	.	155;155;155	E7ETH0;G3XAM2;P05156	.;.;CFAI_HUMAN	R	155;155;155;155;137;155	ENSP00000378131:L155R;ENSP00000378130:L155R;ENSP00000427438:L155R;ENSP00000422009:L155R	ENSP00000378130:L155R	L	-	2	0	CFI	110905160	0.000000	0.05858	0.006000	0.13384	0.877000	0.50540	-1.324000	0.02690	0.428000	0.26173	0.533000	0.62120	CTT	.		0.418	CFI-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_000204	
CHD7	55636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	61769252	61769252	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:61769252A>G	ENST00000423902.2	+	34	7892	c.7413A>G	c.(7411-7413)tcA>tcG	p.S2471S	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000529472.1_3'UTR	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2471					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CTAATGTCTCAACACCAGTGT	0.433																																					p.S2471S		.											.	CHD7	141	0			c.A7413G						.						176.0	169.0	171.0					8																	61769252		1889	4112	6001	SO:0001819	synonymous_variant	55636	exon34			TGTCTCAACACCA	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.7413A>G	8.37:g.61769252A>G		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	70.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	CCDS47865.1																																																																																			.		0.433	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
CLCN1	1180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143043750	143043750	+	Splice_Site	SNP	A	A	T	rs199610988	byFrequency	TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:143043750A>T	ENST00000343257.2	+	19	2450	c.2363A>T	c.(2362-2364)cAg>cTg	p.Q788L		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	788					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					AAAACAACCCAGGTGAGAGGA	0.542																																					p.Q788L		.											.	CLCN1	156	0			c.A2363T						.						80.0	79.0	80.0					7																	143043750		2203	4300	6503	SO:0001630	splice_region_variant	1180	exon19			CAACCCAGGTGAG	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2364+1A>T	7.37:g.143043750A>T		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	10.0	NM_000083	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	A	11.66	1.703664	0.30232	.	.	ENSG00000188037	ENST00000343257	D	0.85629	-2.01	4.49	4.49	0.54785	.	0.250077	0.29480	N	0.012040	D	0.83806	0.5334	M	0.75777	2.31	0.41610	D	0.988909	P	0.40970	0.734	B	0.39339	0.297	D	0.85181	0.1004	10	0.56958	D	0.05	.	10.4836	0.44708	1.0:0.0:0.0:0.0	.	788	P35523	CLCN1_HUMAN	L	788	ENSP00000339867:Q788L	ENSP00000339867:Q788L	Q	+	2	0	CLCN1	142753872	1.000000	0.71417	0.990000	0.47175	0.327000	0.28475	3.999000	0.57031	1.797000	0.52628	0.459000	0.35465	CAG	A|0.999;C|0.001		0.542	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	Missense_Mutation
CNGA4	1262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6261357	6261357	+	Silent	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:6261357C>T	ENST00000379936.2	+	4	448	c.333C>T	c.(331-333)cgC>cgT	p.R111R	CNGA4_ENST00000533426.1_Intron	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	111					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTACGTTCGCACCTGGAGTT	0.607																																					p.R111R		.											.	CNGA4	91	0			c.C333T						.						133.0	125.0	128.0					11																	6261357		2201	4296	6497	SO:0001819	synonymous_variant	1262	exon4			CGTTCGCACCTGG	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.333C>T	11.37:g.6261357C>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	23.0	NM_001037329		Silent	SNP	ENST00000379936.2	37	CCDS31408.1																																																																																			.		0.607	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329	
CNTLN	54875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	17309125	17309125	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr9:17309125A>T	ENST00000380647.3	+	8	1300	c.1216A>T	c.(1216-1218)Act>Tct	p.T406S	CNTLN_ENST00000425824.1_Missense_Mutation_p.T406S|CNTLN_ENST00000262360.5_Missense_Mutation_p.T406S			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	406					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GCAAAGTGTTACTAATCTTCA	0.323																																					p.T406S		.											.	CNTLN	91	0			c.A1216T						.						49.0	47.0	48.0					9																	17309125		1834	4087	5921	SO:0001583	missense	54875	exon8			AGTGTTACTAATC	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1216A>T	9.37:g.17309125A>T	ENSP00000370021:p.Thr406Ser	Somatic	509.0	0.0		WXS	Illumina HiSeq	Phase_I	368.0	153.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	A	10.27	1.304038	0.23736	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.39229	1.09;1.09;1.09	5.66	-0.586	0.11694	.	.	.	.	.	T	0.16128	0.0388	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.12837	0.008;0.008;0.008	T	0.31779	-0.9931	9	0.02654	T	1	.	5.6425	0.17572	0.555:0.1526:0.2923:0.0	.	406;406;406	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	S	406	ENSP00000370021:T406S;ENSP00000392798:T406S;ENSP00000262360:T406S	ENSP00000262360:T406S	T	+	1	0	CNTLN	17299125	0.843000	0.29541	0.779000	0.31741	0.634000	0.38068	-0.008000	0.12788	0.153000	0.19213	-1.964000	0.00472	ACT	.		0.323	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
COL26A1	136227	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	101176396	101176396	+	RNA	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:101176396G>T	ENST00000397927.3	+	0	632				COL26A1_ENST00000313669.7_RNA|COL26A1_ENST00000528707.1_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											AGTGACATGAGTGAGCGACTG	0.592																																					.		.											.	.	.	0			.						.						66.0	61.0	62.0					7																	101176396		2047	4208	6255			136227	.			ACATGAGTGAGCG	AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101176396G>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	10.0	.	Q32M90	RNA	SNP	ENST00000397927.3	37		.	.	.	.	.	.	.	.	.	.	G	18.93	3.726885	0.69074	.	.	ENSG00000160963	ENST00000313669	D	0.90732	-2.72	4.56	3.66	0.41972	.	0.255358	0.27319	N	0.019913	D	0.89584	0.6757	M	0.63843	1.955	0.22947	N	0.998523	D;D	0.56035	0.974;0.974	P;P	0.48227	0.571;0.571	D	0.83688	0.0175	10	0.72032	D	0.01	.	8.9082	0.35537	0.1089:0.0:0.8911:0.0	.	140;140	Q96A83;C9JPW4	EMID2_HUMAN;.	I	140	ENSP00000318234:S140I	ENSP00000318234:S140I	S	+	2	0	EMID2	100963116	0.850000	0.29656	0.997000	0.53966	0.986000	0.74619	1.016000	0.29976	2.072000	0.62099	0.462000	0.41574	AGT	.		0.592	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000315898.2	NM_133457	
COL6A6	131873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130285713	130285713	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:130285713T>A	ENST00000358511.6	+	4	1481	c.1450T>A	c.(1450-1452)Tgg>Agg	p.W484R	COL6A6_ENST00000453409.2_Missense_Mutation_p.W484R	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	484	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TGCTGACAGCTGGGACTTGGA	0.478																																					p.W484R		.											.	COL6A6	76	0			c.T1450A						.						127.0	128.0	128.0					3																	130285713		1919	4117	6036	SO:0001583	missense	131873	exon4			GACAGCTGGGACT	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1450T>A	3.37:g.130285713T>A	ENSP00000351310:p.Trp484Arg	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	36.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	T	10.44	1.351649	0.24512	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.77358	-1.09;-1.09	5.18	4.01	0.46588	von Willebrand factor, type A (3);	0.351095	0.25222	N	0.032223	T	0.53417	0.1795	N	0.08118	0	0.09310	N	1	B	0.17268	0.021	B	0.19391	0.025	T	0.33548	-0.9864	10	0.15952	T	0.53	.	6.4847	0.22083	0.0:0.2761:0.0:0.7239	.	484	A6NMZ7	CO6A6_HUMAN	R	484	ENSP00000351310:W484R;ENSP00000399236:W484R	ENSP00000351310:W484R	W	+	1	0	COL6A6	131768403	0.000000	0.05858	0.984000	0.44739	0.995000	0.86356	0.237000	0.17985	1.954000	0.56735	0.459000	0.35465	TGG	.		0.478	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
COL9A1	1297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	70981793	70981793	+	Splice_Site	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:70981793T>A	ENST00000357250.6	-	13	1224		c.e13-2		COL9A1_ENST00000489611.1_Splice_Site|COL9A1_ENST00000320755.7_Splice_Site|COL9A1_ENST00000370499.4_Intron	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						ACCACGGCCCTAAAAGAGTAC	0.323																																					.		.											.	COL9A1	94	0			c.1066-2A>T						.						43.0	46.0	45.0					6																	70981793		2202	4299	6501	SO:0001630	splice_region_variant	1297	exon14			CGGCCCTAAAAGA		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1066-2A>T	6.37:g.70981793T>A		Somatic	393.0	0.0		WXS	Illumina HiSeq	Phase_I	388.0	113.0	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Splice_Site	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.915352	0.52546	.	.	ENSG00000112280	ENST00000357250;ENST00000320755	.	.	.	6.01	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7159	0.46013	0.0:0.0:0.1594:0.8406	.	.	.	.	.	-1	.	.	.	-	.	.	COL9A1	71038514	1.000000	0.71417	0.958000	0.39756	0.756000	0.42949	2.968000	0.49224	2.307000	0.77673	0.528000	0.53228	.	.		0.323	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		Intron
CPSF2	53981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	92609350	92609350	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr14:92609350A>G	ENST00000298875.4	+	9	1137	c.852A>G	c.(850-852)gtA>gtG	p.V284V		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	284					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		CATGTTAGGTAGAATGGATGA	0.333																																					p.V284V	Ovarian(78;28 1788 18702 44111)	.											.	CPSF2	92	0			c.A852G						.						82.0	77.0	79.0					14																	92609350		2203	4300	6503	SO:0001819	synonymous_variant	53981	exon9			TTAGGTAGAATGG	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.852A>G	14.37:g.92609350A>G		Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	65.0	NM_017437	B3KME1|Q6NSJ1|Q9H3W7	Silent	SNP	ENST00000298875.4	37	CCDS9902.1																																																																																			.		0.333	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1		
CRADD	8738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	94243784	94243784	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:94243784A>T	ENST00000542893.2	+	3	655	c.337A>T	c.(337-339)Agc>Tgc	p.S113C	CRADD_ENST00000548483.1_Intron|CRADD_ENST00000548330.1_3'UTR|CRADD_ENST00000332896.3_Missense_Mutation_p.S113C|CRADD_ENST00000541813.1_Intron			P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with death domain	113					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic signaling pathway (GO:2001235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death domain binding (GO:0070513)|protease binding (GO:0002020)|protein binding, bridging (GO:0030674)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)	8						CATCCTCAACAGCTCCCCATC	0.567																																					p.S113C		.											.	CRADD	228	0			c.A337T						.						60.0	61.0	61.0					12																	94243784		2203	4300	6503	SO:0001583	missense	8738	exon3			CTCAACAGCTCCC	U84388	CCDS9048.1	12q21.33-q23.1	2008-08-04				ENSG00000169372			2340	protein-coding gene	gene with protein product	"""RIP-associated ICH1/CED3-homologous protein with death domain"""	603454				8985253, 9044836	Standard	NM_003805		Approved	RAIDD	uc001tda.3	P78560		ENST00000542893.2:c.337A>T	12.37:g.94243784A>T	ENSP00000439068:p.Ser113Cys	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	31.0	NM_003805	B7Z2Q5	Missense_Mutation	SNP	ENST00000542893.2	37	CCDS9048.1	.	.	.	.	.	.	.	.	.	.	A	16.76	3.212499	0.58452	.	.	ENSG00000169372	ENST00000332896;ENST00000542893	D;D	0.93712	-3.27;-3.27	5.86	4.65	0.58169	Death (1);DEATH-like (1);	0.297093	0.44097	D	0.000486	D	0.90665	0.7072	L	0.45581	1.43	0.80722	D	1	D	0.59357	0.985	B	0.43754	0.43	D	0.91248	0.5027	10	0.59425	D	0.04	-29.5476	12.7723	0.57427	0.8634:0.1366:0.0:0.0	.	113	P78560	CRADD_HUMAN	C	113	ENSP00000327647:S113C;ENSP00000439068:S113C	ENSP00000327647:S113C	S	+	1	0	CRADD	92767915	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	6.140000	0.71738	2.237000	0.73441	0.460000	0.39030	AGC	.		0.567	CRADD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408515.1	NM_003805	
CRNN	49860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152382364	152382364	+	Silent	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:152382364T>A	ENST00000271835.3	-	3	1256	c.1194A>T	c.(1192-1194)acA>acT	p.T398T	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	398					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCCGGTACTGTCTCTCCTG	0.612																																					p.T398T		.											.	CRNN	93	0			c.A1194T						.						103.0	85.0	91.0					1																	152382364		2203	4300	6503	SO:0001819	synonymous_variant	49860	exon3			CGGTACTGTCTCT	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1194A>T	1.37:g.152382364T>A		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	16.0	NM_016190	B2RE60|Q8N613	Silent	SNP	ENST00000271835.3	37	CCDS1010.1																																																																																			.		0.612	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
CST9L	128821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	23548859	23548859	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr20:23548859A>G	ENST00000376979.3	-	1	527	c.229T>C	c.(229-231)Tgg>Cgg	p.W77R		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	77						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TGCTCCTTCCAGGAATTCAAG	0.552																																					p.W77R		.											.	CST9L	90	0			c.T229C						.						139.0	112.0	122.0					20																	23548859		2203	4300	6503	SO:0001583	missense	128821	exon1			CCTTCCAGGAATT		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.229T>C	20.37:g.23548859A>G	ENSP00000366178:p.Trp77Arg	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	25.0	NM_080610	B2R5A1	Missense_Mutation	SNP	ENST00000376979.3	37	CCDS13157.1	.	.	.	.	.	.	.	.	.	.	A	6.704	0.498515	0.12762	.	.	ENSG00000101435	ENST00000376979	T	0.25749	1.78	1.75	0.617	0.17619	Proteinase inhibitor I25, cystatin (2);	1.252520	0.06139	N	0.672032	T	0.16769	0.0403	N	0.25992	0.78	0.09310	N	1	P	0.39181	0.663	B	0.39771	0.309	T	0.21008	-1.0258	10	0.21540	T	0.41	.	3.452	0.07502	0.7749:0.0:0.2251:0.0	.	77	Q9H4G1	CST9L_HUMAN	R	77	ENSP00000366178:W77R	ENSP00000366178:W77R	W	-	1	0	CST9L	23496859	0.000000	0.05858	0.001000	0.08648	0.065000	0.16274	-0.063000	0.11655	0.138000	0.18790	0.260000	0.18958	TGG	.		0.552	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610	
DEAF1	10522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	679715	679715	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:679715G>T	ENST00000382409.3	-	8	1583	c.1099C>A	c.(1099-1101)Cag>Aag	p.Q367K	DEAF1_ENST00000525904.1_5'UTR|DEAF1_ENST00000338675.6_Missense_Mutation_p.Q278K|RP11-754B17.1_ENST00000527799.1_RNA	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	367			Q -> H (in a primary colorectal cancer). {ECO:0000269|PubMed:11705868}.		anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		ACGTCGCCCTGGGCCGGACTC	0.642																																					p.Q367K		.											.	DEAF1	90	0			c.C1099A						.						81.0	71.0	74.0					11																	679715		2203	4300	6503	SO:0001583	missense	10522	exon8			CGCCCTGGGCCGG	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.1099C>A	11.37:g.679715G>T	ENSP00000371846:p.Gln367Lys	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	5.0	NM_021008	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	ENST00000382409.3	37	CCDS31327.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993056	0.54041	.	.	ENSG00000177030	ENST00000382409;ENST00000338675;ENST00000359958;ENST00000388804	T	0.66099	-0.19	3.49	3.49	0.39957	.	0.273852	0.31061	N	0.008329	T	0.50137	0.1598	L	0.40543	1.245	0.40886	D	0.984035	B	0.23377	0.084	B	0.15870	0.014	T	0.48375	-0.9041	10	0.19147	T	0.46	-9.4207	14.3254	0.66515	0.0:0.0:1.0:0.0	.	367	O75398	DEAF1_HUMAN	K	367;278;353;290	ENSP00000371846:Q367K	ENSP00000341902:Q278K	Q	-	1	0	DEAF1	669715	1.000000	0.71417	0.984000	0.44739	0.741000	0.42261	6.803000	0.75180	1.975000	0.57531	0.557000	0.71058	CAG	.		0.642	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383614.3	NM_021008	
DIAPH2	1730	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	95940062	95940062	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chrX:95940062A>C	ENST00000324765.8	+	1	352	c.5A>C	c.(4-6)gAg>gCg	p.E2A	DIAPH2_ENST00000373049.4_Missense_Mutation_p.E2A|DIAPH2_ENST00000373061.3_Missense_Mutation_p.E2A|DIAPH2_ENST00000373054.4_Missense_Mutation_p.E2A|DIAPH2_ENST00000355827.4_Missense_Mutation_p.E2A			O60879	DIAP2_HUMAN	diaphanous-related formin 2	2					actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AGAAAGATGGAGCAGCCCGGG	0.711																																					p.E2A		.											.	DIAPH2	133	0			c.A5C						.						11.0	14.0	13.0					X																	95940062		2022	3928	5950	SO:0001583	missense	1730	exon1			AGATGGAGCAGCC	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.5A>C	X.37:g.95940062A>C	ENSP00000321348:p.Glu2Ala	Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	73.0	NM_007309	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.595429	0.46318	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	D;D;D;D;D	0.82433	-1.55;-1.61;-1.5;-1.5;-1.55	3.63	3.63	0.41609	.	0.653709	0.12306	U	0.480680	D	0.83294	0.5223	N	0.22421	0.69	0.29630	N	0.845499	P;D;P	0.67145	0.956;0.996;0.88	P;D;P	0.73708	0.899;0.981;0.636	T	0.75671	-0.3237	10	0.87932	D	0	.	7.9505	0.30012	1.0:0.0:0.0:0.0	.	2;2;2	O60879;O60879-2;B7ZLJ0	DIAP2_HUMAN;.;.	A	2	ENSP00000362152:E2A;ENSP00000362145:E2A;ENSP00000348082:E2A;ENSP00000362140:E2A;ENSP00000321348:E2A	ENSP00000321348:E2A	E	+	2	0	DIAPH2	95826718	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.323000	0.52014	1.464000	0.47987	0.381000	0.24937	GAG	.		0.711	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38158025	38158025	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:38158025C>T	ENST00000308059.6	+	28	3959	c.3938C>T	c.(3937-3939)cCt>cTt	p.P1313L	DLEC1_ENST00000452631.2_Missense_Mutation_p.P1316L|DLEC1_ENST00000346219.3_Missense_Mutation_p.P1313L					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TATGGGCCACCTTTCCCGCTG	0.607																																					p.P1313L		.											.	DLEC1	161	0			c.C3938T						.						51.0	55.0	53.0					3																	38158025		1999	4158	6157	SO:0001583	missense	9940	exon28			GGCCACCTTTCCC	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.3938C>T	3.37:g.38158025C>T	ENSP00000308597:p.Pro1313Leu	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	31.0	NM_007337		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748585	0.49257	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.08458	3.13;3.09;3.36	5.08	3.24	0.37175	.	0.222183	0.37809	N	0.001934	T	0.25044	0.0608	M	0.75264	2.295	0.58432	D	0.999994	D;D;D;D	0.89917	0.999;0.976;0.999;1.0	D;P;D;D	0.78314	0.984;0.629;0.984;0.991	T	0.00366	-1.1786	10	0.72032	D	0.01	-7.1893	9.1685	0.37065	0.0:0.7695:0.1482:0.0823	.	1316;1313;1313;1313	F8W6T4;B7ZW06;Q9Y238-3;Q9Y238	.;.;.;DLEC1_HUMAN	L	1313;1313;1316	ENSP00000308597:P1313L;ENSP00000315914:P1313L;ENSP00000410427:P1316L	ENSP00000308597:P1313L	P	+	2	0	DLEC1	38133029	0.000000	0.05858	0.528000	0.27938	0.235000	0.25334	0.484000	0.22308	0.512000	0.28257	0.462000	0.41574	CCT	.		0.607	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
DMRTC2	63946	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	42353305	42353305	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:42353305delC	ENST00000269945.3	+	6	787	c.736delC	c.(736-738)cccfs	p.P247fs	DMRTC2_ENST00000596827.1_Frame_Shift_Del_p.P247fs	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	247	Pro-rich.				male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						GCCCCAAGGGCCCCCTAGCCA	0.607																																					p.P246fs		.											.	DMRTC2	90	0			c.736delC						.						82.0	94.0	90.0					19																	42353305		2203	4300	6503	SO:0001589	frameshift_variant	63946	exon6			CAAGGGCCCCCTA	AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.736delC	19.37:g.42353305delC	ENSP00000269945:p.Pro247fs	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	29.0	NM_001040283	Q8N6Q2|Q96M39|Q96SD4	Frame_Shift_Del	DEL	ENST00000269945.3	37	CCDS33034.1																																																																																			.		0.607	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463045.1	NM_001040283	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84832704	84832704	+	Silent	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:84832704A>T	ENST00000237449.6	+	19	3170	c.3162A>T	c.(3160-3162)acA>acT	p.T1054T	DNAH6_ENST00000389394.3_Silent_p.T1054T|DNAH6_ENST00000398278.2_Silent_p.T1054T			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1054	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TGGGCGGCACAGATGACATAC	0.418																																					p.T1054T		.											.	DNAH6	69	0			c.A3162T						.						157.0	132.0	140.0					2																	84832704		692	1591	2283	SO:0001819	synonymous_variant	1768	exon20			CGGCACAGATGAC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3162A>T	2.37:g.84832704A>T		Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	71.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.418	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DNAJC2	27000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102953436	102953436	+	Silent	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:102953436C>T	ENST00000379263.3	-	16	1999	c.1749G>A	c.(1747-1749)gcG>gcA	p.A583A	PMPCB_ENST00000249269.4_3'UTR|PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_Silent_p.A530A	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	583	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						TGCCAGGCACCGCTTCTGCTA	0.398																																					p.A583A		.											.	DNAJC2	158	0			c.G1749A						.						276.0	256.0	262.0					7																	102953436		1862	4094	5956	SO:0001819	synonymous_variant	27000	exon16			AGGCACCGCTTCT	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.1749G>A	7.37:g.102953436C>T		Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	57.0	NM_014377	A4VCI0|Q9BVX1	Silent	SNP	ENST00000379263.3	37	CCDS43628.1																																																																																			.		0.398	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
DOCK4	9732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	111575684	111575684	+	Splice_Site	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:111575684C>G	ENST00000437633.1	-	12	1234		c.e12-1		DOCK4_ENST00000428084.1_Splice_Site|DOCK4_ENST00000476846.1_Splice_Site	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TGTGTTACACCTATGAAAACA	0.393																																					.		.											.	DOCK4	26	0			c.978-1G>C						.						216.0	212.0	213.0					7																	111575684		2049	4205	6254	SO:0001630	splice_region_variant	9732	exon13			TTACACCTATGAA		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.978-1G>C	7.37:g.111575684C>G		Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	207.0	55.0	NM_014705	O14584|O94824|Q8NB45	Splice_Site	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.735794	0.89482	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000445943;ENST00000342288;ENST00000544250	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0137	0.97470	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK4	111362920	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	7.396000	0.79891	2.734000	0.93682	0.563000	0.77884	.	.		0.393	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	Intron
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	116525912	116525912	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:116525912T>A	ENST00000410059.1	+	13	1633	c.1153T>A	c.(1153-1155)Ttt>Att	p.F385I	DPP10_ENST00000310323.8_Missense_Mutation_p.F378I|DPP10_ENST00000409163.1_Missense_Mutation_p.F335I|DPP10_ENST00000393147.2_Missense_Mutation_p.F389I	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	385						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CAGCAAATTCTTTATGACAGT	0.443																																					p.F389I		.											.	DPP10	142	0			c.T1165A						.						143.0	137.0	139.0					2																	116525912		2203	4300	6503	SO:0001583	missense	57628	exon13			AAATTCTTTATGA	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1153T>A	2.37:g.116525912T>A	ENSP00000386565:p.Phe385Ile	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	48.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.943034	0.92526	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.25	5.25	0.73442	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43122	0.1233	L	0.31664	0.95	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.993;0.996;0.996;0.996	T	0.28776	-1.0033	10	0.45353	T	0.12	-15.5129	14.1307	0.65253	0.0:0.0:0.0:1.0	.	378;389;381;385	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	I	385;335;389;378;335	ENSP00000386565:F385I;ENSP00000387038:F335I;ENSP00000376855:F389I;ENSP00000309066:F378I	ENSP00000309066:F378I	F	+	1	0	DPP10	116242382	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.898000	0.75676	2.199000	0.70637	0.533000	0.62120	TTT	.		0.443	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
DUSP27	92235	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	167096126	167096126	+	Silent	SNP	G	G	C	rs144793075		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:167096126G>C	ENST00000361200.2	+	6	1924	c.1758G>C	c.(1756-1758)ctG>ctC	p.L586L	DUSP27_ENST00000443333.1_Silent_p.L586L|DUSP27_ENST00000271385.5_Silent_p.L586L|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	586					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACGTCAGCCTGACAGCCTACC	0.592																																					p.L586L		.											.	DUSP27	71	0			c.G1758C						.						45.0	45.0	45.0					1																	167096126		2203	4300	6503	SO:0001819	synonymous_variant	92235	exon5			CAGCCTGACAGCC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1758G>C	1.37:g.167096126G>C		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	38.0	NM_001080426	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	CCDS30932.1																																																																																			G|1.000;T|0.000		0.592	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
EAF1	85403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	15475936	15475936	+	Silent	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:15475936T>G	ENST00000396842.2	+	4	842	c.417T>G	c.(415-417)ccT>ccG	p.P139P	RNU6-1024P_ENST00000384199.1_RNA|EAF1-AS1_ENST00000597949.1_RNA|EAF1_ENST00000432764.2_Silent_p.P38P	NM_033083.6	NP_149074.3	Q96JC9	EAF1_HUMAN	ELL associated factor 1	139	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ELL-EAF complex (GO:0032783)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	7						CACCACCACCTCCACCACCTA	0.537																																					p.P139P		.											.	EAF1	90	0			c.T417G						.						276.0	253.0	260.0					3																	15475936		2203	4300	6503	SO:0001819	synonymous_variant	85403	exon4			ACCACCTCCACCA	AF272973	CCDS2626.1	3p25.1	2011-06-10			ENSG00000144597	ENSG00000144597			20907	protein-coding gene	gene with protein product		608315				11418481	Standard	NM_033083		Approved		uc003bzu.3	Q96JC9	OTTHUMG00000162544	ENST00000396842.2:c.417T>G	3.37:g.15475936T>G		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	29.0	NM_033083	B4E3F5|Q8IW10	Silent	SNP	ENST00000396842.2	37	CCDS2626.1																																																																																			.		0.537	EAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252100.4	NM_033083	
EFCAB2	84288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	245250660	245250660	+	Intron	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:245250660T>A	ENST00000366522.2	+	7	922				EFCAB2_ENST00000366523.1_Nonstop_Mutation_p.*163K|EFCAB2_ENST00000447569.2_Intron|EFCAB2_ENST00000487845.1_Intron			Q5VUJ9	EFCB2_HUMAN	EF-hand calcium binding domain 2								calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|stomach(2)	13	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)			AGATGAAAATTAAATGTTCTA	0.274																																					p.X163K		.											.	EFCAB2	90	0			c.T487A						.						43.0	45.0	44.0					1																	245250660		2202	4294	6496	SO:0001627	intron_variant	84288	exon8			GAAAATTAAATGT	AB209286	CCDS31082.1, CCDS44341.1	1q44	2014-07-18			ENSG00000203666	ENSG00000203666		"""EF-hand domain containing"""	28166	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 8"""					23427265	Standard	NM_032328		Approved	MGC12458, DRC8, CFAP200	uc001ibc.2	Q5VUJ9	OTTHUMG00000040474	ENST00000366522.2:c.781+3670T>A	1.37:g.245250660T>A		Somatic	221.0	0.0		WXS	Illumina HiSeq	Phase_I	339.0	79.0	NM_032328	B4DZE9|Q59G23|Q9BS36	Missense_Mutation	SNP	ENST00000366522.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.4|22.4	4.280193|4.280193	0.80692|0.80692	.|.	.|.	ENSG00000203666|ENSG00000203666	ENST00000366521|ENST00000366523	.|.	.|.	.|.	5.78|5.78	4.65|4.65	0.58169|0.58169	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	8.6474|8.6474	0.34013|0.34013	0.0:0.0861:0.0:0.9139|0.0:0.0861:0.0:0.9139	.|.	.|.	.|.	.|.	X|K	221|163	.|.	.|.	L|X	+|+	2|1	0|0	EFCAB2|EFCAB2	243317283|243317283	1.000000|1.000000	0.71417|0.71417	0.017000|0.017000	0.16124|0.16124	0.984000|0.984000	0.73092|0.73092	2.276000|2.276000	0.43408|0.43408	1.011000|1.011000	0.39340|0.39340	0.460000|0.460000	0.39030|0.39030	TTA|TAA	.		0.274	EFCAB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000097407.2		
EGF	1950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	110897334	110897334	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:110897334A>T	ENST00000265171.5	+	13	2441	c.1996A>T	c.(1996-1998)Att>Ttt	p.I666F	EGF_ENST00000503392.1_Missense_Mutation_p.I666F|EGF_ENST00000509793.1_Missense_Mutation_p.I624F	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	666					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	GCAGTCTGTGATTGAAATGGC	0.463																																					p.I666F		.											.	EGF	524	0			c.A1996T						.						130.0	110.0	117.0					4																	110897334		2203	4300	6503	SO:0001583	missense	1950	exon13			TCTGTGATTGAAA	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1996A>T	4.37:g.110897334A>T	ENSP00000265171:p.Ile666Phe	Somatic	203.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	108.0	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	37	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.086189	0.76642	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.94687	-3.49;-3.49;-3.49	5.77	4.6	0.57074	Six-bladed beta-propeller, TolB-like (1);	0.221347	0.47093	D	0.000244	D	0.98015	0.9346	H	0.98005	4.125	0.53688	D	0.99997	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.76575	0.988;0.984;0.988	D	0.98089	1.0408	10	0.87932	D	0	.	9.1427	0.36914	0.8654:0.0:0.1346:0.0	.	666;624;666	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	F	624;666;666	ENSP00000424316:I624F;ENSP00000265171:I666F;ENSP00000421384:I666F	ENSP00000265171:I666F	I	+	1	0	EGF	111116783	0.908000	0.30866	0.996000	0.52242	0.998000	0.95712	0.526000	0.22971	2.199000	0.70637	0.533000	0.62120	ATT	.		0.463	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
ELMSAN1	91748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74191982	74191982	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr14:74191982T>C	ENST00000286523.5	-	9	3349	c.2567A>G	c.(2566-2568)cAg>cGg	p.Q856R	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.Q856R	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	856	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										CACCAGCTTCTGCACCAGGAA	0.537																																					p.Q856R		.											.	.	.	0			c.A2567G						.						148.0	139.0	142.0					14																	74191982		2203	4300	6503	SO:0001583	missense	91748	exon9			AGCTTCTGCACCA	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.2567A>G	14.37:g.74191982T>C	ENSP00000286523:p.Gln856Arg	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	20.0	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	ENST00000286523.5	37	CCDS9819.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.041565	0.93685	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.94	5.94	0.96194	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.64402	D	0.000008	T	0.49236	0.1545	L	0.43923	1.385	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.99;0.994	T	0.47275	-0.9130	10	0.66056	D	0.02	-22.5884	16.3979	0.83621	0.0:0.0:0.0:1.0	.	856;856	A0PJD3;Q6PJG2	.;CN043_HUMAN	R	856	ENSP00000377634:Q856R;ENSP00000286523:Q856R;ENSP00000407767:Q856R;ENSP00000402380:Q856R	ENSP00000286523:Q856R	Q	-	2	0	C14orf43	73261735	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.548000	0.82154	2.279000	0.76181	0.459000	0.35465	CAG	.		0.537	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
ERC1	23085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1192437	1192437	+	Silent	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:1192437A>C	ENST00000397203.2	+	3	1183	c.777A>C	c.(775-777)gtA>gtC	p.V259V	ERC1_ENST00000360905.4_Silent_p.V259V|ERC1_ENST00000589028.1_Silent_p.V259V|ERC1_ENST00000546231.2_Silent_p.V259V|ERC1_ENST00000355446.5_Silent_p.V259V|ERC1_ENST00000543086.3_Silent_p.V259V			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	259					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			AACCTTGTGTAGCAGAGCTGA	0.512																																					p.V259V		.											.	ERC1	660	0			c.A777C						.						89.0	81.0	84.0					12																	1192437		2203	4300	6503	SO:0001819	synonymous_variant	23085	exon3			TTGTGTAGCAGAG	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.777A>C	12.37:g.1192437A>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	15.0	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Silent	SNP	ENST00000397203.2	37	CCDS8508.1																																																																																			.		0.512	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
EVC	2121	ucsc.edu;bcgsc.ca;mdanderson.org	37	4	5733299	5733299	+	Missense_Mutation	SNP	G	G	A	rs144897690	byFrequency	TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:5733299G>A	ENST00000264956.6	+	4	716	c.532G>A	c.(532-534)Gtc>Atc	p.V178I	EVC_ENST00000382674.2_Missense_Mutation_p.V178I|EVC_ENST00000509451.1_Missense_Mutation_p.V178I	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	178					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CTCATCCAGCGTCCACTCGGC	0.637													G|||	7	0.00139776	0.0045	0.0014	5008	,	,		17461	0.0		0.0	False		,,,				2504	0.0				p.V178I		.											.	EVC	92	0			c.G532A						.	G	ILE/VAL	32,4374	37.6+/-69.7	0,32,2171	78.0	71.0	73.0		532	-6.7	0.5	4	dbSNP_134	73	2,8598	2.2+/-6.3	0,2,4298	yes	missense	EVC	NM_153717.2	29	0,34,6469	AA,AG,GG		0.0233,0.7263,0.2614	benign	178/993	5733299	34,12972	2203	4300	6503	SO:0001583	missense	2121	exon4			TCCAGCGTCCACT	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.532G>A	4.37:g.5733299G>A	ENSP00000264956:p.Val178Ile	Somatic	229.0	1.0		WXS	Illumina HiSeq	.	243.0	90.0	NM_153717		Missense_Mutation	SNP	ENST00000264956.6	37	CCDS3383.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	0.754	-0.771826	0.02951	0.007263	2.33E-4	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.47528	0.84;0.84;0.95	4.06	-6.7	0.01766	.	0.817676	0.11249	N	0.583814	T	0.09686	0.0238	N	0.05124	-0.11	0.18873	N	0.999982	B	0.06786	0.001	B	0.04013	0.001	T	0.30001	-0.9993	10	0.02654	T	1	.	1.2604	0.02000	0.3589:0.2576:0.2578:0.1256	.	178	P57679	EVC_HUMAN	I	178	ENSP00000264956:V178I;ENSP00000372120:V178I;ENSP00000426774:V178I	ENSP00000264956:V178I	V	+	1	0	EVC	5784200	0.929000	0.31497	0.544000	0.28141	0.521000	0.34408	0.341000	0.19909	-1.386000	0.02098	-0.367000	0.07326	GTC	G|0.997;A|0.003		0.637	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
FAM71B	153745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	156590005	156590005	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:156590005A>T	ENST00000302938.4	-	2	1366	c.1271T>A	c.(1270-1272)gTc>gAc	p.V424D		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	424						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCATTCCAGACTTCAGCACT	0.512																																					p.V424D		.											.	FAM71B	96	0			c.T1271A						.						113.0	112.0	112.0					5																	156590005		2203	4300	6503	SO:0001583	missense	153745	exon2			TTCCAGACTTCAG		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1271T>A	5.37:g.156590005A>T	ENSP00000305596:p.Val424Asp	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	22.0	NM_130899	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	ENST00000302938.4	37	CCDS4335.1	.	.	.	.	.	.	.	.	.	.	G	10.51	1.370628	0.24771	.	.	ENSG00000170613	ENST00000302938	T	0.17691	2.26	4.4	1.2	0.21068	.	1.426320	0.04613	N	0.400568	T	0.12008	0.0292	N	0.22421	0.69	0.09310	N	1	B	0.17667	0.023	B	0.15052	0.012	T	0.33137	-0.9880	10	0.54805	T	0.06	-0.0421	3.5692	0.07910	0.3561:0.1924:0.4515:0.0	.	424	Q8TC56	FA71B_HUMAN	D	424	ENSP00000305596:V424D	ENSP00000305596:V424D	V	-	2	0	FAM71B	156522583	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.397000	0.07269	0.157000	0.19338	-0.215000	0.12644	GTC	.		0.512	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252570.2	NM_130899	
FANCE	2178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35428340	35428340	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:35428340A>G	ENST00000229769.2	+	8	1513	c.1328A>G	c.(1327-1329)gAg>gGg	p.E443G		NM_021922.2	NP_068741.1	Q9HB96	FANCE_HUMAN	Fanconi anemia, complementation group E	443					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)|skin(2)	13						CAGATCTTGGAGCTGCCCTGG	0.562			"""N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.E443G		.	yes	Rec		Fanconi anaemia E	6	6p21-p22	2178	"""Fanconi anemia, complementation group E"""		L	.	FANCE	661	0			c.A1328G						.						87.0	82.0	83.0					6																	35428340		2203	4300	6503	SO:0001583	missense	2178	exon8	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TCTTGGAGCTGCC	AF265210	CCDS4805.1	6p22-p21	2014-09-17			ENSG00000112039	ENSG00000112039		"""Fanconi anemia, complementation groups"""	3586	protein-coding gene	gene with protein product		613976		FACE		7662964, 11001585	Standard	XM_005248885		Approved	FAE	uc003oko.1	Q9HB96	OTTHUMG00000014565	ENST00000229769.2:c.1328A>G	6.37:g.35428340A>G	ENSP00000229769:p.Glu443Gly	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	32.0	NM_021922	A8K907|Q4ZGH2	Missense_Mutation	SNP	ENST00000229769.2	37	CCDS4805.1	.	.	.	.	.	.	.	.	.	.	A	14.89	2.670059	0.47677	.	.	ENSG00000112039	ENST00000229769	T	0.45276	0.9	4.97	4.97	0.65823	Fanconi Anaemia group E protein, C-terminal (1);	0.388525	0.29133	N	0.013059	T	0.32823	0.0842	L	0.55103	1.725	0.35519	D	0.801275	D	0.54601	0.967	P	0.49708	0.62	T	0.21314	-1.0249	10	0.37606	T	0.19	-8.5378	11.3467	0.49565	1.0:0.0:0.0:0.0	.	443	Q9HB96	FANCE_HUMAN	G	443	ENSP00000229769:E443G	ENSP00000229769:E443G	E	+	2	0	FANCE	35536318	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.236000	0.51336	1.988000	0.58038	0.533000	0.62120	GAG	.		0.562	FANCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040282.1		
FBN1	2200	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48760297	48760297	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:48760297T>A	ENST00000316623.5	-	38	5040	c.4585A>T	c.(4585-4587)Acc>Tcc	p.T1529S		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1529					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCAGAGCGGGTATCTATTTAC	0.408																																					p.T1529S		.											.	FBN1	92	0			c.A4585T						.						77.0	77.0	77.0					15																	48760297		2198	4296	6494	SO:0001583	missense	2200	exon38			AGCGGGTATCTAT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4585A>T	15.37:g.48760297T>A	ENSP00000325527:p.Thr1529Ser	Somatic	221.0	1.0		WXS	Illumina HiSeq	Phase_I	161.0	65.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126351	0.56721	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.94000	-3.33	5.14	5.14	0.70334	Matrix fibril-associated (2);	0.093698	0.64402	D	0.000001	D	0.84279	0.5437	N	0.05050	-0.12	0.80722	D	1	P	0.36048	0.534	B	0.35727	0.209	D	0.83699	0.0181	10	0.15952	T	0.53	.	14.7971	0.69886	0.0:0.0:0.0:1.0	.	1529	P35555	FBN1_HUMAN	S	1529;97;419	ENSP00000325527:T1529S	ENSP00000325527:T1529S	T	-	1	0	FBN1	46547589	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	5.977000	0.70492	2.169000	0.68431	0.528000	0.53228	ACC	.		0.408	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FBXL4	26235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	99374696	99374696	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:99374696C>A	ENST00000369244.2	-	4	597	c.169G>T	c.(169-171)Gaa>Taa	p.E57*	FBXL4_ENST00000229971.1_Nonsense_Mutation_p.E57*	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	57					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		TCCACTACTTCTTTGGCATAC	0.428																																					p.E57X		.											.	FBXL4	227	0			c.G169T						.						239.0	213.0	222.0					6																	99374696		2203	4300	6503	SO:0001587	stop_gained	26235	exon3			CTACTTCTTTGGC	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.169G>T	6.37:g.99374696C>A	ENSP00000358247:p.Glu57*	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	41.0	NM_012160	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Nonsense_Mutation	SNP	ENST00000369244.2	37	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	C	39	7.637370	0.98403	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	.	.	.	5.52	4.65	0.58169	.	0.044902	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	14.5366	0.67966	0.0:0.9294:0.0:0.0706	.	.	.	.	X	57	.	ENSP00000229971:E57X	E	-	1	0	FBXL4	99481417	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.587000	0.60991	1.466000	0.48025	0.650000	0.86243	GAA	.		0.428	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2		
FBXO40	51725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121341447	121341447	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:121341447C>G	ENST00000338040.4	+	3	1585	c.1171C>G	c.(1171-1173)Ccc>Gcc	p.P391A		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	391					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		GGAGGACCTGCCCAAATCAGA	0.483																																					p.P391A		.											.	FBXO40	273	0			c.C1171G						.						119.0	110.0	113.0					3																	121341447		2203	4300	6503	SO:0001583	missense	51725	exon3			GACCTGCCCAAAT	AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1171C>G	3.37:g.121341447C>G	ENSP00000337510:p.Pro391Ala	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	51.0	NM_016298	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564107	0.65651	.	.	ENSG00000163833	ENST00000338040	T	0.50277	0.75	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.67163	0.2864	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.62613	-0.6817	10	0.33141	T	0.24	-18.5238	17.4071	0.87476	0.0:1.0:0.0:0.0	.	391	Q9UH90	FBX40_HUMAN	A	391	ENSP00000337510:P391A	ENSP00000337510:P391A	P	+	1	0	FBXO40	122824137	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.487000	0.81328	2.721000	0.93114	0.655000	0.94253	CCC	.		0.483	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298	
FKBP4	2288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	2904411	2904411	+	Splice_Site	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:2904411G>A	ENST00000001008.4	+	1	292		c.e1+1		RP4-816N1.7_ENST00000547042.1_RNA|RP4-816N1.6_ENST00000547834.1_RNA|CBX3P4_ENST00000540428.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa						androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			CGTGCTGAAGGTGAGGGGCGG	0.771																																					.		.											.	FKBP4	226	0			c.105+1G>A						.						16.0	17.0	16.0					12																	2904411		2186	4288	6474	SO:0001630	splice_region_variant	2288	exon1			CTGAAGGTGAGGG	M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.105+1G>A	12.37:g.2904411G>A		Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	53.0	NM_002014	D3DUQ1|Q9UCP1|Q9UCV7	Splice_Site	SNP	ENST00000001008.4	37	CCDS8512.1	.	.	.	.	.	.	.	.	.	.	g	15.42	2.827631	0.50845	.	.	ENSG00000004478	ENST00000001008	.	.	.	4.28	3.35	0.38373	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8563	0.52439	0.0:0.0:0.8233:0.1766	.	.	.	.	.	-1	.	.	.	+	.	.	FKBP4	2774672	1.000000	0.71417	0.398000	0.26321	0.452000	0.32318	7.851000	0.86920	0.744000	0.32741	0.298000	0.19748	.	.		0.771	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206861.1		Intron
FLT1	2321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	29008090	29008090	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr13:29008090T>A	ENST00000282397.4	-	6	930	c.679A>T	c.(679-681)Aat>Tat	p.N227Y	FLT1_ENST00000541932.1_Missense_Mutation_p.N227Y|FLT1_ENST00000539099.1_Missense_Mutation_p.N227Y	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	227					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATGATTGTATTGGCTGCAAGC	0.383																																					p.N227Y		.											.	FLT1	1406	0			c.A679T						.						120.0	122.0	121.0					13																	29008090		2203	4300	6503	SO:0001583	missense	2321	exon6			TTGTATTGGCTGC	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.679A>T	13.37:g.29008090T>A	ENSP00000282397:p.Asn227Tyr	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	69.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.091112	0.76756	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000539099	T;T;T	0.75260	-0.92;-0.31;-0.26	5.78	5.78	0.91487	Tyrosine-protein kinase, vascular endothelial growth factor receptor 1 (VEGFR1), N-terminal (1);	0.224825	0.44097	D	0.000495	T	0.77928	0.4204	L	0.41492	1.28	0.54753	D	0.999986	D;D;D;D	0.76494	0.999;0.999;0.992;0.994	D;D;D;D	0.72338	0.977;0.977;0.967;0.963	T	0.72516	-0.4269	10	0.02654	T	1	.	16.1141	0.81289	0.0:0.0:0.0:1.0	.	227;227;227;227	P17948-4;P17948-3;P17948-2;P17948	.;.;.;VGFR1_HUMAN	Y	227	ENSP00000282397:N227Y;ENSP00000437631:N227Y;ENSP00000442630:N227Y	ENSP00000282397:N227Y	N	-	1	0	FLT1	27906090	1.000000	0.71417	0.986000	0.45419	0.860000	0.49131	5.475000	0.66787	2.214000	0.71695	0.528000	0.53228	AAT	.		0.383	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
FMN2	56776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	240286488	240286488	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:240286488T>C	ENST00000319653.9	+	2	1855	c.1625T>C	c.(1624-1626)cTg>cCg	p.L542P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	542					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGCGAACGCTGTTGGAGAAG	0.552																																					p.L542P		.											.	FMN2	145	0			c.T1625C						.						95.0	88.0	91.0					1																	240286488		2203	4300	6503	SO:0001583	missense	56776	exon2			GAACGCTGTTGGA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1625T>C	1.37:g.240286488T>C	ENSP00000318884:p.Leu542Pro	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	35.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	T	10.04	1.242496	0.22796	.	.	ENSG00000155816	ENST00000319653	T	0.80480	-1.38	5.57	5.57	0.84162	DEP domain (1);	0.000000	0.51477	D	0.000084	D	0.88676	0.6501	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89811	0.3982	10	0.87932	D	0	.	16.0108	0.80402	0.0:0.0:0.0:1.0	.	542	Q9NZ56	FMN2_HUMAN	P	542	ENSP00000318884:L542P	ENSP00000318884:L542P	L	+	2	0	FMN2	238353111	1.000000	0.71417	0.828000	0.32881	0.364000	0.29643	6.950000	0.75977	2.242000	0.73789	0.482000	0.46254	CTG	.		0.552	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
FREM2	341640	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	39262723	39262723	+	Silent	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr13:39262723A>C	ENST00000280481.7	+	1	1458	c.1242A>C	c.(1240-1242)gtA>gtC	p.V414V		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	414					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AATTGGAGGTAGTGGATCTAG	0.542																																					p.V414V		.											.	FREM2	100	0			c.A1242C						.						73.0	81.0	78.0					13																	39262723		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon1			GGAGGTAGTGGAT	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1242A>C	13.37:g.39262723A>C		Somatic	119.0	1.0		WXS	Illumina HiSeq	Phase_I	89.0	35.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FSD2	123722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83437679	83437679	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:83437679A>G	ENST00000334574.8	-	9	1687	c.1506T>C	c.(1504-1506)acT>acC	p.T502T	FSD2_ENST00000541889.1_Silent_p.T457T			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	502	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						TCAGCTCCACAGTGTACGAGT	0.527																																					p.T502T		.											.	FSD2	90	0			c.T1506C						.						50.0	54.0	52.0					15																	83437679		2011	4198	6209	SO:0001819	synonymous_variant	123722	exon9			CTCCACAGTGTAC	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.1506T>C	15.37:g.83437679A>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	34.0	NM_001007122	B3KVG1|B7ZM02	Silent	SNP	ENST00000334574.8	37	CCDS45332.1																																																																																			.		0.527	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	NM_001007122	
FZD9	8326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	72849306	72849306	+	Silent	SNP	C	C	T	rs144961735		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:72849306C>T	ENST00000344575.3	+	1	1198	c.969C>T	c.(967-969)ttC>ttT	p.F323F		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	323					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				TCTACTACTTCGGCATGGCCA	0.657																																					p.F323F	Pancreas(144;909 1878 36867 38226 39554)	.											.	FZD9	1082	0			c.C969T						.	C		2,4404	4.2+/-10.8	0,2,2201	94.0	84.0	87.0		969	3.3	1.0	7	dbSNP_134	87	0,8600		0,0,4300	no	coding-synonymous	FZD9	NM_003508.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		323/592	72849306	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8326	exon1			CTACTTCGGCATG	U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.969C>T	7.37:g.72849306C>T		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	18.0	NM_003508		Silent	SNP	ENST00000344575.3	37	CCDS5548.1																																																																																			C|1.000;T|0.000		0.657	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252120.1		
G2E3	55632	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	31084590	31084590	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr14:31084590A>G	ENST00000206595.6	+	14	1863	c.1709A>G	c.(1708-1710)gAg>gGg	p.E570G	G2E3_ENST00000553504.1_Missense_Mutation_p.E600G|G2E3_ENST00000438909.2_Missense_Mutation_p.E524G	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	570	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GGTGTTTTGGAGAAAATTCAG	0.358																																					p.E570G		.											.	G2E3	660	0			c.A1709G						.						86.0	86.0	86.0					14																	31084590		2203	4300	6503	SO:0001583	missense	55632	exon14			TTTTGGAGAAAAT	AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1709A>G	14.37:g.31084590A>G	ENSP00000206595:p.Glu570Gly	Somatic	218.0	1.0		WXS	Illumina HiSeq	Phase_I	157.0	62.0	NM_017769	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	ENST00000206595.6	37	CCDS9638.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.761106	0.89932	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504	T;T;T	0.59906	0.23;0.23;0.23	5.69	5.69	0.88448	HECT (3);	0.139609	0.64402	D	0.000006	T	0.74854	0.3771	M	0.72894	2.215	0.58432	D	0.999997	P;D	0.89917	0.775;1.0	B;D	0.91635	0.306;0.999	T	0.77935	-0.2401	10	0.87932	D	0	-12.5107	14.512	0.67794	1.0:0.0:0.0:0.0	.	82;570	Q49AD9;Q7L622	.;G2E3_HUMAN	G	570;524;600	ENSP00000206595:E570G;ENSP00000391068:E524G;ENSP00000451653:E600G	ENSP00000206595:E570G	E	+	2	0	G2E3	30154341	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.987000	0.76206	2.168000	0.68352	0.397000	0.26171	GAG	.		0.358	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	
GAK	2580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	887684	887684	+	Nonsense_Mutation	SNP	G	G	T	rs140104121	byFrequency	TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:887684G>T	ENST00000314167.4	-	8	965	c.855C>A	c.(853-855)taC>taA	p.Y285*	GAK_ENST00000511163.1_Nonsense_Mutation_p.Y206*	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	285	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		GGAAGACCGTGTACTGCGTGT	0.612																																					p.Y285X		.											.	GAK	568	0			c.C855A						.						113.0	80.0	91.0					4																	887684		2202	4300	6502	SO:0001587	stop_gained	2580	exon8			GACCGTGTACTGC	D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.855C>A	4.37:g.887684G>T	ENSP00000314499:p.Tyr285*	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	33.0	NM_005255	Q5U4P5|Q9BVY6	Nonsense_Mutation	SNP	ENST00000314167.4	37	CCDS3340.1	.	.	.	.	.	.	.	.	.	.	G	33	5.287891	0.95517	.	.	ENSG00000178950	ENST00000314167;ENST00000511163	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-34.2497	15.4704	0.75437	0.0:0.0:1.0:0.0	.	.	.	.	X	285;206	.	ENSP00000314499:Y285X	Y	-	3	2	GAK	877684	1.000000	0.71417	0.962000	0.40283	0.242000	0.25591	3.194000	0.51005	2.232000	0.73038	0.563000	0.77884	TAC	G|0.999;A|0.001		0.612	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239188.1	NM_005255	
GARNL3	84253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130106562	130106562	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr9:130106562A>G	ENST00000373387.4	+	15	1652	c.1300A>G	c.(1300-1302)Aag>Gag	p.K434E	GARNL3_ENST00000314904.5_Missense_Mutation_p.K434E|GARNL3_ENST00000435213.2_Missense_Mutation_p.K412E	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	434					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						AGAGTCACCCAAGTCAGCGCG	0.423																																					p.K434E		.											.	GARNL3	516	0			c.A1300G						.						136.0	152.0	147.0					9																	130106562		2203	4300	6503	SO:0001583	missense	84253	exon15			TCACCCAAGTCAG	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.1300A>G	9.37:g.130106562A>G	ENSP00000362485:p.Lys434Glu	Somatic	230.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	79.0	NM_032293	B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	ENST00000373387.4	37	CCDS6869.2	.	.	.	.	.	.	.	.	.	.	A	18.94	3.729582	0.69074	.	.	ENSG00000136895	ENST00000435213;ENST00000314904;ENST00000373387	D;D;D	0.87412	-2.24;-2.21;-2.25	5.58	5.58	0.84498	.	0.042704	0.85682	D	0.000000	T	0.81494	0.4834	L	0.44542	1.39	0.58432	D	0.99999	B;B;B	0.31769	0.339;0.224;0.013	B;B;B	0.24701	0.055;0.055;0.006	T	0.78863	-0.2036	9	.	.	.	.	14.5659	0.68176	1.0:0.0:0.0:0.0	.	434;412;375	Q5VVW2;B7Z3Q6;Q5VVW4	GARL3_HUMAN;.;.	E	412;434;434	ENSP00000396205:K412E;ENSP00000313970:K434E;ENSP00000362485:K434E	.	K	+	1	0	GARNL3	129146383	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.833000	0.92089	2.113000	0.64589	0.460000	0.39030	AAG	.		0.423	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054151.3	NM_032293	
GPR141	353345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	37780305	37780305	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:37780305C>G	ENST00000447769.1	+	4	599	c.310C>G	c.(310-312)Cta>Gta	p.L104V	GPR141_ENST00000461610.1_Intron|EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.L104V			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCTCACGTTCCTATTCTATGT	0.468																																					p.L104V		.											.	GPR141	93	0			c.C310G						.						119.0	104.0	109.0					7																	37780305		2203	4300	6503	SO:0001583	missense	353345	exon1			ACGTTCCTATTCT	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.310C>G	7.37:g.37780305C>G	ENSP00000390410:p.Leu104Val	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	36.0	NM_181791	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	ENST00000447769.1	37	CCDS5451.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.826144	0.32237	.	.	ENSG00000187037	ENST00000450180;ENST00000447769;ENST00000334425	T;T;T	0.40476	2.57;1.03;1.03	5.06	3.09	0.35607	GPCR, rhodopsin-like superfamily (1);	0.430924	0.23139	N	0.051490	T	0.36936	0.0985	L	0.48642	1.525	0.46981	D	0.999273	P	0.44776	0.843	P	0.44860	0.462	T	0.07290	-1.0780	10	0.23891	T	0.37	-11.164	9.6395	0.39831	0.1459:0.5702:0.2839:0.0	.	104	Q7Z602	GP141_HUMAN	V	104	ENSP00000396300:L104V;ENSP00000390410:L104V;ENSP00000334540:L104V	ENSP00000334540:L104V	L	+	1	2	GPR141	37746830	0.962000	0.33011	0.996000	0.52242	0.926000	0.56050	0.603000	0.24149	1.239000	0.43787	0.650000	0.86243	CTA	.		0.468	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791	
GPR156	165829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	119886209	119886209	+	Silent	SNP	G	G	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:119886209G>C	ENST00000464295.1	-	10	2560	c.2115C>G	c.(2113-2115)gcC>gcG	p.A705A	GPR156_ENST00000315843.3_Silent_p.A705A|GPR156_ENST00000461057.1_Silent_p.A701A			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	705						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		CAGGACTTGGGGCCCGGCCAG	0.632																																					p.A705A		.											.	GPR156	92	0			c.C2115G						.						43.0	46.0	45.0					3																	119886209		2203	4300	6503	SO:0001819	synonymous_variant	165829	exon9			ACTTGGGGCCCGG	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.2115C>G	3.37:g.119886209G>C		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	16.0	NM_153002	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Silent	SNP	ENST00000464295.1	37	CCDS2997.1																																																																																			.		0.632	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
GPR50	9248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	150349506	150349506	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chrX:150349506C>A	ENST00000218316.3	+	2	1520	c.1451C>A	c.(1450-1452)gCt>gAt	p.A484D	AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	484	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					CATGTCTCTGCTGGCAGCCAC	0.567																																					p.A484D		.											.	GPR50	176	0			c.C1451A						.						135.0	148.0	144.0					X																	150349506		2101	4205	6306	SO:0001583	missense	9248	exon2			TCTCTGCTGGCAG	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1451C>A	X.37:g.150349506C>A	ENSP00000218316:p.Ala484Asp	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	22.0	NM_004224	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	ENST00000218316.3	37	CCDS44012.1	.	.	.	.	.	.	.	.	.	.	C	5.341	0.248297	0.10130	.	.	ENSG00000102195	ENST00000218316	T	0.75260	-0.92	3.32	0.578	0.17391	.	0.951679	0.08587	N	0.923590	T	0.53594	0.1806	N	0.19112	0.55	0.09310	N	1	P	0.44877	0.845	B	0.33750	0.169	T	0.45571	-0.9252	10	0.87932	D	0	-0.8327	6.7161	0.23304	0.0:0.6358:0.0:0.3642	.	484	Q13585	MTR1L_HUMAN	D	484	ENSP00000218316:A484D	ENSP00000218316:A484D	A	+	2	0	GPR50	150100164	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	0.417000	0.21214	0.000000	0.14550	0.529000	0.55759	GCT	.		0.567	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060874.1	NM_004224	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89925133	89925133	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:89925133T>C	ENST00000405460.2	+	9	1712	c.1616T>C	c.(1615-1617)tTg>tCg	p.L539S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	539					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TACTTATCCTTGAGTTTTACA	0.408																																					p.L539S		.											.	GPR98	103	0			c.T1616C						.						96.0	90.0	92.0					5																	89925133		1881	4113	5994	SO:0001583	missense	84059	exon9			TATCCTTGAGTTT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.1616T>C	5.37:g.89925133T>C	ENSP00000384582:p.Leu539Ser	Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	304.0	141.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.464819	0.84425	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.40476	1.03	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.65678	0.2714	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69793	-0.5049	10	0.87932	D	0	.	15.9247	0.79606	0.0:0.0:0.0:1.0	.	539	Q8WXG9	GPR98_HUMAN	S	539	ENSP00000384582:L539S	ENSP00000296619:L539S	L	+	2	0	GPR98	89960889	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.463000	0.80869	2.165000	0.68154	0.533000	0.62120	TTG	.		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
HAS2	3037	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	122626466	122626466	+	Silent	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:122626466A>T	ENST00000303924.4	-	4	2079	c.1542T>A	c.(1540-1542)gtT>gtA	p.V514V		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	514					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			GCAACGTTCCAACAATTAGAA	0.408																																					p.V514V		.											.	HAS2	236	0			c.T1542A						.						175.0	154.0	161.0					8																	122626466		2203	4300	6503	SO:0001819	synonymous_variant	3037	exon4			CGTTCCAACAATT	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1542T>A	8.37:g.122626466A>T		Somatic	164.0	2.0		WXS	Illumina HiSeq	Phase_I	115.0	47.0	NM_005328	Q32MM3	Silent	SNP	ENST00000303924.4	37	CCDS6335.1																																																																																			.		0.408	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
HAVCR2	84868	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	156522415	156522415	+	Missense_Mutation	SNP	C	C	A	rs374018243		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:156522415C>A	ENST00000307851.4	-	5	1308	c.578G>T	c.(577-579)cGg>cTg	p.R193L	HAVCR2_ENST00000522593.1_Missense_Mutation_p.R165L	NM_032782.4	NP_116171.3	Q8TDQ0	HAVR2_HUMAN	hepatitis A virus cellular receptor 2	193						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				cervix(1)|large_intestine(4)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCAGAGTCCCGTAAGTCATT	0.453																																					p.R193L		.											.	HAVCR2	90	0			c.G578T						.						98.0	97.0	97.0					5																	156522415		2203	4300	6503	SO:0001583	missense	84868	exon5			GAGTCCCGTAAGT	AK027334	CCDS4333.1	5q34	2014-01-14			ENSG00000135077	ENSG00000135077		"""Immunoglobulin superfamily / V-set domain containing"""	18437	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 3"""	606652				11823861	Standard	NM_032782		Approved	Tim-3, TIM3, FLJ14428, TIMD3	uc003lwk.2	Q8TDQ0	OTTHUMG00000130249	ENST00000307851.4:c.578G>T	5.37:g.156522415C>A	ENSP00000312002:p.Arg193Leu	Somatic	119.0	1.0		WXS	Illumina HiSeq	Phase_I	169.0	80.0	NM_032782	B2RAY2|Q8WW60|Q96K94	Missense_Mutation	SNP	ENST00000307851.4	37	CCDS4333.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.490197	0.01018	.	.	ENSG00000135077	ENST00000307851;ENST00000522593	T;T	0.19532	2.14;2.48	0.0465	0.0465	0.14256	.	1.279500	0.05478	N	0.554349	T	0.10294	0.0252	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.32798	-0.9893	9	0.27082	T	0.32	-0.4987	.	.	.	.	193	Q8TDQ0	HAVR2_HUMAN	L	193;165	ENSP00000312002:R193L;ENSP00000430873:R165L	ENSP00000312002:R193L	R	-	2	0	HAVCR2	156454993	0.003000	0.15002	0.017000	0.16124	0.013000	0.08279	0.145000	0.16157	0.132000	0.18615	0.134000	0.15878	CGG	.		0.453	HAVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252574.2		
HEATR4	399671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	73989702	73989702	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr14:73989702C>A	ENST00000553558.1	-	3	476	c.155G>T	c.(154-156)aGc>aTc	p.S52I	RP3-414A15.11_ENST00000553394.1_RNA|HEATR4_ENST00000560393.1_Missense_Mutation_p.S5I|RP3-414A15.2_ENST00000555972.2_RNA|HEATR4_ENST00000334988.2_Missense_Mutation_p.S52I	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	52										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		GTACTGTGAGCTGAAGAAGAC	0.527																																					p.S52I		.											.	HEATR4	91	0			c.G155T						.						87.0	91.0	89.0					14																	73989702		2203	4300	6503	SO:0001583	missense	399671	exon2			TGTGAGCTGAAGA	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.155G>T	14.37:g.73989702C>A	ENSP00000450444:p.Ser52Ile	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	36.0	NM_203309	B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	CCDS9815.2	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985548	0.53934	.	.	ENSG00000187105	ENST00000553558;ENST00000334988;ENST00000556455	T;T	0.14766	2.48;2.48	5.6	2.76	0.32466	.	0.446203	0.21515	N	0.073318	T	0.14570	0.0352	L	0.34521	1.04	0.09310	N	1	D	0.55385	0.971	P	0.50440	0.641	T	0.05886	-1.0858	10	0.87932	D	0	-0.3005	7.4349	0.27150	0.0:0.7334:0.0:0.2666	.	52	Q86WZ0	HEAT4_HUMAN	I	52;5;52	ENSP00000450444:S52I;ENSP00000452407:S52I	ENSP00000335447:S5I	S	-	2	0	HEATR4	73059455	0.001000	0.12720	0.017000	0.16124	0.019000	0.09904	0.689000	0.25437	0.706000	0.31912	0.563000	0.77884	AGC	.		0.527	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309	
HERC2P3	283755	ucsc.edu;bcgsc.ca	37	15	20645799	20645799	+	RNA	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:20645799C>T	ENST00000428453.1	-	0	2966							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						TGATCCACTGCAGGGAGCTGA	0.617																																					.		.											.	HERC2P3	92	0			.						.						65.0	42.0	50.0					15																	20645799		2198	4273	6471			283755	.			CCACTGCAGGGAG	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20645799C>T		Somatic	65.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	.		RNA	SNP	ENST00000428453.1	37																																																																																				.		0.617	HERC2P3-014	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347772.2	NG_008269	
HERC6	55008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	89329771	89329771	+	Splice_Site	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:89329771T>C	ENST00000264346.7	+	11	1427		c.e11+2		HERC6_ENST00000380265.5_Splice_Site	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6						hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		TCTTCCATGGTAATAGCCAAT	0.368																																					.		.											.	HERC6	658	0			c.1368+2T>C						.						68.0	60.0	62.0					4																	89329771		1839	4086	5925	SO:0001630	splice_region_variant	55008	exon11			CCATGGTAATAGC	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1368+2T>C	4.37:g.89329771T>C		Somatic	402.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	107.0	NM_017912	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Splice_Site	SNP	ENST00000264346.7	37	CCDS47098.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894310	0.72639	.	.	ENSG00000138642	ENST00000380265;ENST00000264346	.	.	.	4.19	3.0	0.34707	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4534	0.21916	0.0:0.1123:0.0:0.8877	.	.	.	.	.	-1	.	.	.	+	.	.	HERC6	89548794	1.000000	0.71417	0.937000	0.37676	0.846000	0.48090	3.706000	0.54830	0.772000	0.33382	0.397000	0.26171	.	.		0.368	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363259.2		Intron
HHAT	55733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	210591627	210591627	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:210591627A>T	ENST00000367010.1	+	7	1041	c.814A>T	c.(814-816)Agc>Tgc	p.S272C	HHAT_ENST00000545154.1_Missense_Mutation_p.S273C|HHAT_ENST00000308852.6_Missense_Mutation_p.S227C|HHAT_ENST00000413764.2_Missense_Mutation_p.S272C|HHAT_ENST00000541565.1_Missense_Mutation_p.S135C|HHAT_ENST00000391905.3_Missense_Mutation_p.S272C|HHAT_ENST00000537898.1_Missense_Mutation_p.S207C|HHAT_ENST00000545781.1_Missense_Mutation_p.S209C|HHAT_ENST00000261458.3_Missense_Mutation_p.S272C	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	272					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)			breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TGCCATCTACAGCAGCATCCC	0.572																																					p.S273C		.											.	HHAT	92	0			c.A817T						.						117.0	105.0	109.0					1																	210591627		2203	4300	6503	SO:0001583	missense	55733	exon6			ATCTACAGCAGCA	AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.814A>T	1.37:g.210591627A>T	ENSP00000355977:p.Ser272Cys	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	47.0	NM_001170587	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	ENST00000367010.1	37	CCDS1495.1	.	.	.	.	.	.	.	.	.	.	A	12.78	2.041830	0.35989	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000426968	T;T;T;T;T;T;T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87;-0.87	5.1	-1.53	0.08611	.	0.313354	0.39475	N	0.001360	T	0.80618	0.4657	M	0.72118	2.19	0.38827	D	0.955751	D;D;D;D;D	0.76494	0.996;0.999;0.999;0.998;0.996	D;P;D;P;D	0.66979	0.948;0.894;0.947;0.907;0.94	T	0.79351	-0.1839	10	0.56958	D	0.05	-5.1928	10.1145	0.42583	0.6314:0.0:0.3686:0.0	.	227;273;135;207;272	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	C	272;135;273;207;272;209;272;227;272;144	ENSP00000416845:S272C;ENSP00000444995:S135C;ENSP00000438468:S273C;ENSP00000442625:S207C;ENSP00000375773:S272C;ENSP00000439229:S209C;ENSP00000261458:S272C;ENSP00000308628:S227C;ENSP00000355977:S272C;ENSP00000413399:S144C	ENSP00000261458:S272C	S	+	1	0	HHAT	208658250	0.996000	0.38824	0.991000	0.47740	0.095000	0.18619	0.583000	0.23849	-0.258000	0.09446	-0.475000	0.04921	AGC	.		0.572	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1	NM_018194	
HIP1	3092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	75176292	75176292	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:75176292T>A	ENST00000336926.6	-	25	2530	c.2504A>T	c.(2503-2505)cAg>cTg	p.Q835L	HIP1_ENST00000434438.2_Intron	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	835	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GATGAGCACCTGAATAGCTTG	0.547			T	PDGFRB	CMML																																p.Q835L		.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1	1085	0			c.A2504T						.						80.0	60.0	67.0					7																	75176292		2202	4298	6500	SO:0001583	missense	3092	exon25			AGCACCTGAATAG	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2504A>T	7.37:g.75176292T>A	ENSP00000336747:p.Gln835Leu	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	20.0	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	t	15.46	2.841478	0.51057	.	.	ENSG00000127946	ENST00000336926	T	0.28255	1.62	5.01	3.87	0.44632	I/LWEQ (4);	0.214476	0.49305	D	0.000143	T	0.25382	0.0617	L	0.42245	1.32	0.80722	D	1	B	0.13594	0.008	B	0.23275	0.045	T	0.04268	-1.0964	10	0.33141	T	0.24	-5.1368	9.2135	0.37333	0.0:0.0869:0.0:0.9131	.	835	O00291	HIP1_HUMAN	L	835	ENSP00000336747:Q835L	ENSP00000336747:Q835L	Q	-	2	0	HIP1	75014228	0.963000	0.33076	0.972000	0.41901	0.773000	0.43773	1.584000	0.36589	0.777000	0.33496	0.460000	0.39030	CAG	.		0.547	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
HIST1H2BE	8344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26184113	26184113	+	Silent	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:26184113C>G	ENST00000356530.3	+	1	156	c.90C>G	c.(88-90)cgC>cgG	p.R30R		NM_003523.2	NP_003514.2	P62807	H2B1C_HUMAN	histone cluster 1, H2be	30					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(1)	4						GCAAGAAGCGCAAGCGCAGCC	0.587																																					p.R30R		.											.	HIST1H2BE	90	0			c.C90G						.						148.0	135.0	140.0					6																	26184113		2203	4300	6503	SO:0001819	synonymous_variant	8344	exon1			GAAGCGCAAGCGC	Z80780	CCDS4588.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197697	ENSG00000274290		"""Histones / Replication-dependent"""	4753	protein-coding gene	gene with protein product		602805	"""H2B histone family, member H"", ""histone 1, H2be"""	H2BFH		9119399, 12408966	Standard	NM_003523		Approved	H2B/h, H2B.h	uc003ngt.3	P62807	OTTHUMG00000014427	ENST00000356530.3:c.90C>G	6.37:g.26184113C>G		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	42.0	NM_003523	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000356530.3	37	CCDS4588.1																																																																																			.		0.587	HIST1H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040090.1	NM_003523	
HMGB2	3148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	174253236	174253236	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:174253236C>T	ENST00000296503.5	-	5	1498	c.625G>A	c.(625-627)Gaa>Aaa	p.E209K	HMGB2_ENST00000438704.2_Missense_Mutation_p.E209K|RP11-798M19.3_ENST00000507803.1_RNA|HMGB2_ENST00000446922.2_Missense_Mutation_p.E209K			P26583	HMGB2_HUMAN	high mobility group box 2	209	Asp/Glu-rich (acidic).				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		GCCATTTAttcttcatcttca	0.433																																					p.E209K		.											.	HMGB2	650	0			c.G625A						.						429.0	360.0	383.0					4																	174253236		2203	4300	6503	SO:0001583	missense	3148	exon4			TTTATTCTTCATC		CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.625G>A	4.37:g.174253236C>T	ENSP00000296503:p.Glu209Lys	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	28.0	NM_001130689	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	ENST00000296503.5	37	CCDS3816.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761225	0.31137	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704	D;D;D	0.95103	-3.61;-3.61;-3.61	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000013	D	0.94000	0.8078	N	0.08118	0	0.49483	D	0.999791	D	0.63880	0.993	D	0.68192	0.956	D	0.95381	0.8473	10	0.87932	D	0	.	20.2037	0.98272	0.0:1.0:0.0:0.0	.	209	P26583	HMGB2_HUMAN	K	209	ENSP00000296503:E209K;ENSP00000393448:E209K;ENSP00000404912:E209K	ENSP00000296503:E209K	E	-	1	0	HMGB2	174489811	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	5.111000	0.64628	2.866000	0.98385	0.650000	0.86243	GAA	.		0.433	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362362.1	NM_001130688	
HPSE2	60495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	100992230	100992230	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr10:100992230A>T	ENST00000370552.3	-	2	382	c.323T>A	c.(322-324)cTt>cAt	p.L108H	HPSE2_ENST00000404542.1_Missense_Mutation_p.L108H|HPSE2_ENST00000370549.1_Missense_Mutation_p.L108H|HPSE2_ENST00000370546.1_Missense_Mutation_p.L108H	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	108					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GGCGGGCGAAAGTCCCCGGGC	0.642																																					p.L108H		.											.	HPSE2	91	0			c.T323A						.						9.0	10.0	10.0					10																	100992230		2153	4206	6359	SO:0001583	missense	60495	exon2			GGCGAAAGTCCCC	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.323T>A	10.37:g.100992230A>T	ENSP00000359583:p.Leu108His	Somatic	308.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	195.0	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	37	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.806984	0.50421	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546;ENST00000404542	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.27	4.11	0.48088	Glycoside hydrolase, superfamily (1);	0.000000	0.64402	D	0.000006	T	0.63212	0.2492	M	0.77486	2.375	0.29154	N	0.878202	B;D;D;D	0.89917	0.033;0.995;1.0;0.986	B;P;D;P	0.83275	0.04;0.847;0.996;0.62	T	0.62666	-0.6806	10	0.87932	D	0	-3.5153	11.1563	0.48489	0.8617:0.0:0.0:0.1383	.	108;108;108;108	Q8WWQ2-4;Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;.;HPSE2_HUMAN	H	108	ENSP00000359583:L108H;ENSP00000359580:L108H;ENSP00000359577:L108H;ENSP00000384384:L108H	ENSP00000359577:L108H	L	-	2	0	HPSE2	100982220	1.000000	0.71417	0.998000	0.56505	0.769000	0.43574	8.111000	0.89564	0.827000	0.34685	-0.333000	0.08304	CTT	.		0.642	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
IL10RA	3587	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117860245	117860245	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:117860245A>T	ENST00000227752.3	+	3	397	c.277A>T	c.(277-279)Agc>Tgc	p.S93C	IL10RA_ENST00000545409.1_Intron|IL10RA_ENST00000541785.1_Missense_Mutation_p.S73C|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	93					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		CCTGTACCACAGCAATGGCTA	0.572																																					p.S93C		.											.	IL10RA	91	0			c.A277T						.						122.0	100.0	107.0					11																	117860245		2200	4296	6496	SO:0001583	missense	3587	exon3			TACCACAGCAATG	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.277A>T	11.37:g.117860245A>T	ENSP00000227752:p.Ser93Cys	Somatic	98.0	1.0		WXS	Illumina HiSeq	Phase_I	130.0	39.0	NM_001558	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.062509	0.36373	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000536858	T;T	0.74315	-0.83;-0.83	4.95	-2.39	0.06602	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.627220	0.02715	N	0.113342	T	0.63307	0.2500	L	0.46157	1.445	0.09310	N	1	B;B	0.28713	0.184;0.22	B;B	0.26202	0.04;0.067	T	0.48127	-0.9062	10	0.56958	D	0.05	-0.1895	1.0936	0.01668	0.3039:0.1774:0.346:0.1727	.	73;93	F5GYV8;Q13651	.;I10R1_HUMAN	C	93;73;73	ENSP00000227752:S93C;ENSP00000441397:S73C	ENSP00000227752:S93C	S	+	1	0	IL10RA	117365455	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.198000	0.17217	-0.250000	0.09555	0.460000	0.39030	AGC	.		0.572	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
IWS1	55677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	128249666	128249666	+	Splice_Site	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:128249666T>A	ENST00000295321.4	-	10	2189		c.e10-2		AC010976.2_ENST00000596439.1_RNA|AC010976.2_ENST00000599001.1_RNA|AC010976.2_ENST00000598065.1_RNA|AC010976.2_ENST00000595561.1_RNA|AC010976.2_ENST00000454503.2_RNA|IWS1_ENST00000455721.2_Splice_Site	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)						mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		ACTAGGCAGCTGGGGAACATA	0.458																																					.		.											.	IWS1	91	0			c.1930-2A>T						.						73.0	64.0	67.0					2																	128249666		2203	4300	6503	SO:0001630	splice_region_variant	55677	exon11			GGCAGCTGGGGAA	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1930-2A>T	2.37:g.128249666T>A		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	38.0	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Splice_Site	SNP	ENST00000295321.4	37	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.743126	0.89663	.	.	ENSG00000163166	ENST00000295321;ENST00000433551	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1355	0.72562	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	IWS1	127966136	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.789000	0.85783	1.969000	0.57287	0.456000	0.33151	.	.		0.458	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	Intron
PLA2G4B	100137049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42139617	42139617	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:42139617A>G	ENST00000452633.1	+	20	2382	c.2030A>G	c.(2029-2031)cAg>cGg	p.Q677R	PLA2G4B_ENST00000542534.2_Missense_Mutation_p.Q908R|JMJD7-PLA2G4B_ENST00000342159.4_Intron|PLA2G4B_ENST00000458483.1_Missense_Mutation_p.Q677R|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.Q908R			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	677	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		GAGCAGCTCCAGCCTCGGGAG	0.682																																					p.Q908R		.											.	JMJD7-PLA2G4B	135	0			c.A2723G						.						83.0	88.0	86.0					15																	42139617		2203	4300	6503	SO:0001583	missense	8681	exon24			AGCTCCAGCCTCG	AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.2030A>G	15.37:g.42139617A>G	ENSP00000396045:p.Gln677Arg	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	16.0	NM_005090	B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	ENST00000452633.1	37	CCDS45241.1	.	.	.	.	.	.	.	.	.	.	.	7.871	0.728059	0.15507	.	.	ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000458483;ENST00000452633	T;T;T	0.14516	2.5;2.5;2.5	5.09	1.41	0.22369	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.365883	0.25961	N	0.027181	T	0.08044	0.0201	.	.	.	0.24823	N	0.992572	B;B	0.11235	0.004;0.0	B;B	0.16722	0.016;0.001	T	0.24119	-1.0169	9	0.34782	T	0.22	-18.566	5.2293	0.15412	0.7037:0.0:0.1607:0.1356	.	677;908	P0C869;P0C869-6	PA24B_HUMAN;.	R	908;677;677	ENSP00000371886:Q908R;ENSP00000416610:Q677R;ENSP00000396045:Q677R	ENSP00000371886:Q908R	Q	+	2	0	JMJD7-PLA2G4B;PLA2G4B	39926909	0.357000	0.24938	0.757000	0.31301	0.027000	0.11550	0.383000	0.20651	0.896000	0.36366	-0.411000	0.06167	CAG	.		0.682	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345969.1	NM_001114633	
KAT2B	8850	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	20156482	20156482	+	Splice_Site	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:20156482T>G	ENST00000263754.4	+	7	1605		c.e7+2			NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B						cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						TCCAAACAGGTAAGTTTCCTT	0.433																																					.		.											.	KAT2B	228	0			c.1150+2T>G						.						61.0	62.0	62.0					3																	20156482		2203	4300	6503	SO:0001630	splice_region_variant	8850	exon7			AACAGGTAAGTTT	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1150+2T>G	3.37:g.20156482T>G		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	30.0	NM_003884	Q6NSK1	Splice_Site	SNP	ENST00000263754.4	37	CCDS2634.1	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665213	0.67700	.	.	ENSG00000114166	ENST00000263754	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1431	0.72626	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KAT2B	20131486	1.000000	0.71417	0.979000	0.43373	0.728000	0.41692	7.747000	0.85070	2.037000	0.60232	0.368000	0.22195	.	.		0.433	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884	Intron
KCNK3	3777	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	26915803	26915803	+	Silent	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:26915803G>T	ENST00000302909.3	+	1	185	c.60G>T	c.(58-60)ctG>ctT	p.L20L		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	20					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	CCTACCTGCTGGTGGGCGCCG	0.751																																					p.L20L	GBM(80;1457 1631 27100 45946)	.											.	KCNK3	91	0			c.G60T						.						6.0	7.0	7.0					2																	26915803		2130	4141	6271	SO:0001819	synonymous_variant	3777	exon1			CCTGCTGGTGGGC	AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.60G>T	2.37:g.26915803G>T		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	20.0	NM_002246	Q53SU2	Silent	SNP	ENST00000302909.3	37	CCDS1727.1																																																																																			.		0.751	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246	
KIAA0226L	80183	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	46946076	46946076	+	Splice_Site	SNP	C	C	T	rs140036142	byFrequency	TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr13:46946076C>T	ENST00000429979.1	-	3	1139	c.535G>A	c.(535-537)Ggt>Agt	p.G179S	KIAA0226L_ENST00000378797.2_Splice_Site_p.G179S|KIAA0226L_ENST00000378784.4_Splice_Site_p.G112S|RNU2-6P_ENST00000411404.1_RNA|KIAA0226L_ENST00000322896.6_Intron|KIAA0226L_ENST00000378787.3_Splice_Site_p.G179S|KIAA0226L_ENST00000480935.1_5'Flank|KIAA0226L_ENST00000378781.3_Splice_Site_p.G179S|KIAA0226L_ENST00000534925.1_Splice_Site_p.G44S|KIAA0226L_ENST00000389908.3_Splice_Site_p.G179S|KIAA0226L_ENST00000409879.2_Intron	NM_025113.2	NP_079389.2	Q9H714	K226L_HUMAN	KIAA0226-like	179										NS(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|pancreas(1)	26						CTAAAATTACCTTCATCAGCA	0.507																																					p.G179S		.											.	.	.	0			c.G535A						.						64.0	59.0	61.0					13																	46946076		2203	4300	6503	SO:0001630	splice_region_variant	80183	exon3			AATTACCTTCATC	AK025215	CCDS31970.2, CCDS66543.1, CCDS66544.1, CCDS66545.1, CCDS73569.1	13q14.11	2011-08-09	2011-08-09	2011-08-09	ENSG00000102445	ENSG00000102445			20420	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 18"""	C13orf18			Standard	NM_001286766		Approved	FLJ21562	uc010acl.3	Q9H714	OTTHUMG00000016868	ENST00000429979.1:c.535+1G>A	13.37:g.46946076C>T		Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	55.0	22.0	NM_025113	A8KAG9|A8XR19|B3KS87|Q5W051|Q5W053|Q6PJ74|Q6PK94|Q86XH7|Q8N5J6	Missense_Mutation	SNP	ENST00000429979.1	37	CCDS31970.2	.	.	.	.	.	.	.	.	.	.	C	14.09	2.433098	0.43224	.	.	ENSG00000102445	ENST00000378781;ENST00000429979;ENST00000378797;ENST00000378784;ENST00000389908;ENST00000378787;ENST00000534925;ENST00000417405	T;T;T;T;T;T;T;T	0.59083	0.29;0.82;0.77;0.83;0.82;0.77;0.88;0.36	5.7	4.85	0.62838	.	0.532312	0.18550	N	0.137931	T	0.63402	0.2508	L	0.42245	1.32	0.32431	N	0.547993	D;P;P;P;P	0.55605	0.972;0.876;0.804;0.876;0.876	P;P;B;P;P	0.57283	0.817;0.748;0.311;0.508;0.634	T	0.69221	-0.5202	9	.	.	.	-2.1536	12.8953	0.58095	0.0:0.8375:0.1625:0.0	.	179;179;179;112;179	E7EMA2;Q9H714-1;Q9H714;Q9H714-3;Q9H714-4	.;.;K226L_HUMAN;.;.	S	179;179;179;112;179;179;44;44	ENSP00000368057:G179S;ENSP00000396935:G179S;ENSP00000368074:G179S;ENSP00000368061:G112S;ENSP00000374558:G179S;ENSP00000368064:G179S;ENSP00000437501:G44S;ENSP00000402357:G44S	.	G	-	1	0	KIAA0226L	45844077	0.989000	0.36119	0.984000	0.44739	0.075000	0.17131	2.031000	0.41117	1.404000	0.46819	0.561000	0.74099	GGT	C|0.995;G|0.005		0.507	KIAA0226L-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044809.2	NM_025113	Missense_Mutation
KIAA1191	57179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	175774922	175774922	+	Splice_Site	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:175774922A>C	ENST00000298569.4	-	8	1243		c.e8+1		KIAA1191_ENST00000510164.1_Splice_Site|RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393725.2_Splice_Site|KIAA1191_ENST00000393728.2_Splice_Site	NM_020444.3	NP_065177.2	Q96A73	P33MX_HUMAN	KIAA1191							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GTGCTGCCTTACCAGAATCGT	0.458																																					.		.											.	KIAA1191	91	0			c.709+2T>G						.						118.0	118.0	118.0					5																	175774922		2203	4300	6503	SO:0001630	splice_region_variant	57179	exon8			TGCCTTACCAGAA	BC010448	CCDS4399.1, CCDS43402.1, CCDS75373.1	5q35.2	2008-02-05			ENSG00000122203	ENSG00000122203			29209	protein-coding gene	gene with protein product						10574461, 10565538	Standard	XM_005265941		Approved	FLJ21022	uc003mdy.3	Q96A73	OTTHUMG00000130656	ENST00000298569.4:c.709+1T>G	5.37:g.175774922A>C		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	44.0	NM_001079685	B2RD69|B8K1S6|Q6IA24|Q8NDU3|Q9BRE5|Q9H7D5|Q9ULM9	Splice_Site	SNP	ENST00000298569.4	37	CCDS4399.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.327886	0.24080	.	.	ENSG00000122203	ENST00000298569;ENST00000393725;ENST00000510164	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7317	0.46100	0.9255:0.0:0.0745:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA1191	175707528	1.000000	0.71417	0.992000	0.48379	0.285000	0.27093	5.053000	0.64269	2.123000	0.65237	0.533000	0.62120	.	.		0.458	KIAA1191-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253146.2	NM_020444	Intron
KIF5A	3798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57963063	57963063	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:57963063A>T	ENST00000455537.2	+	10	1118	c.844A>T	c.(844-846)Agc>Tgc	p.S282C	KIF5A_ENST00000286452.5_Missense_Mutation_p.S193C	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	282	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						ATATCGTGACAGCAAAATGAC	0.448																																					p.S282C		.											.	KIF5A	517	0			c.A844T						.						66.0	65.0	65.0					12																	57963063		2203	4300	6503	SO:0001583	missense	3798	exon10			CGTGACAGCAAAA	U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.844A>T	12.37:g.57963063A>T	ENSP00000408979:p.Ser282Cys	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	35.0	NM_004984	A6H8M5|Q4LE26	Missense_Mutation	SNP	ENST00000455537.2	37	CCDS8945.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.412656	0.83340	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	D;D	0.86230	-2.09;-2.09	4.23	4.23	0.50019	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.95379	0.8500	H	0.96805	3.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96440	0.9326	10	0.87932	D	0	.	12.76	0.57359	1.0:0.0:0.0:0.0	.	193;282	B7Z2M7;Q12840	.;KIF5A_HUMAN	C	282;193	ENSP00000408979:S282C;ENSP00000286452:S193C	ENSP00000286452:S193C	S	+	1	0	KIF5A	56249330	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.799000	0.91895	1.915000	0.55452	0.454000	0.30748	AGC	.		0.448	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407634.1	NM_004984	
KIF6	221458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	39311593	39311593	+	Splice_Site	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:39311593T>A	ENST00000287152.7	-	22	2416		c.e22-2		KIF6_ENST00000394362.1_Splice_Site|KIF6_ENST00000373213.4_Splice_Site|KIF6_ENST00000229913.5_Splice_Site|KIF6_ENST00000373215.3_Splice_Site|KIF6_ENST00000373216.3_Splice_Site|KIF6_ENST00000541946.1_Splice_Site|KIF6_ENST00000538893.1_Splice_Site	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TTGGGGATGCTGGAGGCAACC	0.493																																					.		.											.	KIF6	713	0			c.2322-2A>T						.						135.0	97.0	110.0					6																	39311593		2203	4300	6503	SO:0001630	splice_region_variant	221458	exon23			GGATGCTGGAGGC	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.2322-2A>T	6.37:g.39311593T>A		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	28.0	NM_145027	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Splice_Site	SNP	ENST00000287152.7	37	CCDS4844.1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.743077	0.30865	.	.	ENSG00000164627	ENST00000287152;ENST00000458470;ENST00000394362;ENST00000373216;ENST00000373213;ENST00000229913;ENST00000373215;ENST00000538893;ENST00000541946	.	.	.	4.91	3.72	0.42706	.	.	.	.	.	.	.	.	.	.	.	0.29465	N	0.857503	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.6963	0.28596	0.0:0.1019:0.0:0.8981	.	.	.	.	.	-1	.	.	.	-	.	.	KIF6	39419571	0.990000	0.36364	0.213000	0.23690	0.091000	0.18340	2.047000	0.41269	1.817000	0.53016	0.379000	0.24179	.	.		0.493	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	Intron
KLHL17	339451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	898282	898282	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:898282G>A	ENST00000338591.3	+	6	1134	c.1027G>A	c.(1027-1029)Gtg>Atg	p.V343M		NM_198317.2	NP_938073.1	Q6TDP4	KLH17_HUMAN	kelch-like family member 17	343	Interaction with F-actin. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|dendrite cytoplasm (GO:0032839)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein complex scaffold (GO:0032947)			central_nervous_system(1)|kidney(2)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGCCGGGCCTGTGCTTTTTGC	0.682																																					p.V343M		.											.	KLHL17	90	0			c.G1027A						.						17.0	24.0	22.0					1																	898282		2179	4284	6463	SO:0001583	missense	339451	exon6			GGGCCTGTGCTTT	AY423763	CCDS30550.1	1p36	2013-01-30	2013-01-30		ENSG00000187961	ENSG00000187961		"""Kelch-like"", ""BTB/POZ domain containing"""	24023	protein-coding gene	gene with protein product	"""actinfilin"""		"""kelch-like 17 (Drosophila)"""			12063253	Standard	NM_198317		Approved		uc001aca.2	Q6TDP4	OTTHUMG00000040721	ENST00000338591.3:c.1027G>A	1.37:g.898282G>A	ENSP00000343930:p.Val343Met	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	12.0	NM_198317	Q5SV94	Missense_Mutation	SNP	ENST00000338591.3	37	CCDS30550.1	.	.	.	.	.	.	.	.	.	.	G	9.763	1.170557	0.21621	.	.	ENSG00000187961	ENST00000338591;ENST00000455747;ENST00000540863	T	0.49139	0.79	5.42	5.42	0.78866	Galactose oxidase, beta-propeller (1);	0.778438	0.11747	N	0.533365	T	0.61714	0.2369	L	0.37750	1.13	0.80722	D	1	D;D	0.65815	0.994;0.995	D;P	0.65233	0.933;0.897	T	0.58629	-0.7603	10	0.48119	T	0.1	.	19.2666	0.93988	0.0:0.0:1.0:0.0	.	66;343	B4DDM9;Q6TDP4	.;KLH17_HUMAN	M	343;219;66	ENSP00000343930:V343M	ENSP00000343930:V343M	V	+	1	0	KLHL17	888145	1.000000	0.71417	0.993000	0.49108	0.150000	0.21749	7.389000	0.79806	2.568000	0.86640	0.442000	0.29010	GTG	.		0.682	KLHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097875.3	NM_198317	
KLHL32	114792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	97512550	97512550	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:97512550G>T	ENST00000369261.4	+	5	722	c.359G>T	c.(358-360)aGt>aTt	p.S120I	KLHL32_ENST00000539200.1_Intron|KLHL32_ENST00000536676.1_Missense_Mutation_p.S84I|KLHL32_ENST00000544166.1_5'UTR	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	120										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GCAGCGGGCAGTCACCTACAG	0.428																																					p.S120I		.											.	KLHL32	94	0			c.G359T						.						143.0	109.0	120.0					6																	97512550		2203	4300	6503	SO:0001583	missense	114792	exon5			CGGGCAGTCACCT	AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.359G>T	6.37:g.97512550G>T	ENSP00000358265:p.Ser120Ile	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	33.0	NM_052904	B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	ENST00000369261.4	37	CCDS5038.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870181	0.91587	.	.	ENSG00000186231	ENST00000369255;ENST00000369261;ENST00000536676;ENST00000369254;ENST00000447886	T;T;T;T	0.68765	-0.35;1.73;-0.35;1.75	5.54	5.54	0.83059	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.73953	0.3653	L	0.48362	1.52	0.80722	D	1	D;D;D	0.71674	0.99;0.985;0.998	D;P;D	0.69142	0.962;0.897;0.941	T	0.74300	-0.3710	10	0.66056	D	0.02	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	84;120;120	B7Z346;Q96NJ5;Q6IQ08	.;KLH32_HUMAN;.	I	46;120;84;120;16	ENSP00000358265:S120I;ENSP00000440382:S84I;ENSP00000358258:S120I;ENSP00000389310:S16I	ENSP00000358258:S120I	S	+	2	0	KLHL32	97619271	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.722000	0.91452	2.890000	0.99128	0.650000	0.86243	AGT	.		0.428	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041570.1	NM_052904	
KRT80	144501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	52579367	52579367	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:52579367T>A	ENST00000394815.2	-	2	402	c.305A>T	c.(304-306)cAa>cTa	p.Q102L	KRT80_ENST00000313234.5_Missense_Mutation_p.Q102L	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80	102	Coil 1A.|Rod.					cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		TTCCAGGGCTTGCACCTGGGA	0.647																																					p.Q102L	GBM(178;2309 2916 15678 35873)	.											.	KRT80	226	0			c.A305T						.						30.0	27.0	28.0					12																	52579367		2203	4300	6503	SO:0001583	missense	144501	exon2			AGGGCTTGCACCT	BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.305A>T	12.37:g.52579367T>A	ENSP00000378292:p.Gln102Leu	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	6.0	NM_182507	Q6P1A5|Q7Z3Q0	Missense_Mutation	SNP	ENST00000394815.2	37	CCDS8821.2	.	.	.	.	.	.	.	.	.	.	T	17.35	3.367443	0.61513	.	.	ENSG00000167767	ENST00000313234;ENST00000394815	D;D	0.89123	-2.47;-2.47	5.08	1.48	0.22813	Filament (1);	0.000000	0.37955	N	0.001873	D	0.82857	0.5128	L	0.41492	1.28	0.34890	D	0.74539	P;P;P	0.46142	0.763;0.801;0.873	B;B;B	0.42361	0.229;0.339;0.385	T	0.82973	-0.0191	10	0.87932	D	0	.	8.0208	0.30408	0.0:0.4262:0.0:0.5738	.	102;102;39	Q6KB66-2;Q6KB66;Q6KB66-3	.;K2C80_HUMAN;.	L	102	ENSP00000369361:Q102L;ENSP00000378292:Q102L	ENSP00000369361:Q102L	Q	-	2	0	KRT80	50865634	0.824000	0.29247	0.332000	0.25469	0.656000	0.38851	1.342000	0.33919	0.097000	0.17492	-0.250000	0.11733	CAA	.		0.647	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316757.1	NM_182507	
KRT7	3855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52635357	52635357	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:52635357G>T	ENST00000331817.5	+	5	978	c.795G>T	c.(793-795)aaG>aaT	p.K265N		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	265	Coil 2.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	CTGAGGTCAAGGCGCAGTATG	0.597																																					p.K265N		.											.	KRT7	90	0			c.G795T						.						93.0	83.0	86.0					12																	52635357		2203	4300	6503	SO:0001583	missense	3855	exon5			GGTCAAGGCGCAG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.795G>T	12.37:g.52635357G>T	ENSP00000329243:p.Lys265Asn	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	22.0	NM_005556	Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	ENST00000331817.5	37	CCDS8822.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759342	0.31137	.	.	ENSG00000135480	ENST00000331817;ENST00000422319;ENST00000551537	D	0.90133	-2.62	4.88	-3.07	0.05363	Prefoldin (1);Filament (1);	1.949080	0.02980	N	0.145483	D	0.96103	0.8730	H	0.97315	3.98	0.26908	N	0.966952	D;D	0.69078	0.996;0.997	D;D	0.70227	0.967;0.968	T	0.82961	-0.0197	10	0.87932	D	0	.	1.7895	0.03048	0.1863:0.2945:0.3215:0.1976	.	265;265	F8VZY5;P08729	.;K2C7_HUMAN	N	265;241;265	ENSP00000329243:K265N	ENSP00000329243:K265N	K	+	3	2	KRT7	50921624	0.229000	0.23729	0.074000	0.20217	0.095000	0.18619	-0.267000	0.08619	-0.468000	0.06922	-0.182000	0.12963	AAG	.		0.597	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
LCT	3938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	136567010	136567010	+	Silent	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:136567010C>T	ENST00000264162.2	-	8	2917	c.2907G>A	c.(2905-2907)ttG>ttA	p.L969L	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	969	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CCTTCACCTTCAAAGCTCGGA	0.507																																					p.L969L		.											.	LCT	101	0			c.G2907A						.						88.0	90.0	89.0					2																	136567010		2203	4300	6503	SO:0001819	synonymous_variant	3938	exon8			CACCTTCAAAGCT	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2907G>A	2.37:g.136567010C>T		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	18.0	NM_002299	Q4ZG58	Silent	SNP	ENST00000264162.2	37	CCDS2178.1																																																																																			.		0.507	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
LEPRE1	64175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	43218272	43218272	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:43218272T>A	ENST00000296388.5	-	9	1460	c.1409A>T	c.(1408-1410)cAg>cTg	p.Q470L	LEPRE1_ENST00000236040.4_Missense_Mutation_p.Q470L|LEPRE1_ENST00000397054.3_Missense_Mutation_p.Q470L			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	470					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CACCACCCGCTGGGAACCATT	0.532																																					p.Q470L		.											.	LEPRE1	94	0			c.A1409T						.						104.0	87.0	92.0					1																	43218272		2203	4300	6503	SO:0001583	missense	64175	exon9			ACCCGCTGGGAAC	AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1409A>T	1.37:g.43218272T>A	ENSP00000296388:p.Gln470Leu	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	25.0	NM_001146289	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	ENST00000296388.5	37	CCDS472.2	.	.	.	.	.	.	.	.	.	.	t	19.77	3.889529	0.72524	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.63417	-0.04;-0.04;-0.04	4.96	4.96	0.65561	Prolyl 4-hydroxylase, alpha subunit (1);	0.055934	0.64402	D	0.000001	T	0.54919	0.1888	L	0.54323	1.7	0.51482	D	0.999928	B;B;P	0.34662	0.41;0.043;0.462	B;B;B	0.29663	0.103;0.025;0.105	T	0.60000	-0.7348	10	0.54805	T	0.06	-32.4245	12.6255	0.56628	0.0:0.0:0.0:1.0	.	470;335;470	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	L	470;470;470;335	ENSP00000380245:Q470L;ENSP00000236040:Q470L;ENSP00000296388:Q470L	ENSP00000236040:Q470L	Q	-	2	0	LEPRE1	42990859	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	7.523000	0.81856	2.097000	0.63578	0.375000	0.23000	CAG	.		0.532	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2	NM_022356	
LENEP	55891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154966209	154966209	+	Silent	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:154966209C>A	ENST00000392487.1	+	1	146	c.126C>A	c.(124-126)acC>acA	p.T42T				Q9Y5L5	LENEP_HUMAN	lens epithelial protein	42					multicellular organismal development (GO:0007275)		DNA binding (GO:0003677)			lung(2)	2	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCCAGCGGACCCTGAAGGAAG	0.602																																					p.T42T		.											.	LENEP	68	0			c.C126A						.						85.0	82.0	83.0					1																	154966209		2203	4300	6503	SO:0001819	synonymous_variant	55891	exon1			GCGGACCCTGAAG	AF268478	CCDS1080.1	1q22.2	2008-02-05			ENSG00000163352	ENSG00000163352			14429	protein-coding gene	gene with protein product		607377				10655141, 11376938	Standard	NM_018655		Approved	LEP503	uc001fgi.3	Q9Y5L5	OTTHUMG00000037417	ENST00000392487.1:c.126C>A	1.37:g.154966209C>A		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	18.0	NM_018655	B5BUM1|Q5T1A4	Silent	SNP	ENST00000392487.1	37	CCDS1080.1																																																																																			.		0.602	LENEP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385609.2	NM_018655	
LRRC4C	57689	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	40137430	40137430	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:40137430G>T	ENST00000278198.2	-	2	2376	c.413C>A	c.(412-414)aCc>aAc	p.T138N	LRRC4C_ENST00000527150.1_Missense_Mutation_p.T138N|LRRC4C_ENST00000530763.1_Missense_Mutation_p.T138N|LRRC4C_ENST00000528697.1_Missense_Mutation_p.T138N			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	138					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				ATTCGGGATGGTAGTAAGACG	0.423																																					p.T138N		.											.	LRRC4C	521	0			c.C413A						.						70.0	71.0	71.0					11																	40137430		2203	4300	6503	SO:0001583	missense	57689	exon7			GGGATGGTAGTAA	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.413C>A	11.37:g.40137430G>T	ENSP00000278198:p.Thr138Asn	Somatic	153.0	1.0		WXS	Illumina HiSeq	Phase_I	177.0	44.0	NM_001258419	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	37	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.895374	0.33442	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86	5.73	4.81	0.61882	.	0.100400	0.64402	D	0.000002	D	0.86719	0.6000	L	0.40543	1.245	0.58432	D	0.999999	P	0.44429	0.835	B	0.43701	0.428	D	0.83658	0.0159	10	0.20519	T	0.43	.	13.2544	0.60070	0.076:0.0:0.924:0.0	.	138	Q9HCJ2	LRC4C_HUMAN	N	138	ENSP00000278198:T138N;ENSP00000436976:T138N;ENSP00000437132:T138N;ENSP00000434761:T138N	ENSP00000278198:T138N	T	-	2	0	LRRC4C	40094006	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.729000	0.74775	2.706000	0.92434	0.585000	0.79938	ACC	.		0.423	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
MAD1L1	8379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2252879	2252879	+	Silent	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:2252879C>T	ENST00000406869.1	-	10	1511	c.954G>A	c.(952-954)gaG>gaA	p.E318E	MAD1L1_ENST00000486340.1_5'UTR|MAD1L1_ENST00000402746.1_Silent_p.E226E|MAD1L1_ENST00000265854.7_Silent_p.E318E|MAD1L1_ENST00000399654.2_Silent_p.E318E			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	318					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GGTCCAGTCTCTCCCAGCTTT	0.557																																					p.E318E		.											.	MAD1L1	1083	0			c.G954A						.						81.0	94.0	90.0					7																	2252879		2065	4200	6265	SO:0001819	synonymous_variant	8379	exon10			CAGTCTCTCCCAG	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.954G>A	7.37:g.2252879C>T		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	19.0	NM_003550	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Silent	SNP	ENST00000406869.1	37	CCDS43539.1																																																																																			.		0.557	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322871.1	NM_003550	
MAGEC2	51438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	141291161	141291161	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chrX:141291161A>T	ENST00000247452.3	-	3	960	c.613T>A	c.(613-615)Ttc>Atc	p.F205I		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	205	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					AACACACAGAAGTGGTCAGGG	0.478										HNSCC(46;0.14)																											p.F205I		.											.	MAGEC2	193	0			c.T613A						.						111.0	104.0	106.0					X																	141291161		2203	4300	6503	SO:0001583	missense	51438	exon3			CACAGAAGTGGTC	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.613T>A	X.37:g.141291161A>T	ENSP00000354660:p.Phe205Ile	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	60.0	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	37	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	7.306	0.613952	0.14066	.	.	ENSG00000046774	ENST00000247452	T	0.04454	3.62	0.988	0.988	0.19796	.	2.722080	0.02290	U	0.070170	T	0.01940	0.0061	N	0.01219	-0.95	0.09310	N	1	B	0.22003	0.063	B	0.20955	0.032	T	0.39440	-0.9614	10	0.16896	T	0.51	.	3.916	0.09224	1.0:0.0:0.0:0.0	.	205	Q9UBF1	MAGC2_HUMAN	I	205	ENSP00000354660:F205I	ENSP00000354660:F205I	F	-	1	0	MAGEC2	141118827	0.000000	0.05858	0.010000	0.14722	0.091000	0.18340	-0.355000	0.07671	0.635000	0.30488	0.235000	0.17854	TTC	.		0.478	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
MAPK7	5598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19284705	19284705	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:19284705A>T	ENST00000308406.5	+	4	1569	c.1183A>T	c.(1183-1185)Atc>Ttc	p.I395F	MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000299612.7_Missense_Mutation_p.I256F|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000395604.3_Missense_Mutation_p.I395F|MAPK7_ENST00000395602.4_Missense_Mutation_p.I395F	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	395	Necessary for oligomerization. {ECO:0000250}.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)			autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					GCGTGAGGGCATCCGCCAACA	0.582																																					p.I395F		.											.	MAPK7	1402	0			c.A1183T						.						71.0	64.0	67.0					17																	19284705		2203	4300	6503	SO:0001583	missense	5598	exon4			GAGGGCATCCGCC	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1183A>T	17.37:g.19284705A>T	ENSP00000311005:p.Ile395Phe	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	17.0	NM_002749	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	A	12.03	1.814615	0.32053	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.74209	-0.56;-0.82;-0.56;-0.56	4.31	4.31	0.51392	.	0.180267	0.47455	D	0.000232	T	0.69360	0.3102	N	0.25647	0.755	0.36006	D	0.837731	D	0.54772	0.968	P	0.50970	0.655	T	0.77960	-0.2391	10	0.66056	D	0.02	-12.697	11.4779	0.50308	1.0:0.0:0.0:0.0	.	395	Q13164	MK07_HUMAN	F	395;256;395;395	ENSP00000311005:I395F;ENSP00000299612:I256F;ENSP00000378968:I395F;ENSP00000378966:I395F	ENSP00000299612:I256F	I	+	1	0	MAPK7	19225298	0.998000	0.40836	1.000000	0.80357	0.925000	0.55904	3.866000	0.56040	1.808000	0.52836	0.459000	0.35465	ATC	.		0.582	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
MC4R	4160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	58039130	58039130	+	Silent	SNP	G	G	A	rs142925940		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr18:58039130G>A	ENST00000299766.3	-	1	871	c.453C>T	c.(451-453)atC>atT	p.I151I		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	151					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				GAGCATAGAAGATAGTAAAGT	0.428																																					p.I151I		.											.	MC4R	522	0			c.C453T						.	G		1,4405	2.1+/-5.4	0,1,2202	91.0	82.0	85.0		453	4.8	1.0	18	dbSNP_134	85	0,8600		0,0,4300	no	coding-synonymous	MC4R	NM_005912.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		151/333	58039130	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4160	exon1			ATAGAAGATAGTA	AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.453C>T	18.37:g.58039130G>A		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	20.0	NM_005912	B2RAC3|Q16317|Q3MIJ6	Silent	SNP	ENST00000299766.3	37	CCDS11976.1																																																																																			G|1.000;A|0.000		0.428	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256139.1	NM_005912	
MDGA1	266727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	37611713	37611713	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:37611713T>C	ENST00000434837.3	-	14	3586	c.2408A>G	c.(2407-2409)tAc>tGc	p.Y803C	MDGA1_ENST00000505425.1_Missense_Mutation_p.Y803C|MDGA1_ENST00000510077.1_5'Flank|MDGA1_ENST00000297153.7_Missense_Mutation_p.Y807C	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	803	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						GATGAACATGTAGTAGCCTGC	0.592																																					p.Y803C		.											.	MDGA1	91	0			c.A2408G						.						49.0	53.0	52.0					6																	37611713		2043	4190	6233	SO:0001583	missense	266727	exon14			AACATGTAGTAGC	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2408A>G	6.37:g.37611713T>C	ENSP00000402584:p.Tyr803Cys	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	20.0	NM_153487	A6NHG0|Q8NBE3	Missense_Mutation	SNP	ENST00000434837.3	37	CCDS47417.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.2|20.2	3.943199|3.943199	0.73672|0.73672	.|.	.|.	ENSG00000112139|ENSG00000112139	ENST00000418178|ENST00000434837;ENST00000297153;ENST00000505425	.|T;T;T	.|0.03982	.|3.74;3.74;3.74	5.8|5.8	5.8|5.8	0.92144|0.92144	.|Concanavalin A-like lectin/glucanase (1);MAM domain (3);	.|0.000000	.|0.45867	.|D	.|0.000322	T|T	0.24005|0.24005	0.0581|0.0581	H|H	0.95611|0.95611	3.695|3.695	0.46725|0.46725	D|D	0.999179|0.999179	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.83275	.|0.996;0.992	T|T	0.30357|0.30357	-0.9981|-0.9981	5|10	.|0.87932	.|D	.|0	.|.	13.8959|13.8959	0.63770|0.63770	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|803;803	.|Q8NFP4-2;Q8NFP4	.|.;MDGA1_HUMAN	A|C	113|803;807;803	.|ENSP00000402584:Y803C;ENSP00000297153:Y807C;ENSP00000422042:Y803C	.|ENSP00000297153:Y807C	T|Y	-|-	1|2	0|0	MDGA1|MDGA1	37719691|37719691	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.950000|0.950000	0.60333|0.60333	4.722000|4.722000	0.61958|0.61958	2.209000|2.209000	0.71365|0.71365	0.533000|0.533000	0.62120|0.62120	ACA|TAC	.		0.592	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3		
MDN1	23195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	90388402	90388402	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:90388402C>T	ENST00000369393.3	-	75	12443	c.12328G>A	c.(12328-12330)Gag>Aag	p.E4110K	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.E4110K			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4110					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CGCTGCTTCTCCTTCTCTGCA	0.478																																					p.E4110K		.											.	MDN1	100	0			c.G12328A						.						150.0	137.0	142.0					6																	90388402		2203	4300	6503	SO:0001583	missense	23195	exon75			GCTTCTCCTTCTC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12328G>A	6.37:g.90388402C>T	ENSP00000358400:p.Glu4110Lys	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	35.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189360	0.57909	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03663	3.85;3.85	5.13	5.13	0.70059	.	0.061513	0.64402	D	0.000006	T	0.02970	0.0088	M	0.77616	2.38	0.58432	D	0.999992	B	0.32653	0.379	B	0.23716	0.048	T	0.17107	-1.0380	10	0.49607	T	0.09	.	12.9533	0.58413	0.0:0.922:0.0:0.078	.	4110	Q9NU22	MDN1_HUMAN	K	4110	ENSP00000358400:E4110K;ENSP00000413970:E4110K	ENSP00000358400:E4110K	E	-	1	0	MDN1	90445123	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.382000	0.79729	2.388000	0.81334	0.561000	0.74099	GAG	.		0.478	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
MED23	9439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	131910712	131910712	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:131910712G>T	ENST00000368068.3	-	28	4011	c.3832C>A	c.(3832-3834)Ctg>Atg	p.L1278M	MED23_ENST00000479213.1_5'UTR|MED23_ENST00000354577.4_Missense_Mutation_p.L1284M|MED23_ENST00000368060.3_Missense_Mutation_p.L1278M|MED23_ENST00000403834.3_Missense_Mutation_p.L1284M|MED23_ENST00000545957.1_Missense_Mutation_p.L919M|MED23_ENST00000368058.1_Missense_Mutation_p.L1284M	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	1278					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		ACATTCAGCAGCATGTCATAA	0.378																																					p.L1284M		.											.	MED23	24	0			c.C3850A						.						95.0	86.0	89.0					6																	131910712		2203	4300	6503	SO:0001583	missense	9439	exon29			TCAGCAGCATGTC	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.3832C>A	6.37:g.131910712G>T	ENSP00000357047:p.Leu1278Met	Somatic	221.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	51.0	NM_015979	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Missense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.877552	0.72294	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000545957	T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.39	3.49	0.39957	.	0.000000	0.85682	D	0.000000	T	0.81074	0.4747	L	0.58810	1.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.83208	-0.0075	10	0.87932	D	0	-10.1418	13.7755	0.63050	0.0897:0.0:0.9103:0.0	.	1278;1284	Q9ULK4;Q9ULK4-3	MED23_HUMAN;.	M	1284;1278;1284;1278;1284;919	ENSP00000346588:L1284M;ENSP00000357047:L1278M;ENSP00000384536:L1284M;ENSP00000357039:L1278M;ENSP00000357037:L1284M;ENSP00000439977:L919M	ENSP00000346588:L1284M	L	-	1	2	MED23	131952405	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.659000	0.68010	0.519000	0.28406	0.591000	0.81541	CTG	.		0.378	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
MERTK	10461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	112732991	112732991	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:112732991G>T	ENST00000295408.4	+	7	1343	c.1086G>T	c.(1084-1086)atG>atT	p.M362I	MERTK_ENST00000409780.1_Missense_Mutation_p.M186I|MERTK_ENST00000421804.2_Missense_Mutation_p.M362I			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	362	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TTTCCTGCATGAATGAAATAG	0.468																																					p.M362I		.											.	MERTK	1463	0			c.G1086T						.						140.0	134.0	136.0					2																	112732991		2203	4300	6503	SO:0001583	missense	10461	exon7			CTGCATGAATGAA	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.1086G>T	2.37:g.112732991G>T	ENSP00000295408:p.Met362Ile	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	56.0	NM_006343	Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694470	0.48202	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000409780	T;T;T	0.55413	0.52;0.52;0.52	5.57	5.57	0.84162	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.239142	0.21365	U	0.075740	T	0.50939	0.1645	L	0.51422	1.61	0.32822	D	0.502865	B	0.24483	0.104	B	0.21917	0.037	T	0.56318	-0.7999	10	0.34782	T	0.22	-13.0059	19.1494	0.93482	0.0:0.0:1.0:0.0	.	362	Q12866	MERTK_HUMAN	I	362;362;186	ENSP00000295408:M362I;ENSP00000389152:M362I;ENSP00000387277:M186I	ENSP00000295408:M362I	M	+	3	0	MERTK	112449462	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.173000	0.65010	2.634000	0.89283	0.563000	0.77884	ATG	.		0.468	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
MFAP2	4237	hgsc.bcm.edu;broad.mit.edu	37	1	17303663	17303663	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:17303663A>G	ENST00000375535.3	-	3	357	c.68T>C	c.(67-69)cTg>cCg	p.L23P	MFAP2_ENST00000375534.3_Missense_Mutation_p.L22P|MFAP2_ENST00000490075.1_5'UTR|MFAP2_ENST00000438542.1_Missense_Mutation_p.L22P|RP1-37C10.3_ENST00000446261.1_RNA			P55001	MFAP2_HUMAN	microfibrillar-associated protein 2	23					extracellular matrix organization (GO:0030198)|platelet formation (GO:0030220)	extracellular region (GO:0005576)|microfibril (GO:0001527)				kidney(1)|lung(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000118)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000538)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|COAD - Colon adenocarcinoma(227;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;3.04e-05)|Kidney(64;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00544)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CAGCGGGTCCAGGTCATACTG	0.652																																					p.L23P		.											.	MFAP2	514	0			c.T68C						.						31.0	27.0	28.0					1																	17303663		2202	4299	6501	SO:0001583	missense	4237	exon3			GGGTCCAGGTCAT	BC015039	CCDS174.1, CCDS44071.1	1p36.1-p35	2008-02-05			ENSG00000117122	ENSG00000117122			7033	protein-coding gene	gene with protein product		156790				7759096	Standard	NM_017459		Approved	MAGP, MAGP-1	uc001azw.3	P55001	OTTHUMG00000002290	ENST00000375535.3:c.68T>C	1.37:g.17303663A>G	ENSP00000364685:p.Leu23Pro	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_002403	Q53X60|Q5JXY0	Missense_Mutation	SNP	ENST00000375535.3	37	CCDS174.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.975008	0.74360	.	.	ENSG00000117122	ENST00000375535;ENST00000375534;ENST00000438542	.	.	.	4.33	4.33	0.51752	.	0.631968	0.12996	N	0.422047	T	0.62551	0.2437	L	0.36672	1.1	0.58432	D	0.999991	P;D	0.56287	0.911;0.975	P;P	0.59424	0.583;0.857	T	0.61720	-0.7005	9	0.66056	D	0.02	.	10.2049	0.43107	1.0:0.0:0.0:0.0	.	22;23	Q5JXY0;P55001	.;MFAP2_HUMAN	P	23;22;22	.	ENSP00000364684:L22P	L	-	2	0	MFAP2	17176250	0.935000	0.31712	0.991000	0.47740	0.932000	0.56968	1.747000	0.38298	1.733000	0.51620	0.379000	0.24179	CTG	.		0.652	MFAP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006609.1	NM_002403	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151873528	151873528	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:151873528G>C	ENST00000262189.6	-	38	9228	c.9010C>G	c.(9010-9012)Ctg>Gtg	p.L3004V	KMT2C_ENST00000355193.2_Missense_Mutation_p.L3004V	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3004					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CCTGTCCCCAGACTGTGGTTA	0.463																																					p.L3004V		.											.	MLL3	1398	0			c.C9010G						.						94.0	87.0	89.0					7																	151873528		2203	4300	6503	SO:0001583	missense	58508	exon38			TCCCCAGACTGTG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.9010C>G	7.37:g.151873528G>C	ENSP00000262189:p.Leu3004Val	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	44.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.806|2.806	-0.248006|-0.248006	0.05867|0.05867	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193|ENST00000360104	D;D|D	0.83250|0.85702	-1.7;-1.7|-2.02	5.66|5.66	0.182|0.182	0.15077|0.15077	.|.	0.165520|.	0.27393|.	N|.	0.019566|.	T|T	0.68833|0.68833	0.3044|0.3044	N|N	0.11427|0.11427	0.14|0.14	0.09310|0.09310	N|N	0.99999|0.99999	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.0;0.0;0.001|.	T|T	0.59757|0.59757	-0.7394|-0.7394	10|7	0.33141|0.56958	T|D	0.24|0.05	.|.	3.3493|3.3493	0.07146|0.07146	0.5806:0.1219:0.0641:0.2333|0.5806:0.1219:0.0641:0.2333	.|.	3004;2065;3004|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	V|C	3004|509	ENSP00000262189:L3004V;ENSP00000347325:L3004V|ENSP00000353218:S509C	ENSP00000262189:L3004V|ENSP00000353218:S509C	L|S	-|-	1|2	2|0	MLL3|MLL3	151504461|151504461	0.992000|0.992000	0.36948|0.36948	0.025000|0.025000	0.17156|0.17156	0.773000|0.773000	0.43773|0.43773	2.254000|2.254000	0.43214|0.43214	-0.166000|-0.166000	0.10890|0.10890	-1.077000|-1.077000	0.02231|0.02231	CTG|TCT	.		0.463	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MLLT6	4302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	36868254	36868254	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:36868254G>C	ENST00000325718.7	+	7	798	c.707G>C	c.(706-708)aGg>aCg	p.R236T	MLLT6_ENST00000378137.5_Missense_Mutation_p.R236T	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	236					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					CACCACGAGAGGGGCCAGAAG	0.607			T	MLL	AL																																p.R236T		.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	659	0			c.G707C						.						103.0	104.0	104.0					17																	36868254		2203	4299	6502	SO:0001583	missense	4302	exon7			ACGAGAGGGGCCA		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.707G>C	17.37:g.36868254G>C	ENSP00000316426:p.Arg236Thr	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	55.0	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Missense_Mutation	SNP	ENST00000325718.7	37	CCDS11327.1	.	.	.	.	.	.	.	.	.	.	g	12.88	2.070750	0.36566	.	.	ENSG00000108292	ENST00000325718;ENST00000378137	T;T	0.81163	-1.46;2.46	4.02	1.98	0.26296	.	0.672888	0.13450	N	0.387017	T	0.71143	0.3305	L	0.51422	1.61	0.29188	N	0.876062	B;B;B	0.29432	0.244;0.244;0.023	B;B;B	0.29785	0.107;0.107;0.021	T	0.58498	-0.7626	10	0.20519	T	0.43	.	6.4327	0.21807	0.2408:0.0:0.7592:0.0	.	236;236;236	E9PEP1;Q6P2C6;P55198	.;.;AF17_HUMAN	T	236	ENSP00000316426:R236T;ENSP00000367377:R236T	ENSP00000316426:R236T	R	+	2	0	MLLT6	34121780	1.000000	0.71417	0.994000	0.49952	0.914000	0.54420	1.327000	0.33746	0.335000	0.23614	0.472000	0.43445	AGG	.		0.607	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	
MRPL46	26589	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	89008827	89008827	+	Missense_Mutation	SNP	G	G	C	rs146169028		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:89008827G>C	ENST00000312475.4	-	2	447	c.406C>G	c.(406-408)Cgc>Ggc	p.R136G	MRPS11_ENST00000325844.4_5'Flank|MRPL46_ENST00000559538.1_5'Flank|MRPS11_ENST00000353598.6_5'Flank	NM_022163.3	NP_071446.2	Q9H2W6	RM46_HUMAN	mitochondrial ribosomal protein L46	136						mitochondrion (GO:0005739)|ribosome (GO:0005840)	hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			CCTGTTATGCGAGCTCCAAGT	0.438																																					p.R136G		.											.	MRPL46	90	0			c.C406G						.						99.0	99.0	99.0					15																	89008827		2201	4299	6500	SO:0001583	missense	26589	exon2			TTATGCGAGCTCC	AF210056	CCDS10341.1	15q25.3	2012-10-08	2001-12-10	2001-12-14	ENSG00000259494	ENSG00000259494		"""Mitochondrial ribosomal proteins / large subunits"""	1192	protein-coding gene	gene with protein product		611851	"""chromosome 15 open reading frame 4"""	C15orf4		11761714, 11551941	Standard	NM_022163		Approved	LIECG2, P2ECSL	uc002bmj.2	Q9H2W6	OTTHUMG00000148683	ENST00000312475.4:c.406C>G	15.37:g.89008827G>C	ENSP00000312311:p.Arg136Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	22.0	NM_022163	B2RD75|Q9HBU8	Missense_Mutation	SNP	ENST00000312475.4	37	CCDS10341.1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097527	0.56075	.	.	ENSG00000173867	ENST00000312475	T	0.69561	-0.41	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.84129	0.5404	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.994;0.998	D	0.86288	0.1672	10	0.59425	D	0.04	.	17.5509	0.87875	0.0:0.0:1.0:0.0	.	51;136;67	Q8TER9;Q9H2W6;E9PCP9	.;RM46_HUMAN;.	G	136	ENSP00000312311:R136G	ENSP00000312311:R136G	R	-	1	0	MRPL46	86809831	1.000000	0.71417	0.998000	0.56505	0.509000	0.34042	3.125000	0.50469	2.683000	0.91414	0.655000	0.94253	CGC	G|1.000;A|0.000		0.438	MRPL46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309073.1	NM_022163	
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9074549	9074549	+	Silent	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:9074549A>T	ENST00000397910.4	-	3	13100	c.12897T>A	c.(12895-12897)atT>atA	p.I4299I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4301	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACACTGTCTCAATCTCTGTGG	0.512																																					p.I4299I		.											.	MUC16	566	0			c.T12897A						.						102.0	101.0	101.0					19																	9074549		2049	4194	6243	SO:0001819	synonymous_variant	94025	exon3			TGTCTCAATCTCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12897T>A	19.37:g.9074549A>T		Somatic	100.0	1.0		WXS	Illumina HiSeq	Phase_I	29.0	23.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYO10	4651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	16682120	16682120	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:16682120G>A	ENST00000513610.1	-	31	4503	c.4049C>T	c.(4048-4050)cCc>cTc	p.P1350L	MYO10_ENST00000274203.9_Missense_Mutation_p.P707L|MYO10_ENST00000505695.1_Missense_Mutation_p.P689L|MYO10_ENST00000515803.1_Missense_Mutation_p.P689L|MYO10_ENST00000427430.2_Missense_Mutation_p.P707L	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1350					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						AAACGAGTTGGGTCTGAGCCA	0.567																																					p.P1350L		.											.	MYO10	3	0			c.C4049T						.						115.0	115.0	115.0					5																	16682120		2128	4231	6359	SO:0001583	missense	4651	exon31			GAGTTGGGTCTGA	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.4049C>T	5.37:g.16682120G>A	ENSP00000421280:p.Pro1350Leu	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	8.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703432	0.88924	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.82	5.82	0.92795	Pleckstrin homology-type (1);	.	.	.	.	T	0.80025	0.4548	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	0.991;0.995;1.0	P;P;D	0.69142	0.778;0.645;0.962	T	0.81008	-0.1127	9	0.87932	D	0	.	20.1027	0.97880	0.0:0.0:1.0:0.0	.	229;990;1350	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	L	1350;689;707;689;707	ENSP00000421280:P1350L;ENSP00000425051:P689L;ENSP00000274203:P707L;ENSP00000421170:P689L;ENSP00000391106:P707L	ENSP00000274203:P707L	P	-	2	0	MYO10	16735120	1.000000	0.71417	0.998000	0.56505	0.459000	0.32528	6.622000	0.74233	2.756000	0.94617	0.655000	0.94253	CCC	.		0.567	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	76858873	76858873	+	Silent	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:76858873G>A	ENST00000409709.3	+	4	434	c.162G>A	c.(160-162)acG>acA	p.T54T	MYO7A_ENST00000409893.1_Silent_p.T54T|MYO7A_ENST00000409619.2_Silent_p.T43T|MYO7A_ENST00000458637.2_Silent_p.T54T	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	54					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGAACGCAACGCACATCAAGC	0.652																																					p.T54T		.											.	MYO7A	138	0			c.G162A						.						36.0	40.0	39.0					11																	76858873		2133	4237	6370	SO:0001819	synonymous_variant	4647	exon4			CGCAACGCACATC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.162G>A	11.37:g.76858873G>A		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	48.0	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	ENST00000409709.3	37	CCDS53683.1																																																																																			.		0.652	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
MYT1	4661	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62837052	62837052	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr20:62837052T>A	ENST00000328439.1	+	6	660	c.296T>A	c.(295-297)gTg>gAg	p.V99E	MYT1_ENST00000536311.1_Missense_Mutation_p.V99E|MYT1_ENST00000360149.4_Missense_Mutation_p.V99E	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GACACTGAGGTGAAGGACGCC	0.602																																					p.V99E	GBM(59;481 1041 20555 21139 33705)	.											.	MYT1	704	0			c.T296A						.						83.0	72.0	76.0					20																	62837052		2203	4300	6503	SO:0001583	missense	4661	exon6			CTGAGGTGAAGGA	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.296T>A	20.37:g.62837052T>A	ENSP00000327465:p.Val99Glu	Somatic	106.0	1.0		WXS	Illumina HiSeq	Phase_I	103.0	30.0	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	T	15.93	2.979192	0.53827	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.40756	1.02;1.44;1.44	5.58	5.58	0.84498	.	0.213160	0.38959	N	0.001505	T	0.29850	0.0746	L	0.41710	1.295	0.25747	N	0.985099	B;B	0.25850	0.024;0.136	B;B	0.27796	0.005;0.083	T	0.29912	-0.9996	10	0.02654	T	1	-20.4786	10.8817	0.46942	0.0:0.0752:0.0:0.9248	.	99;99	Q01538;Q6P6D5	MYT1_HUMAN;.	E	99	ENSP00000353269:V99E;ENSP00000327465:V99E;ENSP00000442412:V99E	ENSP00000327465:V99E	V	+	2	0	MYT1	62307496	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.517000	0.35867	2.135000	0.66039	0.533000	0.62120	GTG	.		0.602	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
NACAD	23148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	45120738	45120738	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:45120738T>A	ENST00000490531.2	-	5	4401	c.4382A>T	c.(4381-4383)tAt>tTt	p.Y1461F		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	1461	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						AAAGACCACATAAGTGTCTGA	0.567																																					p.Y1461F		.											.	.	.	0			c.A4382T						.						71.0	67.0	68.0					7																	45120738		692	1591	2283	SO:0001583	missense	23148	exon5			ACCACATAAGTGT	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.4382A>T	7.37:g.45120738T>A	ENSP00000420477:p.Tyr1461Phe	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	30.0	NM_001146334		Missense_Mutation	SNP	ENST00000490531.2	37	CCDS47582.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.235952	0.79800	.	.	ENSG00000136274	ENST00000490531	T	0.48522	0.81	4.08	4.08	0.47627	Nascent polypeptide-associated complex NAC (2);	0.000000	0.85682	U	0.000000	T	0.64249	0.2581	M	0.69185	2.1	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.66858	-0.5817	10	0.56958	D	0.05	-12.6212	12.0206	0.53342	0.0:0.0:0.0:1.0	.	1461	O15069	NACAD_HUMAN	F	1461	ENSP00000420477:Y1461F	ENSP00000420477:Y1461F	Y	-	2	0	NACAD	45087263	1.000000	0.71417	0.978000	0.43139	0.932000	0.56968	4.959000	0.63666	1.698000	0.51180	0.363000	0.22086	TAT	.		0.567	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
NCKAP1	10787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	183866687	183866687	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:183866687A>G	ENST00000361354.4	-	6	969	c.597T>C	c.(595-597)caT>caC	p.H199H	NCKAP1_ENST00000360982.2_Silent_p.H205H	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	199					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTACCTTGCTATGGGGTACAA	0.383																																					p.H205H		.											.	NCKAP1	92	0			c.T615C						.						138.0	127.0	131.0					2																	183866687		2203	4300	6503	SO:0001819	synonymous_variant	10787	exon7			CTTGCTATGGGGT	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.597T>C	2.37:g.183866687A>G		Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	283.0	77.0	NM_205842	O60329|Q53QN5|Q53S94|Q53Y35	Silent	SNP	ENST00000361354.4	37	CCDS2287.1																																																																																			.		0.383	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
NCOR2	9612	broad.mit.edu;mdanderson.org	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000397355.1_Silent_p.Q499Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q		.											.	NCOR2	229	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A						.						9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T		Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	3.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																			.		0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
NELFB	25920	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	140160781	140160781	+	Splice_Site	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr9:140160781A>G	ENST00000343053.4	+	8	1336		c.e8-1			NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TCCTCCCTACAGGACAGCCCC	0.642																																					.		.											.	.	.	0			c.1000-2A>G						.						28.0	26.0	27.0					9																	140160781		2202	4283	6485	SO:0001630	splice_region_variant	25920	exon8			CCCTACAGGACAG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.1000-1A>G	9.37:g.140160781A>G		Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	36.0	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Splice_Site	SNP	ENST00000343053.4	37	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.548547	0.45383	.	.	ENSG00000188986	ENST00000343053	.	.	.	5.02	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2084	0.48784	0.8459:0.1541:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COBRA1	139280602	1.000000	0.71417	0.860000	0.33809	0.492000	0.33523	9.044000	0.93805	0.827000	0.34685	0.402000	0.26972	.	.		0.642	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	Intron
NOBOX	135935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	144096937	144096937	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:144096937C>A	ENST00000467773.1	-	6	1066	c.1067G>T	c.(1066-1068)cGg>cTg	p.R356L	NOBOX_ENST00000483238.1_Missense_Mutation_p.R324L|NOBOX_ENST00000223140.5_Missense_Mutation_p.R239L	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	356					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CCACTTGGCCCGGCGATTCTG	0.542																																					p.R356L		.											.	NOBOX	69	0			c.G1067T						.						78.0	82.0	80.0					7																	144096937		1955	4150	6105	SO:0001583	missense	135935	exon6			TTGGCCCGGCGAT			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1067G>T	7.37:g.144096937C>A	ENSP00000419457:p.Arg356Leu	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	25.0	NM_001080413	A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	37		.	.	.	.	.	.	.	.	.	.	C	21.8	4.202985	0.79127	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140;ENST00000555556	D;D;D	0.99298	-5.5;-5.71;-5.5	5.55	4.67	0.58626	Homeodomain-related (1);Homeobox (2);	0.324668	0.29987	N	0.010695	D	0.99510	0.9825	M	0.93241	3.395	0.36537	D	0.87108	D	0.89917	1.0	D	0.91635	0.999	D	0.99552	1.0966	10	0.87932	D	0	-35.0972	12.3015	0.54876	0.0:0.918:0.0:0.082	.	356	O60393	NOBOX_HUMAN	L	324;356;239;113	ENSP00000419565:R324L;ENSP00000419457:R356L;ENSP00000223140:R239L	ENSP00000223140:R239L	R	-	2	0	NOBOX	143727870	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	5.277000	0.65586	1.352000	0.45808	0.650000	0.86243	CGG	.		0.542	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420	
NOS1	4842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	117655927	117655927	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:117655927G>A	ENST00000338101.4	-	28	4319	c.4315C>T	c.(4315-4317)Cga>Tga	p.R1439*	NOS1_ENST00000317775.6_Nonsense_Mutation_p.R1405*|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TCGTACGTTCGCAGGGTGACT	0.478																																					p.R1439X	Esophageal Squamous(162;1748 2599 51982 52956)	.											.	NOS1	154	0			c.C4315T						.						315.0	308.0	310.0					12																	117655927		1959	4156	6115	SO:0001587	stop_gained	4842	exon29			ACGTTCGCAGGGT		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.4315C>T	12.37:g.117655927G>A	ENSP00000337459:p.Arg1439*	Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	43.0	NM_001204218		Nonsense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	47	13.579327	0.99750	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	.	.	.	4.57	0.385	0.16249	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.064	8.0152	0.30376	0.0748:0.0:0.3835:0.5417	.	.	.	.	X	1300;1405;1439	.	ENSP00000320758:R1405X	R	-	1	2	NOS1	116140310	1.000000	0.71417	0.449000	0.26957	0.723000	0.41478	4.243000	0.58721	-0.109000	0.12044	0.561000	0.74099	CGA	.		0.478	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
NOX4	50507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	89182674	89182674	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:89182674T>A	ENST00000263317.4	-	4	521	c.283A>T	c.(283-285)Agg>Tgg	p.R95W	NOX4_ENST00000528341.1_Missense_Mutation_p.R70W|NOX4_ENST00000534731.1_Missense_Mutation_p.R95W|NOX4_ENST00000343727.5_Missense_Mutation_p.R71W|NOX4_ENST00000527956.1_Missense_Mutation_p.R71W|NOX4_ENST00000532825.1_Missense_Mutation_p.R71W|NOX4_ENST00000542487.1_Missense_Mutation_p.R71W|NOX4_ENST00000413594.2_Missense_Mutation_p.R116W|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000525196.1_Missense_Mutation_p.R95W|NOX4_ENST00000424319.1_Missense_Mutation_p.R71W|NOX4_ENST00000535633.1_Missense_Mutation_p.R71W			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	95	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AACAATCTCCTGGTTCTCCTG	0.308																																					p.R95W		.											.	NOX4	515	0			c.A283T						.						82.0	78.0	80.0					11																	89182674		2201	4295	6496	SO:0001583	missense	50507	exon4			ATCTCCTGGTTCT	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.283A>T	11.37:g.89182674T>A	ENSP00000263317:p.Arg95Trp	Somatic	242.0	0.0		WXS	Illumina HiSeq	Phase_I	318.0	107.0	NM_001143836	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	T	19.40	3.819687	0.71028	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000528341;ENST00000413594	D;D;D;D;D;D;D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91	5.42	4.28	0.50868	Flavoprotein transmembrane component (1);	0.000000	0.64402	D	0.000001	D	0.95329	0.8484	M	0.79343	2.45	0.49389	D	0.999788	D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0	D;D;D;D;D	0.97110	0.989;1.0;0.996;0.998;0.999	D	0.94496	0.7705	9	.	.	.	-13.7512	11.7003	0.51567	0.0:0.0:0.1483:0.8517	.	71;70;95;95;95	E9PMY6;E9PPP2;E9PI95;Q9NPH5-6;Q9NPH5	.;.;.;.;NOX4_HUMAN	W	71;71;71;95;95;95;71;71;71;70;116	ENSP00000412446:R71W;ENSP00000440172:R71W;ENSP00000344747:R71W;ENSP00000436892:R95W;ENSP00000436716:R95W;ENSP00000263317:R95W;ENSP00000434924:R71W;ENSP00000433797:R71W;ENSP00000439373:R71W;ENSP00000436970:R70W;ENSP00000405705:R116W	.	R	-	1	2	NOX4	88822322	0.999000	0.42202	0.964000	0.40570	0.984000	0.73092	3.255000	0.51484	0.866000	0.35629	0.533000	0.62120	AGG	.		0.308	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
NPSR1	387129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34917718	34917718	+	Silent	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:34917718T>A	ENST00000359791.1	+	9	1184	c.1056T>A	c.(1054-1056)gcT>gcA	p.A352A	NPSR1_ENST00000531252.1_Silent_p.A341A	NM_207173.1	NP_997056.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	0						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	TCCAGGAGGCTGCGCTAATGC	0.527																																					p.A352A		.											.	NPSR1	94	0			c.T1056A						.						64.0	51.0	56.0					7																	34917718		2203	4300	6503	SO:0001819	synonymous_variant	387129	exon9			GGAGGCTGCGCTA	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000359791.1:c.1056T>A	7.37:g.34917718T>A		Somatic	232.0	0.0		WXS	Illumina HiSeq	Phase_I	251.0	70.0	NM_207173	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Silent	SNP	ENST00000359791.1	37	CCDS5443.1																																																																																			.		0.527	NPSR1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000216838.1	NM_207173	
NPTX1	4884	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	78450179	78450179	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:78450179T>A	ENST00000306773.4	-	1	225	c.68A>T	c.(67-69)cAg>cTg	p.Q23L	NPTX1_ENST00000575212.1_Intron	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	23					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			CCCGAAATCCTGGGCCCCGGC	0.796																																					p.Q23L		.											.	NPTX1	90	0			c.A68T						.						2.0	2.0	2.0					17																	78450179		1667	3278	4945	SO:0001583	missense	4884	exon1			AAATCCTGGGCCC	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.68A>T	17.37:g.78450179T>A	ENSP00000307549:p.Gln23Leu	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	13.0	NM_002522	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.344305	0.61073	.	.	ENSG00000171246	ENST00000306773	T	0.10668	2.85	2.47	2.47	0.30058	.	0.000000	0.85682	U	0.000000	T	0.12178	0.0296	M	0.64997	1.995	0.53688	D	0.999977	P	0.37781	0.608	B	0.36666	0.23	T	0.04767	-1.0928	10	0.72032	D	0.01	.	9.2929	0.37797	0.0:0.0:0.0:1.0	.	23	Q15818	NPTX1_HUMAN	L	23	ENSP00000307549:Q23L	ENSP00000307549:Q23L	Q	-	2	0	NPTX1	76064774	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	1.772000	0.38552	1.003000	0.39130	0.254000	0.18369	CAG	.		0.796	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
NUP188	23511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131763862	131763862	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr9:131763862G>A	ENST00000372577.2	+	35	3919	c.3898G>A	c.(3898-3900)Ggt>Agt	p.G1300S	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1300					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						AGACGAGGATGGTGACTCCTG	0.582																																					p.G1300S		.											.	NUP188	207	0			c.G3898A						.						69.0	60.0	63.0					9																	131763862		2203	4300	6503	SO:0001583	missense	23511	exon35			GAGGATGGTGACT	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3898G>A	9.37:g.131763862G>A	ENSP00000361658:p.Gly1300Ser	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	14.0	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324140	0.81580	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.70164	-0.46	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.81192	0.4771	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.87578	0.874;0.998	T	0.79813	-0.1645	10	0.38643	T	0.18	-13.5486	18.1417	0.89642	0.0:0.0:1.0:0.0	.	633;1300	E9PET9;Q5SRE5	.;NU188_HUMAN	S	1189;1300	ENSP00000361658:G1300S	ENSP00000349125:G1189S	G	+	1	0	NUP188	130803683	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.465000	0.97660	2.537000	0.85549	0.462000	0.41574	GGT	.		0.582	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
NUP98	4928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	3721964	3721964	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:3721964T>A	ENST00000324932.7	-	24	4038	c.3618A>T	c.(3616-3618)ttA>ttT	p.L1206F	NUP98_ENST00000359171.4_Missense_Mutation_p.L1206F|NUP98_ENST00000355260.3_Missense_Mutation_p.L1206F	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1223					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TGCTGTGTTTTAATTTGAGCT	0.413			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.L1206F		.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	703	0			c.A3618T						.						181.0	170.0	174.0					11																	3721964		2201	4298	6499	SO:0001583	missense	4928	exon24			GTGTTTTAATTTG	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.3618A>T	11.37:g.3721964T>A	ENSP00000316032:p.Leu1206Phe	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	34.0	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	37	CCDS7746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.47|18.47	3.631798|3.631798	0.67015|0.67015	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000429801|ENST00000324932;ENST00000359171;ENST00000355260	.|.	.|.	.|.	5.4|5.4	-1.47|-1.47	0.08772|0.08772	.|.	.|0.000000	.|0.64402	.|D	.|0.000004	.|T	.|0.56673	.|0.2001	M|M	0.63843|0.63843	1.955|1.955	0.34501|0.34501	D|D	0.706095|0.706095	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.999;0.999	.|T	.|0.60177	.|-0.7314	.|9	.|0.30078	.|T	.|0.28	-7.8161|-7.8161	1.5432|1.5432	0.02559|0.02559	0.1476:0.3349:0.2707:0.2468|0.1476:0.3349:0.2707:0.2468	.|.	.|1206;1206;1120	.|P52948-2;P52948-5;P52948-6	.|.;.;.	X|F	159|1206	.|.	.|ENSP00000316032:L1206F	K|L	-|-	1|3	0|2	NUP98|NUP98	3678540|3678540	0.796000|0.796000	0.28864|0.28864	0.999000|0.999000	0.59377|0.59377	0.972000|0.972000	0.66771|0.66771	-0.339000|-0.339000	0.07832|0.07832	0.038000|0.038000	0.15604|0.15604	-0.263000|-0.263000	0.10527|0.10527	AAA|TTA	.		0.413	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
OR51D1	390038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4661505	4661505	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:4661505T>A	ENST00000357605.2	+	1	561	c.485T>A	c.(484-486)cTg>cAg	p.L162Q		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L162P(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTATCTGCCCTGACCAGGGGG	0.527																																					p.L162Q		.											.	OR51D1	68	1	Substitution - Missense(1)	lung(1)	c.T485A						.						220.0	191.0	201.0					11																	4661505		2201	4298	6499	SO:0001583	missense	390038	exon1			CTGCCCTGACCAG	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.485T>A	11.37:g.4661505T>A	ENSP00000350222:p.Leu162Gln	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	24.0	NM_001004751	B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	37	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	T	12.29	1.893582	0.33442	.	.	ENSG00000197428	ENST00000357605	T	0.38887	1.11	4.4	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35772	N	0.002987	T	0.64649	0.2617	M	0.81614	2.55	0.18873	N	0.999987	D	0.76494	0.999	D	0.77557	0.99	T	0.59473	-0.7448	10	0.87932	D	0	.	12.9235	0.58245	0.0:0.0:0.0:1.0	.	162	Q8NGF3	O51D1_HUMAN	Q	162	ENSP00000350222:L162Q	ENSP00000350222:L162Q	L	+	2	0	OR51D1	4618081	0.135000	0.22499	0.003000	0.11579	0.002000	0.02628	3.066000	0.50002	1.967000	0.57214	0.456000	0.33151	CTG	.		0.527	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751	
OR51F1	256892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4790465	4790465	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:4790465A>C	ENST00000380383.1	-	1	703	c.704T>G	c.(703-705)cTc>cGc	p.L235R	OR51F1_ENST00000343430.3_Missense_Mutation_p.L228R|MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron			A6NGY5	O51F1_HUMAN	olfactory receptor, family 51, subfamily F, member 1	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGCAATTCTGAGGACAGAGTG	0.463																																					p.L228R		.											.	OR51F1	70	0			c.T683G						.						121.0	117.0	118.0					11																	4790465		2201	4298	6499	SO:0001583	missense	256892	exon1			ATTCTGAGGACAG	BK004771	CCDS31359.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188069	ENSG00000188069		"""GPCR / Class A : Olfactory receptors"""	15196	protein-coding gene	gene with protein product				OR51F1P			Standard	NM_001004752		Approved		uc010qyl.2	A6NGY5	OTTHUMG00000066503	ENST00000380383.1:c.704T>G	11.37:g.4790465A>C	ENSP00000369744:p.Leu235Arg	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	56.0	NM_001004752		Missense_Mutation	SNP	ENST00000380383.1	37		.	.	.	.	.	.	.	.	.	.	A	11.25	1.583107	0.28268	.	.	ENSG00000188069	ENST00000343430;ENST00000380383	T;T	0.00316	8.13;8.13	5.24	5.24	0.73138	GPCR, rhodopsin-like superfamily (1);	0.294146	0.23065	N	0.052334	T	0.00936	0.0031	M	0.92604	3.325	0.09310	N	0.999992	D	0.76494	0.999	D	0.72338	0.977	T	0.25257	-1.0137	10	0.87932	D	0	.	14.0937	0.65006	1.0:0.0:0.0:0.0	.	235	A6NGY5	O51F1_HUMAN	R	228;235	ENSP00000345163:L228R;ENSP00000369744:L235R	ENSP00000345163:L228R	L	-	2	0	OR51F1	4747041	0.460000	0.25776	0.039000	0.18376	0.073000	0.16967	5.344000	0.65981	2.202000	0.70862	0.533000	0.62120	CTC	.		0.463	OR51F1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001004752	
OR5B12	390191	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58207528	58207528	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:58207528A>T	ENST00000302572.2	-	1	118	c.97T>A	c.(97-99)Tac>Aac	p.Y33N		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTGATGAGGTAGATGAAAAGG	0.478																																					p.Y33N		.											.	OR5B12	68	0			c.T97A						.						89.0	101.0	97.0					11																	58207528		2201	4295	6496	SO:0001583	missense	390191	exon1			TGAGGTAGATGAA	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.97T>A	11.37:g.58207528A>T	ENSP00000306657:p.Tyr33Asn	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	40.0	NM_001004733	B2RNL2|Q6IEV5	Missense_Mutation	SNP	ENST00000302572.2	37	CCDS31551.1	.	.	.	.	.	.	.	.	.	.	A	11.22	1.573065	0.28092	.	.	ENSG00000172362	ENST00000302572	T	0.04654	3.58	4.74	4.74	0.60224	.	0.000000	0.39687	N	0.001298	T	0.36276	0.0961	H	0.98559	4.265	0.09310	N	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.54944	-0.8217	10	0.87932	D	0	-6.4909	13.8357	0.63408	1.0:0.0:0.0:0.0	.	33	Q96R08	OR5BC_HUMAN	N	33	ENSP00000306657:Y33N	ENSP00000306657:Y33N	Y	-	1	0	OR5B12	57964104	1.000000	0.71417	0.336000	0.25522	0.015000	0.08874	5.916000	0.69981	2.118000	0.64928	0.459000	0.35465	TAC	.		0.478	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733	
OR5H1	26341	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	97851772	97851772	+	Silent	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:97851772G>T	ENST00000354565.2	+	1	231	c.231G>T	c.(229-231)gtG>gtT	p.V77V	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						CATCCACAGTGACCCCAAAGA	0.408																																					p.V77V		.											.	OR5H1	136	0			c.G231T						.						77.0	78.0	77.0					3																	97851772		2203	4296	6499	SO:0001819	synonymous_variant	26341	exon1			CACAGTGACCCCA	X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.231G>T	3.37:g.97851772G>T		Somatic	963.0	1.0		WXS	Illumina HiSeq	Phase_I	701.0	250.0	NM_001005338		Silent	SNP	ENST00000354565.2	37	CCDS33797.1																																																																																			.		0.408	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359100.2	NM_001005338	
OR6M1	390261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123676307	123676307	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:123676307T>A	ENST00000309154.2	-	1	788	c.751A>T	c.(751-753)Agc>Tgc	p.S251C		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		AAGATGTTGCTCCCGTGGGCA	0.517																																					p.S251C		.											.	OR6M1	70	0			c.A751T						.						102.0	89.0	93.0					11																	123676307		2202	4299	6501	SO:0001583	missense	390261	exon1			TGTTGCTCCCGTG	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.751A>T	11.37:g.123676307T>A	ENSP00000311038:p.Ser251Cys	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	34.0	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	37	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	T	12.67	2.007547	0.35415	.	.	ENSG00000196099	ENST00000309154	T	0.00183	8.6	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	U	0.001316	T	0.00300	0.0009	L	0.54863	1.705	0.09310	N	1	P	0.45126	0.851	P	0.52823	0.71	T	0.45308	-0.9270	10	0.87932	D	0	.	9.9694	0.41745	0.0:0.0:0.0:1.0	.	251	Q8NGM8	OR6M1_HUMAN	C	251	ENSP00000311038:S251C	ENSP00000311038:S251C	S	-	1	0	OR6M1	123181517	0.000000	0.05858	0.842000	0.33263	0.522000	0.34438	-0.608000	0.05641	1.432000	0.47375	0.533000	0.62120	AGC	.		0.517	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
OR8S1	341568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48919696	48919696	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:48919696A>G	ENST00000310194.1	+	1	282	c.282A>G	c.(280-282)gtA>gtG	p.V94V	OR8S1_ENST00000551654.1_Intron	NM_001005203.2	NP_001005203.2	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|skin(4)	22						CCATTTCAGTAGAGGGCTGCC	0.522																																					p.V94V		.											.	OR8S1	69	0			c.A282G						.						103.0	99.0	100.0					12																	48919696		2203	4300	6503	SO:0001819	synonymous_variant	341568	exon1			TTCAGTAGAGGGC		CCDS31789.1	12q13.2	2012-08-09				ENSG00000197376		"""GPCR / Class A : Olfactory receptors"""	19628	protein-coding gene	gene with protein product							Standard	NM_001005203		Approved		uc010slu.2	Q8NH09		ENST00000310194.1:c.282A>G	12.37:g.48919696A>G		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	29.0	NM_001005203		Silent	SNP	ENST00000310194.1	37	CCDS31789.1																																																																																			.		0.522	OR8S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406881.1		
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30723268	30723268	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:30723268T>A	ENST00000361762.2	+	1	1232	c.224T>A	c.(223-225)cTg>cAg	p.L75Q	PCDH7_ENST00000543491.1_Missense_Mutation_p.L75Q	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	75	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TCCGAGTACCTGAAGATCGAC	0.632																																					p.L75Q		.											.	PCDH7	229	0			c.T224A						.						67.0	57.0	60.0					4																	30723268		2203	4300	6503	SO:0001583	missense	5099	exon1			AGTACCTGAAGAT	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.224T>A	4.37:g.30723268T>A	ENSP00000355243:p.Leu75Gln	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	15.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.677695	0.47886	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.40476	1.03;1.03	4.87	3.6	0.41247	Cadherin, N-terminal (1);Cadherin (3);	.	.	.	.	T	0.63414	0.2509	M	0.82433	2.59	0.42717	D	0.993668	D;D;D	0.71674	0.992;0.998;0.994	D;D;D	0.73708	0.967;0.967;0.981	T	0.68819	-0.5308	9	0.87932	D	0	.	10.154	0.42812	0.1494:0.0:0.0:0.8506	.	75;75;75	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	Q	75	ENSP00000355243:L75Q;ENSP00000441802:L75Q	ENSP00000330302:L75Q	L	+	2	0	PCDH7	30332366	1.000000	0.71417	1.000000	0.80357	0.506000	0.33950	5.735000	0.68587	1.828000	0.53243	0.254000	0.18369	CTG	.		0.632	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
PABPC4L	132430	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	135121211	135121211	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:135121211C>A	ENST00000421491.3	-	2	1220	c.964G>T	c.(964-966)Gtt>Ttt	p.V322F	PABPC4L_ENST00000529122.2_Missense_Mutation_p.V380F			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	322	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						ATTACCTTAACTCTGCTAATT	0.438																																					p.V380F		.											.	.	.	0			c.G1138T						.						160.0	138.0	145.0					4																	135121211		692	1591	2283	SO:0001583	missense	132430	exon2			CCTTAACTCTGCT	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.964G>T	4.37:g.135121211C>A	ENSP00000463233:p.Val322Phe	Somatic	241.0	1.0		WXS	Illumina HiSeq	Phase_I	249.0	66.0	NM_001114734		Missense_Mutation	SNP	ENST00000421491.3	37																																																																																				.		0.438	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
PCDHGB2	56103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140740665	140740665	+	Silent	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:140740665A>C	ENST00000522605.1	+	1	963	c.963A>C	c.(961-963)gcA>gcC	p.A321A	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	321	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTATCGAAGCAAAAGATCCTG	0.378																																					p.A321A		.											.	PCDHGB2	33	0			c.A963C						.						63.0	61.0	62.0					5																	140740665		1975	4158	6133	SO:0001819	synonymous_variant	56103	exon1			CGAAGCAAAAGAT	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.963A>C	5.37:g.140740665A>C		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	39.0	NM_018923	Q3MIJ3|Q9UN65	Silent	SNP	ENST00000522605.1	37	CCDS54924.1																																																																																			.		0.378	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
PCDHGA8	9708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140773878	140773878	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:140773878C>T	ENST00000398604.2	+	1	1498	c.1498C>T	c.(1498-1500)Ccc>Tcc	p.P500S	PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	500	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGGGGGCGCCCCTGTCCTC	0.567																																					p.P500S		.											.	.	.	0			c.C1498T						.						46.0	53.0	50.0					5																	140773878		2164	4282	6446	SO:0001583	missense	9708	exon1			GGGGCGCCCCTGT	AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1498C>T	5.37:g.140773878C>T	ENSP00000381605:p.Pro500Ser	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	88.0	NM_014004	A7MCZ4|O15039	Missense_Mutation	SNP	ENST00000398604.2	37	CCDS47291.1	.	.	.	.	.	.	.	.	.	.	.	2.470	-0.322220	0.05350	.	.	ENSG00000253767	ENST00000398604	T	0.62941	-0.01	4.33	3.46	0.39613	Cadherin (4);Cadherin-like (1);	0.000000	0.31221	U	0.008030	T	0.54902	0.1887	L	0.56199	1.76	0.23126	N	0.998255	B;B	0.28400	0.107;0.21	B;B	0.34180	0.177;0.169	T	0.49781	-0.8903	10	0.41790	T	0.15	.	6.3579	0.21412	0.0:0.6755:0.1526:0.1719	.	500;500	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	S	500	ENSP00000381605:P500S	ENSP00000381605:P500S	P	+	1	0	PCDHGA8	140754062	0.177000	0.23109	0.019000	0.16419	0.008000	0.06430	0.914000	0.28624	1.139000	0.42245	-0.157000	0.13467	CCC	.		0.567	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376972.1	NM_032088	
PDE11A	50940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	178494226	178494226	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:178494226T>A	ENST00000286063.6	-	20	3028	c.2711A>T	c.(2710-2712)aAg>aTg	p.K904M	PDE11A_ENST00000409504.1_Missense_Mutation_p.K546M|PDE11A_ENST00000449286.2_Missense_Mutation_p.K546M|PDE11A_ENST00000358450.4_Missense_Mutation_p.K654M|PDE11A_ENST00000389683.3_Missense_Mutation_p.K460M|PDE11A_ENST00000450799.2_Missense_Mutation_p.K95M	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	904	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CTCTTCCCACTTACTTCTGTT	0.478									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.K904M		.											.	PDE11A	93	0			c.A2711T						.						290.0	244.0	260.0					2																	178494226		2203	4300	6503	SO:0001583	missense	50940	exon20	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	TCCCACTTACTTC	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.2711A>T	2.37:g.178494226T>A	ENSP00000286063:p.Lys904Met	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	243.0	76.0	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	ENST00000286063.6	37	CCDS33334.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.1|25.1	4.599654|4.599654	0.87055|0.87055	.|.	.|.	ENSG00000128655|ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000450799;ENST00000409504;ENST00000389683;ENST00000449286|ENST00000436700	T;T;T;T;T;T|.	0.77098|.	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07|.	5.62|5.62	5.62|5.62	0.85841|0.85841	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);|.	0.046341|.	0.85682|.	D|.	0.000000|.	T|.	0.48857|.	0.1523|.	N|N	0.14661|0.14661	0.345|0.345	0.58432|0.58432	D|D	0.999995|0.999995	D;D|.	0.64830|.	0.994;0.988|.	P;P|.	0.58873|.	0.847;0.635|.	T|.	0.46414|.	-0.9193|.	10|.	0.72032|.	D|.	0.01|.	.|.	15.8132|15.8132	0.78581|0.78581	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	654;904|.	Q9HCR9-2;Q9HCR9|.	.;PDE11_HUMAN|.	M|Y	904;654;95;546;460;546|106	ENSP00000286063:K904M;ENSP00000351232:K654M;ENSP00000387964:K95M;ENSP00000386539:K546M;ENSP00000374333:K460M;ENSP00000390599:K546M|.	ENSP00000286063:K904M|.	K|X	-|-	2|3	0|2	PDE11A|PDE11A	178202472|178202472	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	5.722000|5.722000	0.68485|0.68485	2.144000|2.144000	0.66660|0.66660	0.482000|0.482000	0.46254|0.46254	AAG|TAA	.		0.478	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
PDZRN3	23024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	73432795	73432795	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:73432795G>T	ENST00000263666.4	-	10	3036	c.2922C>A	c.(2920-2922)agC>agA	p.S974R	PDZRN3_ENST00000462146.2_Missense_Mutation_p.S631R|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Missense_Mutation_p.S696R|PDZRN3_ENST00000479530.1_Missense_Mutation_p.S691R|PDZRN3_ENST00000466780.1_Missense_Mutation_p.S631R	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	974					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TCTCCTCCTTGCTCCAGTAGC	0.642																																					p.S974R		.											.	PDZRN3	232	0			c.C2922A						.						105.0	101.0	102.0					3																	73432795		2203	4300	6503	SO:0001583	missense	23024	exon10			CTCCTTGCTCCAG	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2922C>A	3.37:g.73432795G>T	ENSP00000263666:p.Ser974Arg	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	16.0	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.26|18.26|18.26	3.584098|3.584098|3.584098	0.65992|0.65992|0.65992	.|.|.	.|.|.	ENSG00000121440|ENSG00000121440|ENSG00000121440	ENST00000494559|ENST00000416926|ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530	.|.|T;T;T;T;T	.|.|0.75589	.|.|-0.95;-0.95;-0.95;-0.95;-0.95	5.53|5.53|5.53	4.63|4.63|4.63	0.57726|0.57726|0.57726	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	D|D|D	0.83972|0.83972|0.83972	0.5370|0.5370|0.5370	M|M|M	0.75777|0.75777|0.75777	2.31|2.31|2.31	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D	.|.|0.89917	.|.|0.999;1.0;0.998;0.999	.|.|D;D;D;D	.|.|0.85130	.|.|0.991;0.997;0.969;0.993	D|D|D	0.84852|0.84852|0.84852	0.0814|0.0814|0.0814	5|6|10	.|0.59425|0.87932	.|D|D	.|0.04|0	.|.|.	9.7339|9.7339|9.7339	0.40376|0.40376|0.40376	0.0747:0.0:0.7829:0.1423|0.0747:0.0:0.7829:0.1423|0.0747:0.0:0.7829:0.1423	.|.|.	.|.|696;691;691;974	.|.|F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.|.|.;.;.;PZRN3_HUMAN	E|K|R	290|694|974;696;631;631;691	.|.|ENSP00000263666:S974R;ENSP00000442026:S696R;ENSP00000418168:S631R;ENSP00000418484:S631R;ENSP00000418624:S691R	.|ENSP00000392657:Q694K|ENSP00000263666:S974R	A|Q|S	-|-|-	2|1|3	0|0|2	PDZRN3|PDZRN3|PDZRN3	73515485|73515485|73515485	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.984000|0.984000|0.984000	0.73092|0.73092|0.73092	7.519000|7.519000|7.519000	0.81809|0.81809|0.81809	1.254000|1.254000|1.254000	0.44035|0.44035|0.44035	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	GCA|CAA|AGC	.		0.642	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
PDZRN3	23024	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	73673351	73673351	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:73673351A>C	ENST00000263666.4	-	1	740	c.626T>G	c.(625-627)cTg>cGg	p.L209R	PDZRN3_ENST00000308537.4_Missense_Mutation_p.L209R|PDZRN3-AS1_ENST00000608304.1_RNA|PDZRN3-AS1_ENST00000478988.1_RNA|PDZRN3-AS1_ENST00000608743.1_RNA	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	209					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GGTCATCTGCAGCTCAAGCTG	0.701																																					p.L209R		.											.	PDZRN3	232	0			c.T626G						.						4.0	4.0	4.0					3																	73673351		1905	3829	5734	SO:0001583	missense	23024	exon1			ATCTGCAGCTCAA	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.626T>G	3.37:g.73673351A>C	ENSP00000263666:p.Leu209Arg	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	7.0	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.549084	0.86127	.	.	ENSG00000121440	ENST00000263666;ENST00000416926;ENST00000308537	T;T	0.27720	1.65;1.65	5.04	5.04	0.67666	TRAF-like (1);	0.634448	0.14989	N	0.286781	T	0.51686	0.1689	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.38779	-0.9645	10	0.33141	T	0.24	.	14.7898	0.69830	1.0:0.0:0.0:0.0	.	209	Q9UPQ7	PZRN3_HUMAN	R	209	ENSP00000263666:L209R;ENSP00000308831:L209R	ENSP00000263666:L209R	L	-	2	0	PDZRN3	73756041	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	6.816000	0.75247	1.870000	0.54199	0.477000	0.44152	CTG	.		0.701	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
PEX2	5828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	77895734	77895734	+	Silent	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:77895734A>T	ENST00000419564.2	-	4	1145	c.681T>A	c.(679-681)ctT>ctA	p.L227L	PEX2_ENST00000520103.1_Silent_p.L227L|PEX2_ENST00000522527.1_Silent_p.L227L|PEX2_ENST00000357039.4_Silent_p.L227L	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	227					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						GTGCACCAGTAAGAGGAATAC	0.448																																					p.L227L		.											.	PEX2	91	0			c.T681A						.						104.0	96.0	99.0					8																	77895734		2203	4300	6503	SO:0001819	synonymous_variant	5828	exon4			ACCAGTAAGAGGA	M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.681T>A	8.37:g.77895734A>T		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	23.0	NM_000318	Q567S6|Q9BW41	Silent	SNP	ENST00000419564.2	37	CCDS6221.1																																																																																			.		0.448	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318	
PEX2	5828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	77895736	77895737	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:77895736_77895737GA>AT	ENST00000419564.2	-	4	1142_1143	c.678_679TC>AT	c.(676-681)ccTCtt>ccATtt	p.L227F	PEX2_ENST00000520103.1_Missense_Mutation_p.L227F|PEX2_ENST00000522527.1_Missense_Mutation_p.L227F|PEX2_ENST00000357039.4_Missense_Mutation_p.L227F	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	227					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						GCACCAGTAAGAGGAATACACC	0.45																																					p.L227F|p.P226P		.											.	PEX2	91	0			c.C679T|c.T678A						.																																			SO:0001583	missense	5828	exon4			CAGTAAGAGGAAT|AGTAAGAGGAATA	M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.678_679delinsAT	8.37:g.77895736_77895737delinsAT	ENSP00000400984:p.Leu227Phe	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0|65.0	22.0|23.0	NM_000318	Q567S6|Q9BW41	Missense_Mutation|Silent	SNP	ENST00000419564.2	37	CCDS6221.1																																																																																			.		0.450	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379122.1	NM_000318	
PFKFB1	5207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54982655	54982655	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chrX:54982655A>C	ENST00000375006.3	-	7	639	c.569T>G	c.(568-570)cTg>cGg	p.L190R	PFKFB1_ENST00000545676.1_Missense_Mutation_p.L125R|PFKFB1_ENST00000374992.2_Intron	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	190	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						AAAGTCTTCCAGAACCTTTTC	0.483																																					p.L190R		.											.	PFKFB1	131	0			c.T569G						.						97.0	83.0	87.0					X																	54982655		2203	4300	6503	SO:0001583	missense	5207	exon7			TCTTCCAGAACCT		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.569T>G	X.37:g.54982655A>C	ENSP00000364145:p.Leu190Arg	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	9.0	NM_002625	B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	37	CCDS14364.1	.	.	.	.	.	.	.	.	.	.	A	14.00	2.405529	0.42715	.	.	ENSG00000158571	ENST00000375006;ENST00000545676	.	.	.	4.65	4.65	0.58169	6-phosphofructo-2-kinase (1);	0.197023	0.42964	D	0.000636	T	0.61726	0.2370	M	0.75150	2.29	0.80722	D	1	B;B	0.29115	0.233;0.06	B;B	0.28849	0.095;0.071	T	0.62369	-0.6869	9	0.38643	T	0.18	-8.3604	12.6988	0.57020	1.0:0.0:0.0:0.0	.	125;190	B4DUN5;P16118	.;F261_HUMAN	R	190;125	.	ENSP00000364145:L190R	L	-	2	0	PFKFB1	54999380	0.998000	0.40836	0.983000	0.44433	0.978000	0.69477	7.304000	0.78882	1.800000	0.52685	0.486000	0.48141	CTG	.		0.483	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1		
PFKFB3	5209	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	6257273	6257273	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr10:6257273G>T	ENST00000379775.4	+	3	622	c.292G>T	c.(292-294)Gtc>Ttc	p.V98F	PFKFB3_ENST00000360521.2_Missense_Mutation_p.V98F|PFKFB3_ENST00000379789.4_Missense_Mutation_p.V78F|PFKFB3_ENST00000317350.4_Missense_Mutation_p.V98F|PFKFB3_ENST00000536985.1_Missense_Mutation_p.V78F|PFKFB3_ENST00000540253.1_Missense_Mutation_p.V112F|PFKFB3_ENST00000379782.3_Missense_Mutation_p.V98F|PFKFB3_ENST00000379785.1_Missense_Mutation_p.V98F	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	98	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						AGCCATGAAAGTCCGGAAGTA	0.637																																					p.V98F		.											.	PFKFB3	117	0			c.G292T						.						43.0	35.0	38.0					10																	6257273		2203	4300	6503	SO:0001583	missense	5209	exon3			ATGAAAGTCCGGA		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.292G>T	10.37:g.6257273G>T	ENSP00000369100:p.Val98Phe	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	5.0	NM_004566	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	37	CCDS7078.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516967	0.85495	.	.	ENSG00000170525	ENST00000536985;ENST00000379789;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	.	.	.	4.91	4.91	0.64330	6-phosphofructo-2-kinase (1);	0.118198	0.64402	D	0.000018	T	0.62744	0.2453	L	0.36672	1.1	0.58432	D	0.999995	D;D;P;D	0.57257	0.972;0.974;0.592;0.979	P;P;B;P	0.61800	0.894;0.557;0.43;0.684	T	0.64993	-0.6276	9	0.62326	D	0.03	-12.4316	11.5843	0.50910	0.0823:0.0:0.9177:0.0	.	112;98;98;78	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	F	78;78;112;98;98;98;98;98;98	.	ENSP00000369105:V98F	V	+	1	0	PFKFB3	6297279	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	6.033000	0.70925	2.280000	0.76307	0.467000	0.42956	GTC	.		0.637	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1		
PGR	5241	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	100999049	100999049	+	Silent	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:100999049T>C	ENST00000325455.5	-	1	2206	c.753A>G	c.(751-753)ggA>ggG	p.G251G	PGR_ENST00000534013.1_Intron|PGR_ENST00000263463.5_Silent_p.G251G	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	251	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CCGCGGCTCCTCCTCCAGCCG	0.711																																					p.G251G	Pancreas(124;2271 2354 21954 22882)	.											.	PGR	652	0			c.A753G						.						4.0	6.0	6.0					11																	100999049		1965	4022	5987	SO:0001819	synonymous_variant	5241	exon1			GGCTCCTCCTCCA	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.753A>G	11.37:g.100999049T>C		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	7.0	NM_000926	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Silent	SNP	ENST00000325455.5	37	CCDS8310.1																																																																																			.		0.711	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
PHIP	55023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	79688417	79688417	+	Silent	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:79688417C>G	ENST00000275034.4	-	24	2948	c.2781G>C	c.(2779-2781)gtG>gtC	p.V927V	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	927	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TTAGTTCTCCCACAGCCAATC	0.323																																					p.V927V		.											.	PHIP	579	0			c.G2781C						.						71.0	68.0	69.0					6																	79688417		2203	4300	6503	SO:0001819	synonymous_variant	55023	exon24			TTCTCCCACAGCC	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2781G>C	6.37:g.79688417C>G		Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	47.0	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	ENST00000275034.4	37	CCDS4987.1																																																																																			.		0.323	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
PIP5K1C	23396	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3648626	3648626	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:3648626T>A	ENST00000335312.3	-	9	1296	c.1208A>T	c.(1207-1209)tAc>tTc	p.Y403F	PIP5K1C_ENST00000589578.1_Missense_Mutation_p.Y403F|PIP5K1C_ENST00000537021.1_Missense_Mutation_p.Y403F|PIP5K1C_ENST00000587482.1_5'Flank|PIP5K1C_ENST00000539785.1_Missense_Mutation_p.Y403F	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	403	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CACCCACCTGTAGGACTGCAG	0.711																																					p.Y403F	Esophageal Squamous(135;99 1744 12852 27186 39851)	.											.	PIP5K1C	267	0			c.A1208T						.						41.0	42.0	41.0					19																	3648626		2203	4299	6502	SO:0001583	missense	23396	exon9			CACCTGTAGGACT	AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.1208A>T	19.37:g.3648626T>A	ENSP00000335333:p.Tyr403Phe	Somatic	176.0	1.0		WXS	Illumina HiSeq	Phase_I	104.0	48.0	NM_001195733	B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	ENST00000335312.3	37	CCDS32872.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.425894	0.62733	.	.	ENSG00000186111	ENST00000335312;ENST00000539785;ENST00000537021	T;T;T	0.56275	0.47;0.47;0.47	4.04	4.04	0.47022	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.60170	0.2248	M	0.81179	2.53	0.54753	D	0.999983	P;P	0.48764	0.915;0.673	P;B	0.47015	0.534;0.361	T	0.67300	-0.5705	10	0.62326	D	0.03	.	12.1375	0.53979	0.0:0.0:0.0:1.0	.	403;403	O60331-3;O60331	.;PI51C_HUMAN	F	403	ENSP00000335333:Y403F;ENSP00000445992:Y403F;ENSP00000444779:Y403F	ENSP00000335333:Y403F	Y	-	2	0	PIP5K1C	3599626	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	7.954000	0.87848	1.464000	0.47987	0.247000	0.18012	TAC	.		0.711	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453432.2	NM_012398	
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	47886593	47886593	+	Silent	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:47886593T>A	ENST00000289672.2	-	32	5087	c.5037A>T	c.(5035-5037)gcA>gcT	p.A1679A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1679					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TATAGTTCACTGCCTTAGCTA	0.403																																					p.A1679A		.											.	PKD1L1	145	0			c.A5037T						.						109.0	103.0	105.0					7																	47886593		2203	4300	6503	SO:0001819	synonymous_variant	168507	exon32			GTTCACTGCCTTA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5037A>T	7.37:g.47886593T>A		Somatic	313.0	0.0		WXS	Illumina HiSeq	Phase_I	327.0	114.0	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																			.		0.403	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51923279	51923279	+	Missense_Mutation	SNP	A	A	T	rs201989004		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:51923279A>T	ENST00000371117.3	-	16	1629	c.1354T>A	c.(1354-1356)Tac>Aac	p.Y452N	PKHD1_ENST00000340994.4_Missense_Mutation_p.Y452N	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	452					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCCAGGTAGTACATGGCTCCA	0.557																																					p.Y452N		.											.	PKHD1	603	0			c.T1354A						.						203.0	175.0	184.0					6																	51923279		2203	4300	6503	SO:0001583	missense	5314	exon16			GGTAGTACATGGC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1354T>A	6.37:g.51923279A>T	ENSP00000360158:p.Tyr452Asn	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	37.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445970	0.84101	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.92545	-2.79;-3.06	5.94	5.94	0.96194	.	0.086604	0.50627	D	0.000120	D	0.95683	0.8596	M	0.83223	2.63	0.36492	D	0.868481	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.97014	0.9738	10	0.87932	D	0	.	15.5809	0.76439	1.0:0.0:0.0:0.0	.	452;452	P08F94-2;P08F94	.;PKHD1_HUMAN	N	452	ENSP00000360158:Y452N;ENSP00000341097:Y452N	ENSP00000341097:Y452N	Y	-	1	0	PKHD1	52031238	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.186000	0.72026	2.275000	0.75901	0.528000	0.53228	TAC	A|0.999;G|0.000		0.557	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110471959	110471959	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:110471959A>C	ENST00000378402.5	+	47	7244	c.7140A>C	c.(7138-7140)gaA>gaC	p.E2380D		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2380					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTCTGTTTGAAGCAAGAGCAG	0.373										HNSCC(38;0.096)																											p.E2380D		.											.	PKHD1L1	145	0			c.A7140C						.						72.0	67.0	69.0					8																	110471959		1840	4083	5923	SO:0001583	missense	93035	exon47			GTTTGAAGCAAGA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.7140A>C	8.37:g.110471959A>C	ENSP00000367655:p.Glu2380Asp	Somatic	278.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	83.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.245453	0.59103	.	.	ENSG00000205038	ENST00000378402	D	0.93604	-3.25	5.24	1.35	0.21983	.	0.123125	0.53938	N	0.000058	D	0.82884	0.5134	N	0.12527	0.23	0.26600	N	0.973041	B	0.24258	0.1	B	0.22880	0.042	T	0.70605	-0.4826	10	0.28530	T	0.3	.	6.9475	0.24526	0.4623:0.4548:0.0829:0.0	.	2380	Q86WI1	PKHL1_HUMAN	D	2380	ENSP00000367655:E2380D	ENSP00000367655:E2380D	E	+	3	2	PKHD1L1	110541135	0.997000	0.39634	0.998000	0.56505	0.986000	0.74619	0.462000	0.21956	0.000000	0.14550	0.254000	0.18369	GAA	.		0.373	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLA2G4E	123745	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	15	42342807	42342807	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:42342807C>G	ENST00000399518.3	-	1	581	c.95G>C	c.(94-96)gGa>gCa	p.G32A		NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	0					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		GAAACTTCTTCCTGACCTGCT	0.552																																					p.G32A		.											.	.	.	0			c.G95C						.																																			SO:0001583	missense	123745	exon1			CTTCTTCCTGACC		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.95G>C	15.37:g.42342807C>G	ENSP00000382434:p.Gly32Ala	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	44.0	NM_001206670	Q6ZSC0	Missense_Mutation	SNP	ENST00000399518.3	37	CCDS55962.1	.	.	.	.	.	.	.	.	.	.	C	3.860	-0.030140	0.07543	.	.	ENSG00000188089	ENST00000399518	T	0.01665	4.7	4.7	1.3	0.21679	.	.	.	.	.	T	0.01092	0.0036	N	0.19112	0.55	0.09310	N	0.999996	.	.	.	.	.	.	T	0.47459	-0.9116	7	0.07990	T	0.79	1.7908	4.1253	0.10125	0.0:0.5693:0.1831:0.2476	.	.	.	.	A	32	ENSP00000382434:G32A	ENSP00000382434:G32A	G	-	2	0	PLA2G4E	40130099	0.055000	0.20627	0.018000	0.16275	0.341000	0.28922	0.136000	0.15974	0.144000	0.18951	0.561000	0.74099	GGA	.		0.552	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
PLD5	200150	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	242264076	242264076	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:242264076A>G	ENST00000536534.2	-	9	1489	c.1248T>C	c.(1246-1248)ttT>ttC	p.F416F	PLD5_ENST00000442594.2_Silent_p.F324F|PLD5_ENST00000427495.1_Silent_p.F354F			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	416						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TTTCCAGATCAAAAAATTTCT	0.378																																					p.F416F		.											.	PLD5	96	0			c.T1248C						.						80.0	77.0	78.0					1																	242264076		2203	4300	6503	SO:0001819	synonymous_variant	200150	exon10			CAGATCAAAAAAT	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1248T>C	1.37:g.242264076A>G		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	29.0	NM_152666	A1KXV0|B7Z324|Q494U9|Q8NB22	Silent	SNP	ENST00000536534.2	37	CCDS1621.2																																																																																			.		0.378	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
PLEKHM1	9842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	43545720	43545720	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:43545720T>C	ENST00000430334.3	-	5	1296	c.1163A>G	c.(1162-1164)cAg>cGg	p.Q388R	RN7SL730P_ENST00000583727.1_RNA|PLEKHM1_ENST00000421073.2_Missense_Mutation_p.Q299R	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	388					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					CTCTACAGGCTGCTGTAAGTC	0.637																																					p.Q388R		.											.	PLEKHM1	90	0			c.A1163G						.						23.0	24.0	24.0					17																	43545720		2203	4300	6503	SO:0001583	missense	9842	exon5			ACAGGCTGCTGTA	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.1163A>G	17.37:g.43545720T>C	ENSP00000389913:p.Gln388Arg	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	39.0	NM_014798	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	T	6.266	0.417220	0.11870	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.64803	-0.1;-0.12	4.45	2.06	0.26882	.	1.201540	0.05874	N	0.625103	T	0.55353	0.1915	L	0.51422	1.61	0.09310	N	1	B;B	0.31100	0.255;0.308	B;B	0.32393	0.145;0.101	T	0.36335	-0.9752	10	0.16896	T	0.51	.	8.557	0.33487	0.0:0.0:0.3831:0.6169	.	299;388	F8W648;Q9Y4G2	.;PKHM1_HUMAN	R	388;337;299	ENSP00000389913:Q388R;ENSP00000414352:Q299R	ENSP00000414352:Q299R	Q	-	2	0	PLEKHM1	40901503	0.001000	0.12720	0.028000	0.17463	0.050000	0.14768	-0.091000	0.11146	0.268000	0.21939	0.533000	0.62120	CAG	.		0.637	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
PPP1R13B	23368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	104206739	104206739	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr14:104206739G>A	ENST00000202556.9	-	12	2296	c.2014C>T	c.(2014-2016)Ccc>Tcc	p.P672S	PPP1R13B_ENST00000555391.1_5'UTR|PPP1R13B_ENST00000423488.2_Missense_Mutation_p.P91S	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	672	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				AGCTTGGTGGGGCTGAGTGGC	0.667																																					p.P672S		.											.	PPP1R13B	227	0			c.C2014T						.						57.0	69.0	65.0					14																	104206739		2143	4241	6384	SO:0001583	missense	23368	exon12			TGGTGGGGCTGAG	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.2014C>T	14.37:g.104206739G>A	ENSP00000202556:p.Pro672Ser	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	16.0	NM_015316	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	37	CCDS41997.1	.	.	.	.	.	.	.	.	.	.	G	35	5.515550	0.96402	.	.	ENSG00000088808	ENST00000202556;ENST00000423488;ENST00000380023	T;D	0.92099	-0.98;-2.97	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.95239	0.8456	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95107	0.8235	10	0.59425	D	0.04	.	19.5918	0.95518	0.0:0.0:1.0:0.0	.	672	Q96KQ4	ASPP1_HUMAN	S	672;91;539	ENSP00000202556:P672S;ENSP00000395213:P91S	ENSP00000202556:P672S	P	-	1	0	PPP1R13B	103276492	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.858000	0.99539	2.608000	0.88229	0.655000	0.94253	CCC	.		0.667	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414591.1	NM_015316	
PPP1R3G	648791	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	5086148	5086148	+	Silent	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:5086148C>A	ENST00000405617.2	+	1	429	c.429C>A	c.(427-429)gcC>gcA	p.A143A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	143					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TAAGCCTGGCCAGCGTGAAGC	0.721																																					p.A143A		.											.	PPP1R3G	136	0			c.C429A						.						1.0	2.0	2.0					6																	5086148		383	1060	1443	SO:0001819	synonymous_variant	648791	exon1			CCTGGCCAGCGTG		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.429C>A	6.37:g.5086148C>A		Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	9.0	NM_001145115		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			.		0.721	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PRDM1	639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106553643	106553643	+	Silent	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:106553643A>T	ENST00000369096.4	+	5	1842	c.1608A>T	c.(1606-1608)gcA>gcT	p.A536A	PRDM1_ENST00000369091.2_Silent_p.A500A|PRDM1_ENST00000369089.3_Silent_p.A402A	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	536	Interaction with PIAS1.				cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CTACCTCAGCAGCGATGGCAG	0.577			"""D, N, Mis, F, S"""		DLBCL																																p.A536A		.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	862	0			c.A1608T						.						42.0	46.0	45.0					6																	106553643		2203	4300	6503	SO:0001819	synonymous_variant	639	exon5			CTCAGCAGCGATG		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1608A>T	6.37:g.106553643A>T		Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	48.0	NM_001198	B2REA6|E1P5E0|Q86WM7	Silent	SNP	ENST00000369096.4	37	CCDS5054.2																																																																																			.		0.577	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
PRDX4	10549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	23693213	23693213	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chrX:23693213C>G	ENST00000379341.4	+	3	591	c.466C>G	c.(466-468)Cat>Gat	p.H156D	PRDX4_ENST00000495599.1_3'UTR|PRDX4_ENST00000379331.3_Missense_Mutation_p.H156D	NM_006406.1	NP_006397.1	Q13162	PRDX4_HUMAN	peroxiredoxin 4	156	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|I-kappaB phosphorylation (GO:0007252)|male gonad development (GO:0008584)|negative regulation of male germ cell proliferation (GO:2000255)|protein maturation by protein folding (GO:0022417)|reactive oxygen species metabolic process (GO:0072593)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	thioredoxin peroxidase activity (GO:0008379)			lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	9						ACAGTTTACCCATTTGGCCTG	0.348																																					p.H156D		.											.	PRDX4	131	0			c.C466G						.						149.0	129.0	136.0					X																	23693213		2203	4300	6503	SO:0001583	missense	10549	exon3			TTTACCCATTTGG	U25182	CCDS14206.1	Xp22.11	2012-09-20			ENSG00000123131	ENSG00000123131			17169	protein-coding gene	gene with protein product		300927				9388242	Standard	XM_005274438		Approved	AOE37-2	uc004dam.3	Q13162	OTTHUMG00000021253	ENST00000379341.4:c.466C>G	X.37:g.23693213C>G	ENSP00000368646:p.His156Asp	Somatic	695.0	0.0		WXS	Illumina HiSeq	Phase_I	577.0	228.0	NM_006406	Q6FHT3	Missense_Mutation	SNP	ENST00000379341.4	37	CCDS14206.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.648807|4.648807	0.87958|0.87958	.|.	.|.	ENSG00000123131|ENSG00000123131	ENST00000379349;ENST00000379341;ENST00000379331|ENST00000439422	T;T;T|.	0.19532|.	2.14;2.14;2.14|.	5.84|5.84	5.84|5.84	0.93424|0.93424	Alkyl hydroperoxide reductase subunit C/ Thiol specific antioxidant (1);Thioredoxin-like fold (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.92632|0.92632	0.7659|0.7659	H|H	0.99900|0.99900	4.915|4.915	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	D|D	0.96221|0.96221	0.9160|0.9160	10|5	0.87932|.	D|.	0|.	-4.3105|-4.3105	18.7138|18.7138	0.91668|0.91668	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	156|.	Q13162|.	PRDX4_HUMAN|.	D|R	142;156;156|33	ENSP00000368654:H142D;ENSP00000368646:H156D;ENSP00000368635:H156D|.	ENSP00000368635:H156D|.	H|P	+|+	1|2	0|0	PRDX4|PRDX4	23603134|23603134	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.485000|7.485000	0.81204|0.81204	2.463000|2.463000	0.83235|0.83235	0.594000|0.594000	0.82650|0.82650	CAT|CCA	.		0.348	PRDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056049.1	NM_006406	
PSKH2	85481	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	87076277	87076277	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:87076277T>A	ENST00000276616.2	-	2	843	c.769A>T	c.(769-771)Agc>Tgc	p.S257C	PSKH2_ENST00000517981.1_5'Flank	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			AGGAATCCGCTAAGTAAAGCA	0.433																																					p.S257C		.											.	PSKH2	385	0			c.A769T						.						83.0	81.0	82.0					8																	87076277		2203	4300	6503	SO:0001583	missense	85481	exon2			ATCCGCTAAGTAA	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.769A>T	8.37:g.87076277T>A	ENSP00000276616:p.Ser257Cys	Somatic	119.0	2.0		WXS	Illumina HiSeq	Phase_I	88.0	36.0	NM_033126	A0AV22	Missense_Mutation	SNP	ENST00000276616.2	37	CCDS6240.1	.	.	.	.	.	.	.	.	.	.	T	10.36	1.328771	0.24167	.	.	ENSG00000147613	ENST00000276616	T	0.40756	1.02	4.98	2.38	0.29361	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.22003	0.0530	N	0.05351	-0.065	0.37276	D	0.90762	P	0.40282	0.711	P	0.47015	0.534	T	0.33420	-0.9869	9	0.02654	T	1	.	5.1796	0.15152	0.1753:0.0884:0.0:0.7363	.	257	Q96QS6	KPSH2_HUMAN	C	257	ENSP00000276616:S257C	ENSP00000276616:S257C	S	-	1	0	PSKH2	87145393	1.000000	0.71417	0.147000	0.22382	0.885000	0.51271	3.665000	0.54532	0.168000	0.19655	0.533000	0.62120	AGC	.		0.433	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374628.1	NM_033126	
PTCHD4	442213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	47846685	47846685	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:47846685A>T	ENST00000339488.4	-	3	1928	c.1895T>A	c.(1894-1896)cTa>cAa	p.L632Q		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	632						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TGAGAGGGATAGGGGCCTCAG	0.478																																					p.L632Q		.											.	.	.	0			c.T1895A						.						185.0	175.0	179.0					6																	47846685		2203	4300	6503	SO:0001583	missense	442213	exon3			AGGGATAGGGGCC		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1895T>A	6.37:g.47846685A>T	ENSP00000341914:p.Leu632Gln	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	13.0	NM_001013732	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	A	17.30	3.353500	0.61293	.	.	ENSG00000244694	ENST00000339488	D	0.86097	-2.07	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000001	D	0.89918	0.6854	M	0.66939	2.045	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	D	0.90563	0.4517	10	0.56958	D	0.05	.	16.35	0.83199	1.0:0.0:0.0:0.0	.	632	Q6ZW05	CF138_HUMAN	Q	632	ENSP00000341914:L632Q	ENSP00000341914:L632Q	L	-	2	0	C6orf138	47954644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.270000	0.75569	0.528000	0.53228	CTA	.		0.478	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
PTGIR	5739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47124692	47124692	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:47124692G>A	ENST00000291294.2	-	3	1139	c.1006C>T	c.(1006-1008)Ccc>Tcc	p.P336S	PTGIR_ENST00000597185.1_Missense_Mutation_p.P65S|PTGIR_ENST00000598865.1_Missense_Mutation_p.P124S|PTGIR_ENST00000594275.1_Missense_Mutation_p.P93S	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	336					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	GGAGCAGAGGGGGCCCTTGGG	0.682																																					p.P336S		.											.	PTGIR	522	0			c.C1006T						.						29.0	33.0	31.0					19																	47124692		2203	4300	6503	SO:0001583	missense	5739	exon3			CAGAGGGGGCCCT		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.1006C>T	19.37:g.47124692G>A	ENSP00000291294:p.Pro336Ser	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	49.0	NM_000960		Missense_Mutation	SNP	ENST00000291294.2	37	CCDS12686.1	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147272	0.57151	.	.	ENSG00000160013	ENST00000291294	T	0.08458	3.09	4.91	1.34	0.21922	.	0.202762	0.31358	N	0.007797	T	0.04634	0.0126	L	0.29908	0.895	0.09310	N	1	B	0.32781	0.384	B	0.34180	0.177	T	0.36138	-0.9760	10	0.10111	T	0.7	-16.2334	4.1798	0.10369	0.2215:0.211:0.5675:0.0	.	336	P43119	PI2R_HUMAN	S	336	ENSP00000291294:P336S	ENSP00000291294:P336S	P	-	1	0	PTGIR	51816532	0.000000	0.05858	0.014000	0.15608	0.863000	0.49368	0.064000	0.14437	1.050000	0.40346	0.561000	0.74099	CCC	.		0.682	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	40944529	40944529	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr20:40944529A>T	ENST00000373187.1	-	12	1972	c.1973T>A	c.(1972-1974)cTc>cAc	p.L658H	PTPRT_ENST00000373193.3_Missense_Mutation_p.L658H|PTPRT_ENST00000373184.1_Missense_Mutation_p.L658H|PTPRT_ENST00000373198.4_Missense_Mutation_p.L658H|PTPRT_ENST00000373190.1_Missense_Mutation_p.L658H|PTPRT_ENST00000356100.2_Missense_Mutation_p.L658H|PTPRT_ENST00000373201.1_Missense_Mutation_p.L658H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	658	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAGAGAATCGAGGCTGGAGGC	0.522																																					p.L658H		.											.	PTPRT	664	0			c.T1973A						.						128.0	127.0	127.0					20																	40944529		2027	4166	6193	SO:0001583	missense	11122	exon12			GAATCGAGGCTGG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1973T>A	20.37:g.40944529A>T	ENSP00000362283:p.Leu658His	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	63.0	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.152474	0.57259	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.36699	1.29;1.28;1.28;1.24;1.24;1.29;1.28	5.57	5.57	0.84162	.	0.138558	0.49305	D	0.000155	T	0.56688	0.2002	M	0.72118	2.19	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.984	T	0.53620	-0.8413	10	0.13853	T	0.58	.	15.7373	0.77856	1.0:0.0:0.0:0.0	.	658;658	O14522-1;O14522	.;PTPRT_HUMAN	H	658	ENSP00000362286:L658H;ENSP00000362283:L658H;ENSP00000362289:L658H;ENSP00000348408:L658H;ENSP00000362294:L658H;ENSP00000362280:L658H;ENSP00000362297:L658H	ENSP00000348408:L658H	L	-	2	0	PTPRT	40377943	0.991000	0.36638	0.847000	0.33407	0.936000	0.57629	4.056000	0.57448	2.120000	0.65058	0.460000	0.39030	CTC	.		0.522	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
PVRL1	5818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119508959	119508959	+	Splice_Site	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:119508959T>A	ENST00000341398.2	-	8	1227		c.e8-2		RP11-196E1.3_ENST00000601999.1_RNA|RP11-196E1.3_ENST00000532153.1_RNA	NM_203285.1	NP_976030.1	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)						adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		GTGGACAACCTGGAAGAGAAG	0.612																																					.		.											.	PVRL1	90	0			c.1228-2A>T						.						45.0	42.0	43.0					11																	119508959		2199	4295	6494	SO:0001630	splice_region_variant	5818	exon9			ACAACCTGGAAGA	X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000341398.2:c.1228-2A>T	11.37:g.119508959T>A		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	9.0	NM_203285	O75465|Q2M3D3|Q9HBE6|Q9HBW2	Splice_Site	SNP	ENST00000341398.2	37	CCDS8425.1	.	.	.	.	.	.	.	.	.	.	T	6.210	0.406970	0.11754	.	.	ENSG00000110400	ENST00000341398	.	.	.	3.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9846	0.47514	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PVRL1	119014169	0.996000	0.38824	0.525000	0.27900	0.072000	0.16883	4.511000	0.60462	1.901000	0.55032	0.482000	0.46254	.	.		0.612	PVRL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388230.1		Intron
RAP1A	5906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	112247100	112247100	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:112247100G>A	ENST00000369709.3	+	6	639	c.460G>A	c.(460-462)Gtt>Att	p.V154I	RAP1A_ENST00000436150.2_Missense_Mutation_p.V154I|RAP1A_ENST00000494982.1_3'UTR|RAP1A_ENST00000356415.1_Missense_Mutation_p.V154I|RAP1A_ENST00000545460.1_Missense_Mutation_p.V154I	NM_002884.2	NP_002875.1	P62834	RAP1A_HUMAN	RAP1A, member of RAS oncogene family	154					activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of vasculogenesis (GO:2001214)|protein transport (GO:0015031)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|guanyl-nucleotide exchange factor complex (GO:0032045)|late endosome (GO:0005770)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)		AAAGATCAATGTTAATGAGGT	0.383																																					p.V154I		.											.	RAP1A	847	0			c.G460A						.						85.0	80.0	82.0					1																	112247100		2203	4300	6503	SO:0001583	missense	5906	exon7			ATCAATGTTAATG	BC014086	CCDS840.1	1p13.3	2014-05-09			ENSG00000116473	ENSG00000116473			9855	protein-coding gene	gene with protein product		179520				3143720	Standard	XM_006710803		Approved	KREV-1, SMGP21	uc001ebl.3	P62834	OTTHUMG00000011959	ENST00000369709.3:c.460G>A	1.37:g.112247100G>A	ENSP00000358723:p.Val154Ile	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	55.0	NM_001010935	P10113	Missense_Mutation	SNP	ENST00000369709.3	37	CCDS840.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986864	0.74589	.	.	ENSG00000116473	ENST00000356415;ENST00000369709;ENST00000436150;ENST00000545460	T;T;T;T	0.80653	-1.4;-1.4;-1.4;-1.4	5.92	5.92	0.95590	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.68174	0.2972	L	0.31157	0.91	0.80722	D	1	B	0.17667	0.023	B	0.28232	0.087	T	0.63888	-0.6535	10	0.49607	T	0.09	.	19.9157	0.97061	0.0:0.0:1.0:0.0	.	154	P62834	RAP1A_HUMAN	I	154	ENSP00000348786:V154I;ENSP00000358723:V154I;ENSP00000394318:V154I;ENSP00000443009:V154I	ENSP00000348786:V154I	V	+	1	0	RAP1A	112048623	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.476000	0.97823	2.809000	0.96659	0.655000	0.94253	GTT	.		0.383	RAP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033071.1	NM_002884	
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	111688372	111688372	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:111688372T>A	ENST00000358835.3	-	15	7073	c.6619A>T	c.(6619-6621)Aga>Tga	p.R2207*	REV3L_ENST00000368802.3_Nonsense_Mutation_p.R2207*|REV3L_ENST00000368805.1_Nonsense_Mutation_p.R2207*|REV3L_ENST00000435970.1_Nonsense_Mutation_p.R2129*			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2207					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AGAAGTTTTCTCTGTATGATT	0.408								DNA polymerases (catalytic subunits)																													p.R2207X		.											.	REV3L	294	0			c.A6619T						.						98.0	97.0	97.0					6																	111688372		2203	4300	6503	SO:0001587	stop_gained	5980	exon14			GTTTTCTCTGTAT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6619A>T	6.37:g.111688372T>A	ENSP00000351697:p.Arg2207*	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	37.0	NM_002912	O43214|Q5TC33	Nonsense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	31	5.066444	0.93898	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	.	.	.	5.46	5.46	0.80206	.	0.074533	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.533	15.8257	0.78706	0.0:0.0:0.0:1.0	.	.	.	.	X	2207;2207;2207;2129;280	.	ENSP00000351697:R2207X	R	-	1	2	REV3L	111795065	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.085000	0.57657	2.188000	0.69820	0.533000	0.62120	AGA	.		0.408	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	111693804	111693804	+	Silent	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:111693804C>T	ENST00000358835.3	-	14	6208	c.5754G>A	c.(5752-5754)aaG>aaA	p.K1918K	REV3L_ENST00000368802.3_Silent_p.K1918K|REV3L_ENST00000368805.1_Silent_p.K1918K|REV3L_ENST00000435970.1_Silent_p.K1840K			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1918					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ATTACCTGGGCTTTTCTGGTA	0.348								DNA polymerases (catalytic subunits)																													p.K1918K		.											.	REV3L	294	0			c.G5754A						.						75.0	79.0	78.0					6																	111693804		2203	4300	6503	SO:0001819	synonymous_variant	5980	exon13			CCTGGGCTTTTCT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.5754G>A	6.37:g.111693804C>T		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	34.0	NM_002912	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																			.		0.348	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
RNF212	285498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1084625	1084625	+	Splice_Site	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:1084625A>T	ENST00000433731.2	-	4	309	c.248T>A	c.(247-249)aTt>aAt	p.I83N	RNF212_ENST00000382968.5_Splice_Site_p.I83N			Q495C1	RN212_HUMAN	ring finger protein 212	83					chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		AAATTCTAAAATCTGAAAAGA	0.423																																					p.I83N		.											.	RNF212	68	0			c.T248A						.						91.0	87.0	88.0					4																	1084625		2202	4300	6502	SO:0001630	splice_region_variant	285498	exon4			TCTAAAATCTGAA	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-1T>A	4.37:g.1084625A>T		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	24.0	NM_194439	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	Missense_Mutation	SNP	ENST00000433731.2	37	CCDS46996.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.878848	0.33162	.	.	ENSG00000178222	ENST00000382968;ENST00000433731	D;D	0.98835	-5.17;-5.17	3.91	3.91	0.45181	.	.	.	.	.	D	0.97720	0.9252	L	0.53249	1.67	0.80722	D	1	D;P;P	0.54964	0.969;0.925;0.925	P;P;P	0.51701	0.648;0.677;0.556	D	0.97240	0.9890	9	0.66056	D	0.02	0.2099	9.3084	0.37889	1.0:0.0:0.0:0.0	.	83;83;83	Q495C1-2;Q495C1;Q495C1-5	.;RN212_HUMAN;.	N	83	ENSP00000372428:I83N;ENSP00000389709:I83N	ENSP00000372428:I83N	I	-	2	0	RNF212	1074625	1.000000	0.71417	0.851000	0.33527	0.056000	0.15407	3.989000	0.56958	1.782000	0.52362	0.172000	0.16884	ATT	.		0.423	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359124.2	NM_194439	Missense_Mutation
RNF6	6049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	26789149	26789149	+	Silent	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr13:26789149T>A	ENST00000381588.4	-	5	1622	c.870A>T	c.(868-870)acA>acT	p.T290T	RNF6_ENST00000468480.1_Intron|RNF6_ENST00000381570.3_Silent_p.T290T|RNF6_ENST00000399762.2_Intron|RNF6_ENST00000346166.3_Silent_p.T290T	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	290					negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		TATTCCTCACTGTAACATTAC	0.448																																					p.T290T		.											RNF6,arm,malignant_melanoma,-2	RNF6	228	0			c.A870T						.						214.0	206.0	208.0					13																	26789149		2203	4300	6503	SO:0001819	synonymous_variant	6049	exon5			CCTCACTGTAACA	AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.870A>T	13.37:g.26789149T>A		Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	38.0	NM_183043	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Silent	SNP	ENST00000381588.4	37	CCDS9316.1																																																																																			.		0.448	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044246.2	NM_005977	
ROCK2	9475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	11337476	11337476	+	Splice_Site	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:11337476T>A	ENST00000315872.6	-	27	3728		c.e27-2		ROCK2_ENST00000401753.1_Splice_Site	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2						actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		AGCTATTTGCTATAAGAAATT	0.348																																					.		.											.	ROCK2	546	0			c.3280-2A>T						.						70.0	65.0	66.0					2																	11337476		1852	4096	5948	SO:0001630	splice_region_variant	9475	exon28			ATTTGCTATAAGA	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.3280-2A>T	2.37:g.11337476T>A		Somatic	215.0	0.0		WXS	Illumina HiSeq	Phase_I	219.0	61.0	NM_004850	Q53QZ0|Q53SJ7|Q9UQN5	Splice_Site	SNP	ENST00000315872.6	37	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.446931	0.63178	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0084	0.80380	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ROCK2	11254927	1.000000	0.71417	0.926000	0.36857	0.675000	0.39556	7.849000	0.86908	2.180000	0.69256	0.460000	0.39030	.	.		0.348	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3		Intron
ROS1	6098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	117686251	117686251	+	Silent	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:117686251T>A	ENST00000368508.3	-	20	3288	c.3090A>T	c.(3088-3090)acA>acT	p.T1030T	ROS1_ENST00000368507.3_Silent_p.T1025T|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1030	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GTGACAGAGATGTTTTGGGGC	0.398			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.T1030T		.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	1353	0			c.A3090T						.						97.0	97.0	97.0					6																	117686251		2203	4300	6503	SO:0001819	synonymous_variant	6098	exon20			CAGAGATGTTTTG	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.3090A>T	6.37:g.117686251T>A		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	42.0	NM_002944	Q15368|Q5TDB5	Silent	SNP	ENST00000368508.3	37	CCDS5116.1																																																																																			.		0.398	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	55533794	55533794	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:55533794C>G	ENST00000220676.1	+	2	416	c.268C>G	c.(268-270)Cac>Gac	p.H90D		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	90	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TCGGGGCAGGCACAGCATCAC	0.607																																					p.H90D	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.C268G						.						95.0	79.0	84.0					8																	55533794		2203	4300	6503	SO:0001583	missense	6101	exon2			GGCAGGCACAGCA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.268C>G	8.37:g.55533794C>G	ENSP00000220676:p.His90Asp	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	32.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372261	0.61624	.	.	ENSG00000104237	ENST00000220676	D	0.92446	-3.04	5.34	5.34	0.76211	Doublecortin domain (5);	0.094927	0.46758	D	0.000277	D	0.95765	0.8622	M	0.70842	2.15	0.49483	D	0.999792	D	0.76494	0.999	D	0.73708	0.981	D	0.96064	0.9041	10	0.87932	D	0	-9.3041	19.0468	0.93022	0.0:1.0:0.0:0.0	.	90	P56715	RP1_HUMAN	D	90	ENSP00000220676:H90D	ENSP00000220676:H90D	H	+	1	0	RP1	55696347	1.000000	0.71417	0.997000	0.53966	0.332000	0.28634	5.911000	0.69939	2.498000	0.84270	0.650000	0.86243	CAC	.		0.607	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
RPS6KA2	6196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	166862319	166862319	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:166862319T>A	ENST00000265678.4	-	14	1448	c.1225A>T	c.(1225-1227)Atc>Ttc	p.I409F	RPS6KA2_ENST00000481261.2_Missense_Mutation_p.I320F|RPS6KA2_ENST00000503859.1_Missense_Mutation_p.I417F|RPS6KA2_ENST00000510118.1_Missense_Mutation_p.I434F|RPS6KA2_ENST00000405189.3_Missense_Mutation_p.I320F	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	409					axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)	p.I409V(1)|p.I417V(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GTGAAGTGGATGTTGTTCCCG	0.557																																					p.I417F		.											.	RPS6KA2	1405	2	Substitution - Missense(2)	lung(2)	c.A1249T						.						305.0	222.0	250.0					6																	166862319		2203	4300	6503	SO:0001583	missense	6196	exon15			AGTGGATGTTGTT	L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.1225A>T	6.37:g.166862319T>A	ENSP00000265678:p.Ile409Phe	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	25.0	NM_001006932	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Missense_Mutation	SNP	ENST00000265678.4	37	CCDS5294.1	.	.	.	.	.	.	.	.	.	.	T	5.617	0.298652	0.10622	.	.	ENSG00000071242	ENST00000265678;ENST00000510118;ENST00000503859;ENST00000481261;ENST00000405189	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	4.39	-4.78	0.03209	Protein kinase-like domain (1);	0.436706	0.24485	N	0.038104	T	0.09862	0.0242	N	0.19112	0.55	0.35819	D	0.824425	B;B;B	0.23650	0.0;0.001;0.089	B;B;B	0.14023	0.002;0.007;0.01	T	0.08391	-1.0724	10	0.31617	T	0.26	.	13.1586	0.59533	0.0:0.6033:0.0:0.3967	.	434;417;409	F2Z2J1;Q15349-3;Q15349	.;.;KS6A2_HUMAN	F	409;434;417;320;320	ENSP00000265678:I409F;ENSP00000422435:I434F;ENSP00000427015:I417F;ENSP00000422484:I320F;ENSP00000386050:I320F	ENSP00000265678:I409F	I	-	1	0	RPS6KA2	166782309	0.002000	0.14202	0.574000	0.28523	0.989000	0.77384	-0.761000	0.04751	-1.168000	0.02776	-0.376000	0.06991	ATC	.		0.557	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043075.3	NM_021135	
SAMD9L	219285	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92763732	92763732	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:92763732T>G	ENST00000318238.4	-	5	2769	c.1553A>C	c.(1552-1554)cAg>cCg	p.Q518P	SAMD9L_ENST00000437805.1_Missense_Mutation_p.Q518P|SAMD9L_ENST00000411955.1_Missense_Mutation_p.Q518P	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	518					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TCTTTCTCTCTGCCATAAATG	0.368																																					p.Q518P		.											.	SAMD9L	94	0			c.A1553C						.						71.0	76.0	74.0					7																	92763732		2203	4300	6503	SO:0001583	missense	219285	exon5			TCTCTCTGCCATA	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.1553A>C	7.37:g.92763732T>G	ENSP00000326247:p.Gln518Pro	Somatic	189.0	1.0		WXS	Illumina HiSeq	Phase_I	207.0	73.0	NM_152703	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.963025	0.34659	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.13657	2.57;2.57;2.57	4.59	4.59	0.56863	.	0.567406	0.16011	N	0.233820	T	0.23330	0.0564	L	0.55481	1.735	0.39063	D	0.960556	P	0.50528	0.936	P	0.51355	0.667	T	0.02417	-1.1162	10	0.37606	T	0.19	-0.1103	13.7732	0.63038	0.0:0.0:0.0:1.0	.	518	Q8IVG5	SAM9L_HUMAN	P	518	ENSP00000326247:Q518P;ENSP00000405760:Q518P;ENSP00000408796:Q518P	ENSP00000326247:Q518P	Q	-	2	0	SAMD9L	92601668	0.779000	0.28652	0.996000	0.52242	0.733000	0.41908	1.321000	0.33678	1.930000	0.55929	0.377000	0.23210	CAG	.		0.368	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
SCAF8	22828	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155145419	155145419	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:155145419C>A	ENST00000367178.3	+	17	2554	c.1978C>A	c.(1978-1980)Cct>Act	p.P660T	SCAF8_ENST00000367186.4_Missense_Mutation_p.P726T|SCAF8_ENST00000417268.1_Missense_Mutation_p.P660T|RNU6-824P_ENST00000363724.1_RNA	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	660	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						ACCAGCATTTCCTGTGTCGAT	0.473																																					p.P660T		.											.	SCAF8	91	0			c.C1978A						.						195.0	190.0	192.0					6																	155145419		2203	4300	6503	SO:0001583	missense	22828	exon17			GCATTTCCTGTGT	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.1978C>A	6.37:g.155145419C>A	ENSP00000356146:p.Pro660Thr	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	10.0	NM_014892	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Missense_Mutation	SNP	ENST00000367178.3	37	CCDS5247.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667251	0.88348	.	.	ENSG00000213079	ENST00000367178;ENST00000417268;ENST00000367186	T;T;T	0.50548	0.79;0.79;0.74	5.27	5.27	0.74061	.	0.000000	0.64402	U	0.000001	T	0.50411	0.1614	L	0.37750	1.13	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.997;0.994;0.997	T	0.36286	-0.9754	10	0.23891	T	0.37	.	18.8836	0.92367	0.0:1.0:0.0:0.0	.	705;726;738;660	B7Z876;B7Z888;B7Z3A4;Q9UPN6	.;.;.;SCAF8_HUMAN	T	660;660;726	ENSP00000356146:P660T;ENSP00000413098:P660T;ENSP00000356154:P726T	ENSP00000356146:P660T	P	+	1	0	SCAF8	155187111	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.205000	0.77881	2.454000	0.82982	0.650000	0.86243	CCT	.		0.473	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
SCAP	22937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47461017	47461017	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:47461017G>T	ENST00000265565.5	-	13	2153	c.1741C>A	c.(1741-1743)Cca>Aca	p.P581T	SCAP_ENST00000465628.1_5'Flank|SCAP_ENST00000545718.1_Missense_Mutation_p.P189T|SCAP_ENST00000441517.2_Missense_Mutation_p.P326T	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	581					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GCATCAGGTGGGAAGATGGAG	0.642																																					p.P581T	Pancreas(149;978 1908 29304 37806 46700)	.											.	SCAP	91	0			c.C1741A						.						77.0	77.0	77.0					3																	47461017		2203	4300	6503	SO:0001583	missense	22937	exon13			CAGGTGGGAAGAT	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.1741C>A	3.37:g.47461017G>T	ENSP00000265565:p.Pro581Thr	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	35.0	NM_012235	Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	37	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370887	0.61624	.	.	ENSG00000114650	ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.79749	-1.3;-1.25;0.88	4.33	3.43	0.39272	.	0.058060	0.64402	D	0.000001	T	0.81475	0.4830	L	0.60455	1.87	0.41946	D	0.990631	P;B	0.51653	0.947;0.021	P;B	0.49853	0.624;0.03	T	0.81600	-0.0859	10	0.44086	T	0.13	-4.3161	13.7526	0.62917	0.0:0.1555:0.8445:0.0	.	326;581	F8W921;Q12770	.;SCAP_HUMAN	T	208;581;326;189	ENSP00000265565:P581T;ENSP00000416847:P326T;ENSP00000438956:P189T	ENSP00000265565:P581T	P	-	1	0	SCAP	47436021	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	5.060000	0.64312	0.990000	0.38787	0.462000	0.41574	CCA	.		0.642	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235	
SCNN1G	6340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23197855	23197855	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr16:23197855A>T	ENST00000300061.2	+	2	406	c.263A>T	c.(262-264)cAc>cTc	p.H88L		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	88					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	ATCAAAGTCCACTTCCGGAAG	0.562																																					p.H88L		.											.	SCNN1G	158	0			c.A263T						.						59.0	56.0	57.0					16																	23197855		2197	4300	6497	SO:0001583	missense	6340	exon2			AAGTCCACTTCCG	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.263A>T	16.37:g.23197855A>T	ENSP00000300061:p.His88Leu	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	14.0	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	37	CCDS10608.1	.	.	.	.	.	.	.	.	.	.	A	13.13	2.145201	0.37825	.	.	ENSG00000166828	ENST00000300061	T	0.62639	0.01	4.99	4.99	0.66335	.	0.501673	0.21372	N	0.075617	T	0.55641	0.1933	L	0.57536	1.79	0.34913	D	0.747655	P	0.35226	0.491	B	0.31946	0.138	T	0.69254	-0.5193	10	0.62326	D	0.03	-13.9998	9.8043	0.40783	0.8271:0.1729:0.0:0.0	.	88	P51170	SCNNG_HUMAN	L	88	ENSP00000300061:H88L	ENSP00000300061:H88L	H	+	2	0	SCNN1G	23105356	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	3.868000	0.56055	1.875000	0.54330	0.460000	0.39030	CAC	.		0.562	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
SEMA3A	10371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83675692	83675692	+	Silent	SNP	A	A	C	rs548421717		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:83675692A>C	ENST00000265362.4	-	6	929	c.615T>G	c.(613-615)ctT>ctG	p.L205L	SEMA3A_ENST00000436949.1_Silent_p.L205L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	205	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						GGTGGTGCCCAAGAGTTCGGA	0.433																																					p.L205L		.											.	SEMA3A	156	0			c.T615G						.						218.0	195.0	203.0					7																	83675692		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon6			GTGCCCAAGAGTT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.615T>G	7.37:g.83675692A>C		Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	219.0	66.0	NM_006080		Silent	SNP	ENST00000265362.4	37	CCDS5599.1																																																																																			.		0.433	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SEMA6A	57556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	115783094	115783094	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:115783094G>A	ENST00000343348.6	-	19	3095	c.2308C>T	c.(2308-2310)Ccc>Tcc	p.P770S	SEMA6A_ENST00000503865.1_Missense_Mutation_p.P149S|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000510263.1_Missense_Mutation_p.P770S|SEMA6A_ENST00000282394.6_Missense_Mutation_p.P247S|CTB-118N6.3_ENST00000508424.1_RNA|CTB-118N6.3_ENST00000512128.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.P787S|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000513137.1_Missense_Mutation_p.P197S	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	770					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CCGCGGCTGGGCTTCCGCTTC	0.627																																					p.P770S		.											.	SEMA6A	92	0			c.C2308T						.						51.0	62.0	59.0					5																	115783094		2089	4204	6293	SO:0001583	missense	57556	exon19			GGCTGGGCTTCCG	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2308C>T	5.37:g.115783094G>A	ENSP00000345512:p.Pro770Ser	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	44.0	NM_020796	Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	37	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096092	0.56075	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000513137;ENST00000282394;ENST00000503865;ENST00000510263	T;T;T;T;T;T	0.47869	2.21;2.21;0.84;2.69;0.83;2.21	5.45	4.57	0.56435	.	0.115400	0.64402	D	0.000014	T	0.60996	0.2312	L	0.44542	1.39	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;0.995;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.87578	0.998;0.844;0.998;0.998;0.998;0.998	T	0.60321	-0.7286	10	0.40728	T	0.16	.	15.8163	0.78604	0.0:0.1366:0.8634:0.0	.	149;770;314;787;247;197	E9PDV9;Q9H2E6;Q96SM8;Q9H2E6-2;E7ERF3;B3KU01	.;SEM6A_HUMAN;.;.;.;.	S	770;787;197;247;149;770	ENSP00000345512:P770S;ENSP00000257414:P787S;ENSP00000422997:P197S;ENSP00000282394:P247S;ENSP00000425364:P149S;ENSP00000424388:P770S	ENSP00000257414:P787S	P	-	1	0	SEMA6A	115810993	1.000000	0.71417	0.961000	0.40146	0.996000	0.88848	7.501000	0.81600	1.279000	0.44446	0.650000	0.86243	CCC	.		0.627	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
SERTAD3	29946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40947776	40947776	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:40947776A>T	ENST00000322354.3	-	2	708	c.212T>A	c.(211-213)cTg>cAg	p.L71Q	CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000392028.4_Missense_Mutation_p.L71Q|SERTAD3_ENST00000601217.1_5'Flank	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3	71	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.				negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGCGGGAGCCAGGCGAAGTGC	0.657																																					p.L71Q		.											.	SERTAD3	90	0			c.T212A						.						26.0	22.0	23.0					19																	40947776		2203	4296	6499	SO:0001583	missense	29946	exon2			GGAGCCAGGCGAA	AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.212T>A	19.37:g.40947776A>T	ENSP00000325414:p.Leu71Gln	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	13.0	NM_013368	B3KQB3|Q96CQ2	Missense_Mutation	SNP	ENST00000322354.3	37	CCDS12558.1	.	.	.	.	.	.	.	.	.	.	A	6.459	0.452792	0.12283	.	.	ENSG00000167565	ENST00000322354;ENST00000392028	.	.	.	5.17	2.91	0.33838	.	0.665545	0.12590	N	0.455709	T	0.17195	0.0413	N	0.08118	0	0.09310	N	1	B	0.32968	0.392	B	0.30029	0.11	T	0.16482	-1.0401	9	0.21540	T	0.41	-10.9924	8.955	0.35812	0.6338:0.3662:0.0:0.0	.	71	Q9UJW9	SRTD3_HUMAN	Q	71	.	ENSP00000325414:L71Q	L	-	2	0	SERTAD3	45639616	0.789000	0.28775	0.010000	0.14722	0.904000	0.53231	1.294000	0.33365	0.783000	0.33636	0.533000	0.62120	CTG	.		0.657	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462573.1	NM_013368	
SESN3	143686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94906456	94906456	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:94906456A>G	ENST00000536441.1	-	10	1778	c.1442T>C	c.(1441-1443)cTt>cCt	p.L481P	SESN3_ENST00000278499.2_Missense_Mutation_p.L342P|RP11-712B9.2_ENST00000534891.1_RNA|RP11-712B9.2_ENST00000534864.1_RNA	NM_001271594.1|NM_144665.2	NP_001258523.1|NP_653266.2	P58005	SESN3_HUMAN	sestrin 3	481					glucose homeostasis (GO:0042593)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)|response to insulin (GO:0032868)	nucleus (GO:0005634)				endometrium(5)|large_intestine(6)|lung(3)|skin(1)|stomach(1)	16		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.234)		AAGAGCATAAAGAAGTTCAGC	0.358																																					p.L481P		.											.	SESN3	90	0			c.T1442C						.						110.0	95.0	100.0					11																	94906456		2201	4298	6499	SO:0001583	missense	143686	exon10			GCATAAAGAAGTT	AK096300	CCDS8303.1, CCDS60938.1	11q21	2005-09-18			ENSG00000149212	ENSG00000149212			23060	protein-coding gene	gene with protein product		607768				12607115	Standard	NM_144665		Approved	SEST3, MGC29667	uc001pfj.4	P58005	OTTHUMG00000167829	ENST00000536441.1:c.1442T>C	11.37:g.94906456A>G	ENSP00000441927:p.Leu481Pro	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	37.0	NM_144665	B7Z7P9|Q96AD1	Missense_Mutation	SNP	ENST00000536441.1	37	CCDS8303.1	.	.	.	.	.	.	.	.	.	.	A	12.60	1.986420	0.35036	.	.	ENSG00000149212	ENST00000536441;ENST00000278499	T;T	0.37915	1.17;1.17	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000003	T	0.66538	0.2799	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	T	0.74352	-0.3693	10	0.87932	D	0	0.3648	15.3779	0.74625	1.0:0.0:0.0:0.0	.	342;481	B7Z7P9;P58005	.;SESN3_HUMAN	P	481;342	ENSP00000441927:L481P;ENSP00000278499:L342P	ENSP00000278499:L342P	L	-	2	0	SESN3	94546104	1.000000	0.71417	0.589000	0.28718	0.152000	0.21847	8.771000	0.91751	2.045000	0.60652	0.454000	0.30748	CTT	.		0.358	SESN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396475.3	NM_144665	
SFTPA2	729238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	81317058	81317058	+	Silent	SNP	A	A	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr10:81317058A>C	ENST00000372325.2	-	6	738	c.654T>G	c.(652-654)ggT>ggG	p.G218G	SFTPA2_ENST00000372327.5_Silent_p.G218G	NM_001098668.2	NP_001092138.1	Q8IWL1	SFPA2_HUMAN	surfactant protein A2	218	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			CTTTTCCCCGACCTGCAGGCT	0.562									Pulmonary Fibrosis, Idiopathic																												p.G218G		.											.	.	.	0			c.T654G						.						234.0	223.0	227.0					10																	81317058		2203	4296	6499	SO:0001819	synonymous_variant	729238	exon6	Familial Cancer Database	Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia	TCCCCGACCTGCA		CCDS41540.1	10q22.3	2012-11-02	2008-08-26			ENSG00000185303		"""Collectins"""	10799	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A2A"""	178642	"""surfactant, pulmonary-associated protein A2"""				Standard	NM_001098668		Approved	SP-A2, COLEC5	uc001kal.4	Q8IWL1		ENST00000372325.2:c.654T>G	10.37:g.81317058A>C		Somatic	455.0	1.0		WXS	Illumina HiSeq	Phase_I	322.0	261.0	NM_001098668	A4QPA7|B2RXI6|B2RXK9|C9J9I7|E3VLC6|E3VLC7|E3VLC8|E3VLC9|P07714|Q14DV3|Q5RIR8|Q5RIR9	Silent	SNP	ENST00000372325.2	37	CCDS41540.1																																																																																			.		0.562	SFTPA2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048961.1	NM_001098668	
SIAH1	6477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	48395984	48395984	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr16:48395984T>G	ENST00000380006.2	-	1	1809	c.356A>C	c.(355-357)gAg>gCg	p.E119A	SIAH1_ENST00000573005.1_5'Flank|SIAH1_ENST00000394725.2_Missense_Mutation_p.E119A|SIAH1_ENST00000356721.3_Missense_Mutation_p.E150A			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	119	SBD.				anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				CTCACAGAGCTCTTCATGGTC	0.468																																					p.E150A		.											.	SIAH1	415	0			c.A449C						.						84.0	62.0	70.0					16																	48395984		2200	4300	6500	SO:0001583	missense	6477	exon2			CAGAGCTCTTCAT	U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.356A>C	16.37:g.48395984T>G	ENSP00000369343:p.Glu119Ala	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	37.0	NM_001006610	A0FKF3|O43269|Q49A58|Q92880	Missense_Mutation	SNP	ENST00000380006.2	37	CCDS10735.1	.	.	.	.	.	.	.	.	.	.	T	15.01	2.705885	0.48412	.	.	ENSG00000196470	ENST00000356721;ENST00000394725;ENST00000380006	T;T	0.27104	1.69;1.69	5.2	5.2	0.72013	Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);Seven In Absentia Homolog-type (1);Zinc finger, SIAH-type (1);	0.000000	0.85682	U	0.000000	T	0.31358	0.0794	L	0.42245	1.32	0.80722	D	1	P;B	0.42757	0.789;0.049	P;B	0.47705	0.555;0.061	T	0.02009	-1.1230	10	0.30078	T	0.28	-19.9522	15.3506	0.74380	0.0:0.0:0.0:1.0	.	119;150	Q8IUQ4;Q8IUQ4-2	SIAH1_HUMAN;.	A	150;119;135	ENSP00000349156:E150A;ENSP00000378214:E119A	ENSP00000349156:E150A	E	-	2	0	SIAH1	46953485	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.997000	0.88414	2.094000	0.63399	0.533000	0.62120	GAG	.		0.468	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256842.12		
SIPA1L2	57568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	232539296	232539296	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:232539296C>A	ENST00000366630.1	-	20	5196	c.4838G>T	c.(4837-4839)tGc>tTc	p.C1613F	SIPA1L2_ENST00000308942.4_Missense_Mutation_p.C669F|SIPA1L2_ENST00000262861.4_Missense_Mutation_p.C1613F			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1613					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TGTCAGGGTGCAGAAGGATGC	0.507																																					p.C1613F		.											.	SIPA1L2	95	0			c.G4838T						.						53.0	56.0	55.0					1																	232539296		1942	4160	6102	SO:0001583	missense	57568	exon19			AGGGTGCAGAAGG	AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.4838G>T	1.37:g.232539296C>A	ENSP00000355589:p.Cys1613Phe	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	37.0	NM_020808	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	ENST00000366630.1	37	CCDS41474.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705639	0.30232	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.28069	1.63;1.63;1.63	5.04	5.04	0.67666	.	0.227351	0.45867	D	0.000322	T	0.22205	0.0535	N	0.12182	0.205	0.50467	D	0.99987	P;D	0.54964	0.662;0.969	B;P	0.47827	0.273;0.558	T	0.02457	-1.1156	10	0.07990	T	0.79	-10.1775	16.9133	0.86145	0.0:1.0:0.0:0.0	.	1613;669	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	F	1613;1613;669	ENSP00000355589:C1613F;ENSP00000262861:C1613F;ENSP00000309102:C669F	ENSP00000262861:C1613F	C	-	2	0	SIPA1L2	230605919	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.504000	0.73704	2.639000	0.89480	0.644000	0.83932	TGC	.		0.507	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092318.1	XM_045839	
SLC17A3	10786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	25850686	25850686	+	Splice_Site	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:25850686C>T	ENST00000360657.3	-	7	1045		c.e7+1		SLC17A3_ENST00000397060.4_Splice_Site|SLC17A3_ENST00000361703.6_Splice_Site			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3						drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						AACATACTCACGTCTCTGATG	0.403																																					.		.											.	SLC17A3	91	0			c.759+1G>A						.						180.0	139.0	153.0					6																	25850686		2203	4300	6503	SO:0001630	splice_region_variant	10786	exon8			TACTCACGTCTCT	U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.759+1G>A	6.37:g.25850686C>T		Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	41.0	NM_006632	B7WNJ5|B7Z511|Q8WWC7|Q9H533	Splice_Site	SNP	ENST00000360657.3	37	CCDS4566.2	.	.	.	.	.	.	.	.	.	.	C	7.632	0.679015	0.14841	.	.	ENSG00000124564	ENST00000397060;ENST00000360657;ENST00000361703	.	.	.	3.53	2.66	0.31614	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9028	0.24293	0.0:0.873:0.0:0.127	.	.	.	.	.	-1	.	.	.	-	.	.	SLC17A3	25958665	0.996000	0.38824	0.999000	0.59377	0.323000	0.28346	4.283000	0.58977	1.050000	0.40346	-0.237000	0.12165	.	.		0.403	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040070.2		Intron
SLC1A6	6511	broad.mit.edu;ucsc.edu;mdanderson.org	37	19	15063777	15063777	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:15063777C>A	ENST00000221742.3	-	8	1469	c.1462G>T	c.(1462-1464)Gaa>Taa	p.E488*	SLC1A6_ENST00000600144.1_Nonsense_Mutation_p.E410*|SLC1A6_ENST00000430939.2_Nonsense_Mutation_p.E424*	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	488					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						GTGATGTCTTCCGTGGGCAAG	0.602																																					p.E488X		.											.	SLC1A6	186	0			c.G1462T						.						200.0	152.0	168.0					19																	15063777		2203	4300	6503	SO:0001587	stop_gained	6511	exon8			TGTCTTCCGTGGG		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1462G>T	19.37:g.15063777C>A	ENSP00000221742:p.Glu488*	Somatic	199.0	1.0		WXS	Illumina HiSeq	Phase_I	148.0	41.0	NM_005071	Q8N753	Nonsense_Mutation	SNP	ENST00000221742.3	37	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	-	37	6.332923	0.97480	.	.	ENSG00000105143	ENST00000430939;ENST00000221742	.	.	.	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-16.8722	14.8789	0.70516	0.0:1.0:0.0:0.0	.	.	.	.	X	424;488	.	ENSP00000221742:E488X	E	-	1	0	SLC1A6	14924777	1.000000	0.71417	0.976000	0.42696	0.899000	0.52679	4.656000	0.61483	2.451000	0.82905	0.446000	0.29264	GAA	.		0.602	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
SLC25A24	29957	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	108686249	108686249	+	Silent	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:108686249T>C	ENST00000565488.1	-	8	1233	c.1014A>G	c.(1012-1014)gaA>gaG	p.E338E	SLC25A24_ENST00000370041.4_Silent_p.E319E	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24	338					ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		CTCCCAAGCCTTCATGTTTCA	0.378																																					p.E338E		.											.	SLC25A24	91	0			c.A1014G						.						100.0	102.0	101.0					1																	108686249		2203	4299	6502	SO:0001819	synonymous_variant	29957	exon8			CAAGCCTTCATGT	AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.1014A>G	1.37:g.108686249T>C		Somatic	118.0	1.0		WXS	Illumina HiSeq	Phase_I	142.0	27.0	NM_013386	B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Silent	SNP	ENST00000565488.1	37	CCDS41361.1																																																																																			.		0.378	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030280.2	NM_013386	
SLC29A4	222962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	5336621	5336621	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:5336621C>G	ENST00000396872.3	+	7	835	c.674C>G	c.(673-675)cCc>cGc	p.P225R	SLC29A4_ENST00000406453.3_Missense_Mutation_p.P211R|SLC29A4_ENST00000297195.4_Missense_Mutation_p.P225R			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	225					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	CTGCTGCTGCCCGACGAGCGC	0.682																																					p.P225R		.											.	SLC29A4	515	0			c.C674G						.						23.0	23.0	23.0					7																	5336621		2191	4254	6445	SO:0001583	missense	222962	exon7			TGCTGCCCGACGA	AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.674C>G	7.37:g.5336621C>G	ENSP00000380081:p.Pro225Arg	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	10.0	NM_153247	Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Missense_Mutation	SNP	ENST00000396872.3	37	CCDS5340.1	.	.	.	.	.	.	.	.	.	.	.	13.65	2.299093	0.40694	.	.	ENSG00000164638	ENST00000396872;ENST00000297195;ENST00000406453	T;T;T	0.63096	-0.02;-0.02;-0.02	3.45	3.45	0.39498	Major facilitator superfamily domain, general substrate transporter (1);	0.440030	0.24213	N	0.040514	T	0.59972	0.2233	L	0.58810	1.83	0.30794	N	0.740572	P;P	0.38078	0.617;0.584	B;B	0.40782	0.226;0.34	T	0.64041	-0.6500	10	0.33940	T	0.23	-16.3178	13.4531	0.61182	0.0:1.0:0.0:0.0	.	211;225	Q7RTT9-2;Q7RTT9	.;S29A4_HUMAN	R	225;225;211	ENSP00000380081:P225R;ENSP00000297195:P225R;ENSP00000385845:P211R	ENSP00000297195:P225R	P	+	2	0	SLC29A4	5303147	0.943000	0.32029	0.992000	0.48379	0.995000	0.86356	2.441000	0.44864	1.652000	0.50683	0.555000	0.69702	CCC	.		0.682	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060118.6	NM_153247	
SLC7A8	23428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23635745	23635745	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr14:23635745G>C	ENST00000316902.7	-	2	881	c.156C>G	c.(154-156)aaC>aaG	p.N52K	SLC7A8_ENST00000469263.1_Missense_Mutation_p.N52K	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	52					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	AGCCGATGATGTTCCCTGCAT	0.532																																					p.N52K		.											.	SLC7A8	91	0			c.C156G						.						133.0	131.0	132.0					14																	23635745		2203	4300	6503	SO:0001583	missense	23428	exon2			GATGATGTTCCCT	Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.156C>G	14.37:g.23635745G>C	ENSP00000320378:p.Asn52Lys	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	11.0	NM_012244	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	ENST00000316902.7	37	CCDS9590.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.369677	0.61624	.	.	ENSG00000092068	ENST00000316902;ENST00000469263;ENST00000524758;ENST00000525062	D;D;D;D	0.94497	-2.52;-2.52;-2.73;-3.44	5.49	4.6	0.57074	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.96234	0.8772	M	0.71920	2.185	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.78314	0.985;0.991	D	0.96003	0.8995	10	0.72032	D	0.01	.	9.6422	0.39846	0.1611:0.0:0.8389:0.0	.	52;52	E9PLV9;Q9UHI5	.;LAT2_HUMAN	K	52	ENSP00000320378:N52K;ENSP00000435114:N52K;ENSP00000434352:N52K;ENSP00000436665:N52K	ENSP00000320378:N52K	N	-	3	2	SLC7A8	22705585	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	3.287000	0.51732	1.453000	0.47775	0.655000	0.94253	AAC	.		0.532	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071718.3		
SMG1	23049	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	18887703	18887703	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr16:18887703C>A	ENST00000446231.2	-	13	2045	c.1633G>T	c.(1633-1635)Gcc>Tcc	p.A545S	SMG1_ENST00000565224.1_Missense_Mutation_p.A519S|SMG1_ENST00000389467.3_Missense_Mutation_p.A545S			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	545	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ACAGCATGGGCTACAGCAACA	0.333																																					p.A545S		.											.	SMG1	1160	0			c.G1633T						.						14.0	13.0	13.0					16																	18887703		1783	3985	5768	SO:0001583	missense	23049	exon13			CATGGGCTACAGC	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.1633G>T	16.37:g.18887703C>A	ENSP00000402515:p.Ala545Ser	Somatic	270.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	90.0	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208841	0.58343	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.00995	5.46;5.46	5.49	5.49	0.81192	Armadillo-type fold (1);	0.000000	0.52532	U	0.000064	T	0.00875	0.0029	N	0.12182	0.205	0.47819	D	0.99952	P	0.47762	0.9	B	0.39068	0.289	D	0.84025	0.0356	10	0.17832	T	0.49	.	19.3528	0.94395	0.0:1.0:0.0:0.0	.	545	Q96Q15	SMG1_HUMAN	S	545	ENSP00000402515:A545S;ENSP00000374118:A545S	ENSP00000374118:A545S	A	-	1	0	SMG1	18795204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.891000	0.63185	2.565000	0.86533	0.491000	0.48974	GCC	.		0.333	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
SPTBN5	51332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	42185565	42185565	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:42185565T>C	ENST00000320955.6	-	2	358	c.131A>G	c.(130-132)cAc>cGc	p.H44R	RP11-23P13.6_ENST00000568861.1_RNA|RP11-23P13.6_ENST00000564432.2_RNA|RP11-23P13.6_ENST00000309874.2_RNA|RP11-23P13.6_ENST00000562920.1_RNA|RP11-23P13.7_ENST00000605942.1_lincRNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	44	Actin-binding.				actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTTGCGAATGTGGCCCGTCTC	0.607																																					p.H9R		.											.	SPTBN5	91	0			c.A26G						.						59.0	63.0	61.0					15																	42185565		2043	4192	6235	SO:0001583	missense	51332	exon2			CGAATGTGGCCCG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.131A>G	15.37:g.42185565T>C	ENSP00000317790:p.His44Arg	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	24.0	NM_016642		Missense_Mutation	SNP	ENST00000320955.6	37		.	.	.	.	.	.	.	.	.	.	T	18.34	3.601563	0.66445	.	.	ENSG00000137877	ENST00000320955	D	0.95103	-3.61	5.32	2.91	0.33838	Calponin homology domain (1);	0.276491	0.30252	N	0.010049	D	0.85435	0.5696	N	0.17723	0.515	0.24630	N	0.993621	B	0.31599	0.33	B	0.28011	0.085	T	0.72377	-0.4312	10	0.02654	T	1	.	10.2877	0.43577	0.2631:0.0:0.0:0.7369	.	44	Q9NRC6	SPTN5_HUMAN	R	44	ENSP00000317790:H44R	ENSP00000317790:H44R	H	-	2	0	SPTBN5	39972857	0.987000	0.35691	0.355000	0.25773	0.841000	0.47740	2.138000	0.42140	0.292000	0.22492	0.533000	0.62120	CAC	.		0.607	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
ST18	9705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	53050033	53050033	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:53050033G>T	ENST00000276480.7	-	18	2862	c.2179C>A	c.(2179-2181)Cca>Aca	p.P727T		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	727					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TCACATCCTGGTGTTGGACAG	0.463																																					p.P727T		.											.	ST18	95	0			c.C2179A						.						160.0	129.0	139.0					8																	53050033		2203	4300	6503	SO:0001583	missense	9705	exon18			ATCCTGGTGTTGG	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2179C>A	8.37:g.53050033G>T	ENSP00000276480:p.Pro727Thr	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	39.0	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968147	0.92855	.	.	ENSG00000147488	ENST00000276480	T	0.58060	0.36	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.78748	0.4332	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79564	-0.1751	10	0.49607	T	0.09	-13.7446	20.3052	0.98627	0.0:0.0:1.0:0.0	.	727	O60284	ST18_HUMAN	T	727	ENSP00000276480:P727T	ENSP00000276480:P727T	P	-	1	0	ST18	53212586	1.000000	0.71417	0.928000	0.36995	0.888000	0.51559	9.686000	0.98664	2.808000	0.96608	0.655000	0.94253	CCA	.		0.463	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
STAC2	342667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37371219	37371219	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:37371219C>A	ENST00000333461.5	-	6	1126	c.757G>T	c.(757-759)Ggg>Tgg	p.G253W		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	253					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						TCACCAGGCCCCTCCTCAGAG	0.642																																					p.G253W		.											.	STAC2	91	0			c.G757T						.						240.0	214.0	223.0					17																	37371219		2203	4300	6503	SO:0001583	missense	342667	exon6			CAGGCCCCTCCTC	AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.757G>T	17.37:g.37371219C>A	ENSP00000327509:p.Gly253Trp	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	20.0	NM_198993	Q32MA3	Missense_Mutation	SNP	ENST00000333461.5	37	CCDS11335.1	.	.	.	.	.	.	.	.	.	.	c	17.71	3.455943	0.63401	.	.	ENSG00000141750	ENST00000333461	T	0.80909	-1.43	4.75	4.75	0.60458	.	0.615509	0.15526	N	0.257796	T	0.77631	0.4159	L	0.36672	1.1	0.26967	N	0.96568	D	0.57257	0.979	P	0.50231	0.635	T	0.70857	-0.4758	10	0.66056	D	0.02	-9.2732	9.2826	0.37737	0.0:0.9003:0.0:0.0997	.	253	Q6ZMT1	STAC2_HUMAN	W	253	ENSP00000327509:G253W	ENSP00000327509:G253W	G	-	1	0	STAC2	34624745	0.978000	0.34361	1.000000	0.80357	0.992000	0.81027	1.472000	0.35376	2.353000	0.79882	0.556000	0.70494	GGG	.		0.642	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444533.2	NM_198993	
SV2A	9900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149879627	149879627	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:149879627T>A	ENST00000369146.3	-	9	2001	c.1511A>T	c.(1510-1512)cAg>cTg	p.Q504L	SV2A_ENST00000369145.1_Missense_Mutation_p.Q504L	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	504					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	TCGGTGGATCTGATTCTCCAA	0.498																																					p.Q504L		.											.	SV2A	97	0			c.A1511T						.						162.0	158.0	159.0					1																	149879627		2203	4300	6503	SO:0001583	missense	9900	exon9			TGGATCTGATTCT	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1511A>T	1.37:g.149879627T>A	ENSP00000358142:p.Gln504Leu	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	51.0	NM_014849	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	37	CCDS940.1	.	.	.	.	.	.	.	.	.	.	T	15.73	2.920403	0.52653	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.39229	1.09;1.09	5.26	5.26	0.73747	Major facilitator superfamily domain (1);	0.163230	0.40728	N	0.001028	T	0.29850	0.0746	M	0.74467	2.265	0.80722	D	1	P	0.36027	0.533	B	0.36418	0.224	T	0.12451	-1.0547	10	0.25106	T	0.35	-15.2338	13.1692	0.59589	0.0:0.0:0.0:1.0	.	504	Q7L0J3	SV2A_HUMAN	L	504	ENSP00000358142:Q504L;ENSP00000358141:Q504L	ENSP00000358141:Q504L	Q	-	2	0	SV2A	148146251	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.868000	0.87116	2.213000	0.71641	0.454000	0.30748	CAG	.		0.498	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
TBC1D28	254272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18541690	18541690	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:18541690C>T	ENST00000345096.4	-	7	1022	c.323G>A	c.(322-324)gGc>gAc	p.G108D	TBC1D28_ENST00000405044.1_Missense_Mutation_p.G108D			Q2M2D7	TBC28_HUMAN	TBC1 domain family, member 28	108	Rab-GAP TBC.						Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(5)|lung(2)|ovary(1)	9						CAACGCCCGGCCCCGCACCGC	0.507																																					p.G108D		.											.	TBC1D28	91	0			c.G323A						.						116.0	117.0	117.0					17																	18541690		1923	4127	6050	SO:0001583	missense	254272	exon8			GCCCGGCCCCGCA		CCDS42273.1	17p11.2	2008-10-27			ENSG00000189375	ENSG00000189375			26858	protein-coding gene	gene with protein product							Standard	NM_001039397		Approved	FLJ40244	uc002gud.2	Q2M2D7	OTTHUMG00000059054	ENST00000345096.4:c.323G>A	17.37:g.18541690C>T	ENSP00000339973:p.Gly108Asp	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	54.0	NM_001039397	Q2M2E1	Missense_Mutation	SNP	ENST00000345096.4	37	CCDS42273.1	.	.	.	.	.	.	.	.	.	.	N	11.40	1.626577	0.28978	.	.	ENSG00000189375	ENST00000345096;ENST00000405044	T;T	0.12672	2.66;2.66	0.185	0.185	0.15096	Rab-GAP/TBC domain (2);	0.064020	0.64402	U	0.000008	T	0.34803	0.0910	M	0.87547	2.89	0.09310	N	1	D	0.89917	1.0	D	0.75020	0.985	T	0.06058	-1.0848	9	0.66056	D	0.02	.	.	.	.	.	108	Q2M2D7	TBC28_HUMAN	D	108	ENSP00000339973:G108D;ENSP00000385821:G108D	ENSP00000339973:G108D	G	-	2	0	TBC1D28	18482415	0.853000	0.29707	0.001000	0.08648	0.001000	0.01503	2.423000	0.44705	0.293000	0.22520	0.298000	0.19748	GGC	.		0.507	TBC1D28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130672.2	NM_001039397	
TCN2	6948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31006953	31006953	+	Missense_Mutation	SNP	A	A	G	rs556464879		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr22:31006953A>G	ENST00000215838.3	+	2	654	c.160A>G	c.(160-162)Atc>Gtc	p.I54V	TCN2_ENST00000405742.3_Missense_Mutation_p.I54V|TCN2_ENST00000407817.3_Missense_Mutation_p.I54V			P20062	TCO2_HUMAN	transcobalamin II	54					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAACCCCAGCATCTATGTGGG	0.557																																					p.I54V		.											.	TCN2	90	0			c.A160G						.						196.0	183.0	187.0					22																	31006953		2203	4300	6503	SO:0001583	missense	6948	exon2			CCCAGCATCTATG		CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.160A>G	22.37:g.31006953A>G	ENSP00000215838:p.Ile54Val	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	29.0	NM_001184726	Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	ENST00000215838.3	37	CCDS13881.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.802737	0.31869	.	.	ENSG00000185339	ENST00000215838;ENST00000423350;ENST00000405742;ENST00000407817	T;T;T;T	0.41400	1.39;1.39;1.39;1.0	6.16	-1.24	0.09435	.	0.312746	0.39407	N	0.001362	T	0.19927	0.0479	N	0.17723	0.515	0.80722	D	1	B;B;B	0.12630	0.006;0.003;0.003	B;B;B	0.20184	0.028;0.021;0.021	T	0.17228	-1.0376	10	0.10377	T	0.69	-18.156	6.2067	0.20606	0.3659:0.3603:0.2738:0.0	.	54;54;54	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	V	54	ENSP00000215838:I54V;ENSP00000411529:I54V;ENSP00000385914:I54V;ENSP00000384914:I54V	ENSP00000215838:I54V	I	+	1	0	TCN2	29336953	0.860000	0.29831	0.965000	0.40720	0.966000	0.64601	-0.187000	0.09656	-0.629000	0.05575	-0.280000	0.10049	ATC	.		0.557	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321282.2	NM_000355	
TGFBRAP1	9392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	105890085	105890085	+	Silent	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:105890085T>A	ENST00000393359.2	-	9	2154	c.1728A>T	c.(1726-1728)ccA>ccT	p.P576P	TGFBRAP1_ENST00000258449.1_Silent_p.P576P			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	576					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						TAATGTCGTCTGGATTAAAAC	0.438																																					p.P576P	Esophageal Squamous(183;794 2019 9730 21801 48859)	.											.	TGFBRAP1	91	0			c.A1728T						.						216.0	207.0	210.0					2																	105890085		2203	4300	6503	SO:0001819	synonymous_variant	9392	exon9			GTCGTCTGGATTA	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.1728A>T	2.37:g.105890085T>A		Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	49.0	NM_004257	A8K5R7|D3DVJ8|O60466	Silent	SNP	ENST00000393359.2	37	CCDS2067.1																																																																																			.		0.438	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
THBS2	7058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	169639734	169639734	+	Silent	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:169639734T>C	ENST00000366787.3	-	8	1338	c.1089A>G	c.(1087-1089)ccA>ccG	p.P363P	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	363	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CCACAAAGGATGGACTGGCGC	0.488																																					p.P363P	Esophageal Squamous(91;219 1934 18562 44706)	.											.	THBS2	95	0			c.A1089G						.						81.0	60.0	67.0					6																	169639734		2201	4298	6499	SO:0001819	synonymous_variant	7058	exon8			AAAGGATGGACTG		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1089A>G	6.37:g.169639734T>C		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	17.0	NM_003247	A6H8N1|A7E232|Q5RI52	Silent	SNP	ENST00000366787.3	37	CCDS34574.1																																																																																			.		0.488	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
TLL1	7092	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	166996136	166996136	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:166996136T>A	ENST00000061240.2	+	17	2942	c.2295T>A	c.(2293-2295)aaT>aaA	p.N765K	TLL1_ENST00000507499.1_Missense_Mutation_p.N788K	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	765	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TACATGACAATAAACATGATT	0.403																																					p.N765K		.											.	TLL1	158	0			c.T2295A						.						289.0	239.0	256.0					4																	166996136		2203	4300	6503	SO:0001583	missense	7092	exon17			TGACAATAAACAT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2295T>A	4.37:g.166996136T>A	ENSP00000061240:p.Asn765Lys	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	17.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	T	13.58	2.280481	0.40294	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	D;D	0.96522	-4.04;-4.04	5.72	-1.6	0.08426	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.97241	0.9098	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.99	D	0.95944	0.8949	10	0.62326	D	0.03	.	13.255	0.60073	0.0:0.534:0.0:0.466	.	788;765	E9PD25;O43897	.;TLL1_HUMAN	K	765;788	ENSP00000061240:N765K;ENSP00000426082:N788K	ENSP00000061240:N765K	N	+	3	2	TLL1	167215586	0.942000	0.31987	0.996000	0.52242	0.007000	0.05969	0.081000	0.14823	-0.155000	0.11098	-0.924000	0.02725	AAT	.		0.403	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
TMCC3	57458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	94972248	94972248	+	Silent	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr12:94972248T>A	ENST00000261226.4	-	3	1184	c.1053A>T	c.(1051-1053)acA>acT	p.T351T	TMCC3_ENST00000551457.1_Silent_p.T320T	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	351						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						TCAGGTTGGCTGTCTCATGCT	0.562																																					p.T351T		.											.	TMCC3	92	0			c.A1053T						.						92.0	76.0	82.0					12																	94972248		2203	4300	6503	SO:0001819	synonymous_variant	57458	exon3			GTTGGCTGTCTCA	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.1053A>T	12.37:g.94972248T>A		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	31.0	NM_020698	Q8IWB2	Silent	SNP	ENST00000261226.4	37	CCDS31877.1																																																																																			.		0.562	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
TOP3A	7156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18193874	18193874	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr17:18193874T>A	ENST00000321105.5	-	13	1808	c.1594A>T	c.(1594-1596)Att>Ttt	p.I532F	TOP3A_ENST00000542570.1_Missense_Mutation_p.I437F|TOP3A_ENST00000540524.1_Missense_Mutation_p.I62F	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	532					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						CACTGACCAATGCCATGCTTC	0.552																																					p.I532F		.											.	TOP3A	228	0			c.A1594T						.						58.0	45.0	49.0					17																	18193874		2203	4300	6503	SO:0001583	missense	7156	exon13			GACCAATGCCATG	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.1594A>T	17.37:g.18193874T>A	ENSP00000321636:p.Ile532Phe	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	11.0	NM_004618	A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	ENST00000321105.5	37	CCDS11194.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.382966	0.61845	.	.	ENSG00000177302	ENST00000321105;ENST00000540524;ENST00000542570	T;T;T	0.37915	1.17;1.17;1.17	5.66	5.66	0.87406	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);DNA topoisomerase, type IA, central region, subdomain 1 (1);	0.000000	0.85682	D	0.000000	T	0.75583	0.3869	H	0.98682	4.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85866	0.1413	10	0.87932	D	0	.	15.8887	0.79273	0.0:0.0:0.0:1.0	.	437;532	B4DK80;Q13472	.;TOP3A_HUMAN	F	532;62;437	ENSP00000321636:I532F;ENSP00000446425:I62F;ENSP00000442336:I437F	ENSP00000321636:I532F	I	-	1	0	TOP3A	18134599	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	7.965000	0.87945	2.154000	0.67381	0.460000	0.39030	ATT	.		0.552	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
TPP2	7174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103288606	103288606	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr13:103288606T>A	ENST00000376065.4	+	13	1578	c.1542T>A	c.(1540-1542)aaT>aaA	p.N514K	TPP2_ENST00000376052.3_Missense_Mutation_p.N514K	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	514					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCGTTCAGAATACATCATTTG	0.363																																					p.N514K		.											.	TPP2	92	0			c.T1542A						.						93.0	84.0	87.0					13																	103288606		2203	4300	6503	SO:0001583	missense	7174	exon13			TCAGAATACATCA	M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.1542T>A	13.37:g.103288606T>A	ENSP00000365233:p.Asn514Lys	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	61.0	NM_003291	Q5VZU8	Missense_Mutation	SNP	ENST00000376065.4	37	CCDS9502.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.886737	0.51908	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.41065	1.01;1.01	5.96	-2.27	0.06846	.	0.183525	0.64402	D	0.000020	T	0.30634	0.0771	L	0.43923	1.385	0.49051	D	0.99974	B	0.26318	0.146	B	0.22152	0.038	T	0.10965	-1.0607	10	0.59425	D	0.04	.	11.5795	0.50883	0.0:0.4156:0.0:0.5844	.	514	P29144	TPP2_HUMAN	K	514	ENSP00000365233:N514K;ENSP00000365220:N514K	ENSP00000365220:N514K	N	+	3	2	TPP2	102086607	0.976000	0.34144	0.993000	0.49108	0.998000	0.95712	0.116000	0.15561	-0.276000	0.09206	0.533000	0.62120	AAT	.		0.363	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045683.2		
TRERF1	55809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42200563	42200563	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr6:42200563T>C	ENST00000372922.4	-	17	3696	c.3134A>G	c.(3133-3135)aAg>aGg	p.K1045R	TRERF1_ENST00000340840.2_Missense_Mutation_p.K974R|TRERF1_ENST00000354325.2_Missense_Mutation_p.K962R|TRERF1_ENST00000372917.4_Missense_Mutation_p.K974R|TRERF1_ENST00000541110.1_Missense_Mutation_p.K1065R	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1045	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACCTCGGGCCTTGGTCACCTG	0.612																																					p.K1045R		.											.	TRERF1	230	0			c.A3134G						.						43.0	37.0	39.0					6																	42200563		2203	4300	6503	SO:0001583	missense	55809	exon17			CGGGCCTTGGTCA	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3134A>G	6.37:g.42200563T>C	ENSP00000362013:p.Lys1045Arg	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	12.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.282926	0.59867	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	5.54	5.54	0.83059	.	0.224693	0.30999	N	0.008446	T	0.29850	0.0746	N	0.24115	0.695	0.37052	D	0.897636	D;D;D;D;P	0.71674	0.998;0.997;0.997;0.998;0.497	D;D;D;D;B	0.80764	0.994;0.985;0.985;0.994;0.242	T	0.12400	-1.0549	10	0.33141	T	0.24	-5.4772	15.7331	0.77822	0.0:0.0:0.0:1.0	.	962;1065;1045;801;813	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	R	1065;974;1045;974;962	ENSP00000439689:K1065R;ENSP00000362008:K974R;ENSP00000362013:K1045R;ENSP00000339438:K974R;ENSP00000346285:K962R	ENSP00000339438:K974R	K	-	2	0	TRERF1	42308541	1.000000	0.71417	0.994000	0.49952	0.994000	0.84299	5.505000	0.66981	2.123000	0.65237	0.477000	0.44152	AAG	.		0.612	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
TRIM4	89122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99506413	99506413	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr7:99506413A>G	ENST00000355947.2	-	4	719	c.590T>C	c.(589-591)aTg>aCg	p.M197T	TRIM4_ENST00000349062.2_Missense_Mutation_p.M171T|TRIM4_ENST00000354241.5_Missense_Mutation_p.M171T	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	197					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				GCTGATTCTCATTCGCTGACT	0.428																																					p.M197T		.											.	TRIM4	227	0			c.T590C						.						128.0	118.0	121.0					7																	99506413		2203	4300	6503	SO:0001583	missense	89122	exon4			ATTCTCATTCGCT	AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.590T>C	7.37:g.99506413A>G	ENSP00000348216:p.Met197Thr	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	30.0	NM_033017	A4D298|Q75MK1|Q96F06|Q9C036	Missense_Mutation	SNP	ENST00000355947.2	37	CCDS5679.1	.	.	.	.	.	.	.	.	.	.	A	3.136	-0.177375	0.06380	.	.	ENSG00000146833	ENST00000355947;ENST00000349062;ENST00000542799;ENST00000354241	T;T;T	0.04406	3.63;3.63;3.63	2.68	-5.36	0.02689	.	.	.	.	.	T	0.02767	0.0083	L	0.36672	1.1	0.09310	N	1	B;B;B	0.33073	0.002;0.358;0.396	B;B;B	0.29785	0.01;0.107;0.05	T	0.38672	-0.9650	9	0.27082	T	0.32	.	0.8981	0.01268	0.2544:0.3383:0.2405:0.1667	.	171;171;197	Q9C037-3;Q9C037-2;Q9C037	.;.;TRIM4_HUMAN	T	197;171;27;171	ENSP00000348216:M197T;ENSP00000275736:M171T;ENSP00000346186:M171T	ENSP00000275736:M171T	M	-	2	0	TRIM4	99344349	0.000000	0.05858	0.000000	0.03702	0.846000	0.48090	-0.143000	0.10296	-1.355000	0.02186	-0.263000	0.10527	ATG	.		0.428	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345050.1	NM_033017	
TRIM52	84851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180684462	180684462	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr5:180684462G>T	ENST00000327767.4	-	2	1151	c.847C>A	c.(847-849)Ctt>Att	p.L283I	CTC-338M12.4_ENST00000505151.1_RNA|TRIM52_ENST00000514805.1_5'Flank|CTC-338M12.4_ENST00000511331.1_RNA|AC008443.1_ENST00000599439.1_3'UTR|CTC-338M12.4_ENST00000417281.2_RNA|CTC-338M12.4_ENST00000506340.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	283					positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		TCTATCTGAAGTATTCCCACC	0.333																																					p.L283I		.											.	TRIM52	90	0			c.C847A						.						129.0	114.0	119.0					5																	180684462		2201	4300	6501	SO:0001583	missense	84851	exon2			TCTGAAGTATTCC		CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.847C>A	5.37:g.180684462G>T	ENSP00000332152:p.Leu283Ile	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	42.0	NM_032765		Missense_Mutation	SNP	ENST00000327767.4	37	CCDS4467.1	.	.	.	.	.	.	.	.	.	.	g	1.308	-0.602894	0.03744	.	.	ENSG00000183718	ENST00000327767	T	0.22743	1.94	2.24	0.374	0.16183	.	.	.	.	.	T	0.08537	0.0212	N	0.08118	0	0.09310	N	1	B	0.27192	0.171	B	0.15870	0.014	T	0.26677	-1.0096	9	0.52906	T	0.07	.	3.5641	0.07893	0.1607:0.2636:0.5757:0.0	.	283	Q96A61	TRI52_HUMAN	I	283	ENSP00000332152:L283I	ENSP00000332152:L283I	L	-	1	0	TRIM52	180617068	0.000000	0.05858	0.086000	0.20670	0.183000	0.23260	-0.421000	0.07053	0.062000	0.16340	0.561000	0.74099	CTT	.		0.333	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253572.3	NM_032765	
TSHZ3	57616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	31768760	31768760	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:31768760T>G	ENST00000240587.4	-	2	2266	c.1939A>C	c.(1939-1941)Agc>Cgc	p.S647R		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	647					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ACTTCGCTGCTACATGGGGAG	0.617																																					p.S647R		.											.	TSHZ3	232	0			c.A1939C						.						22.0	25.0	24.0					19																	31768760		2192	4283	6475	SO:0001583	missense	57616	exon2			CGCTGCTACATGG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1939A>C	19.37:g.31768760T>G	ENSP00000240587:p.Ser647Arg	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	21.0	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	37	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	T	7.367	0.626095	0.14257	.	.	ENSG00000121297	ENST00000240587	T	0.44482	0.92	5.41	0.989	0.19802	.	0.221279	0.53938	D	0.000052	T	0.29976	0.0750	L	0.43152	1.355	0.43296	D	0.995287	B	0.06786	0.001	B	0.04013	0.001	T	0.08493	-1.0719	10	0.21540	T	0.41	-12.8003	9.2101	0.37313	0.0:0.3575:0.0:0.6425	.	647	Q63HK5	TSH3_HUMAN	R	647	ENSP00000240587:S647R	ENSP00000240587:S647R	S	-	1	0	TSHZ3	36460600	1.000000	0.71417	0.902000	0.35471	0.514000	0.34195	2.073000	0.41519	-0.172000	0.10779	0.477000	0.44152	AGC	.		0.617	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
TSTA3	7264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144698802	144698802	+	Silent	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr8:144698802T>G	ENST00000425753.2	-	2	184	c.81A>C	c.(79-81)gtA>gtC	p.V27V	TSTA3_ENST00000529064.1_Silent_p.V27V	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	27					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CTCCATCTGCTACCACCTTCT	0.562																																					p.V27V		.											.	TSTA3	91	0			c.A81C						.						192.0	169.0	177.0					8																	144698802		2203	4300	6503	SO:0001819	synonymous_variant	7264	exon2			ATCTGCTACCACC	U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.81A>C	8.37:g.144698802T>G		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	43.0	NM_003313	B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Silent	SNP	ENST00000425753.2	37	CCDS6408.1																																																																																			.		0.562	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382263.1	NM_003313	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	179641996	179641996	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:179641996A>G	ENST00000591111.1	-	27	4918	c.4694T>C	c.(4693-4695)gTc>gCc	p.V1565A	TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V1519A|TTN_ENST00000460472.2_Missense_Mutation_p.V1519A|TTN_ENST00000342175.6_Missense_Mutation_p.V1519A|TTN_ENST00000589042.1_Missense_Mutation_p.V1565A|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V1565A|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.V1565A|TTN-AS1_ENST00000610005.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12422	Ig-like 7.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTATATTGACATTTTTCAG	0.398																																					p.V1565A		.											.	TTN	636	0			c.T4694C						.						126.0	118.0	120.0					2																	179641996		2203	4300	6503	SO:0001583	missense	7273	exon27			ATATTGACATTTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4694T>C	2.37:g.179641996A>G	ENSP00000465570:p.Val1565Ala	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	22.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	8.113	0.779292	0.16120	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47	5.9	5.9	0.94986	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65873	0.2733	L	0.52011	1.625	0.28910	N	0.892782	B;B;B;B;B	0.34329	0.052;0.052;0.052;0.052;0.449	B;B;B;B;B	0.26094	0.055;0.055;0.055;0.055;0.066	T	0.67225	-0.5724	9	0.87932	D	0	.	16.3228	0.82958	1.0:0.0:0.0:0.0	.	1519;1519;1519;1565;1565	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	A	1565;1519;1519;1519;1519;1565	ENSP00000343764:V1565A;ENSP00000434586:V1519A;ENSP00000340554:V1519A;ENSP00000352154:V1519A;ENSP00000354117:V1565A	ENSP00000340554:V1519A	V	-	2	0	TTN	179350241	1.000000	0.71417	0.996000	0.52242	0.143000	0.21401	9.265000	0.95647	2.262000	0.75019	0.528000	0.53228	GTC	.		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TUBB1	81027	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57599165	57599165	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr20:57599165T>A	ENST00000217133.1	+	4	952	c.683T>A	c.(682-684)cTa>cAa	p.L228Q		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	228					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	CTCAACCACCTAGTGTCCTTG	0.572																																					p.L228Q		.											.	TUBB1	227	0			c.T683A						.						136.0	117.0	124.0					20																	57599165		2203	4300	6503	SO:0001583	missense	81027	exon4			ACCACCTAGTGTC	AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.683T>A	20.37:g.57599165T>A	ENSP00000217133:p.Leu228Gln	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	27.0	NM_030773		Missense_Mutation	SNP	ENST00000217133.1	37	CCDS13475.1	.	.	.	.	.	.	.	.	.	.	T	19.29	3.798708	0.70567	.	.	ENSG00000101162	ENST00000217133	T	0.72051	-0.62	5.19	5.19	0.71726	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.85682	D	0.000000	D	0.89347	0.6689	H	0.97659	4.05	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.92886	0.6327	10	0.87932	D	0	.	14.1922	0.65646	0.0:0.0:0.0:1.0	.	228	Q9H4B7	TBB1_HUMAN	Q	228	ENSP00000217133:L228Q	ENSP00000217133:L228Q	L	+	2	0	TUBB1	57032560	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	8.040000	0.89188	1.966000	0.57179	0.459000	0.35465	CTA	.		0.572	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079903.1	NM_030773	
TUBGCP6	85378	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50682173	50682173	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr22:50682173G>A	ENST00000248846.5	-	1	820	c.716C>T	c.(715-717)gCg>gTg	p.A239V	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.A239V|HDAC10_ENST00000498366.1_5'Flank|MAPK12_ENST00000497036.1_5'Flank			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	239					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGAGAGGTCCGCATTGTCTGG	0.542																																					p.A239V		.											.	TUBGCP6	93	0			c.C716T						.						43.0	47.0	46.0					22																	50682173		2203	4300	6503	SO:0001583	missense	85378	exon1			AGGTCCGCATTGT	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.716C>T	22.37:g.50682173G>A	ENSP00000248846:p.Ala239Val	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	4.0	NM_020461	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	37	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012525	0.75161	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.15718	2.78;2.4	3.89	2.87	0.33458	.	0.155218	0.43416	D	0.000575	T	0.23014	0.0556	M	0.65975	2.015	0.35698	D	0.81535	D;D;D	0.64830	0.988;0.977;0.994	P;P;P	0.48654	0.51;0.585;0.543	T	0.31861	-0.9928	10	0.25106	T	0.35	.	11.0151	0.47685	0.0929:0.0:0.9071:0.0	.	239;239;239	A7E2V7;B2RWN4;Q96RT7	.;.;GCP6_HUMAN	V	239	ENSP00000248846:A239V;ENSP00000397387:A239V	ENSP00000248846:A239V	A	-	2	0	TUBGCP6	49024300	1.000000	0.71417	0.578000	0.28575	0.880000	0.50808	4.235000	0.58666	0.851000	0.35264	0.555000	0.69702	GCG	.		0.542	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
UBQLN1	29979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	86284174	86284174	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr9:86284174G>T	ENST00000376395.4	-	7	1697	c.1174C>A	c.(1174-1176)Caa>Aaa	p.Q392K	UBQLN1_ENST00000257468.7_Missense_Mutation_p.Q392K	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	392					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						AACATGTTTTGCATCAGTTGT	0.388																																					p.Q392K	Melanoma(186;1284 2073 12755 14558 18426)	.											.	UBQLN1	90	0			c.C1174A						.						145.0	128.0	134.0					9																	86284174		2203	4300	6503	SO:0001583	missense	29979	exon7			TGTTTTGCATCAG	AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.1174C>A	9.37:g.86284174G>T	ENSP00000365576:p.Gln392Lys	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	32.0	NM_053067	Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Missense_Mutation	SNP	ENST00000376395.4	37	CCDS6663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.317598|4.317598	0.81469|0.81469	.|.	.|.	ENSG00000135018|ENSG00000135018	ENST00000526134|ENST00000376395;ENST00000257468	.|T;T	.|0.54071	.|1.09;0.59	5.72|5.72	5.72|5.72	0.89469|0.89469	.|Heat shock chaperonin-binding (1);	.|0.077207	.|0.53938	.|D	.|0.000042	.|T	.|0.61438	.|0.2347	M|M	0.82823|0.82823	2.61|2.61	0.80722|0.80722	D|D	1|1	.|B;P	.|0.45348	.|0.354;0.856	.|B;B	.|0.42030	.|0.373;0.263	.|T	.|0.64563	.|-0.6378	.|10	.|0.34782	.|T	.|0.22	.|.	19.8548|19.8548	0.96752|0.96752	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|392;392	.|Q9UMX0-2;Q9UMX0	.|.;UBQL1_HUMAN	X|K	11|392	.|ENSP00000365576:Q392K;ENSP00000257468:Q392K	.|ENSP00000257468:Q392K	C|Q	-|-	3|1	2|0	UBQLN1|UBQLN1	85473994|85473994	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.471000|9.471000	0.97696|0.97696	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	TGC|CAA	.		0.388	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000052834.1	NM_013438	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210818961	210818961	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:210818961A>G	ENST00000439458.1	+	47	7306	c.7226A>G	c.(7225-7227)cAg>cGg	p.Q2409R	UNC80_ENST00000272845.6_Missense_Mutation_p.Q2404R	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2409					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ACGTCCCTACAGGCCCTTTTG	0.473																																					p.Q2409R		.											.	UNC80	90	0			c.A7226G						.						103.0	109.0	107.0					2																	210818961		692	1591	2283	SO:0001583	missense	285175	exon47			CCCTACAGGCCCT	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.7226A>G	2.37:g.210818961A>G	ENSP00000391088:p.Gln2409Arg	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	31.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	14.24	2.476641	0.44044	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.27720	1.65;1.65	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.27205	0.0667	N	0.04090	-0.28	0.80722	D	1	P	0.48294	0.908	D	0.64144	0.922	T	0.08973	-1.0696	10	0.06365	T	0.9	-14.4498	14.3186	0.66470	1.0:0.0:0.0:0.0	.	2409	Q8N2C7	UNC80_HUMAN	R	2409;2404	ENSP00000391088:Q2409R;ENSP00000272845:Q2404R	ENSP00000272845:Q2404R	Q	+	2	0	UNC80	210527206	1.000000	0.71417	0.989000	0.46669	0.555000	0.35460	9.305000	0.96197	1.872000	0.54250	0.533000	0.62120	CAG	.		0.473	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
USP53	54532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	120189490	120189490	+	Silent	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:120189490G>A	ENST00000274030.6	+	14	2382	c.1203G>A	c.(1201-1203)aaG>aaA	p.K401K	USP53_ENST00000450251.1_Silent_p.K401K	NM_019050.2	NP_061923.2			ubiquitin specific peptidase 53											breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	27						ATCAGGCAAAGCAGAGAGAAA	0.343																																					p.K401K		.											.	USP53	660	0			c.G1203A						.						67.0	63.0	65.0					4																	120189490		1828	4089	5917	SO:0001819	synonymous_variant	54532	exon13			GGCAAAGCAGAGA	BC017382	CCDS43265.1	4q26	2010-05-12	2005-08-08		ENSG00000145390	ENSG00000145390		"""Ubiquitin-specific peptidases"""	29255	protein-coding gene	gene with protein product			"""ubiquitin specific protease 53"""			10718198, 14715245	Standard	NM_019050		Approved	KIAA1350	uc003ics.4	Q70EK8	OTTHUMG00000161331	ENST00000274030.6:c.1203G>A	4.37:g.120189490G>A		Somatic	682.0	0.0		WXS	Illumina HiSeq	Phase_I	663.0	193.0	NM_019050		Silent	SNP	ENST00000274030.6	37	CCDS43265.1																																																																																			.		0.343	USP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364564.2	XM_052597	
VWA3B	200403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	98779401	98779401	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:98779401C>T	ENST00000477737.1	+	8	1280	c.1076C>T	c.(1075-1077)gCc>gTc	p.A359V	VWA3B_ENST00000451075.2_Missense_Mutation_p.A209V|VWA3B_ENST00000435344.1_Missense_Mutation_p.A359V	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	359										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AGGCTGGTGGCCGAGCCTCCC	0.562																																					p.A359V		.											.	VWA3B	139	0			c.C1076T						.						51.0	59.0	57.0					2																	98779401		2076	4228	6304	SO:0001583	missense	200403	exon8			TGGTGGCCGAGCC	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.1076C>T	2.37:g.98779401C>T	ENSP00000417955:p.Ala359Val	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	21.0	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	C	8.571	0.880069	0.17467	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.22945	1.93;3.37;2.48	4.68	0.144	0.14824	.	0.974484	0.08412	N	0.949710	T	0.19565	0.0470	L	0.47716	1.5	0.09310	N	1	B;B;B	0.26318	0.146;0.085;0.029	B;B;B	0.19666	0.014;0.026;0.005	T	0.28038	-1.0056	10	0.31617	T	0.26	.	5.6348	0.17530	0.5569:0.3416:0.0:0.1015	.	209;359;359	B7Z7Q7;Q502W6;Q502W6-8	.;VWA3B_HUMAN;.	V	359;359;209	ENSP00000401959:A359V;ENSP00000417955:A359V;ENSP00000389463:A209V	ENSP00000411168:A359V	A	+	2	0	VWA3B	98145833	0.000000	0.05858	0.024000	0.17045	0.910000	0.53928	0.157000	0.16402	0.155000	0.19261	0.650000	0.86243	GCC	.		0.562	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
WFDC3	140686	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44417609	44417609	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr20:44417609T>G	ENST00000243938.4	-	3	255	c.172A>C	c.(172-174)Acc>Ccc	p.T58P	WFDC3_ENST00000481847.1_Intron|WFDC3_ENST00000372630.2_Intron|DNTTIP1_ENST00000372622.3_5'Flank|WFDC3_ENST00000372632.2_Missense_Mutation_p.T58P	NM_080614.1	NP_542181.1	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3	58	WAP 1. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(3)|prostate(1)	5		Myeloproliferative disorder(115;0.0122)				CAGCCTGTGGTGCAGCACTTC	0.517																																					p.T58P		.											.	WFDC3	90	0			c.A172C						.						231.0	210.0	217.0					20																	44417609		2203	4300	6503	SO:0001583	missense	140686	exon3			CTGTGGTGCAGCA	AL050348	CCDS33478.1	20q13.12	2013-01-21			ENSG00000124116	ENSG00000124116		"""WAP four-disulfide core domain containing"""	15957	protein-coding gene	gene with protein product						12206714, 10680116	Standard	NM_080614		Approved	dJ447F3.3, WAP14	uc002xpf.1	Q8IUB2	OTTHUMG00000032614	ENST00000243938.4:c.172A>C	20.37:g.44417609T>G	ENSP00000243938:p.Thr58Pro	Somatic	78.0	1.0		WXS	Illumina HiSeq	Phase_I	92.0	24.0	NM_080614	A6PVF2|Q0P6A5|Q3T1C5|Q8TC52|Q9BQP3|Q9BQP4	Missense_Mutation	SNP	ENST00000243938.4	37	CCDS33478.1	.	.	.	.	.	.	.	.	.	.	T	6.372	0.436679	0.12104	.	.	ENSG00000124116	ENST00000243938;ENST00000372632	T;T	0.72282	-0.64;-0.64	3.57	2.42	0.29668	Whey acidic protein, 4-disulphide core (5);	0.600692	0.13876	N	0.356649	T	0.44371	0.1290	N	0.02275	-0.615	0.42780	D	0.993869	B	0.33919	0.432	B	0.36608	0.229	T	0.29150	-1.0021	10	0.40728	T	0.16	-3.1762	7.1948	0.25847	0.0:0.0:0.2285:0.7715	.	58	Q8IUB2	WFDC3_HUMAN	P	58	ENSP00000243938:T58P;ENSP00000361715:T58P	ENSP00000243938:T58P	T	-	1	0	WFDC3	43851016	0.773000	0.28580	0.417000	0.26559	0.396000	0.30629	0.972000	0.29409	0.502000	0.28037	-0.313000	0.08912	ACC	.		0.517	WFDC3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316858.1		
ZDBF2	57683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	207176232	207176232	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr2:207176232A>T	ENST00000374423.3	+	5	7366	c.6980A>T	c.(6979-6981)gAt>gTt	p.D2327V		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2327							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGAGCATATGATCTGAGAAGC	0.458																																					p.D2327V		.											.	ZDBF2	3	0			c.A6980T						.						46.0	47.0	47.0					2																	207176232		1934	4147	6081	SO:0001583	missense	57683	exon5			CATATGATCTGAG	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6980A>T	2.37:g.207176232A>T	ENSP00000363545:p.Asp2327Val	Somatic	309.0	0.0		WXS	Illumina HiSeq	Phase_I	289.0	74.0	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	A	13.07	2.128475	0.37533	.	.	ENSG00000204186	ENST00000374423	T	0.50813	0.73	5.09	-10.2	0.00374	.	.	.	.	.	T	0.21468	0.0517	N	0.02011	-0.69	0.09310	N	0.999999	B	0.19706	0.038	B	0.19391	0.025	T	0.42327	-0.9458	9	0.62326	D	0.03	.	18.0918	0.89477	0.1267:0.7882:0.0:0.0851	.	2327	Q9HCK1	ZDBF2_HUMAN	V	2327	ENSP00000363545:D2327V	ENSP00000363545:D2327V	D	+	2	0	ZDBF2	206884477	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.575000	0.05861	-1.159000	0.02807	-0.435000	0.05868	GAT	.		0.458	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
ZFP42	132625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	188924650	188924650	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr4:188924650C>A	ENST00000326866.4	+	4	1097	c.689C>A	c.(688-690)tCa>tAa	p.S230*	ZFP42_ENST00000509524.1_Nonsense_Mutation_p.S230*	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	230					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S230L(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GTTGAGAGCTCAAAACTAAAG	0.493																																					p.S230X		.											.	ZFP42	228	1	Substitution - Missense(1)	lung(1)	c.C689A						.						116.0	122.0	120.0					4																	188924650		2203	4300	6503	SO:0001587	stop_gained	132625	exon4			AGAGCTCAAAACT	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.689C>A	4.37:g.188924650C>A	ENSP00000317686:p.Ser230*	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	39.0	NM_174900	D3DP65|Q8WXE2	Nonsense_Mutation	SNP	ENST00000326866.4	37	CCDS3849.1	.	.	.	.	.	.	.	.	.	.	C	37	6.460024	0.97585	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	.	.	.	4.39	3.52	0.40303	.	0.304578	0.31949	N	0.006809	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5078	0.55991	0.0:0.8301:0.1699:0.0	.	.	.	.	X	230	.	ENSP00000317686:S230X	S	+	2	0	ZFP42	189161644	0.265000	0.24102	0.002000	0.10522	0.009000	0.06853	4.645000	0.61404	1.405000	0.46838	0.655000	0.94253	TCA	.		0.493	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359794.1	NM_174900	
ZFP91	80829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58347078	58347078	+	Silent	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr11:58347078G>A	ENST00000316059.6	+	1	495	c.324G>A	c.(322-324)aaG>aaA	p.K108K	ZFP91-CNTF_ENST00000389919.4_Silent_p.K108K|LPXN_ENST00000528489.1_5'Flank|LPXN_ENST00000528954.1_5'Flank	NM_001197051.1|NM_053023.4	NP_001183980.1|NP_444251.1	Q96JP5	ZFP91_HUMAN	ZFP91 zinc finger protein	108					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein K63-linked ubiquitination (GO:0070534)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TTCAGGGCAAGAAGAGTCCGC	0.677											OREG0020976	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K108K		.											.	ZFP91	91	0			c.G324A						.						15.0	16.0	16.0					11																	58347078		1771	3606	5377	SO:0001819	synonymous_variant	80829	exon1			GGGCAAGAAGAGT	AB056107	CCDS31553.1	11q12	2012-11-27	2012-11-27		ENSG00000186660	ENSG00000186660		"""Zinc fingers, C2H2-type"""	14983	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp91 in mouse"", ""zinc finger protein 91 homolog (mouse)"""			12738986, 20682767	Standard	NM_053023		Approved	PZF, ZNF757	uc001nmx.4	Q96JP5	OTTHUMG00000137391	ENST00000316059.6:c.324G>A	11.37:g.58347078G>A		Somatic	41.0	0.0	1030	WXS	Illumina HiSeq	Phase_I	47.0	12.0	NM_001197051	A6NHC4|A8MSG7|Q86V47|Q96JP4|Q96QA3	Silent	SNP	ENST00000316059.6	37	CCDS31553.1																																																																																			.		0.677	ZFP91-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268674.1	NM_053023	
ZFR2	23217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3820200	3820200	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:3820200G>T	ENST00000262961.4	-	11	1730	c.1720C>A	c.(1720-1722)Ccc>Acc	p.P574T		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	574	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCGCTGGCGGGTGACTCCGGC	0.716																																					p.P574T		.											.	ZFR2	70	0			c.C1720A						.						12.0	16.0	14.0					19																	3820200		2088	4109	6197	SO:0001583	missense	23217	exon11			TGGCGGGTGACTC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.1720C>A	19.37:g.3820200G>T	ENSP00000262961:p.Pro574Thr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	20.0	NM_015174		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.850101	0.32699	.	.	ENSG00000105278	ENST00000262961	T	0.09350	2.99	2.52	0.0452	0.14229	.	0.000000	0.64402	U	0.000005	T	0.18215	0.0437	M	0.82323	2.585	0.09310	N	0.999999	P	0.46784	0.884	P	0.48952	0.596	T	0.07404	-1.0774	10	0.66056	D	0.02	-8.7711	4.5513	0.12114	0.1491:0.4539:0.397:0.0	.	574	Q9UPR6	ZFR2_HUMAN	T	574	ENSP00000262961:P574T	ENSP00000262961:P574T	P	-	1	0	ZFR2	3771200	0.014000	0.17966	0.000000	0.03702	0.005000	0.04900	0.151000	0.16283	-0.037000	0.13646	0.491000	0.48974	CCC	.		0.716	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
ZFYVE20	64145	broad.mit.edu;bcgsc.ca	37	3	15137554	15137554	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:15137554G>T	ENST00000253699.3	-	4	687	c.74C>A	c.(73-75)tCt>tAt	p.S25Y	ZFYVE20_ENST00000449050.1_Missense_Mutation_p.S25Y|ZFYVE20_ENST00000449964.2_5'UTR|ZFYVE20_ENST00000435849.3_Missense_Mutation_p.S25Y|ZFYVE20_ENST00000476527.2_Missense_Mutation_p.S25Y	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20	25					blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						CTGATAGAAAGACTGCAGATC	0.537																																					p.S25Y		.											.	ZFYVE20	92	0			c.C74A						.						177.0	165.0	169.0					3																	15137554		2203	4300	6503	SO:0001583	missense	64145	exon4			TAGAAAGACTGCA	AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.74C>A	3.37:g.15137554G>T	ENSP00000253699:p.Ser25Tyr	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	6.0	NM_022340	B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Missense_Mutation	SNP	ENST00000253699.3	37	CCDS2623.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568600	0.86439	.	.	ENSG00000131381	ENST00000253699;ENST00000476527;ENST00000435849;ENST00000449050;ENST00000507357	T;T;T;T	0.74106	0.43;0.43;-0.81;0.36	5.43	5.43	0.79202	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.055571	0.64402	D	0.000001	D	0.83899	0.5354	M	0.69358	2.11	0.80722	D	1	D;D	0.71674	0.979;0.998	P;P	0.60173	0.692;0.87	D	0.85562	0.1228	10	0.87932	D	0	-17.6732	18.8489	0.92218	0.0:0.0:1.0:0.0	.	25;25	B4DWY8;Q9H1K0	.;RBNS5_HUMAN	Y	25	ENSP00000253699:S25Y;ENSP00000422551:S25Y;ENSP00000391039:S25Y;ENSP00000427038:S25Y	ENSP00000253699:S25Y	S	-	2	0	ZFYVE20	15112558	1.000000	0.71417	0.993000	0.49108	0.429000	0.31625	9.130000	0.94437	2.563000	0.86464	0.555000	0.69702	TCT	.		0.537	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252102.2	NM_022340	
ZMYM4	9202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	35884069	35884069	+	Silent	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr1:35884069A>G	ENST00000314607.6	+	29	4415	c.4335A>G	c.(4333-4335)aaA>aaG	p.K1445K	ZMYM4_ENST00000373297.2_Silent_p.K1356K	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	1445					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCAAGAGGAAACGAAATGAAG	0.398																																					p.K1445K		.											.	ZMYM4	291	0			c.A4335G						.						118.0	111.0	113.0					1																	35884069		2203	4300	6503	SO:0001819	synonymous_variant	9202	exon29			GAGGAAACGAAAT	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.4335A>G	1.37:g.35884069A>G		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	28.0	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Silent	SNP	ENST00000314607.6	37	CCDS389.1	.	.	.	.	.	.	.	.	.	.	A	9.726	1.160948	0.21538	.	.	ENSG00000146463	ENST00000457946	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	T	0.62925	0.2468	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62315	-0.6880	4	.	.	.	-15.3005	10.5374	0.45013	0.9282:0.0:0.0717:0.0	.	.	.	.	A	1104	.	.	T	+	1	0	ZMYM4	35656656	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.539000	0.45718	2.230000	0.72887	0.528000	0.53228	ACG	.		0.398	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
ZNF101	94039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19790802	19790802	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:19790802A>G	ENST00000592502.1	+	4	1114	c.1004A>G	c.(1003-1005)gAa>gGa	p.E335G	ZNF101_ENST00000415784.2_Missense_Mutation_p.E215G|ZNF101_ENST00000444249.2_3'UTR			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						CACACTGGAGAAAGACCTTAT	0.373																																					p.E335G		.											.	ZNF101	92	0			c.A1004G						.						57.0	56.0	56.0					19																	19790802		2203	4300	6503	SO:0001583	missense	94039	exon4			CTGGAGAAAGACC	AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.1004A>G	19.37:g.19790802A>G	ENSP00000468049:p.Glu335Gly	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	33.0	NM_033204	C9JU83|Q0VDG9	Missense_Mutation	SNP	ENST00000592502.1	37	CCDS32971.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.104672	0.37145	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	T;T	0.27557	1.66;1.66	0.235	0.235	0.15431	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32882	0.0844	M	0.83312	2.635	0.25011	N	0.991406	B	0.25312	0.123	B	0.27170	0.077	T	0.34153	-0.9840	8	.	.	.	.	4.8392	0.13481	0.9998:0.0:2.0E-4:0.0	.	335	Q8IZC7	ZN101_HUMAN	G	335;335;215	ENSP00000319716:E335G;ENSP00000400952:E215G	.	E	+	2	0	ZNF101	19651802	0.003000	0.15002	0.181000	0.23098	0.181000	0.23173	0.805000	0.27112	0.263000	0.21812	0.260000	0.18958	GAA	.		0.373	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460559.1	NM_033204	
ZNF174	7727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3458764	3458764	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr16:3458764G>A	ENST00000268655.4	+	3	1654	c.1069G>A	c.(1069-1071)Gga>Aga	p.G357R	ZNF174_ENST00000571936.1_Missense_Mutation_p.G357R	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	357					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						CTACACGTGCGGAGAGTGTGG	0.527																																					p.G357R		.											.	ZNF174	90	0			c.G1069A						.						51.0	59.0	56.0					16																	3458764		2197	4300	6497	SO:0001583	missense	7727	exon3			ACGTGCGGAGAGT	U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.1069G>A	16.37:g.3458764G>A	ENSP00000268655:p.Gly357Arg	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	33.0	NM_003450	Q53Y68|Q9BQ34	Missense_Mutation	SNP	ENST00000268655.4	37	CCDS10504.1	.	.	.	.	.	.	.	.	.	.	G	1.874	-0.459444	0.04508	.	.	ENSG00000103343	ENST00000268655	T	0.17691	2.26	4.72	3.76	0.43208	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.147725	0.31809	N	0.007025	T	0.11024	0.0269	N	0.13272	0.32	0.19300	N	0.999974	D	0.60575	0.988	P	0.47786	0.557	T	0.15178	-1.0446	10	0.17832	T	0.49	.	8.1977	0.31407	0.0:0.1734:0.6469:0.1797	.	357	Q15697	ZN174_HUMAN	R	357	ENSP00000268655:G357R	ENSP00000268655:G357R	G	+	1	0	ZNF174	3398765	0.000000	0.05858	0.065000	0.19835	0.027000	0.11550	-1.233000	0.02934	1.578000	0.49821	-0.176000	0.13171	GGA	.		0.527	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251510.1	NM_003450	
ZNF180	7733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44981527	44981527	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:44981527T>G	ENST00000221327.4	-	5	1452	c.1171A>C	c.(1171-1173)Agc>Cgc	p.S391R	ZNF180_ENST00000592529.1_Missense_Mutation_p.S364R|ZNF180_ENST00000391956.4_Missense_Mutation_p.S366R|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				GAGCTCCGGCTGAAGGATTTT	0.463																																					p.S391R	Esophageal Squamous(180;1353 2003 32862 46574 49854)	.											.	ZNF180	92	0			c.A1171C						.						68.0	70.0	69.0					19																	44981527		2203	4300	6503	SO:0001583	missense	7733	exon5			TCCGGCTGAAGGA	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1171A>C	19.37:g.44981527T>G	ENSP00000221327:p.Ser391Arg	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	37.0	NM_013256	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	37	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	T	0.395	-0.921267	0.02396	.	.	ENSG00000167384	ENST00000221327;ENST00000391956	T;T	0.07567	3.18;3.18	5.47	0.616	0.17613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.277746	0.25938	N	0.027321	T	0.05227	0.0139	N	0.26130	0.795	0.09310	N	0.999995	B;B;B	0.14012	0.008;0.009;0.009	B;B;B	0.11329	0.004;0.006;0.006	T	0.33240	-0.9876	10	0.44086	T	0.13	-2.6399	5.3941	0.16259	0.0959:0.0672:0.3717:0.4653	.	366;390;391	G5E9B8;Q58F03;Q9UJW8	.;.;ZN180_HUMAN	R	391;366	ENSP00000221327:S391R;ENSP00000375818:S366R	ENSP00000221327:S391R	S	-	1	0	ZNF180	49673367	0.073000	0.21202	0.802000	0.32245	0.000000	0.00434	0.849000	0.27723	-0.220000	0.09988	-2.613000	0.00159	AGC	.		0.463	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
ZNF609	23060	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	64967591	64967591	+	Silent	SNP	T	T	G	rs372733652		TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr15:64967591T>G	ENST00000326648.3	+	4	2666	c.2538T>G	c.(2536-2538)tcT>tcG	p.S846S		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	846						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTGCATACTCTGACATCTCTG	0.502																																					p.S846S		.											.	ZNF609	92	0			c.T2538G						.	T		0,4406		0,0,2203	68.0	70.0	69.0		2538	-11.3	0.4	15		69	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	ZNF609	NM_015042.1		0,1,6501	GG,GT,TT		0.0116,0.0,0.0077		846/1412	64967591	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	23060	exon4			ATACTCTGACATC	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.2538T>G	15.37:g.64967591T>G		Somatic	52.0	1.0		WXS	Illumina HiSeq	Phase_I	34.0	14.0	NM_015042	Q0D2I2	Silent	SNP	ENST00000326648.3	37	CCDS32270.1																																																																																			.		0.502	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	31038966	31038967	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:31038966_31038967GG>TT	ENST00000355537.3	+	4	2587_2588	c.2440_2441GG>TT	c.(2440-2442)GGg>TTg	p.G814L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	814					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCCGCTGTCTGGGCAACCCCCA	0.574																																					p.G814L		.											.	.	.	0			.						.																																			SO:0001583	missense	9745	.			CTGTCTGGGCAAC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		Exception_encountered	19.37:g.31038966_31038967delinsTT	ENSP00000347730:p.Gly814Leu	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	62.0	.	A2RU18	Missense_Mutation	DNP	ENST00000355537.3	37	CCDS32984.1																																																																																			.		0.574	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF793	390927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38024278	38024278	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:38024278G>A	ENST00000587143.1	+	5	446	c.211G>A	c.(211-213)Gca>Aca	p.A71T	ZNF793_ENST00000589319.1_Missense_Mutation_p.A71T|ZNF793_ENST00000542455.1_Missense_Mutation_p.A71T|ZNF793_ENST00000588578.1_Missense_Mutation_p.A71T|ZNF793_ENST00000445217.1_Missense_Mutation_p.A71T|ZNF793_ENST00000587986.1_Missense_Mutation_p.A71T			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	71	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATTGGTGAGGCAGCATGCCC	0.512																																					p.A71T	Melanoma(44;400 1431 1499 19093)	.											.	ZNF793	68	0			c.G211A						.						81.0	84.0	83.0					19																	38024278		1955	4146	6101	SO:0001583	missense	390927	exon7			GGTGAGGCAGCAT	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.211G>A	19.37:g.38024278G>A	ENSP00000468605:p.Ala71Thr	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	60.0	NM_001013659	E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	ENST00000587143.1	37	CCDS46062.1	.	.	.	.	.	.	.	.	.	.	G	5.232	0.228274	0.09916	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	T;T	0.06294	3.32;3.32	3.46	2.38	0.29361	Krueppel-associated box (1);	0.816405	0.09992	N	0.729552	T	0.03827	0.0108	N	0.16833	0.445	0.09310	N	1	B;B	0.27498	0.18;0.018	B;B	0.19391	0.025;0.011	T	0.46219	-0.9207	10	0.15066	T	0.55	.	7.938	0.29941	0.0:0.0:0.7543:0.2457	.	71;71	Q6ZN11;E9PGN4	ZN793_HUMAN;.	T	71;71;71;70	ENSP00000444355:A71T;ENSP00000396402:A71T	ENSP00000318811:A70T	A	+	1	0	ZNF793	42716118	0.023000	0.18921	0.372000	0.25991	0.679000	0.39708	0.332000	0.19751	0.729000	0.32403	0.462000	0.41574	GCA	.		0.512	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
ZNF773	374928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58018610	58018610	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr19:58018610G>C	ENST00000282292.4	+	4	1287	c.1147G>C	c.(1147-1149)Gga>Cga	p.G383R	ZNF773_ENST00000599847.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.G382R|ZNF773_ENST00000593916.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	383					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		AGTTCACACTGGAGAAAAACC	0.423																																					p.G383R		.											.	ZNF773	91	0			c.G1147C						.						107.0	110.0	109.0					19																	58018610		2203	4300	6503	SO:0001583	missense	374928	exon4			CACACTGGAGAAA	BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.1147G>C	19.37:g.58018610G>C	ENSP00000282292:p.Gly383Arg	Somatic	222.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	55.0	NM_198542	Q96DL8	Missense_Mutation	SNP	ENST00000282292.4	37	CCDS33134.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.599732	0.46318	.	.	ENSG00000152439	ENST00000282292	T	0.26223	1.75	1.09	1.09	0.20402	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37517	0.1006	L	0.41632	1.29	0.35383	D	0.790063	D;D	0.89917	1.0;1.0	D;D	0.97110	0.99;1.0	T	0.49890	-0.8891	9	0.72032	D	0.01	.	9.7158	0.40274	0.0:0.0:1.0:0.0	.	382;383	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	R	383	ENSP00000282292:G383R	ENSP00000282292:G383R	G	+	1	0	ZNF773	62710422	0.004000	0.15560	0.996000	0.52242	0.922000	0.55478	0.398000	0.20899	0.880000	0.35969	0.305000	0.20034	GGA	.		0.423	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466475.1	NM_198542	
KAT2B	8850	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	20156480	20156481	+	Splice_Site	DNP	GG	GG	TT			TCGA-LG-A6GG-01A-11D-A30V-10	TCGA-LG-A6GG-10A-01D-A30V-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	85af03fa-9e34-4b29-8897-d39a1b1773e2	b9ec4d89-18c3-4d18-b0cc-43cb9a086ec5	g.chr3:20156480_20156481GG>TT	ENST00000263754.4	+	7	1605	c.1150_1150GG>TT	c.(1150-1152)GGgt>TTggt	p.G384L		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	384					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						CATCCAAACAGGTAAGTTTCCT	0.431																																					.		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	8850	.			CAAACAGGTAAGT	U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	Exception_encountered	3.37:g.20156480_20156481delinsTT		Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	30.0	.	Q6NSK1	Splice_Site	DNP	ENST00000263754.4	37	CCDS2634.1																																																																																			.		0.431	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252880.1	NM_003884	Missense_Mutation
