#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACR	49	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	51183204	51183204	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr22:51183204T>C	ENST00000216139.5	+	5	875	c.835T>C	c.(835-837)Tgg>Cgg	p.W279R	AC002056.5_ENST00000532913.1_RNA|ACR_ENST00000527761.1_3'UTR	NM_001097.2	NP_001088.2	P10323	ACRO_HUMAN	acrosin	279	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acrosome matrix dispersal (GO:0002077)|acrosome reaction (GO:0007340)|activation of adenylate cyclase activity (GO:0007190)|binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|response to steroid hormone (GO:0048545)|single fertilization (GO:0007338)	acrosomal matrix (GO:0043159)|extracellular region (GO:0005576)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|protein complex (GO:0043234)	amidase activity (GO:0004040)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|drug binding (GO:0008144)|fucose binding (GO:0042806)|mannose binding (GO:0005537)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		CACGGCCACCTGGCCCTATCT	0.597																																					p.W279R		.											.	ACR	90	0			c.T835C						.						15.0	16.0	16.0					22																	51183204		2195	4285	6480	SO:0001583	missense	49	exon5			GCCACCTGGCCCT	CR456366	CCDS14101.1	22q13.33	2012-10-23	2012-10-23		ENSG00000100312	ENSG00000100312	3.4.21.10		126	protein-coding gene	gene with protein product	"""preproacrosin"", ""acrosin light and heavy chain prepropeptide"""	102480				2298447, 12398221	Standard	NM_001097		Approved		uc003bnh.4	P10323	OTTHUMG00000150155	ENST00000216139.5:c.835T>C	22.37:g.51183204T>C	ENSP00000216139:p.Trp279Arg	Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	64.0	NM_001097	Q6ICK2	Missense_Mutation	SNP	ENST00000216139.5	37	CCDS14101.1	.	.	.	.	.	.	.	.	.	.	T	13.96	2.391652	0.42410	.	.	ENSG00000100312	ENST00000216139	D	0.88201	-2.35	4.19	1.85	0.25348	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.382752	0.19487	N	0.113087	T	0.81269	0.4787	N	0.01493	-0.835	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.69997	-0.4993	10	0.49607	T	0.09	-14.1835	4.5294	0.11997	0.3359:0.0:0.1731:0.4911	.	279	P10323	ACRO_HUMAN	R	279	ENSP00000216139:W279R	ENSP00000216139:W279R	W	+	1	0	ACR	49530070	0.997000	0.39634	0.603000	0.28903	0.948000	0.59901	1.858000	0.39408	0.629000	0.30376	0.254000	0.18369	TGG	.		0.597	ACR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000316605.2	NM_001097	
ADAM12	8038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127753560	127753560	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr10:127753560G>A	ENST00000368679.4	-	14	1742	c.1433C>T	c.(1432-1434)gCa>gTa	p.A478V	ADAM12_ENST00000467145.1_5'UTR|ADAM12_ENST00000368676.4_Missense_Mutation_p.A478V	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	478	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CGCTGTTCCTGCAGGCTTCAG	0.612																																					p.A478V		.											.	ADAM12	716	0			c.C1433T						.						57.0	56.0	56.0					10																	127753560		2203	4300	6503	SO:0001583	missense	8038	exon14			GTTCCTGCAGGCT	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1433C>T	10.37:g.127753560G>A	ENSP00000357668:p.Ala478Val	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	16.0	NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	ENST00000368679.4	37	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260318	0.80246	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	T;T	0.12879	2.64;2.64	5.26	5.26	0.73747	Disintegrin, conserved site (1);Blood coagulation inhibitor, Disintegrin (6);	0.063944	0.64402	D	0.000008	T	0.43299	0.1241	M	0.85859	2.78	0.80722	D	1	D;D;D;D;D	0.71674	0.98;0.975;0.975;0.975;0.998	P;P;P;P;D	0.67900	0.893;0.828;0.828;0.828;0.954	T	0.45352	-0.9267	10	0.72032	D	0.01	.	19.0783	0.93171	0.0:0.0:1.0:0.0	.	475;475;478;475;478	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	V	478	ENSP00000357668:A478V;ENSP00000357665:A478V	ENSP00000357665:A478V	A	-	2	0	ADAM12	127743550	1.000000	0.71417	0.168000	0.22838	0.347000	0.29111	9.534000	0.98061	2.731000	0.93534	0.650000	0.86243	GCA	.		0.612	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		
ALX1	8092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85677457	85677457	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:85677457G>A	ENST00000316824.3	+	2	489	c.334G>A	c.(334-336)Gag>Aag	p.E112K		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	112					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		AGGGATGCAAGAGAAGGGAGA	0.483																																					p.E112K		.											.	ALX1	24	0			c.G334A						.						119.0	112.0	114.0					12																	85677457		2203	4300	6503	SO:0001583	missense	8092	exon2			ATGCAAGAGAAGG	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.334G>A	12.37:g.85677457G>A	ENSP00000315417:p.Glu112Lys	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	41.0	NM_006982	Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	37	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351348	0.82132	.	.	ENSG00000180318	ENST00000316824	D	0.92446	-3.04	5.62	5.62	0.85841	.	0.185627	0.56097	D	0.000024	D	0.86431	0.5931	N	0.14661	0.345	0.80722	D	1	B	0.19331	0.035	B	0.15484	0.013	T	0.80466	-0.1370	10	0.41790	T	0.15	.	20.0205	0.97499	0.0:0.0:1.0:0.0	.	112	Q15699	ALX1_HUMAN	K	112	ENSP00000315417:E112K	ENSP00000315417:E112K	E	+	1	0	ALX1	84201588	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.383000	0.73172	2.801000	0.96364	0.650000	0.86243	GAG	.		0.483	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	
AMPD3	272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10527413	10527413	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:10527413C>T	ENST00000396554.3	+	15	2654	c.2313C>T	c.(2311-2313)atC>atT	p.I771I	AMPD3_ENST00000444303.2_Silent_p.I603I	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	762					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CAGAAGAGATCACCGCCTTGA	0.433																																					p.I771I		.											.	AMPD3	291	0			c.C2313T						.						135.0	123.0	127.0					11																	10527413		2201	4294	6495	SO:0001819	synonymous_variant	272	exon15			AGAGATCACCGCC	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.2313C>T	11.37:g.10527413C>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	15.0	NM_000480	A0AUX0|B7Z2S2|B7Z763|B7Z877	Silent	SNP	ENST00000396554.3	37	CCDS7802.1																																																																																			.		0.433	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480	
ANPEP	290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	15	90335706	90335706	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr15:90335706C>T	ENST00000300060.6	-	17	2650	c.2337G>A	c.(2335-2337)tgG>tgA	p.W779*		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	779	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	GGTTCTCCATCCACTGCTTGA	0.592																																					p.W779X	NSCLC(30;827 977 2459 19669 26125)	.											.	ANPEP	94	0			c.G2337A						.						156.0	136.0	143.0					15																	90335706		2200	4299	6499	SO:0001587	stop_gained	290	exon17			CTCCATCCACTGC	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2337G>A	15.37:g.90335706C>T	ENSP00000300060:p.Trp779*	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	33.0	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Nonsense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	C	42	9.233115	0.99108	.	.	ENSG00000166825	ENST00000300060	.	.	.	5.3	5.3	0.74995	.	0.142617	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4527	0.83997	0.0:1.0:0.0:0.0	.	.	.	.	X	779	.	ENSP00000300060:W779X	W	-	3	0	ANPEP	88136710	1.000000	0.71417	0.997000	0.53966	0.456000	0.32438	7.683000	0.84093	2.490000	0.84030	0.555000	0.69702	TGG	.		0.592	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
ANPEP	290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90335708	90335708	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr15:90335708A>C	ENST00000300060.6	-	17	2648	c.2335T>G	c.(2335-2337)Tgg>Ggg	p.W779G		NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	779	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	TTCTCCATCCACTGCTTGAAA	0.587																																					p.W779G	NSCLC(30;827 977 2459 19669 26125)	.											.	ANPEP	94	0			c.T2335G						.						154.0	134.0	141.0					15																	90335708		2200	4299	6499	SO:0001583	missense	290	exon17			CCATCCACTGCTT	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.2335T>G	15.37:g.90335708A>C	ENSP00000300060:p.Trp779Gly	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	34.0	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509527	0.64522	.	.	ENSG00000166825	ENST00000300060	T	0.06608	3.28	5.3	5.3	0.74995	.	0.142617	0.53938	D	0.000045	T	0.36908	0.0984	H	0.96301	3.8	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.53913	-0.8371	10	0.87932	D	0	.	13.1997	0.59761	1.0:0.0:0.0:0.0	.	779	P15144	AMPN_HUMAN	G	779	ENSP00000300060:W779G	ENSP00000300060:W779G	W	-	1	0	ANPEP	88136712	1.000000	0.71417	0.982000	0.44146	0.466000	0.32739	9.172000	0.94808	2.014000	0.59158	0.454000	0.30748	TGG	.		0.587	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
ANXA1	301	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	75782426	75782426	+	Silent	SNP	A	A	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr9:75782426A>T	ENST00000376911.1	+	10	1698	c.816A>T	c.(814-816)acA>acT	p.T272T	ANXA1_ENST00000257497.6_Silent_p.T272T			P04083	ANXA1_HUMAN	annexin A1	272					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	AGTGCGCCACAAGCAAACCAG	0.328																																					p.T272T		.											.	ANXA1	650	0			c.A816T						.						109.0	107.0	107.0					9																	75782426		2203	4299	6502	SO:0001819	synonymous_variant	301	exon11			CGCCACAAGCAAA	X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.816A>T	9.37:g.75782426A>T		Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	9.0	NM_000700		Silent	SNP	ENST00000376911.1	37	CCDS6645.1																																																																																			.		0.328	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	NM_000700	
ARFRP1	10139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62338416	62338416	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr20:62338416T>C	ENST00000359715.5	-	1	594	c.28A>G	c.(28-30)Aag>Gag	p.K10E	ARFRP1_ENST00000440854.1_Missense_Mutation_p.K10E|ZGPAT_ENST00000357119.4_5'Flank|ZGPAT_ENST00000328969.5_5'Flank|ZGPAT_ENST00000369967.3_5'Flank|ZGPAT_ENST00000448100.2_5'Flank|RP4-583P15.15_ENST00000490623.2_5'Flank|ARFRP1_ENST00000324228.2_Missense_Mutation_p.K10E|ZGPAT_ENST00000355969.6_5'Flank|ARFRP1_ENST00000607873.1_Intron|ARFRP1_ENST00000609142.1_Missense_Mutation_p.K10E			Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1	10					gastrulation (GO:0007369)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			AACATGTACTTGTACAAGCCC	0.607																																					p.K10E		.											.	ARFRP1	291	0			c.A28G						.						200.0	121.0	148.0					20																	62338416		2203	4298	6501	SO:0001583	missense	10139	exon2			TGTACTTGTACAA	X91504	CCDS13533.1, CCDS46630.1, CCDS68172.1, CCDS68173.1	20q13.3	2014-05-09			ENSG00000101246	ENSG00000101246		"""ADP-ribosylation factors"""	662	protein-coding gene	gene with protein product		604699				8530503	Standard	NM_003224		Approved	ARP, Arp1, ARL18	uc031rup.1	Q13795	OTTHUMG00000032993	ENST00000359715.5:c.28A>G	20.37:g.62338416T>C	ENSP00000352746:p.Lys10Glu	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	20.0	NM_001134758	B7ZKX7|E1P5J9|Q6IBQ0	Missense_Mutation	SNP	ENST00000359715.5	37	CCDS13533.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.755360	0.69648	.	.	ENSG00000101246	ENST00000440854;ENST00000359715;ENST00000324228	T;T;T	0.63096	-0.02;-0.02;-0.02	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.64724	0.2624	M	0.75264	2.295	0.80722	D	1	B;B	0.31790	0.34;0.117	B;B	0.35278	0.199;0.152	T	0.68345	-0.5433	10	0.59425	D	0.04	-12.4031	13.4987	0.61440	0.0:0.0:0.0:1.0	.	10;10	B3KTR4;Q13795	.;ARFRP_HUMAN	E	10	ENSP00000403942:K10E;ENSP00000352746:K10E;ENSP00000326884:K10E	ENSP00000326884:K10E	K	-	1	0	ARFRP1	61808860	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.147000	0.77382	1.789000	0.52484	0.402000	0.26972	AAG	.		0.607	ARFRP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472024.1		
ARID2	196528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	46123902	46123902	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:46123902delT	ENST00000334344.6	+	2	340	c.168delT	c.(166-168)actfs	p.T56fs	LINC00938_ENST00000609803.1_lincRNA|ARID2_ENST00000422737.1_5'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	56	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GAGTCACTACTTTAGGCGGAT	0.537			"""N, S, F"""		hepatocellular carcinoma																																p.T56fs		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	100	0			c.168delT						.						82.0	83.0	83.0					12																	46123902		2203	4300	6503	SO:0001589	frameshift_variant	196528	exon2			CACTACTTTAGGC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.168delT	12.37:g.46123902delT	ENSP00000335044:p.Thr56fs	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	46.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	37	CCDS31783.1																																																																																			.		0.537	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ARID2	196528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	46246499	46246499	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:46246499delA	ENST00000334344.6	+	15	4765	c.4593delA	c.(4591-4593)ccafs	p.P1531fs	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000457135.1_Frame_Shift_Del_p.P139fs|ARID2_ENST00000422737.1_Frame_Shift_Del_p.P1382fs|ARID2_ENST00000444670.1_Frame_Shift_Del_p.P1141fs	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1531					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CAGGAATTCCAAATAAAGTAG	0.478			"""N, S, F"""		hepatocellular carcinoma																																p.P1531fs		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	100	0			c.4593delA						.						76.0	72.0	73.0					12																	46246499		2203	4300	6503	SO:0001589	frameshift_variant	196528	exon15			AATTCCAAATAAA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4593delA	12.37:g.46246499delA	ENSP00000335044:p.Pro1531fs	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	26.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	37	CCDS31783.1																																																																																			.		0.478	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ATP5L	10632	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118277703	118277703	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:118277703A>C	ENST00000300688.3	+	2	616	c.104A>C	c.(103-105)aAg>aCg	p.K35T	ATP5L_ENST00000529770.1_3'UTR|ATP5L_ENST00000524422.1_Missense_Mutation_p.K35T	NM_006476.4	NP_006467.4	O75964	ATP5L_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G	35					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)		TACTACGCCAAGGTTGAGCTG	0.453																																					p.K35T		.											.	ATP5L	90	0			c.A104C						.						56.0	48.0	51.0					11																	118277703		2200	4296	6496	SO:0001583	missense	10632	exon2			ACGCCAAGGTTGA	AF092124	CCDS8397.1	11q23.3	2012-10-12	2010-06-11		ENSG00000167283	ENSG00000167283		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	14247	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G"""			11230166, 11042152	Standard	NR_033759		Approved	ATP5JG	uc001psx.3	O75964		ENST00000300688.3:c.104A>C	11.37:g.118277703A>C	ENSP00000300688:p.Lys35Thr	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	5.0	NM_006476	A8K0K3|Q96BV6|Q9UBZ7	Missense_Mutation	SNP	ENST00000300688.3	37	CCDS8397.1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.846266	0.51164	.	.	ENSG00000167283	ENST00000300688;ENST00000524422	.	.	.	5.97	1.04	0.20106	.	0.193545	0.53938	D	0.000059	T	0.67059	0.2853	M	0.79258	2.445	0.49582	D	0.999802	B	0.15719	0.014	B	0.30716	0.119	T	0.62946	-0.6746	9	0.59425	D	0.04	-0.8845	10.4057	0.44256	0.5911:0.0:0.4089:0.0	.	35	O75964	ATP5L_HUMAN	T	35	.	ENSP00000300688:K35T	K	+	2	0	ATP5L	117782913	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	1.461000	0.35255	-0.065000	0.13021	0.533000	0.62120	AAG	.		0.453	ATP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389220.1	NM_006476	
ATRN	8455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3541522	3541522	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr20:3541522T>G	ENST00000262919.5	+	8	1485	c.1417T>G	c.(1417-1419)Tat>Gat	p.Y473D	ATRN_ENST00000446916.2_Missense_Mutation_p.Y473D	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	473					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						TCTCTATGGATATATAAGCAA	0.413																																					p.Y473D		.											.	ATRN	154	0			c.T1417G						.						212.0	190.0	197.0					20																	3541522		2203	4300	6503	SO:0001583	missense	8455	exon8			TATGGATATATAA	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.1417T>G	20.37:g.3541522T>G	ENSP00000262919:p.Tyr473Asp	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	51.0	NM_139321	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	ENST00000262919.5	37	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132565	0.77662	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.68181	3.23;-0.31	4.99	4.99	0.66335	Kelch-type beta propeller (1);	0.142166	0.49916	D	0.000123	T	0.82029	0.4948	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.98;0.998	D	0.84958	0.0875	10	0.87932	D	0	-18.2912	14.4925	0.67660	0.0:0.0:0.0:1.0	.	473;473	O75882;O75882-2	ATRN_HUMAN;.	D	473;473;399	ENSP00000262919:Y473D;ENSP00000416587:Y473D	ENSP00000262919:Y473D	Y	+	1	0	ATRN	3489522	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	7.836000	0.86788	2.080000	0.62538	0.528000	0.53228	TAT	.		0.413	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
BCL9L	283149	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	118769207	118769207	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:118769207G>T	ENST00000334801.3	-	8	5381	c.4417C>A	c.(4417-4419)Ccc>Acc	p.P1473T	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1473					canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TGCCGAAGGGGGTGGGACACC	0.701																																					p.P1473T		.											.	BCL9L	229	0			c.C4417A						.						22.0	25.0	24.0					11																	118769207		2198	4295	6493	SO:0001583	missense	283149	exon8			GAAGGGGGTGGGA	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.4417C>A	11.37:g.118769207G>T	ENSP00000335320:p.Pro1473Thr	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	28.0	NM_182557	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	ENST00000334801.3	37	CCDS8403.1	.	.	.	.	.	.	.	.	.	.	G	9.717	1.158604	0.21454	.	.	ENSG00000186174	ENST00000334801;ENST00000526143;ENST00000525300;ENST00000431085	T	0.63255	-0.03	3.98	3.98	0.46160	.	0.240053	0.22137	U	0.064119	T	0.45895	0.1365	N	0.22421	0.69	0.30303	N	0.789254	P;B	0.36535	0.557;0.436	B;B	0.27500	0.08;0.057	T	0.54423	-0.8296	10	0.48119	T	0.1	-4.1001	16.4076	0.83691	0.0:0.0:1.0:0.0	.	1468;1473	Q86UU0-2;Q86UU0	.;BCL9L_HUMAN	T	1473;1436;719;1428	ENSP00000335320:P1473T	ENSP00000335320:P1473T	P	-	1	0	BCL9L	118274417	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.725000	0.47294	1.909000	0.55274	0.305000	0.20034	CCC	.		0.701	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389653.1	NM_182557	
BDKRB2	624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96707560	96707560	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr14:96707560G>A	ENST00000306005.3	+	3	1091	c.895G>A	c.(895-897)Ggc>Agc	p.G299S	BDKRB2_ENST00000539359.1_Missense_Mutation_p.G272S|BDKRB2_ENST00000554311.1_Missense_Mutation_p.G299S|BDKRB2_ENST00000542454.2_Missense_Mutation_p.G272S|RP11-404P21.8_ENST00000553811.1_Intron	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	299					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	GCATCGCCTCGGCATCCTCTC	0.577																																					p.G299S		.											.	BDKRB2	662	0			c.G895A						.						66.0	59.0	61.0					14																	96707560		2203	4300	6503	SO:0001583	missense	624	exon3			CGCCTCGGCATCC	S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.895G>A	14.37:g.96707560G>A	ENSP00000307713:p.Gly299Ser	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	20.0	NM_000623		Missense_Mutation	SNP	ENST00000306005.3	37	CCDS9942.1	.	.	.	.	.	.	.	.	.	.	G	0.232	-1.020393	0.02061	.	.	ENSG00000168398	ENST00000542454;ENST00000554311;ENST00000306005;ENST00000539359	T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5	4.62	-5.69	0.02428	GPCR, rhodopsin-like superfamily (1);	1.913840	0.02342	N	0.075049	T	0.54464	0.1860	L	0.39245	1.2	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.23404	-1.0189	10	0.22109	T	0.4	-3.4146	3.1966	0.06635	0.3048:0.3955:0.201:0.0987	.	299	P30411	BKRB2_HUMAN	S	272;299;299;272	ENSP00000439459:G272S;ENSP00000450482:G299S;ENSP00000307713:G299S;ENSP00000438376:G272S	ENSP00000307713:G299S	G	+	1	0	BDKRB2	95777313	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.868000	0.04236	-1.006000	0.03412	-1.263000	0.01449	GGC	.		0.577	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1		
C2orf71	388939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	29295459	29295459	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:29295459C>A	ENST00000331664.5	-	1	1668	c.1669G>T	c.(1669-1671)Gtg>Ttg	p.V557L		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	557					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						CCACAGGGCACAGGGACAAAC	0.597																																					p.V557L		.											.	C2orf71	91	0			c.G1669T						.						45.0	49.0	47.0					2																	29295459		2009	4168	6177	SO:0001583	missense	388939	exon1			AGGGCACAGGGAC		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1669G>T	2.37:g.29295459C>A	ENSP00000332809:p.Val557Leu	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	16.0	NM_001029883		Missense_Mutation	SNP	ENST00000331664.5	37	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	C	9.414	1.081225	0.20309	.	.	ENSG00000179270	ENST00000331664	T	0.24350	1.86	5.17	1.12	0.20585	.	0.866213	0.10034	N	0.724349	T	0.17152	0.0412	L	0.33485	1.01	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.28235	-1.0050	10	0.40728	T	0.16	-0.6019	4.4834	0.11778	0.2635:0.4132:0.2548:0.0686	.	557	A6NGG8	CB071_HUMAN	L	557	ENSP00000332809:V557L	ENSP00000332809:V557L	V	-	1	0	C2orf71	29148963	0.000000	0.05858	0.167000	0.22817	0.861000	0.49209	0.011000	0.13264	-0.071000	0.12886	0.561000	0.74099	GTG	.		0.597	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
C6orf226	441150	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42858426	42858426	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr6:42858426A>G	ENST00000408925.2	-	1	128	c.101T>C	c.(100-102)cTc>cCc	p.L34P		NM_001008739.1	NP_001008739.1	Q5I0X4	CF226_HUMAN	chromosome 6 open reading frame 226	34										lung(2)	2						CAGGCCCGGGAGTTCCTGGCC	0.711																																					p.L34P		.											.	.	.	0			c.T101C						.						31.0	38.0	36.0					6																	42858426		1950	4143	6093	SO:0001583	missense	441150	exon1			CCCGGGAGTTCCT	BC051007, BC060325	CCDS43463.1	6p21.1	2009-02-11			ENSG00000221821	ENSG00000221821			34431	protein-coding gene	gene with protein product							Standard	NM_001008739		Approved	LOC441150	uc003osw.3	Q5I0X4	OTTHUMG00000156926	ENST00000408925.2:c.101T>C	6.37:g.42858426A>G	ENSP00000386146:p.Leu34Pro	Somatic	53.0	1.0		WXS	Illumina HiSeq	Phase_I	44.0	16.0	NM_001008739		Missense_Mutation	SNP	ENST00000408925.2	37	CCDS43463.1	.	.	.	.	.	.	.	.	.	.	A	10.51	1.369449	0.24771	.	.	ENSG00000221821	ENST00000408925	.	.	.	5.15	5.15	0.70609	.	0.249386	0.26282	N	0.025270	T	0.26048	0.0635	N	0.19112	0.55	0.26233	N	0.978988	D	0.69078	0.997	P	0.60345	0.873	T	0.11348	-1.0591	9	0.87932	D	0	-10.8688	11.2823	0.49201	1.0:0.0:0.0:0.0	.	34	Q5I0X4	CF226_HUMAN	P	34	.	ENSP00000386146:L34P	L	-	2	0	C6orf226	42966404	0.964000	0.33143	0.572000	0.28498	0.029000	0.11900	3.812000	0.55628	2.162000	0.67917	0.459000	0.35465	CTC	.		0.711	C6orf226-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346635.1	NM_001008739	
CARS2	79587	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	111335421	111335421	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr13:111335421A>C	ENST00000257347.4	-	6	695	c.632T>G	c.(631-633)gTc>gGc	p.V211G	CARS2_ENST00000535398.1_5'UTR	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)	211				LVGVVPGPVGEPADSDK -> IGRRGPWSSPETSGLLTS (in Ref. 4; BAB93499). {ECO:0000305}.	cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	TGGACCAGGGACCACGCCGAC	0.537																																					p.V211G		.											.	CARS2	90	0			c.T632G						.						116.0	116.0	116.0					13																	111335421		2203	4300	6503	SO:0001583	missense	79587	exon6			CCAGGGACCACGC	BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.632T>G	13.37:g.111335421A>C	ENSP00000257347:p.Val211Gly	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	19.0	NM_024537	Q8NI84|Q96IV4	Missense_Mutation	SNP	ENST00000257347.4	37	CCDS9514.1	.	.	.	.	.	.	.	.	.	.	A	7.637	0.680045	0.14907	.	.	ENSG00000134905	ENST00000257347	T	0.29917	1.55	5.39	-7.39	0.01402	.	1.251980	0.05294	N	0.521770	T	0.15869	0.0382	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.19943	-1.0290	10	0.19147	T	0.46	-4.423	5.4535	0.16578	0.5509:0.1037:0.2597:0.0857	.	211	Q9HA77	SYCM_HUMAN	G	211	ENSP00000257347:V211G	ENSP00000257347:V211G	V	-	2	0	CARS2	110133422	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-0.434000	0.06939	-1.409000	0.02038	-0.624000	0.04008	GTC	.		0.537	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045772.3	NM_024537	
CBFA2T2	9139	hgsc.bcm.edu;broad.mit.edu	37	20	32199083	32199084	+	In_Frame_Ins	INS	-	-	CAATGACAT			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr20:32199083_32199084insCAATGACAT	ENST00000346541.3	+	4	926_927	c.389_390insCAATGACAT	c.(388-393)ggcaat>ggCAATGACATcaat	p.131_132insDIN	CBFA2T2_ENST00000397798.2_In_Frame_Ins_p.102_103insDIN|CBFA2T2_ENST00000492345.1_In_Frame_Ins_p.102_103insDIN|CBFA2T2_ENST00000375279.2_In_Frame_Ins_p.131_132insDIN|CBFA2T2_ENST00000397800.1_In_Frame_Ins_p.102_103insDIN|CBFA2T2_ENST00000342704.6_In_Frame_Ins_p.122_123insDIN|CBFA2T2_ENST00000359606.3_In_Frame_Ins_p.141_142insDIN|CBFA2T2_ENST00000344201.3_In_Frame_Ins_p.102_103insDIN	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	131	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						CAACAGTTTGGCAATGACATCT	0.495																																					p.G130delinsGNDI	Esophageal Squamous(174;142 1955 14837 21276 28041)	.											.	CBFA2T2	92	0			c.389_390insCAATGACAT						.																																			SO:0001652	inframe_insertion	9139	exon4			AGTTTGGCAATGA	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.390_398dupCAATGACAT	20.37:g.32199084_32199092dupCAATGACAT	ENSP00000262653:p.Asn131_Asp132insAspIleAsn	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	10.0	NM_005093	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	In_Frame_Ins	INS	ENST00000346541.3	37	CCDS13221.1																																																																																			.		0.495	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	
CC2D1B	200014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	52830265	52830265	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:52830265C>A	ENST00000371586.2	-	2	166	c.28G>T	c.(28-30)Ggc>Tgc	p.G10C	CC2D1B_ENST00000438831.1_5'UTR|CC2D1B_ENST00000284376.3_Missense_Mutation_p.G10C	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	10						nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						GCCTGAGGGCCCTTCCGAGGT	0.587																																					p.G10C		.											.	CC2D1B	92	0			c.G28T						.						43.0	38.0	40.0					1																	52830265		2203	4300	6503	SO:0001583	missense	200014	exon2			GAGGGCCCTTCCG	AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.28G>T	1.37:g.52830265C>A	ENSP00000360642:p.Gly10Cys	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	8.0	NM_032449	Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	ENST00000371586.2	37	CCDS30714.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825864	0.71143	.	.	ENSG00000154222	ENST00000371586;ENST00000284376;ENST00000371575	T;T	0.26957	1.7;1.7	4.7	4.7	0.59300	.	0.299139	0.31279	N	0.007928	T	0.38585	0.1046	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.21348	-1.0248	10	0.54805	T	0.06	-13.354	5.5618	0.17148	0.0:0.7621:0.0:0.2379	.	10	Q5T0F9	C2D1B_HUMAN	C	10	ENSP00000360642:G10C;ENSP00000284376:G10C	ENSP00000284376:G10C	G	-	1	0	CC2D1B	52602853	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.668000	0.46816	2.439000	0.82584	0.591000	0.81541	GGC	.		0.587	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022189.1	NM_032449	
CCDC88C	440193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	91779756	91779756	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr14:91779756C>G	ENST00000389857.6	-	15	2490	c.2404G>C	c.(2404-2406)Gac>Cac	p.D802H		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	802					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCCTCCAGGTCCCGCCGCAGC	0.672																																					p.D802H		.											.	CCDC88C	25	0			c.G2404C						.						13.0	16.0	15.0					14																	91779756		2058	4195	6253	SO:0001583	missense	440193	exon15			CCAGGTCCCGCCG		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.2404G>C	14.37:g.91779756C>G	ENSP00000374507:p.Asp802His	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	10.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300824	0.60195	.	.	ENSG00000015133	ENST00000389857	T	0.14640	2.49	5.03	4.01	0.46588	.	0.262593	0.25552	U	0.029898	T	0.14700	0.0355	L	0.51422	1.61	0.80722	D	1	P	0.48016	0.904	P	0.47044	0.535	T	0.01545	-1.1328	10	0.66056	D	0.02	-27.7084	3.2625	0.06854	0.0:0.5971:0.0:0.4029	.	802	Q9P219	DAPLE_HUMAN	H	802	ENSP00000374507:D802H	ENSP00000374507:D802H	D	-	1	0	CCDC88C	90849509	0.972000	0.33761	0.997000	0.53966	0.985000	0.73830	2.818000	0.48041	2.338000	0.79540	0.561000	0.74099	GAC	.		0.672	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
CCSER1	401145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	91389492	91389492	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr4:91389492G>A	ENST00000509176.1	+	5	1999	c.1711G>A	c.(1711-1713)Gag>Aag	p.E571K	CCSER1_ENST00000432775.2_Missense_Mutation_p.E571K|CCSER1_ENST00000333691.8_Missense_Mutation_p.E571K	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	571																	AGAATTTCCTGAGCCTTCCAA	0.343																																					p.E571K		.											.	.	.	0			c.G1711A						.						73.0	70.0	71.0					4																	91389492		1820	4075	5895	SO:0001583	missense	401145	exon5			TTTCCTGAGCCTT		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1711G>A	4.37:g.91389492G>A	ENSP00000425040:p.Glu571Lys	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	42.0	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277939	0.80692	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.43294	1.51;0.95;1.51	4.63	4.63	0.57726	.	0.212785	0.40144	N	0.001178	T	0.37019	0.0988	N	0.17082	0.46	0.32536	N	0.534297	P;D	0.54207	0.782;0.965	B;P	0.50270	0.24;0.636	T	0.44467	-0.9326	10	0.37606	T	0.19	-17.1105	15.2528	0.73561	0.0:0.0:1.0:0.0	.	571;571	Q9C0I3-2;Q9C0I3	.;F190A_HUMAN	K	571	ENSP00000425040:E571K;ENSP00000389283:E571K;ENSP00000329482:E571K	ENSP00000329482:E571K	E	+	1	0	FAM190A	91608515	1.000000	0.71417	0.985000	0.45067	0.974000	0.67602	5.103000	0.64578	2.514000	0.84764	0.467000	0.42956	GAG	.		0.343	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
CD164L2	388611	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	27709145	27709145	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:27709145C>T	ENST00000374030.1	-	2	241	c.101G>A	c.(100-102)cGa>cAa	p.R34Q	CD164L2_ENST00000374027.3_Missense_Mutation_p.R34Q|CD164L2_ENST00000374025.3_Missense_Mutation_p.R34Q			Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2	34						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CCCAAAGCCTCGAGCTCCTTT	0.642																																					p.R34Q		.											.	CD164L2	90	0			c.G101A						.						44.0	48.0	46.0					1																	27709145		2203	4299	6502	SO:0001583	missense	388611	exon2			AAGCCTCGAGCTC	AY358761	CCDS302.1	1p36.11	2008-02-05			ENSG00000174950	ENSG00000174950			32043	protein-coding gene	gene with protein product							Standard	XM_005245868		Approved		uc001boc.3	Q6UWJ8	OTTHUMG00000003395	ENST00000374030.1:c.101G>A	1.37:g.27709145C>T	ENSP00000363142:p.Arg34Gln	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	26.0	NM_207397	B2RPJ0|Q5JXD6	Missense_Mutation	SNP	ENST00000374030.1	37		.	.	.	.	.	.	.	.	.	.	C	20.3	3.968016	0.74131	.	.	ENSG00000174950	ENST00000374030;ENST00000374027;ENST00000374025	T;T;T	0.44083	0.93;0.93;0.93	4.64	-0.842	0.10748	.	1.028080	0.07785	N	0.954017	T	0.34019	0.0883	L	0.57536	1.79	0.26294	N	0.978071	B	0.16166	0.016	B	0.14578	0.011	T	0.39583	-0.9607	10	0.59425	D	0.04	-13.2005	1.751	0.02972	0.1489:0.3336:0.3314:0.1861	.	34	Q6UWJ8	C16L2_HUMAN	Q	34	ENSP00000363142:R34Q;ENSP00000363139:R34Q;ENSP00000363137:R34Q	ENSP00000363137:R34Q	R	-	2	0	CD164L2	27581732	0.467000	0.25831	0.887000	0.34795	0.943000	0.58893	0.090000	0.15025	-0.326000	0.08564	0.555000	0.69702	CGA	.		0.642	CD164L2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000009518.1	NM_207397	
CD22	933	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35832797	35832797	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr19:35832797G>C	ENST00000085219.5	+	9	2030	c.1964G>C	c.(1963-1965)gGt>gCt	p.G655A	CD22_ENST00000419549.2_Missense_Mutation_p.G483A|CD22_ENST00000544992.2_Missense_Mutation_p.G655A|CD22_ENST00000270311.6_Missense_Mutation_p.G535A|CD22_ENST00000341773.6_Missense_Mutation_p.G478A|CD22_ENST00000594250.1_Missense_Mutation_p.G478A|CD22_ENST00000536635.2_Missense_Mutation_p.G567A	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	655	Ig-like C2-type 6.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CAGCACTCGGGTGCCTACTGG	0.587																																					p.G655A	Ovarian(42;1009 1133 23674 26041)	.											.	CD22	526	0			c.G1964C						.						109.0	86.0	94.0					19																	35832797		2203	4300	6503	SO:0001583	missense	933	exon9			ACTCGGGTGCCTA	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1964G>C	19.37:g.35832797G>C	ENSP00000085219:p.Gly655Ala	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	25.0	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	37	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478467	0.63849	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992;ENST00000270311;ENST00000419549	T;T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03;2.03	5.29	5.29	0.74685	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000073	T	0.57755	0.2075	H	0.94222	3.51	0.26236	N	0.978942	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.62238	-0.6896	10	0.72032	D	0.01	.	14.4406	0.67314	0.0:0.0:1.0:0.0	.	483;655;567;655;478	Q32M46;F5GYU4;F5H7U3;P20273;P20273-2	.;.;.;CD22_HUMAN;.	A	655;567;478;655;535;483	ENSP00000085219:G655A;ENSP00000442279:G567A;ENSP00000339349:G478A;ENSP00000441237:G655A;ENSP00000270311:G535A;ENSP00000403822:G483A	ENSP00000085219:G655A	G	+	2	0	CD22	40524637	0.999000	0.42202	0.180000	0.23079	0.007000	0.05969	5.088000	0.64486	2.500000	0.84329	0.491000	0.48974	GGT	.		0.587	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109812678	109812678	+	Missense_Mutation	SNP	A	A	G	rs78104849		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:109812678A>G	ENST00000271332.3	+	23	7292	c.7231A>G	c.(7231-7233)Atc>Gtc	p.I2411V		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2411					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCAACACGGCATCCGACGTAA	0.577													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19476	0.0		0.0	False		,,,				2504	0.0				p.I2411V	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.A7231G						.						186.0	171.0	176.0					1																	109812678		2203	4300	6503	SO:0001583	missense	1952	exon23			CACGGCATCCGAC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7231A>G	1.37:g.109812678A>G	ENSP00000271332:p.Ile2411Val	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	37.0	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	17.57	3.422996	0.62733	.	.	ENSG00000143126	ENST00000271332	T	0.59224	0.28	3.78	3.78	0.43462	GPCR, family 2-like (1);	.	.	.	.	T	0.64843	0.2635	M	0.74546	2.27	0.36307	D	0.857394	D	0.67145	0.996	D	0.87578	0.998	T	0.69628	-0.5094	9	0.66056	D	0.02	.	8.5855	0.33655	0.9035:0.0:0.0965:0.0	.	2411	Q9HCU4	CELR2_HUMAN	V	2411	ENSP00000271332:I2411V	ENSP00000271332:I2411V	I	+	1	0	CELSR2	109614201	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.476000	0.66793	1.710000	0.51325	0.459000	0.35465	ATC	A|0.999;G|0.000		0.577	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CHD1L	9557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	146747921	146747921	+	Splice_Site	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:146747921G>A	ENST00000369258.4	+	14	1559	c.1539G>A	c.(1537-1539)caG>caA	p.Q513Q	CHD1L_ENST00000431239.1_Splice_Site_p.Q419Q|CHD1L_ENST00000369259.3_Splice_Site_p.Q309Q|CHD1L_ENST00000361293.5_Splice_Site_p.Q232Q|CHD1L_ENST00000467213.1_3'UTR	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	513	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					CTGACCTCCAGGTATGATATG	0.473																																					p.Q513Q		.											.	CHD1L	231	0			c.G1539A						.						85.0	86.0	86.0					1																	146747921		2203	4300	6503	SO:0001630	splice_region_variant	9557	exon14			CCTCCAGGTATGA	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1539+1G>A	1.37:g.146747921G>A		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	22.0	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Silent	SNP	ENST00000369258.4	37	CCDS927.1																																																																																			.		0.473	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	Silent
CHD4	1108	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	6703766	6703778	+	Frame_Shift_Del	DEL	TCCACCTGTAGCA	TCCACCTGTAGCA	-			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	TCCACCTGTAGCA	TCCACCTGTAGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:6703766_6703778delTCCACCTGTAGCA	ENST00000357008.2	-	15	2323_2335	c.2160_2172delTGCTACAGGTGGA	c.(2158-2172)gatgctacaggtggafs	p.DATGG720fs	CHD4_ENST00000544040.1_Frame_Shift_Del_p.DATGG713fs|CHD4_ENST00000544484.1_Frame_Shift_Del_p.DATGG717fs|CHD4_ENST00000309577.6_Frame_Shift_Del_p.DATGG720fs	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	720					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GGTGCAGGGTTCCACCTGTAGCATCCAGGTACT	0.54																																					p.720_724del	Colon(32;586 792 4568 16848 45314)	.											.	CHD4	228	0			c.2160_2172del						.																																			SO:0001589	frameshift_variant	1108	exon15			CAGGGTTCCACCT	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.2160_2172delTGCTACAGGTGGA	12.37:g.6703766_6703778delTCCACCTGTAGCA	ENSP00000349508:p.Asp720fs	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	33.0	NM_001273	Q8IXZ5	Frame_Shift_Del	DEL	ENST00000357008.2	37	CCDS8552.1																																																																																			.		0.540	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
CHRNA3	1136	hgsc.bcm.edu;broad.mit.edu	37	15	78894345	78894345	+	Silent	SNP	T	T	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr15:78894345T>A	ENST00000326828.5	-	5	1023	c.639A>T	c.(637-639)ccA>ccT	p.P213P	CHRNA3_ENST00000348639.3_Silent_p.P213P	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	213					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	GTTTGTAGCCTGGGGCTTTGA	0.537																																					p.P213P		.											.	CHRNA3	515	0			c.A639T						.						154.0	132.0	140.0					15																	78894345		2196	4293	6489	SO:0001819	synonymous_variant	1136	exon5			GTAGCCTGGGGCT		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.639A>T	15.37:g.78894345T>A		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_000743	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Silent	SNP	ENST00000326828.5	37	CCDS10305.1																																																																																			.		0.537	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3		
COL13A1	1305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	71688713	71688713	+	Silent	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr10:71688713G>T	ENST00000398978.3	+	27	1902	c.1410G>T	c.(1408-1410)ggG>ggT	p.G470G	COL13A1_ENST00000398974.3_Silent_p.G458G|COL13A1_ENST00000398972.3_Silent_p.G470G|COL13A1_ENST00000398964.3_Silent_p.G441G|COL13A1_ENST00000398968.3_Silent_p.G451G|COL13A1_ENST00000356340.3_Silent_p.G470G|COL13A1_ENST00000398971.3_Silent_p.G470G|COL13A1_ENST00000522165.1_Silent_p.G451G|COL13A1_ENST00000398973.3_Silent_p.G470G|COL13A1_ENST00000520133.1_Silent_p.G419G|COL13A1_ENST00000398966.3_Silent_p.G448G|COL13A1_ENST00000354547.3_Silent_p.G448G|COL13A1_ENST00000398969.3_Silent_p.G413G|COL13A1_ENST00000517713.1_Silent_p.G448G|COL13A1_ENST00000357811.3_Silent_p.G448G|COL13A1_ENST00000520267.1_Silent_p.G413G	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						GTCTTCCTGGGCAAATTGGCC	0.557																																					p.G470G		.											.	COL13A1	91	0			c.G1410T						.						61.0	65.0	64.0					10																	71688713		1852	4093	5945	SO:0001819	synonymous_variant	1305	exon27			TCCTGGGCAAATT	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.1410G>T	10.37:g.71688713G>T		Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	11.0	NM_001130103		Silent	SNP	ENST00000398978.3	37	CCDS44419.1	.	.	.	.	.	.	.	.	.	.	G	9.296	1.051945	0.19827	.	.	ENSG00000197467	ENST00000398975	D	0.99353	-5.77	4.84	2.44	0.29823	.	0.000000	0.56097	D	0.000038	D	0.98516	0.9505	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.97779	1.0231	7	0.87932	D	0	-7.0981	4.2937	0.10890	0.2523:0.0:0.5322:0.2156	.	.	.	.	V	15	ENSP00000381947:G15V	ENSP00000381947:G15V	G	+	2	0	COL13A1	71358719	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	0.789000	0.26886	0.817000	0.34445	0.555000	0.69702	GGC	.		0.557	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
COPZ1	22818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54736037	54736037	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:54736037G>T	ENST00000262061.2	+	3	172	c.135G>T	c.(133-135)gaG>gaT	p.E45D	RN7SL744P_ENST00000577604.1_RNA|RP11-968A15.8_ENST00000553061.1_RNA|COPZ1_ENST00000548753.1_5'UTR|COPZ1_ENST00000552218.1_Missense_Mutation_p.E45D|COPZ1_ENST00000553231.1_Missense_Mutation_p.E22D|COPZ1_ENST00000548281.1_3'UTR|COPZ1_ENST00000549116.1_Intron|COPZ1_ENST00000549043.1_Missense_Mutation_p.E53D|COPZ1_ENST00000552362.1_Missense_Mutation_p.E45D|COPZ1_ENST00000455864.2_Missense_Mutation_p.E22D|COPZ1_ENST00000551779.1_Missense_Mutation_p.E45D|COPZ1_ENST00000416254.2_Missense_Mutation_p.R25I	NM_001271734.1|NM_001271736.1|NM_016057.1	NP_001258663.1|NP_001258665.1|NP_057141.1	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1	45					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)				kidney(1)|lung(4)	5						AGGCCTTTGAGAAGAACATTT	0.502																																					p.E53D		.											.	COPZ1	90	0			c.G159T						.						151.0	136.0	141.0					12																	54736037		2203	4300	6503	SO:0001583	missense	22818	exon3			CTTTGAGAAGAAC	AF151878	CCDS8877.1, CCDS61137.1, CCDS61138.1, CCDS61139.1	12q13.2-q13.3	2008-02-05		2003-07-23					2243	protein-coding gene	gene with protein product		615472	"""coatomer protein complex, subunit zeta"""	COPZ			Standard	NM_001271734		Approved	CGI-120	uc009znm.2	P61923		ENST00000262061.2:c.135G>T	12.37:g.54736037G>T	ENSP00000262061:p.Glu45Asp	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	31.0	NM_001271736	B4DDX8|B4DHZ0|F8VS17|F8VWL5|Q549N6|Q9Y3C3	Missense_Mutation	SNP	ENST00000262061.2	37	CCDS8877.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.57|19.57	3.852190|3.852190	0.71719|0.71719	.|.	.|.	ENSG00000111481|ENSG00000111481	ENST00000552848;ENST00000262061;ENST00000549043;ENST00000552218;ENST00000553231;ENST00000552362;ENST00000455864;ENST00000551779;ENST00000550713|ENST00000416254	.|.	.|.	.|.	5.12|5.12	3.31|3.31	0.37934|0.37934	Longin-like (1);AP complex, mu/sigma subunit (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68375|0.68375	0.2994|0.2994	H|H	0.97023|0.97023	3.925|3.925	0.80722|0.80722	D|D	1|1	P;D;P|P	0.65815|0.36733	0.805;0.995;0.882|0.567	P;D;P|B	0.70016|0.34991	0.779;0.967;0.904|0.193	T|T	0.66567|0.66567	-0.5891|-0.5891	9|8	0.87932|0.23302	D|T	0|0.38	-0.9625|-0.9625	7.0527|7.0527	0.25081|0.25081	0.2694:0.0:0.7306:0.0|0.2694:0.0:0.7306:0.0	.|.	22;53;45|25	B4DDX8;F8VWL5;P61923|B4DHZ0	.;.;COPZ1_HUMAN|.	D|I	45;45;53;45;22;45;22;45;53|25	.|.	ENSP00000262061:E45D|ENSP00000388141:R25I	E|R	+|+	3|2	2|0	COPZ1|COPZ1	53022304|53022304	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.366000|3.366000	0.52343|0.52343	0.880000|0.880000	0.35969|0.35969	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.		0.502	COPZ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405753.1	NM_016057	
CPT1B	1375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	51014481	51014481	+	Missense_Mutation	SNP	T	T	C	rs148070553		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr22:51014481T>C	ENST00000360719.2	-	7	897	c.760A>G	c.(760-762)Agc>Ggc	p.S254G	CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000440709.1_Missense_Mutation_p.S254G|CPT1B_ENST00000312108.7_Missense_Mutation_p.S254G|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000395650.2_Missense_Mutation_p.S254G|CPT1B_ENST00000457250.1_Missense_Mutation_p.S220G|CPT1B_ENST00000434492.2_Missense_Mutation_p.S51G|CPT1B_ENST00000405237.3_Missense_Mutation_p.S254G	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	254					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		TAATAGTTGCTGTTCACCATG	0.587											OREG0026685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S254G	Esophageal Squamous(170;988 1933 25577 30295 48163)	.											.	CPT1B	116	0			c.A760G						.	T	GLY/SER,GLY/SER,GLY/SER,GLY/SER,GLY/SER,GLY/SER,GLY/SER	0,4406		0,0,2203	103.0	91.0	95.0		658,760,760,760,760,760,760	4.8	1.0	22	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	CPT1B	NM_001145134.1,NM_001145135.1,NM_001145136.1,NM_001145137.1,NM_004377.3,NM_152245.2,NM_152246.2	56,56,56,56,56,56,56	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	220/739,254/773,254/692,254/773,254/773,254/773,254/773	51014481	1,13005	2203	4300	6503	SO:0001583	missense	1375	exon7			AGTTGCTGTTCAC	U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.760A>G	22.37:g.51014481T>C	ENSP00000353945:p.Ser254Gly	Somatic	56.0	0.0	974	WXS	Illumina HiSeq	Phase_I	44.0	18.0	NM_001145135	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	ENST00000360719.2	37	CCDS14098.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.031594	0.75504	0.0	1.16E-4	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000440709;ENST00000434492;ENST00000395650	D;D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.95984	0.8692	M	0.92923	3.36	0.80722	D	1	D;P;D;D	0.89917	0.997;0.949;1.0;1.0	D;P;D;D	0.80764	0.994;0.833;0.992;0.99	D	0.96647	0.9478	10	0.87932	D	0	-34.0447	12.3354	0.55065	0.0:0.0:0.0:1.0	.	254;220;51;254	E9PCP2;B7Z4U4;A2RRE8;Q92523	.;.;.;CPT1B_HUMAN	G	254;254;254;220;254;51;254	ENSP00000385486:S254G;ENSP00000312189:S254G;ENSP00000353945:S254G;ENSP00000409342:S220G;ENSP00000414713:S254G;ENSP00000410966:S51G;ENSP00000379011:S254G	ENSP00000312189:S254G	S	-	1	0	CPT1B	49361347	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.368000	0.79567	2.024000	0.59613	0.459000	0.35465	AGC	T|1.000;C|0.000		0.587	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317264.5	NM_152246	
CSMD3	114788	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113304861	113304861	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:113304861G>T	ENST00000297405.5	-	55	8937	c.8693C>A	c.(8692-8694)aCa>aAa	p.T2898K	CSMD3_ENST00000455883.2_Missense_Mutation_p.T2729K|CSMD3_ENST00000343508.3_Missense_Mutation_p.T2858K|CSMD3_ENST00000352409.3_Missense_Mutation_p.T2828K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2898	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GCATGAGAATGTTACCACATC	0.453										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T2898K		.											.	CSMD3	1132	0			c.C8693A						.						191.0	158.0	169.0					8																	113304861		2203	4300	6503	SO:0001583	missense	114788	exon55			GAGAATGTTACCA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8693C>A	8.37:g.113304861G>T	ENSP00000297405:p.Thr2898Lys	Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	223.0	24.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	10.85	1.467416	0.26335	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	5.76	5.76	0.90799	Complement control module (2);Sushi/SCR/CCP (3);	0.214818	0.35378	N	0.003249	T	0.65375	0.2685	L	0.35723	1.085	0.49798	D	0.999829	B;B;D	0.65815	0.321;0.24;0.995	B;B;P	0.58454	0.205;0.309;0.839	T	0.57271	-0.7840	10	0.05525	T	0.97	.	19.9664	0.97271	0.0:0.0:1.0:0.0	.	2729;2898;2858	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	2858;2898;2168;2729;2828	ENSP00000345799:T2858K;ENSP00000297405:T2898K;ENSP00000341558:T2168K;ENSP00000412263:T2729K;ENSP00000343124:T2828K	ENSP00000297405:T2898K	T	-	2	0	CSMD3	113374037	1.000000	0.71417	0.999000	0.59377	0.885000	0.51271	4.034000	0.57289	2.724000	0.93272	0.650000	0.86243	ACA	.		0.453	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41268766	41268766	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr3:41268766A>T	ENST00000349496.5	+	7	1284	c.1004A>T	c.(1003-1005)aAa>aTa	p.K335I	CTNNB1_ENST00000396185.3_Missense_Mutation_p.K335I|CTNNB1_ENST00000405570.1_Missense_Mutation_p.K335I|CTNNB1_ENST00000453024.1_Missense_Mutation_p.K328I|CTNNB1_ENST00000396183.3_Missense_Mutation_p.K335I	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	335					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.K335I(8)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTTACGAAAAACTACTGTGG	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.K335I	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,Wilms_tumour,0	CTNNB1	24361	8	Substitution - Missense(8)	liver(7)|kidney(1)	c.A1004T						.						110.0	108.0	109.0					3																	41268766		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACGAAAAACTACT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1004A>T	3.37:g.41268766A>T	ENSP00000344456:p.Lys335Ile	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	27.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.040885	0.93685	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82148	0.4974	M	0.89287	3.02	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.75484	0.97;0.986	D	0.85830	0.1391	10	0.72032	D	0.01	-3.7939	15.5934	0.76558	1.0:0.0:0.0:0.0	.	263;335	B4DSW9;P35222	.;CTNB1_HUMAN	I	335;335;335;328;335	ENSP00000385604:K335I;ENSP00000379486:K335I;ENSP00000344456:K335I;ENSP00000411226:K328I;ENSP00000379488:K335I	ENSP00000344456:K335I	K	+	2	0	CTNNB1	41243770	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	AAA	.		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CYP11B2	1585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	143994269	143994269	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:143994269A>G	ENST00000323110.2	-	7	1156	c.1154T>C	c.(1153-1155)gTg>gCg	p.V385A		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	385					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TGAGCTCACCACTCGCTCCAA	0.592									Familial Hyperaldosteronism type I																												p.V385A		.											.	CYP11B2	90	0			c.T1154C						.						84.0	76.0	79.0					8																	143994269		2203	4300	6503	SO:0001583	missense	1585	exon7	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	CTCACCACTCGCT	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1154T>C	8.37:g.143994269A>G	ENSP00000325822:p.Val385Ala	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	20.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	37	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	8.707	0.911008	0.17833	.	.	ENSG00000179142	ENST00000323110	T	0.68479	-0.33	2.96	-5.92	0.02261	.	4.047030	0.00738	N	0.000984	T	0.43656	0.1257	N	0.20357	0.565	0.09310	N	1	B	0.11235	0.004	B	0.20384	0.029	T	0.19031	-1.0318	10	0.23302	T	0.38	.	0.0342	0.00006	0.3101:0.2235:0.1884:0.278	rs28930074	385	P19099	C11B2_HUMAN	A	385	ENSP00000325822:V385A	ENSP00000325822:V385A	V	-	2	0	CYP11B2	143991271	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.492000	0.22435	-1.752000	0.01325	0.460000	0.39030	GTG	.		0.592	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
DICER1	23405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	95574719	95574719	+	Missense_Mutation	SNP	T	T	C	rs527568726		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr14:95574719T>C	ENST00000526495.1	-	17	2669	c.2378A>G	c.(2377-2379)tAt>tGt	p.Y793C	DICER1_ENST00000393063.1_Missense_Mutation_p.Y793C|DICER1_ENST00000541352.1_Missense_Mutation_p.Y793C|DICER1_ENST00000556045.1_5'Flank|DICER1_ENST00000343455.3_Missense_Mutation_p.Y793C|DICER1_ENST00000527414.1_Missense_Mutation_p.Y793C			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	793					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TTCAGGAGGATAGAGCTTCCG	0.423			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome				T|||	1	0.000199681	0.0008	0.0	5008	,	,		18951	0.0		0.0	False		,,,				2504	0.0				p.Y793C		.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	961	0			c.A2378G						.						168.0	159.0	162.0					14																	95574719		2203	4300	6503	SO:0001583	missense	23405	exon16	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	GGAGGATAGAGCT	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.2378A>G	14.37:g.95574719T>C	ENSP00000437256:p.Tyr793Cys	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	21.0	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	37	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.061548	0.76187	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65	5.65	4.48	0.54585	.	0.056743	0.64402	D	0.000001	D	0.87533	0.6201	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	D	0.86843	0.2018	10	0.49607	T	0.09	-18.7645	12.1495	0.54042	0.1285:0.0:0.0:0.8715	.	793	Q9UPY3	DICER_HUMAN	C	793	ENSP00000343745:Y793C;ENSP00000437256:Y793C;ENSP00000376783:Y793C;ENSP00000435681:Y793C;ENSP00000444719:Y793C	ENSP00000343745:Y793C	Y	-	2	0	DICER1	94644472	1.000000	0.71417	0.973000	0.42090	0.967000	0.64934	7.771000	0.85420	1.037000	0.40024	0.533000	0.62120	TAT	.		0.423	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
DNAH7	56171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	196866480	196866480	+	Silent	SNP	A	A	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:196866480A>T	ENST00000312428.6	-	11	1192	c.1092T>A	c.(1090-1092)gcT>gcA	p.A364A	DNAH7_ENST00000410072.1_Silent_p.A364A	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	364	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TAAGTGCAGCAGCACAGTTGA	0.408																																					p.A364A		.											.	DNAH7	102	0			c.T1092A						.						99.0	95.0	97.0					2																	196866480		1899	4111	6010	SO:0001819	synonymous_variant	56171	exon11			TGCAGCAGCACAG	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.1092T>A	2.37:g.196866480A>T		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	41.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																			.		0.408	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
DPYSL2	1808	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	26485436	26485436	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:26485436G>T	ENST00000311151.5	+	7	1082	c.670G>T	c.(670-672)Gtg>Ttg	p.V224L	DPYSL2_ENST00000521983.1_3'UTR|DPYSL2_ENST00000521913.1_Missense_Mutation_p.V188L|DPYSL2_ENST00000523027.1_Missense_Mutation_p.V188L	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	224					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)			breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		CGAGGGACATGTGCTGAGCCG	0.572																																					p.V329L		.											.	DPYSL2	153	0			c.G985T						.						70.0	61.0	64.0					8																	26485436		2203	4300	6503	SO:0001583	missense	1808	exon7			GGACATGTGCTGA	D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.670G>T	8.37:g.26485436G>T	ENSP00000309539:p.Val224Leu	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	5.0	NM_001197293	A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	37	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693103	0.68271	.	.	ENSG00000092964	ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4	5.92	5.92	0.95590	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.87200	0.6118	L	0.42245	1.32	0.80722	D	1	B;B;B	0.23316	0.008;0.027;0.083	B;B;B	0.24974	0.01;0.04;0.057	T	0.82114	-0.0617	10	0.48119	T	0.1	-21.3152	20.3214	0.98679	0.0:0.0:1.0:0.0	.	224;224;280	Q53ET2;Q16555;Q59GB4	.;DPYL2_HUMAN;.	L	188;224;224;188	ENSP00000427985:V188L;ENSP00000309539:V224L;ENSP00000428909:V224L;ENSP00000431117:V188L	ENSP00000309539:V224L	V	+	1	0	DPYSL2	26541353	1.000000	0.71417	0.994000	0.49952	0.940000	0.58332	9.869000	0.99810	2.804000	0.96469	0.655000	0.94253	GTG	.		0.572	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386	
DSCAML1	57453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	117352790	117352790	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:117352790C>T	ENST00000321322.6	-	12	2628	c.2627G>A	c.(2626-2628)cGg>cAg	p.R876Q	DSCAML1_ENST00000527706.1_Missense_Mutation_p.R606Q	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	816	Ig-like C2-type 9.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GATGATGGGCCGCTCACCCCG	0.642																																					p.R876Q		.											.	DSCAML1	159	0			c.G2627A						.						153.0	108.0	123.0					11																	117352790		2201	4296	6497	SO:0001583	missense	57453	exon12			ATGGGCCGCTCAC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2627G>A	11.37:g.117352790C>T	ENSP00000315465:p.Arg876Gln	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	28.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.924106	0.52653	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.66280	-0.2;-0.2	3.89	3.89	0.44902	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37183	0.0994	N	0.02539	-0.55	0.37008	D	0.89557	B	0.21821	0.061	B	0.16289	0.015	T	0.35001	-0.9806	9	0.27082	T	0.32	.	16.1057	0.81220	0.0:1.0:0.0:0.0	.	816	Q8TD84	DSCL1_HUMAN	Q	606;876;583	ENSP00000434335:R606Q;ENSP00000315465:R876Q	ENSP00000315465:R876Q	R	-	2	0	DSCAML1	116858000	0.981000	0.34729	0.996000	0.52242	0.894000	0.52154	2.462000	0.45049	2.000000	0.58554	0.485000	0.47835	CGG	.		0.642	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
DSEL	92126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	65179142	65179142	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr18:65179142C>A	ENST00000310045.7	-	2	4207	c.2734G>T	c.(2734-2736)Gat>Tat	p.D912Y	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	902					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TCACAAGCATCTACAAATGAG	0.408																																					p.D912Y		.											.	DSEL	157	0			c.G2734T						.						82.0	81.0	81.0					18																	65179142		2203	4300	6503	SO:0001583	missense	92126	exon2			AAGCATCTACAAA	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.2734G>T	18.37:g.65179142C>A	ENSP00000310565:p.Asp912Tyr	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	23.0	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898842	0.91962	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.24908	1.83	5.13	5.13	0.70059	Sulfotransferase domain (1);	0.320190	0.31010	N	0.008424	T	0.51822	0.1697	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55263	-0.8168	10	0.87932	D	0	-22.1036	18.5756	0.91154	0.0:1.0:0.0:0.0	.	902	Q8IZU8	DSEL_HUMAN	Y	912;902	ENSP00000310565:D912Y	ENSP00000310565:D912Y	D	-	1	0	DSEL	63330122	1.000000	0.71417	0.844000	0.33320	0.950000	0.60333	7.717000	0.84732	2.384000	0.81235	0.563000	0.77884	GAT	.		0.408	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
EEA1	8411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	93205145	93205145	+	Silent	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:93205145A>G	ENST00000322349.8	-	17	2373	c.2109T>C	c.(2107-2109)caT>caC	p.H703H		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	703	Gln/Glu/Lys-rich.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						GCTGACTGCAATGTTCTTGCT	0.333																																					p.H703H		.											.	EEA1	229	0			c.T2109C						.						63.0	63.0	63.0					12																	93205145		2201	4300	6501	SO:0001819	synonymous_variant	8411	exon17			ACTGCAATGTTCT	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.2109T>C	12.37:g.93205145A>G		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	38.0	NM_003566	Q14221	Silent	SNP	ENST00000322349.8	37	CCDS31874.1																																																																																			.		0.333	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407304.1	NM_003566	
EPB41L4A	64097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	111598279	111598279	+	Splice_Site	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr5:111598279C>T	ENST00000261486.5	-	7	831		c.e7-1			NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		AATCTGACCCCTACACCCAGC	0.428																																					.		.											.	EPB41L4A	91	0			c.555-1G>A						.						85.0	86.0	86.0					5																	111598279		1912	4111	6023	SO:0001630	splice_region_variant	64097	exon8			TGACCCCTACACC	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.555-1G>A	5.37:g.111598279C>T		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	20.0	NM_022140	A4FUI6	Splice_Site	SNP	ENST00000261486.5	37	CCDS43350.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284077	0.59867	.	.	ENSG00000129595	ENST00000261486	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6127	0.91291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPB41L4A	111626178	1.000000	0.71417	0.998000	0.56505	0.659000	0.38960	5.914000	0.69964	2.764000	0.94973	0.655000	0.94253	.	.		0.428	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		Intron
EPHA8	2046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22902830	22902830	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:22902830G>A	ENST00000166244.3	+	3	352	c.280G>A	c.(280-282)Gcc>Acc	p.A94T	EPHA8_ENST00000538803.1_Missense_Mutation_p.A94T|EPHA8_ENST00000374644.4_Missense_Mutation_p.A94T	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	94	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCGAGACGGCGCCCGGCGCGT	0.607																																					p.A94T		.											.	EPHA8	1380	0			c.G280A						.						60.0	61.0	61.0					1																	22902830		2203	4300	6503	SO:0001583	missense	2046	exon3			GACGGCGCCCGGC	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.280G>A	1.37:g.22902830G>A	ENSP00000166244:p.Ala94Thr	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	76.0	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557296	0.86231	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.15256	2.44;2.44;2.44	4.29	4.29	0.51040	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.56013	-0.8049	10	0.87932	D	0	.	15.4668	0.75406	0.0:0.0:1.0:0.0	.	94;94	P29322;P29322-2	EPHA8_HUMAN;.	T	94	ENSP00000166244:A94T;ENSP00000363775:A94T;ENSP00000440274:A94T	ENSP00000166244:A94T	A	+	1	0	EPHA8	22775417	1.000000	0.71417	0.990000	0.47175	0.708000	0.40852	9.657000	0.98554	2.212000	0.71576	0.442000	0.29010	GCC	.		0.607	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
ESRRB	2103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76905705	76905705	+	Silent	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr14:76905705G>A	ENST00000509242.1	+	3	107	c.9G>A	c.(7-9)tcG>tcA	p.S3S	ESRRB_ENST00000556177.1_Silent_p.S3S|ESRRB_ENST00000261532.7_Silent_p.S3S|ESRRB_ENST00000380887.2_Silent_p.S3S|ESRRB_ENST00000507951.1_3'UTR	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	3					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		GGATGTCCTCGGACGACAGGC	0.657																																					p.S3S		.											.	ESRRB	188	0			c.G9A						.						64.0	68.0	67.0					14																	76905705		2195	4284	6479	SO:0001819	synonymous_variant	2103	exon4			GTCCTCGGACGAC	X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.9G>A	14.37:g.76905705G>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	29.0	NM_004452	A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Silent	SNP	ENST00000509242.1	37	CCDS9850.2																																																																																			.		0.657	ESRRB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360663.1		
FADD	8772	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	70049616	70049616	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:70049616C>T	ENST00000301838.4	+	1	348	c.51C>T	c.(49-51)agC>agT	p.S17S	RP11-805J14.5_ENST00000526174.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	17	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)			endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GCCTGTCGAGCAGCGAGCTGA	0.697																																					p.S17S		.											.	FADD	660	0			c.C51T						.						13.0	12.0	12.0					11																	70049616		2186	4257	6443	SO:0001819	synonymous_variant	8772	exon1			GTCGAGCAGCGAG	U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.51C>T	11.37:g.70049616C>T		Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	34.0	NM_003824	Q14866|Q6IBR4	Silent	SNP	ENST00000301838.4	37	CCDS8196.1																																																																																			.		0.697	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393902.1	NM_003824	
FAM124B	79843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	225266002	225266002	+	Nonsense_Mutation	SNP	T	T	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:225266002T>A	ENST00000409685.3	-	1	749	c.484A>T	c.(484-486)Aga>Tga	p.R162*	FAM124B_ENST00000243806.2_Nonsense_Mutation_p.R162*|FAM124B_ENST00000389874.3_Nonsense_Mutation_p.R162*	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	162										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		GTCGCTTCTCTCTGCAGGATC	0.522																																					p.R162X		.											.	FAM124B	92	0			c.A484T						.						89.0	84.0	86.0					2																	225266002		2203	4300	6503	SO:0001587	stop_gained	79843	exon1			CTTCTCTCTGCAG	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.484A>T	2.37:g.225266002T>A	ENSP00000386895:p.Arg162*	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	30.0	NM_024785	A6NNC7|Q8NBZ4|Q8TAV7	Nonsense_Mutation	SNP	ENST00000409685.3	37	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	T	39	7.322505	0.98210	.	.	ENSG00000124019	ENST00000389874;ENST00000409685;ENST00000243806	.	.	.	5.64	1.74	0.24563	.	0.277697	0.39341	N	0.001382	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.8127	8.4307	0.32755	0.0:0.0666:0.3767:0.5566	.	.	.	.	X	162	.	ENSP00000243806:R162X	R	-	1	2	FAM124B	224974246	0.977000	0.34250	0.639000	0.29394	0.941000	0.58515	1.604000	0.36804	0.053000	0.16036	0.533000	0.62120	AGA	.		0.522	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
FAM160A1	729830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	152550986	152550986	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr4:152550986G>A	ENST00000505231.1	+	6	1270	c.1111G>A	c.(1111-1113)Gac>Aac	p.D371N	FAM160A1_ENST00000435205.1_Missense_Mutation_p.D371N			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	371										endometrium(2)|kidney(1)	3						CCACATCCTAGACACTCTCAC	0.478																																					p.D371N		.											.	.	.	0			c.G1111A						.						136.0	98.0	110.0					4																	152550986		692	1591	2283	SO:0001583	missense	729830	exon8			ATCCTAGACACTC		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.1111G>A	4.37:g.152550986G>A	ENSP00000421580:p.Asp371Asn	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	13.0	NM_001109977	Q6ZUS2	Missense_Mutation	SNP	ENST00000505231.1	37	CCDS47146.1	.	.	.	.	.	.	.	.	.	.	G	34	5.291411	0.95546	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.30448	1.53;1.53	5.54	5.54	0.83059	.	.	.	.	.	T	0.49609	0.1567	L	0.51422	1.61	0.58432	D	0.999999	D	0.55605	0.972	P	0.61397	0.888	T	0.38243	-0.9670	9	0.49607	T	0.09	.	19.5185	0.95176	0.0:0.0:1.0:0.0	.	371	Q05DH4	F16A1_HUMAN	N	371	ENSP00000413196:D371N;ENSP00000421580:D371N	ENSP00000413196:D371N	D	+	1	0	FAM160A1	152770436	1.000000	0.71417	0.970000	0.41538	0.960000	0.62799	9.428000	0.97476	2.618000	0.88619	0.579000	0.79373	GAC	.		0.478	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365691.1	NM_001109977	
FAM179A	165186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	29222109	29222109	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:29222109G>T	ENST00000379558.4	+	4	553	c.202G>T	c.(202-204)Gga>Tga	p.G68*	FAM179A_ENST00000403861.2_Nonsense_Mutation_p.G68*	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	68										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GCTCCTGCGTGGACTCGGACA	0.617																																					p.G68X		.											.	FAM179A	26	0			c.G202T						.						40.0	44.0	43.0					2																	29222109		2131	4240	6371	SO:0001587	stop_gained	165186	exon4			CTGCGTGGACTCG	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.202G>T	2.37:g.29222109G>T	ENSP00000368876:p.Gly68*	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	15.0	NM_199280	Q6ZUF5	Nonsense_Mutation	SNP	ENST00000379558.4	37	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929203	0.52759	.	.	ENSG00000189350	ENST00000420297;ENST00000379558;ENST00000403861	.	.	.	5.51	3.36	0.38483	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	8.5104	0.33213	0.2071:0.0:0.7929:0.0	.	.	.	.	X	68	.	ENSP00000368876:G68X	G	+	1	0	FAM179A	29075613	0.295000	0.24389	0.009000	0.14445	0.022000	0.10575	2.135000	0.42112	1.324000	0.45282	0.478000	0.44815	GGA	.		0.617	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
FHOD3	80206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	34174853	34174853	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr18:34174853C>A	ENST00000359247.4	+	7	710	c.710C>A	c.(709-711)aCg>aAg	p.T237K	FHOD3_ENST00000445677.1_Missense_Mutation_p.T237K|FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000590592.1_Missense_Mutation_p.T237K|FHOD3_ENST00000257209.4_Missense_Mutation_p.T237K	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	237	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GCTGTTGACACGAAAAGAGGT	0.502																																					p.T237K		.											.	FHOD3	139	0			c.C710A						.						120.0	94.0	103.0					18																	34174853		2203	4300	6503	SO:0001583	missense	80206	exon7			TTGACACGAAAAG	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.710C>A	18.37:g.34174853C>A	ENSP00000352186:p.Thr237Lys	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	39.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	37		.	.	.	.	.	.	.	.	.	.	C	8.245	0.807739	0.16467	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.17054	2.3;2.3;2.3	5.3	5.3	0.74995	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);	0.421002	0.27406	N	0.019520	T	0.12263	0.0298	L	0.29908	0.895	0.24084	N	0.995939	P;P;B	0.43578	0.811;0.495;0.056	B;B;B	0.42319	0.383;0.148;0.117	T	0.15867	-1.0422	10	0.09843	T	0.71	.	10.3048	0.43674	0.0:0.9097:0.0:0.0903	.	237;237;237	Q2V2M9;Q2V2M9-3;E5F5Q0	FHOD3_HUMAN;.;.	K	237	ENSP00000257209:T237K;ENSP00000352186:T237K;ENSP00000411430:T237K	ENSP00000257209:T237K	T	+	2	0	FHOD3	32428851	0.063000	0.20901	0.995000	0.50966	0.163000	0.22366	0.524000	0.22940	2.625000	0.88918	0.655000	0.94253	ACG	.		0.502	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
FLG2	388698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152323836	152323836	+	Silent	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:152323836C>A	ENST00000388718.5	-	3	6498	c.6426G>T	c.(6424-6426)ggG>ggT	p.G2142G	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2142					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCCTGTCTCCCGTGAATGG	0.517																																					p.G2142G		.											.	FLG2	151	0			c.G6426T						.						419.0	388.0	399.0					1																	152323836		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			CTGTCTCCCGTGA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6426G>T	1.37:g.152323836C>A		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	32.0	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																			.		0.517	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
FMO2	2327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	171178027	171178027	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:171178027T>A	ENST00000209929.7	+	9	1509	c.1351T>A	c.(1351-1353)Tct>Act	p.S451T	RP1-127D3.4_ENST00000445290.1_RNA|FMO2_ENST00000529935.1_3'UTR|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000422841.1_RNA|FMO2_ENST00000441535.1_Missense_Mutation_p.S451T			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	449					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGATTTCTGCTCTCTCTTGTT	0.498																																					p.S451T		.											.	FMO2	91	0			c.T1351A						.						210.0	203.0	205.0					1																	171178027		2203	4300	6503	SO:0001583	missense	2327	exon9			TTCTGCTCTCTCT	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.1351T>A	1.37:g.171178027T>A	ENSP00000209929:p.Ser451Thr	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	25.0	NM_001460	Q53XR0	Missense_Mutation	SNP	ENST00000209929.7	37	CCDS1293.1	.	.	.	.	.	.	.	.	.	.	T	2.843	-0.240102	0.05944	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	T;T	0.56941	0.43;0.43	5.99	0.95	0.19572	.	0.562999	0.21084	N	0.080436	T	0.23766	0.0575	M	0.75777	2.31	0.09310	N	1	P	0.34699	0.464	B	0.36186	0.219	T	0.25082	-1.0142	10	0.22706	T	0.39	-6.2112	1.7888	0.03047	0.1247:0.1386:0.2591:0.4776	.	451	Q99518	FMO2_HUMAN	T	451	ENSP00000209929:S451T;ENSP00000405905:S451T	ENSP00000209929:S451T	S	+	1	0	FMO2	169444651	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.152000	0.03172	-0.079000	0.12707	-0.313000	0.08912	TCT	.		0.498	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2	NM_001460	
FZD5	7855	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	208632778	208632778	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:208632778G>T	ENST00000295417.3	-	2	1239	c.686C>A	c.(685-687)gCc>gAc	p.A229D		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	229					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		GCGCTCGTCGGCACTGAAGGA	0.612																																					p.A229D		.											.	FZD5	660	0			c.C686A						.						59.0	56.0	57.0					2																	208632778		2203	4300	6503	SO:0001583	missense	7855	exon2			TCGTCGGCACTGA	U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.686C>A	2.37:g.208632778G>T	ENSP00000354607:p.Ala229Asp	Somatic	70.0	1.0		WXS	Illumina HiSeq	Phase_I	70.0	32.0	NM_003468	A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	ENST00000295417.3	37	CCDS33366.1	.	.	.	.	.	.	.	.	.	.	G	10.90	1.482635	0.26598	.	.	ENSG00000163251	ENST00000295417	D	0.81579	-1.51	5.05	5.05	0.67936	.	0.378699	0.26489	U	0.024089	T	0.66458	0.2791	N	0.16790	0.44	0.30822	N	0.737625	B	0.02656	0.0	B	0.11329	0.006	T	0.63180	-0.6695	10	0.32370	T	0.25	.	11.5612	0.50778	0.0:0.0:0.6964:0.3036	.	229	Q13467	FZD5_HUMAN	D	229	ENSP00000354607:A229D	ENSP00000354607:A229D	A	-	2	0	FZD5	208341023	0.993000	0.37304	0.997000	0.53966	0.850000	0.48378	2.215000	0.42862	2.355000	0.79922	0.561000	0.74099	GCC	.		0.612	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1	NM_003468	
GABRA6	2559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	161113294	161113294	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr5:161113294A>G	ENST00000274545.5	+	2	530	c.97A>G	c.(97-99)Agt>Ggt	p.S33G	GABRA6_ENST00000523217.1_Missense_Mutation_p.S33G|RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000522269.1_3'UTR			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	33					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	AGAAAACGTCAGTCGGATCCT	0.483										TCGA Ovarian(5;0.080)																											p.S33G		.											.	GABRA6	163	0			c.A97G						.						112.0	113.0	112.0					5																	161113294		2203	4300	6503	SO:0001583	missense	2559	exon2			AACGTCAGTCGGA		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.97A>G	5.37:g.161113294A>G	ENSP00000274545:p.Ser33Gly	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	23.0	NM_000811	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.521666	0.64747	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	T;T	0.77750	-1.12;-1.12	5.63	5.63	0.86233	Neurotransmitter-gated ion-channel ligand-binding (3);	0.044841	0.85682	D	0.000000	T	0.81578	0.4852	M	0.72118	2.19	0.39704	D	0.971232	B	0.29955	0.263	B	0.42625	0.393	T	0.83144	-0.0107	10	0.87932	D	0	.	11.6013	0.51003	0.8668:0.0:0.0:0.1332	.	33	Q16445	GBRA6_HUMAN	G	33	ENSP00000274545:S33G;ENSP00000430527:S33G	ENSP00000274545:S33G	S	+	1	0	GABRA6	161045872	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	6.902000	0.75699	2.145000	0.66743	0.533000	0.62120	AGT	.		0.483	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
GALK1	2584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	73761055	73761055	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:73761055T>C	ENST00000588479.1	-	1	737	c.163A>G	c.(163-165)Atg>Gtg	p.M55V	GALK1_ENST00000437911.1_Missense_Mutation_p.M85V|GALK1_ENST00000225614.2_Missense_Mutation_p.M55V			P51570	GALK1_HUMAN	galactokinase 1	55					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCCCTCACCATAGGCAGCACC	0.746																																					p.M55V		.											.	GALK1	90	0			c.A163G						.						18.0	25.0	23.0					17																	73761055		2195	4287	6482	SO:0001583	missense	2584	exon1			TCACCATAGGCAG		CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.163A>G	17.37:g.73761055T>C	ENSP00000465930:p.Met55Val	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	34.0	NM_000154	B2RC07|B4E1G6	Missense_Mutation	SNP	ENST00000588479.1	37	CCDS11728.1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.292472	0.59976	.	.	ENSG00000108479	ENST00000225614;ENST00000437911;ENST00000375188	D;D	0.90504	-2.68;-2.68	4.47	4.47	0.54385	Ribosomal protein S5 domain 2-type fold (1);Galactokinase galactose-binding domain (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.078972	0.85682	D	0.000000	D	0.94132	0.8118	M	0.77486	2.375	0.80722	D	1	D;D	0.63046	0.992;0.984	P;P	0.61201	0.852;0.885	D	0.94708	0.7889	10	0.66056	D	0.02	-15.9352	13.9259	0.63961	0.0:0.0:0.0:1.0	.	55;55	B4E1A8;P51570	.;GALK1_HUMAN	V	55;85;55	ENSP00000225614:M55V;ENSP00000406305:M85V	ENSP00000225614:M55V	M	-	1	0	GALK1	71272650	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	7.053000	0.76641	1.883000	0.54544	0.172000	0.16884	ATG	.		0.746	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448430.1		
GLCE	26035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69560737	69560737	+	Silent	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr15:69560737T>C	ENST00000261858.2	+	5	1236	c.1008T>C	c.(1006-1008)gaT>gaC	p.D336D	GLCE_ENST00000559500.1_3'UTR|GLCE_ENST00000559420.2_Silent_p.D272D	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	336					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AAGAAAGAGATATATACTATG	0.433																																					p.D336D		.											.	GLCE	92	0			c.T1008C						.						65.0	68.0	67.0					15																	69560737		2200	4298	6498	SO:0001819	synonymous_variant	26035	exon5			AAGAGATATATAC	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.1008T>C	15.37:g.69560737T>C		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	32.0	NM_015554	Q6GUQ2	Silent	SNP	ENST00000261858.2	37	CCDS32277.1																																																																																			.		0.433	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
GPR174	84636	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	78427073	78427073	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chrX:78427073A>G	ENST00000276077.1	+	1	605	c.569A>G	c.(568-570)gAg>gGg	p.E190G		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T187fs*3(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						ACCATTGGCGAGTTGATTGGG	0.453										HNSCC(63;0.18)																											p.E190G		.											.	GPR174	130	1	Deletion - Frameshift(1)	large_intestine(1)	c.A569G						.						114.0	103.0	107.0					X																	78427073		2203	4300	6503	SO:0001583	missense	84636	exon1			TTGGCGAGTTGAT	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.569A>G	X.37:g.78427073A>G	ENSP00000276077:p.Glu190Gly	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	6.0	NM_032553	Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	a	14.01	2.406348	0.42715	.	.	ENSG00000147138	ENST00000276077	T	0.71817	-0.6	5.08	5.08	0.68730	GPCR, rhodopsin-like superfamily (1);	0.055152	0.64402	D	0.000001	T	0.82019	0.4946	M	0.79011	2.435	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.80365	-0.1413	10	0.23302	T	0.38	.	12.6818	0.56926	1.0:0.0:0.0:0.0	.	190	Q9BXC1	GP174_HUMAN	G	190	ENSP00000276077:E190G	ENSP00000276077:E190G	E	+	2	0	GPR174	78313729	1.000000	0.71417	0.776000	0.31678	0.123000	0.20343	7.306000	0.78905	1.673000	0.50895	0.397000	0.26171	GAG	.		0.453	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553	
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	12120854	12120854	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr6:12120854G>T	ENST00000379388.2	+	4	1158	c.826G>T	c.(826-828)Gca>Tca	p.A276S		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	276					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TGAGCAAGGGGCAATGCAGTC	0.448																																					p.A276S		.											.	HIVEP1	139	0			c.G826T						.						113.0	105.0	107.0					6																	12120854		1944	4148	6092	SO:0001583	missense	3096	exon4			CAAGGGGCAATGC	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.826G>T	6.37:g.12120854G>T	ENSP00000368698:p.Ala276Ser	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	36.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.754705	0.00663	.	.	ENSG00000095951	ENST00000379388	T	0.08546	3.08	5.17	-4.81	0.03180	.	0.806254	0.10135	N	0.711645	T	0.01287	0.0042	L	0.35414	1.06	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.47761	-0.9092	9	.	.	.	-1.0969	1.9728	0.03409	0.2448:0.4121:0.1564:0.1867	.	276	P15822	ZEP1_HUMAN	S	276	ENSP00000368698:A276S	.	A	+	1	0	HIVEP1	12228840	0.000000	0.05858	0.000000	0.03702	0.135000	0.20990	0.034000	0.13776	-0.837000	0.04223	-0.885000	0.02943	GCA	.		0.448	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
HNF4G	3174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	76471204	76471204	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:76471204A>T	ENST00000354370.1	+	9	1184	c.914A>T	c.(913-915)cAa>cTa	p.Q305L	HNF4G_ENST00000396423.2_Missense_Mutation_p.Q342L			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	305					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			ATGATTGAGCAAATACAGTTT	0.413																																					p.Q342L		.											.	HNF4G	187	0			c.A1025T						.						92.0	90.0	91.0					8																	76471204		2203	4300	6503	SO:0001583	missense	3174	exon8			TTGAGCAAATACA		CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.914A>T	8.37:g.76471204A>T	ENSP00000346339:p.Gln305Leu	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	20.0	NM_004133	Q7Z2V9|Q9UH81|Q9UIS6	Missense_Mutation	SNP	ENST00000354370.1	37		.	.	.	.	.	.	.	.	.	.	A	29.3	4.994405	0.93167	.	.	ENSG00000164749	ENST00000354370;ENST00000396423	D;D	0.96745	-4.11;-4.11	5.52	5.52	0.82312	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.000000	0.85682	D	0.000000	D	0.97281	0.9111	M	0.70787	2.145	0.80722	D	1	P;D	0.56521	0.898;0.976	B;P	0.58013	0.43;0.831	D	0.97878	1.0290	10	0.87932	D	0	.	15.6365	0.76958	1.0:0.0:0.0:0.0	.	342;305	F1D8Q4;Q14541	.;HNF4G_HUMAN	L	305;342	ENSP00000346339:Q305L;ENSP00000379701:Q342L	ENSP00000346339:Q305L	Q	+	2	0	HNF4G	76633759	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.281000	0.95811	2.093000	0.63338	0.533000	0.62120	CAA	.		0.413	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000313914.2	NM_004133	
JMJD7	100137047	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42126967	42126967	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr15:42126967C>T	ENST00000397299.4	+	2	134	c.94C>T	c.(94-96)Ctg>Ttg	p.L32L	JMJD7_ENST00000408047.1_Intron|JMJD7-PLA2G4B_ENST00000382448.4_Silent_p.L32L|JMJD7-PLA2G4B_ENST00000342159.4_Silent_p.L32L|PLA2G4B_ENST00000542534.2_Silent_p.L32L|JMJD7_ENST00000405106.2_3'UTR	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	32										NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						TGTGCCCTACCTGGACAAACC	0.612																																					p.L32L		.											.	JMJD7-PLA2G4B	135	0			c.C94T						.						131.0	130.0	130.0					15																	42126967		2203	4300	6503	SO:0001819	synonymous_variant	8681	exon2			CCCTACCTGGACA		CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.94C>T	15.37:g.42126967C>T		Somatic	84.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	21.0	NM_005090	A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Silent	SNP	ENST00000397299.4	37	CCDS45240.1																																																																																			.		0.612	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326082.1	NM_001114632	
CFAP74	85452	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1890603	1890603	+	IGR	SNP	C	C	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:1890603C>G								TMEM52 (39891 upstream) : C1orf222 (28959 downstream)																							GAAAACTCGCCCGTCTGAGCC	0.438																																					p.G603R		.											.	KIAA1751	69	0			c.G1807C						.						95.0	96.0	95.0					1																	1890603		1847	4100	5947	SO:0001628	intergenic_variant	85452	exon16			ACTCGCCCGTCTG																													1.37:g.1890603C>G		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	12.0	NM_001080484		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	C	18.88	3.717694	0.68844	.	.	ENSG00000142609	ENST00000270720;ENST00000461752	.	.	.	4.72	4.72	0.59763	.	0.159217	0.39985	N	0.001214	T	0.80363	0.4609	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83505	0.0077	9	0.66056	D	0.02	-27.4137	15.5598	0.76234	0.0:1.0:0.0:0.0	.	603;603	Q9C0B2-2;Q9C0B2	.;K1751_HUMAN	R	603;50	.	ENSP00000270720:G603R	G	-	1	0	C1orf222	1880463	0.984000	0.35163	0.408000	0.26446	0.871000	0.50021	5.011000	0.64011	2.329000	0.79093	0.561000	0.74099	GGC	.	0	0.438								
KIAA0907	22889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	155891367	155891367	+	Nonsense_Mutation	SNP	A	A	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:155891367A>C	ENST00000368321.3	-	10	1088	c.1065T>G	c.(1063-1065)taT>taG	p.Y355*	KIAA0907_ENST00000368320.3_Nonsense_Mutation_p.Y355*|KIAA0907_ENST00000368319.3_Intron|SNORA42_ENST00000384744.1_RNA|KIAA0907_ENST00000482337.1_Intron	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	355	Pro-rich.						RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			CATTGGATGGATAATATGGTG	0.488																																					p.Y355X		.											.	KIAA0907	90	0			c.T1065G						.						125.0	122.0	123.0					1																	155891367		2203	4300	6503	SO:0001587	stop_gained	22889	exon10			GGATGGATAATAT	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.1065T>G	1.37:g.155891367A>C	ENSP00000357304:p.Tyr355*	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	239.0	201.0	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Nonsense_Mutation	SNP	ENST00000368321.3	37	CCDS30885.1	.	.	.	.	.	.	.	.	.	.	A	29.1	4.978543	0.92982	.	.	ENSG00000132680	ENST00000368321;ENST00000368320	.	.	.	5.62	4.5	0.54988	.	0.125010	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8562	4.8857	0.13701	0.7345:0.0:0.2655:0.0	.	.	.	.	X	355	.	ENSP00000357303:Y355X	Y	-	3	2	KIAA0907	154157991	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.440000	0.44855	2.136000	0.66102	0.402000	0.26972	TAT	.		0.488	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,NS,haematopoietic_neoplasm,0	KRAS	92875	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp	Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	75.0	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
KRT10	3858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38976377	38976377	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:38976377C>G	ENST00000269576.5	-	5	1088	c.1079G>C	c.(1078-1080)aGc>aCc	p.S360T	TMEM99_ENST00000301665.3_Intron|TMEM99_ENST00000496847.1_Intron	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	360	Coil 2.|Gly-rich.|Rod.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				AGATTTATAGCTGGATATCTG	0.353																																					p.S360T		.											.	KRT10	90	0			c.G1079C						.						101.0	99.0	100.0					17																	38976377		2203	4300	6503	SO:0001583	missense	3858	exon5			TTATAGCTGGATA	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1079G>C	17.37:g.38976377C>G	ENSP00000269576:p.Ser360Thr	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	24.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	37	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346658	0.61073	.	.	ENSG00000186395	ENST00000269576	D	0.88975	-2.45	5.6	5.6	0.85130	Filament (1);	0.000000	0.43260	D	0.000590	D	0.83257	0.5215	N	0.12471	0.22	0.80722	D	1	B	0.17465	0.022	B	0.41174	0.349	T	0.76490	-0.2940	10	0.23302	T	0.38	.	10.1187	0.42607	0.0:0.8517:0.0:0.1483	.	360	P13645	K1C10_HUMAN	T	360	ENSP00000269576:S360T	ENSP00000269576:S360T	S	-	2	0	KRT10	36229903	0.000000	0.05858	0.999000	0.59377	0.957000	0.61999	0.515000	0.22801	2.655000	0.90218	0.655000	0.94253	AGC	.		0.353	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
LAMB1	3912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107580787	107580787	+	Silent	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr7:107580787G>A	ENST00000222399.6	-	25	3638	c.3408C>T	c.(3406-3408)ccC>ccT	p.P1136P	LAMB1_ENST00000393561.1_Silent_p.P1160P|CTB-13F3.1_ENST00000608515.1_RNA	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1136	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CAATGCCCCTGGGGTCACAGT	0.522																																					p.P1136P		.											.	LAMB1	97	0			c.C3408T						.						60.0	53.0	56.0					7																	107580787		2203	4300	6503	SO:0001819	synonymous_variant	3912	exon25			GCCCCTGGGGTCA	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.3408C>T	7.37:g.107580787G>A		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	18.0	NM_002291	Q14D91	Silent	SNP	ENST00000222399.6	37	CCDS5750.1																																																																																			.		0.522	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
LGALS3BP	3959	ucsc.edu;bcgsc.ca	37	17	76973243	76973243	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:76973243G>T	ENST00000262776.3	-	2	339	c.31C>A	c.(31-33)Ctg>Atg	p.L11M	LGALS3BP_ENST00000585407.1_Missense_Mutation_p.L11M|LGALS3BP_ENST00000591778.1_Missense_Mutation_p.L11M	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	11					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GCAACCAGCAGCCACACCCAG	0.627																																					p.L11M	GBM(89;1105 1755 18102 21513)	.											.	LGALS3BP	515	0			c.C31A						.						62.0	57.0	59.0					17																	76973243		2203	4300	6503	SO:0001583	missense	3959	exon2			CCAGCAGCCACAC	L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.31C>A	17.37:g.76973243G>T	ENSP00000262776:p.Leu11Met	Somatic	53.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_005567	Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Missense_Mutation	SNP	ENST00000262776.3	37	CCDS11759.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.543297	0.27563	.	.	ENSG00000108679	ENST00000262776;ENST00000536190	T	0.38722	1.12	3.22	1.19	0.21007	.	0.000000	0.28971	N	0.013547	T	0.58308	0.2113	M	0.76328	2.33	0.23249	N	0.99805	D	0.89917	1.0	D	0.83275	0.996	T	0.48854	-0.8998	10	0.66056	D	0.02	-21.7235	7.8566	0.29485	0.2345:0.0:0.7655:0.0	.	11	Q08380	LG3BP_HUMAN	M	11	ENSP00000262776:L11M	ENSP00000262776:L11M	L	-	1	2	LGALS3BP	74484838	0.669000	0.27502	0.865000	0.33974	0.394000	0.30568	0.656000	0.24948	0.073000	0.16731	-0.797000	0.03246	CTG	.		0.627	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437785.3	NM_005567	
LRP4	4038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46921486	46921486	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:46921486C>T	ENST00000378623.1	-	4	600	c.358G>A	c.(358-360)Ggc>Agc	p.G120S		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	120	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		ATGCAGTAGCCATTCTGGCAG	0.632																																					p.G120S		.											.	LRP4	94	0			c.G358A						.						84.0	77.0	80.0					11																	46921486		2201	4299	6500	SO:0001583	missense	4038	exon4			AGTAGCCATTCTG	AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.358G>A	11.37:g.46921486C>T	ENSP00000367888:p.Gly120Ser	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	13.0	NM_002334	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	ENST00000378623.1	37	CCDS31478.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682626	0.88542	.	.	ENSG00000134569	ENST00000378623;ENST00000534404	D;D	0.95980	-3.87;-3.07	5.33	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.97192	0.9082	M	0.73430	2.235	0.80722	D	1	B;D	0.76494	0.346;0.999	B;D	0.72982	0.212;0.979	D	0.97490	1.0053	10	0.62326	D	0.03	.	14.1484	0.65364	0.0:0.9276:0.0:0.0724	.	165;120	C9JRN7;O75096	.;LRP4_HUMAN	S	120;71	ENSP00000367888:G120S;ENSP00000434763:G71S	ENSP00000367888:G120S	G	-	1	0	LRP4	46878062	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	5.806000	0.69150	1.398000	0.46701	0.511000	0.50034	GGC	.		0.632	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391133.1	NM_002334	
MDC1	9656	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	30681730	30681731	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr6:30681730_30681731delAG	ENST00000376406.3	-	3	1013_1014	c.366_367delCT	c.(364-369)ctctttfs	p.F123fs	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Frame_Shift_Del_p.F123fs	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	123	Interaction with CHEK2.|Interaction with the MRN complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						AAGTCAGCAAAGAGAATCAATT	0.545								Other conserved DNA damage response genes																													p.122_123del		.											.	MDC1	273	0			c.366_367del						.																																			SO:0001589	frameshift_variant	9656	exon3			CAGCAAAGAGAAT	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.366_367delCT	6.37:g.30681732_30681733delAG	ENSP00000365588:p.Phe123fs	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	25.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Frame_Shift_Del	DEL	ENST00000376406.3	37	CCDS34384.1																																																																																			.		0.545	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
ZRANB2	9406	ucsc.edu;mdanderson.org	37	1	71533380	71533380	+	Intron	SNP	T	T	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:71533380T>A	ENST00000370920.3	-	9	1072				ZRANB2_ENST00000477096.1_5'Flank|ZRANB2-AS1_ENST00000426999.1_RNA|ZRANB2_ENST00000254821.6_Intron|MIR186_ENST00000384988.1_RNA|ZRANB2-AS1_ENST00000450461.1_RNA	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						AAAGGAGAATTCTTTGGAAAG	0.333																																					.		.											.	.	.	0			.						.						11.0	11.0	11.0					1																	71533380		1552	3502	5054	SO:0001627	intron_variant	406962	.			GAGAATTCTTTGG	AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.771-763A>T	1.37:g.71533380T>A		Somatic	258.0	0.0		WXS	Illumina HiSeq	.	250.0	95.0	.	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	RNA	SNP	ENST00000370920.3	37	CCDS659.1																																																																																			.		0.333	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026636.1	NM_203350	
MRC2	9902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	60742016	60742016	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:60742016C>A	ENST00000303375.5	+	2	628	c.226C>A	c.(226-228)Cgc>Agc	p.R76S	Y_RNA_ENST00000384652.1_RNA	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	76	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCCTGCCCAGCGCTGGAAGTG	0.652																																					p.R76S		.											.	MRC2	117	0			c.C226A						.						67.0	67.0	67.0					17																	60742016		2203	4300	6503	SO:0001583	missense	9902	exon2			GCCCAGCGCTGGA	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.226C>A	17.37:g.60742016C>A	ENSP00000307513:p.Arg76Ser	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	14.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295546	0.60086	.	.	ENSG00000011028	ENST00000303375	T	0.31247	1.5	5.23	5.23	0.72850	Ricin B-related lectin (1);Ricin B lectin (2);	0.268277	0.40385	N	0.001120	T	0.21509	0.0518	L	0.29908	0.895	0.80722	D	1	P	0.38148	0.62	B	0.28849	0.095	T	0.05131	-1.0904	10	0.54805	T	0.06	-25.7213	14.5256	0.67887	0.1471:0.8529:0.0:0.0	.	76	Q9UBG0	MRC2_HUMAN	S	76	ENSP00000307513:R76S	ENSP00000307513:R76S	R	+	1	0	MRC2	58095748	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.369000	0.44231	2.450000	0.82876	0.561000	0.74099	CGC	.		0.652	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9084547	9084547	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr19:9084547T>G	ENST00000397910.4	-	1	7471	c.7268A>C	c.(7267-7269)aAt>aCt	p.N2423T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2423	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGTGGCTGTATTTGTCTCTGT	0.493																																					p.N2423T		.											.	MUC16	566	0			c.A7268C						.						84.0	87.0	86.0					19																	9084547		1970	4153	6123	SO:0001583	missense	94025	exon1			GCTGTATTTGTCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7268A>C	19.37:g.9084547T>G	ENSP00000381008:p.Asn2423Thr	Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	6.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	3.290	-0.145088	0.06627	.	.	ENSG00000181143	ENST00000397910	T	0.02498	4.27	0.225	0.225	0.15325	.	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	.	.	.	D	0.54772	0.968	P	0.59546	0.859	T	0.45745	-0.9240	7	0.87932	D	0	.	.	.	.	.	2423	B5ME49	.	T	2423	ENSP00000381008:N2423T	ENSP00000381008:N2423T	N	-	2	0	MUC16	8945547	0.003000	0.15002	0.359000	0.25824	0.361000	0.29550	-0.141000	0.10327	0.257000	0.21650	0.254000	0.18369	AAT	.		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
N4BP2L2	10443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	33110720	33110720	+	Missense_Mutation	SNP	T	T	C	rs375163250		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr13:33110720T>C	ENST00000267068.3	-	2	609	c.445A>G	c.(445-447)Ata>Gta	p.I149V	N4BP2L2_ENST00000399396.3_Intron|N4BP2L2_ENST00000504114.1_Intron|N4BP2L2_ENST00000357505.6_Intron|N4BP2L2_ENST00000446957.2_Missense_Mutation_p.I149V	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	149					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		CTGTCATTTATACCATTTAGA	0.338																																					p.I149V		.											.	N4BP2L2	68	0			c.A445G						.	T	VAL/ILE,	1,4405	2.1+/-5.4	0,1,2202	113.0	117.0	116.0		445,	-3.0	0.0	13		116	0,8600		0,0,4300	no	missense,intron	N4BP2L2	NM_014887.2,NM_033111.3	29,	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	,	149/584,	33110720	1,13005	2203	4300	6503	SO:0001583	missense	10443	exon2			CATTTATACCATT	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.445A>G	13.37:g.33110720T>C	ENSP00000267068:p.Ile149Val	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	50.0	NM_014887	A3KME8	Missense_Mutation	SNP	ENST00000267068.3	37	CCDS9346.1	.	.	.	.	.	.	.	.	.	.	T	0.020	-1.436195	0.01108	2.27E-4	0.0	ENSG00000244754	ENST00000446957;ENST00000505213;ENST00000267068	T;T;T	0.41065	1.01;1.01;1.01	5.02	-3.03	0.05429	.	.	.	.	.	T	0.20007	0.0481	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.36383	-0.9750	9	0.02654	T	1	-14.8072	8.7717	0.34735	0.1097:0.488:0.0:0.4023	.	149;149	D6R968;Q92802	.;N42L2_HUMAN	V	149	ENSP00000394239:I149V;ENSP00000423362:I149V;ENSP00000267068:I149V	ENSP00000267068:I149V	I	-	1	0	N4BP2L2	32008720	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.457000	0.21875	-0.454000	0.07066	0.460000	0.39030	ATA	.		0.338	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1	NM_014887	
NEO1	4756	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	73541427	73541427	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr15:73541427C>T	ENST00000339362.5	+	11	2080	c.1633C>T	c.(1633-1635)Ctt>Ttt	p.L545F	NEO1_ENST00000560262.1_Missense_Mutation_p.L545F|NEO1_ENST00000560352.1_3'UTR|NEO1_ENST00000261908.6_Missense_Mutation_p.L545F|NEO1_ENST00000558964.1_Missense_Mutation_p.L545F			Q92859	NEO1_HUMAN	neogenin 1	545	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						AGCACCTAACCTTCGTGCATA	0.428																																					p.L545F		.											.	NEO1	116	0			c.C1633T						.						115.0	109.0	111.0					15																	73541427		2198	4297	6495	SO:0001583	missense	4756	exon10			CCTAACCTTCGTG	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.1633C>T	15.37:g.73541427C>T	ENSP00000341198:p.Leu545Phe	Somatic	61.0	1.0		WXS	Illumina HiSeq	Phase_I	41.0	23.0	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	37	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285802	0.40394	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.64438	-0.1;-0.1	5.43	4.3	0.51218	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.167940	0.53938	D	0.000054	T	0.62780	0.2456	M	0.70275	2.135	0.39327	D	0.965346	B;B;B;B	0.16396	0.003;0.008;0.017;0.017	B;B;B;B	0.36922	0.061;0.236;0.236;0.184	T	0.56098	-0.8035	10	0.20519	T	0.43	-11.762	7.6749	0.28480	0.7142:0.1473:0.0:0.1385	.	545;545;283;545	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	F	545;283;545	ENSP00000341198:L545F;ENSP00000261908:L545F	ENSP00000261908:L545F	L	+	1	0	NEO1	71328480	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	2.963000	0.49184	0.899000	0.36444	-0.265000	0.10407	CTT	.		0.428	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
OR13C9	286362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107379836	107379836	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr9:107379836G>T	ENST00000259362.1	-	1	649	c.650C>A	c.(649-651)tCt>tAt	p.S217Y		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						TAATGAGTAAGAGATAACTAT	0.448																																					p.S217Y		.											.	OR13C9	68	0			c.C650A						.						87.0	80.0	82.0					9																	107379836		2202	4300	6502	SO:0001583	missense	286362	exon1			GAGTAAGAGATAA		CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.650C>A	9.37:g.107379836G>T	ENSP00000259362:p.Ser217Tyr	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	21.0	NM_001001956	Q6IFL2	Missense_Mutation	SNP	ENST00000259362.1	37	CCDS35093.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817518	0.50633	.	.	ENSG00000136839	ENST00000259362	T	0.46063	0.88	4.46	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000260	T	0.78149	0.4238	H	0.98883	4.36	0.28238	N	0.925805	D	0.89917	1.0	D	0.87578	0.998	T	0.78959	-0.1998	10	0.87932	D	0	.	14.6428	0.68737	0.0:0.0:1.0:0.0	.	217	Q8NGT0	O13C9_HUMAN	Y	217	ENSP00000259362:S217Y	ENSP00000259362:S217Y	S	-	2	0	OR13C9	106419657	1.000000	0.71417	0.219000	0.23793	0.643000	0.38383	7.303000	0.78871	2.271000	0.75665	0.643000	0.83706	TCT	.		0.448	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1		
OR2L13	284521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248263223	248263223	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:248263223C>T	ENST00000358120.2	+	2	691	c.546C>T	c.(544-546)gcC>gcT	p.A182A	OR2L13_ENST00000366478.2_Silent_p.A182A			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			ATGTCCCAGCCATGTTGCTTC	0.453																																					p.A182A		.											.	OR2L13	70	0			c.C546T						.						268.0	240.0	249.0					1																	248263223		2203	4300	6503	SO:0001819	synonymous_variant	284521	exon3			CCCAGCCATGTTG	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.546C>T	1.37:g.248263223C>T		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	68.0	NM_175911	Q5VUR5	Silent	SNP	ENST00000358120.2	37	CCDS1637.1																																																																																			.		0.453	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
OR2M3	127062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248366590	248366590	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:248366590T>C	ENST00000456743.1	+	1	259	c.221T>C	c.(220-222)aTc>aCc	p.I74T		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTCATGCTCATCTGCACCACC	0.517																																					p.I74T		.											.	OR2M3	70	0			c.T221C						.						292.0	275.0	281.0					1																	248366590		2203	4300	6503	SO:0001583	missense	127062	exon1			TGCTCATCTGCAC		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.221T>C	1.37:g.248366590T>C	ENSP00000389625:p.Ile74Thr	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	46.0	NM_001004689	B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	37	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	T	10.28	1.306330	0.23736	.	.	ENSG00000228198	ENST00000456743	T	0.00601	6.29	2.44	1.3	0.21679	GPCR, rhodopsin-like superfamily (1);	0.543723	0.13772	U	0.363815	T	0.00412	0.0013	N	0.17312	0.475	0.09310	N	1	B	0.16802	0.019	B	0.18871	0.023	T	0.45920	-0.9228	10	0.38643	T	0.18	.	4.2878	0.10863	0.0:0.1266:0.2055:0.6679	.	74	Q8NG83	OR2M3_HUMAN	T	74	ENSP00000389625:I74T	ENSP00000389625:I74T	I	+	2	0	OR2M3	246433213	0.000000	0.05858	0.022000	0.16811	0.603000	0.37013	0.031000	0.13710	1.117000	0.41842	0.333000	0.21579	ATC	.		0.517	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
OR5D18	219438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55587642	55587642	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:55587642C>T	ENST00000333976.4	+	1	557	c.537C>T	c.(535-537)ttC>ttT	p.F179F		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				ATCACTTCTTCTGTGAGTTCT	0.428																																					p.F179F		.											.	OR5D18	71	0			c.C537T						.						216.0	198.0	204.0					11																	55587642		2200	4296	6496	SO:0001819	synonymous_variant	219438	exon1			CTTCTTCTGTGAG	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.537C>T	11.37:g.55587642C>T		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	28.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	ENST00000333976.4	37	CCDS31510.1																																																																																			.		0.428	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
PARG	8505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	51040916	51040916	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr10:51040916C>A	ENST00000402038.3	-	12	1124	c.1125G>T	c.(1123-1125)gaG>gaT	p.E375D	PARG_ENST00000492350.1_5'UTR	NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	860	A-domain.				carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)			endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		CAGAAAGATTCTCTGAAGAAA	0.453																																					p.E860D		.											.	PARG	948	0			c.G2580T						.						74.0	70.0	71.0					10																	51040916		692	1591	2283	SO:0001583	missense	8505	exon16			AAGATTCTCTGAA	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.1125G>T	10.37:g.51040916C>A	ENSP00000384408:p.Glu375Asp	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	44.0	NM_003631	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.64|10.64	1.406817|1.406817	0.25378|0.25378	.|.	.|.	ENSG00000227345|ENSG00000227345	ENST00000402038|ENST00000432127	.|.	.|.	.|.	5.67|5.67	1.73|1.73	0.24493|0.24493	.|.	0.145331|.	0.64402|.	D|.	0.000010|.	T|T	0.24547|0.24547	0.0595|0.0595	N|N	0.16743|0.16743	0.435|0.435	.|.	.|.	.|.	P;P;B;P;B;B;P|.	0.45283|.	0.622;0.855;0.356;0.525;0.116;0.143;0.768|.	B;P;B;B;B;B;B|.	0.47015|.	0.146;0.534;0.084;0.124;0.062;0.084;0.415|.	T|T	0.30297|0.30297	-0.9983|-0.9983	8|4	0.19590|.	T|.	0.45|.	-13.7566|-13.7566	5.233|5.233	0.15432|0.15432	0.1307:0.4435:0.0:0.4258|0.1307:0.4435:0.0:0.4258	.|.	778;860;411;128;375;400;860|.	Q86W56-2;Q86W56;A5YBK3;B4DHS4;Q5SQP4;B4DX76;Q0MQR4|.	.;PARG_HUMAN;.;.;.;.;.|.	D|I	375|76	.|.	ENSP00000384408:E375D|.	E|R	-|-	3|2	2|0	PARG|PARG	50710922|50710922	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.897000|0.897000	0.52465|0.52465	0.964000|0.964000	0.29306|0.29306	0.064000|0.064000	0.16427|0.16427	-0.136000|-0.136000	0.14681|0.14681	GAG|AGA	.		0.453	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
PCYT1A	5130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195975135	195975135	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr3:195975135C>A	ENST00000292823.2	-	5	449	c.277G>T	c.(277-279)Gcc>Tcc	p.A93S	RP11-447L10.1_ENST00000431391.1_3'UTR|PCYT1A_ENST00000431016.1_Missense_Mutation_p.A93S|PCYT1A_ENST00000491544.1_5'UTR|AC069257.8_ENST00000425275.1_RNA|PCYT1A_ENST00000419333.1_Missense_Mutation_p.A93S|AC069257.8_ENST00000608995.1_RNA	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	93					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	AGAGCTCGGGCGTGACCAGAG	0.413																																					p.A93S		.											.	PCYT1A	90	0			c.G277T						.						120.0	117.0	118.0					3																	195975135		2203	4300	6503	SO:0001583	missense	5130	exon5			CTCGGGCGTGACC	L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.277G>T	3.37:g.195975135C>A	ENSP00000292823:p.Ala93Ser	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	26.0	NM_005017	A9LYK9|D3DXB1|Q86Y88	Missense_Mutation	SNP	ENST00000292823.2	37	CCDS3315.1	.	.	.	.	.	.	.	.	.	.	c	36	5.722870	0.96847	.	.	ENSG00000161217	ENST00000441879;ENST00000419333;ENST00000292823;ENST00000416798;ENST00000431016;ENST00000411591;ENST00000430755;ENST00000412869;ENST00000443555	D;D;D;D;D;D;D;D	0.96856	-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15	5.98	5.98	0.97165	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.000000	0.85682	D	0.000000	D	0.98362	0.9456	M	0.87758	2.905	0.80722	D	1	D	0.54601	0.967	D	0.68765	0.96	D	0.98794	1.0737	10	0.87932	D	0	-46.947	19.5104	0.95139	0.0:1.0:0.0:0.0	.	93	P49585	PCY1A_HUMAN	S	93;93;93;54;93;93;27;93;93	ENSP00000392397:A93S;ENSP00000390968:A93S;ENSP00000292823:A93S;ENSP00000394617:A93S;ENSP00000400430:A93S;ENSP00000402283:A27S;ENSP00000402015:A93S;ENSP00000393341:A93S	ENSP00000292823:A93S	A	-	1	0	PCYT1A	197459532	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.485000	0.81204	2.853000	0.98044	0.645000	0.84053	GCC	.		0.413	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	NM_005017	
PHRF1	57661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	608998	608998	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:608998G>T	ENST00000264555.5	+	14	3670	c.3542G>T	c.(3541-3543)cGt>cTt	p.R1181L	PHRF1_ENST00000533464.1_Missense_Mutation_p.R1177L|PHRF1_ENST00000416188.2_Missense_Mutation_p.R1180L|PHRF1_ENST00000413872.2_Missense_Mutation_p.R1179L	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1181	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CCTCGGTCCCGTGAGAAGTGG	0.706																																					p.R1180L		.											.	PHRF1	22	0			c.G3539T						.						7.0	9.0	9.0					11																	608998		2077	4169	6246	SO:0001583	missense	57661	exon14			GGTCCCGTGAGAA	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.3542G>T	11.37:g.608998G>T	ENSP00000264555:p.Arg1181Leu	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	11.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	G	10.66	1.413680	0.25465	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.18657	2.2;2.2;2.2;2.2	5.19	0.0918	0.14469	.	2.028990	0.02544	N	0.094885	T	0.22437	0.0541	L	0.27053	0.805	0.09310	N	1	P;P;P;P	0.47191	0.826;0.891;0.891;0.826	B;P;P;B	0.46339	0.315;0.513;0.513;0.315	T	0.36648	-0.9739	10	0.62326	D	0.03	-1.9303	10.0174	0.42022	0.439:0.0:0.561:0.0	.	1177;1179;1180;1181	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	L	1181;1179;1180;1177	ENSP00000264555:R1181L;ENSP00000388589:R1179L;ENSP00000410626:R1180L;ENSP00000431870:R1177L	ENSP00000264555:R1181L	R	+	2	0	PHRF1	598998	0.090000	0.21635	0.031000	0.17742	0.036000	0.12997	0.993000	0.29680	-0.285000	0.09089	0.462000	0.41574	CGT	.		0.706	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
PI4K2A	55361	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	99400560	99400560	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr10:99400560C>T	ENST00000370631.3	+	1	118	c.61C>T	c.(61-63)Ccg>Tcg	p.P21S	PI4K2A_ENST00000555577.1_Intron|PI4K2A_ENST00000370649.3_Intron	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	21					basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		CTACACCTTCCCGTCGGGCTC	0.771																																					p.P21S		.											.	PI4K2A	226	0			c.C61T						.						9.0	11.0	10.0					10																	99400560		2159	4249	6408	SO:0001583	missense	55361	exon1			ACCTTCCCGTCGG	AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.61C>T	10.37:g.99400560C>T	ENSP00000359665:p.Pro21Ser	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	18.0	NM_018425	D3DR59|Q9NSG8	Missense_Mutation	SNP	ENST00000370631.3	37	CCDS7469.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.947330	0.53186	.	.	ENSG00000155252	ENST00000370631	.	.	.	4.17	4.17	0.49024	.	0.270393	0.36234	N	0.002712	T	0.37732	0.1014	N	0.22421	0.69	0.80722	D	1	P	0.44627	0.839	B	0.38056	0.264	T	0.28004	-1.0057	9	0.30078	T	0.28	-6.8852	16.2281	0.82311	0.0:1.0:0.0:0.0	.	21	Q9BTU6	P4K2A_HUMAN	S	21	.	ENSP00000359665:P21S	P	+	1	0	PI4K2A	99390550	1.000000	0.71417	1.000000	0.80357	0.166000	0.22503	5.871000	0.69628	2.157000	0.67596	0.462000	0.41574	CCG	.		0.771	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049735.1	NM_018425	
PIGL	9487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	16216896	16216896	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:16216896C>A	ENST00000225609.5	+	4	479	c.462C>A	c.(460-462)caC>caA	p.H154Q	PIGL_ENST00000498772.2_Missense_Mutation_p.H154Q|PIGL_ENST00000395844.4_Missense_Mutation_p.H154Q|PIGL_ENST00000581006.1_Intron	NM_004278.3	NP_004269.1	Q9Y2B2	PIGL_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class L	154					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	N-acetylglucosaminylphosphatidylinositol deacetylase activity (GO:0000225)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)		TAAGTGGCCACAGCAATCACA	0.483																																					p.H154Q		.											.	PIGL	226	0			c.C462A						.						239.0	205.0	216.0					17																	16216896		2203	4300	6503	SO:0001583	missense	9487	exon4			TGGCCACAGCAAT	AB017165	CCDS11176.1	17p12-p11.2	2013-02-26	2006-06-28		ENSG00000108474	ENSG00000108474	3.5.1.89	"""Phosphatidylinositol glycan anchor biosynthesis"""	8966	protein-coding gene	gene with protein product	"""N-acetylglucosaminylphosphatidylinositol deacetylase"""	605947	"""phosphatidylinositol glycan, class L"""			10085243	Standard	NM_004278		Approved		uc002gpv.3	Q9Y2B2	OTTHUMG00000059346	ENST00000225609.5:c.462C>A	17.37:g.16216896C>A	ENSP00000225609:p.His154Gln	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	29.0	NM_004278	A8KA67|B4DYN4	Missense_Mutation	SNP	ENST00000225609.5	37	CCDS11176.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220892	0.58560	.	.	ENSG00000108474	ENST00000225609;ENST00000395844	D;D	0.86497	-2.13;-2.13	5.41	1.88	0.25563	Putative deacetylase LmbE-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94503	0.8230	H	0.97214	3.96	0.48632	D	0.999681	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92332	0.5874	10	0.87932	D	0	-24.8874	5.8218	0.18532	0.0:0.6384:0.0:0.3616	.	154;154	B4DYN4;Q9Y2B2	.;PIGL_HUMAN	Q	154	ENSP00000225609:H154Q;ENSP00000379185:H154Q	ENSP00000225609:H154Q	H	+	3	2	PIGL	16157621	0.976000	0.34144	0.999000	0.59377	0.656000	0.38851	0.510000	0.22723	0.785000	0.33685	-0.140000	0.14226	CAC	.		0.483	PIGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131881.1		
PKD1	5310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2158624	2158624	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr16:2158624G>C	ENST00000262304.4	-	15	6752	c.6544C>G	c.(6544-6546)Cag>Gag	p.Q2182E	PKD1_ENST00000423118.1_Missense_Mutation_p.Q2182E|PKD1_ENST00000561991.1_5'Flank	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2182	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TACTCAGTCTGGTAGGTGACG	0.706																																					p.Q2182E		.											.	PKD1	91	0			c.C6544G						.						21.0	17.0	18.0					16																	2158624		2138	4227	6365	SO:0001583	missense	5310	exon15			CAGTCTGGTAGGT	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.6544C>G	16.37:g.2158624G>C	ENSP00000262304:p.Gln2182Glu	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	16.0	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	g	13.74	2.325879	0.41197	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.69175	-0.38;-0.38	5.49	5.49	0.81192	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);Polycystin cation channel (1);	0.121954	0.56097	D	0.000031	T	0.75766	0.3894	M	0.68317	2.08	0.34664	D	0.722946	D;D	0.61080	0.989;0.968	P;P	0.58780	0.845;0.817	T	0.79212	-0.1896	10	0.26408	T	0.33	.	15.1	0.72266	0.0:0.0:0.8577:0.1423	.	2182;2182	P98161-3;P98161	.;PKD1_HUMAN	E	2182;2182;1533;461	ENSP00000262304:Q2182E;ENSP00000399501:Q2182E	ENSP00000262304:Q2182E	Q	-	1	0	PKD1	2098625	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.629000	0.67798	2.597000	0.87782	0.544000	0.68410	CAG	.		0.706	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PKMYT1	9088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3024301	3024301	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr16:3024301C>T	ENST00000262300.8	-	6	1605	c.1097G>A	c.(1096-1098)gGt>gAt	p.G366D	PKMYT1_ENST00000574730.1_Missense_Mutation_p.G297D|PKMYT1_ENST00000431515.2_Missense_Mutation_p.G366D|PKMYT1_ENST00000440027.2_Missense_Mutation_p.G366D|PKMYT1_ENST00000574385.1_Missense_Mutation_p.G357D|PKMYT1_ENST00000573944.1_Missense_Mutation_p.G357D	NM_001258450.1|NM_004203.4|NM_182687.2	NP_001245379.1|NP_004194.3|NP_872629.1	Q99640	PMYT1_HUMAN	protein kinase, membrane associated tyrosine/threonine 1	366					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						CCACAGCACACCCCAGGCCCG	0.706																																					p.G366D		.											.	PKMYT1	765	0			c.G1097A						.						9.0	13.0	12.0					16																	3024301		2159	4255	6414	SO:0001583	missense	9088	exon6			AGCACACCCCAGG	AK097642	CCDS10486.1, CCDS45391.1, CCDS58414.1, CCDS58415.1	16p13.3	2014-06-13			ENSG00000127564	ENSG00000127564			29650	protein-coding gene	gene with protein product	"""membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase"", ""protein phosphatase 1, regulatory subunit 126"""	602474				9001210, 12606722	Standard	NM_004203		Approved	MYT1, PPP1R126	uc002csn.3	Q99640	OTTHUMG00000128975	ENST00000262300.8:c.1097G>A	16.37:g.3024301C>T	ENSP00000262300:p.Gly366Asp	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	35.0	NM_182687	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000262300.8	37	CCDS10486.1	.	.	.	.	.	.	.	.	.	.	C	3.869	-0.028314	0.07589	.	.	ENSG00000127564	ENST00000431515;ENST00000262300;ENST00000440027;ENST00000402679;ENST00000382240	T;T;T;T	0.60548	0.18;0.27;0.23;1.9	5.36	0.757	0.18427	.	0.323813	0.34460	N	0.003948	T	0.32406	0.0828	N	0.24115	0.695	0.09310	N	1	B;B;B;P	0.34977	0.381;0.059;0.059;0.478	B;B;B;B	0.34489	0.184;0.024;0.024;0.122	T	0.26503	-1.0101	10	0.09338	T	0.73	-2.6839	5.1277	0.14894	0.0:0.5888:0.1563:0.2549	.	357;297;366;366	A6NHV6;B4DXD4;Q99640;F8W164	.;.;PMYT1_HUMAN;.	D	366;366;366;366;357	ENSP00000392855:G366D;ENSP00000262300:G366D;ENSP00000397739:G366D;ENSP00000371675:G357D	ENSP00000262300:G366D	G	-	2	0	PKMYT1	2964302	0.017000	0.18338	0.079000	0.20413	0.038000	0.13279	0.374000	0.20501	-0.094000	0.12374	0.650000	0.86243	GGT	.		0.706	PKMYT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250963.2	NM_004203	
PLEKHA5	54477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	19436367	19436367	+	Silent	SNP	A	A	G	rs376638119		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:19436367A>G	ENST00000299275.6	+	11	1455	c.1449A>G	c.(1447-1449)acA>acG	p.T483T	PLEKHA5_ENST00000317589.4_Silent_p.T483T|PLEKHA5_ENST00000543806.1_Silent_p.T375T|PLEKHA5_ENST00000538714.1_Silent_p.T483T|PLEKHA5_ENST00000359180.3_Silent_p.T483T|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000539256.1_Silent_p.T241T|PLEKHA5_ENST00000309364.4_Silent_p.T483T|PLEKHA5_ENST00000424268.1_Silent_p.T375T|PLEKHA5_ENST00000429027.2_Silent_p.T489T|PLEKHA5_ENST00000355397.3_Silent_p.T483T	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	483					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATGACAAGACATTAGGACCCG	0.493																																					p.T489T	Pancreas(196;329 2193 11246 14234 19524)	.											.	PLEKHA5	227	0			c.A1467G						.	A	,	1,4405	2.1+/-5.4	0,1,2202	87.0	82.0	84.0		1449,1449	-7.3	0.0	12		84	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PLEKHA5	NM_001143821.2,NM_019012.5	,	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	,	483/1175,483/1117	19436367	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54477	exon12			CAAGACATTAGGA	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.1449A>G	12.37:g.19436367A>G		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	36.0	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	ENST00000299275.6	37	CCDS8682.1																																																																																			.		0.493	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
POU5F1B	5462	hgsc.bcm.edu;broad.mit.edu	37	8	128428177	128428199	+	Frame_Shift_Del	DEL	ATGGGGGGCGGAGCCGGGCTGGG	ATGGGGGGCGGAGCCGGGCTGGG	-	rs531267041|rs551358165		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	ATGGGGGGCGGAGCCGGGCTGGG	ATGGGGGGCGGAGCCGGGCTGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:128428177_128428199delATGGGGGGCGGAGCCGGGCTGGG	ENST00000465342.2	+	2	1223_1245	c.66_88delATGGGGGGCGGAGCCGGGCTGGG	c.(64-90)ccatggggggcggagccgggctgggttfs	p.WGAEPGWV23fs	CASC8_ENST00000502082.1_RNA|POU5F1B_ENST00000391675.1_Frame_Shift_Del_p.WGAEPGWV23fs|CASC8_ENST00000523825.1_RNA|CASC8_ENST00000501396.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	23				WGA -> GGP (in Ref. 5; ADE48566/ ADE48597). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						GTGATGGGCCATGGGGGGCGGAGCCGGGCTGGGTTGATCCTCT	0.7																																					p.22_30del		.											.	.	.	0			c.66_88del						.																																			SO:0001589	frameshift_variant	5462	exon1			TGGGCCATGGGGG	AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.66_88delATGGGGGGCGGAGCCGGGCTGGG	8.37:g.128428177_128428199delATGGGGGGCGGAGCCGGGCTGGG	ENSP00000419298:p.Trp23fs	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	0.0	NM_001159542	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Frame_Shift_Del	DEL	ENST00000465342.2	37	CCDS55274.1																																																																																			.		0.700	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349649.2	NM_001159542	
PRKACB	5567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	84662426	84662427	+	Splice_Site	INS	-	-	TA			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:84662426_84662427insTA	ENST00000370689.2	+	6	810		c.e6+1		PRKACB_ENST00000394838.2_Splice_Site|PRKACB_ENST00000370682.3_Splice_Site|PRKACB_ENST00000370680.1_Splice_Site|PRKACB_ENST00000370685.3_Splice_Site|PRKACB_ENST00000370688.3_Splice_Site|PRKACB_ENST00000394839.2_Splice_Site	NM_001242862.1|NM_002731.2	NP_001229791.1|NP_002722.1	P22694	KAPCB_HUMAN	protein kinase, cAMP-dependent, catalytic, beta						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of protein processing (GO:0070613)|response to clozapine (GO:0097338)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|magnesium ion binding (GO:0000287)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|lung(11)|ovary(1)	16				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		CTATATCCAGGTATGACTTTAA	0.351																																					.		.											.	PRKACB	1083	0			c.546+1->TA						.																																			SO:0001630	splice_region_variant	5567	exon6			ATCCAGGTATGAC	BC035058	CCDS691.1, CCDS692.1, CCDS693.1, CCDS55610.1, CCDS55611.1, CCDS72812.1, CCDS72813.1, CCDS72814.1, CCDS72815.1, CCDS72816.1	1p36.1	2012-10-02			ENSG00000142875	ENSG00000142875	2.7.11.1		9381	protein-coding gene	gene with protein product		176892					Standard	XM_005271016		Approved	PKACb	uc001djl.3	P22694	OTTHUMG00000009975	ENST00000370689.2:c.546+1->TA	1.37:g.84662427_84662428dupTA		Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	50.0	NM_002731	B1APG4|B4DKB0|B4E2Q1|Q14VH1|Q59GC0|Q5BNE9|Q5BNF0|Q5BNF1|Q5BNF2|Q5BNF3|Q5CZ92|Q5T1K3|Q7Z3M1|Q8IYR5|Q8IZQ0|Q96B09	Splice_Site	INS	ENST00000370689.2	37	CCDS691.1																																																																																			.		0.351	PRKACB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027641.1	NM_182948	Intron
PTCHD2	57540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11591710	11591710	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:11591710C>T	ENST00000294484.6	+	17	3456	c.3318C>T	c.(3316-3318)caC>caT	p.H1106H	PTCHD2_ENST00000389575.3_Silent_p.H1106H|PTCHD2_ENST00000304391.6_5'Flank	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1106					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		AGCTGTCCCACGGGGCAGTGG	0.662																																					p.H1106H		.											.	PTCHD2	209	0			c.C3318T						.						31.0	35.0	34.0					1																	11591710		2022	4168	6190	SO:0001819	synonymous_variant	57540	exon17			GTCCCACGGGGCA	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3318C>T	1.37:g.11591710C>T		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	31.0	NM_020780	Q5VTU9|Q9UJD6	Silent	SNP	ENST00000294484.6	37	CCDS41247.1																																																																																			.		0.662	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
PTPRB	5787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	70953301	70953301	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr12:70953301C>T	ENST00000261266.5	-	16	3911	c.3882G>A	c.(3880-3882)gaG>gaA	p.E1294E	PTPRB_ENST00000334414.6_Silent_p.E1512E|PTPRB_ENST00000550857.1_Silent_p.E1204E|PTPRB_ENST00000538708.1_Silent_p.E1204E|PTPRB_ENST00000551525.1_Silent_p.E1511E|PTPRB_ENST00000550358.1_Silent_p.E1424E|PTPRB_ENST00000451516.2_Silent_p.E1204E	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1294	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACCACTGCAGCTCAAAGTCGT	0.498																																					p.E1512E		.											.	PTPRB	226	0			c.G4536A						.						229.0	226.0	227.0					12																	70953301		1994	4170	6164	SO:0001819	synonymous_variant	5787	exon18			CTGCAGCTCAAAG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.3882G>A	12.37:g.70953301C>T		Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	47.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	37	CCDS44944.1																																																																																			.		0.498	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
QRICH2	84074	broad.mit.edu;mdanderson.org	37	17	74271920	74271920	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:74271920A>C	ENST00000262765.5	-	18	5143	c.4964T>G	c.(4963-4965)aTt>aGt	p.I1655S		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1655										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						GCCAGCCGAAATCTGGGCGCT	0.682																																					p.I1655S		.											.	QRICH2	94	0			c.T4964G						.						68.0	57.0	61.0					17																	74271920		2202	4300	6502	SO:0001583	missense	84074	exon18			GCCGAAATCTGGG	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.4964T>G	17.37:g.74271920A>C	ENSP00000262765:p.Ile1655Ser	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	6.0	NM_032134	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.006|0.006	-2.037757|-2.037757	0.00402|0.00402	.|.	.|.	ENSG00000129646|ENSG00000129646	ENST00000447564;ENST00000532549|ENST00000262765;ENST00000301613	T|T	0.44083|0.09911	0.93|2.93	3.63|3.63	0.116|0.116	0.14647|0.14647	.|.	.|.	.|.	.|.	.|.	T|T	0.05227|0.05227	0.0139|0.0139	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.14012	.|0.009	.|B	.|0.15870	.|0.014	T|T	0.37957|0.37957	-0.9683|-0.9683	7|9	0.02654|0.56958	T|D	1|0.05	-7.9248|-7.9248	5.8361|5.8361	0.18607|0.18607	0.5807:0.0:0.4193:0.0|0.5807:0.0:0.4193:0.0	.|.	.|1655	.|Q9H0J4	.|QRIC2_HUMAN	E|S	429;253|1655;1421	ENSP00000394461:D429E|ENSP00000262765:I1655S	ENSP00000394461:D429E|ENSP00000262765:I1655S	D|I	-|-	3|2	2|0	QRICH2|QRICH2	71783515|71783515	0.000000|0.000000	0.05858|0.05858	0.015000|0.015000	0.15790|0.15790	0.039000|0.039000	0.13416|0.13416	-0.028000|-0.028000	0.12350|0.12350	-0.013000|-0.013000	0.14199|0.14199	0.459000|0.459000	0.35465|0.35465	GAT|ATT	.		0.682	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
RASAL3	64926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15569403	15569403	+	Silent	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr19:15569403G>T	ENST00000343625.7	-	7	811	c.726C>A	c.(724-726)gcC>gcA	p.A242A	RASAL3_ENST00000608577.1_5'Flank	NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	242	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						CATCCCGCTCGGCACCCAGGT	0.637																																					p.A242A		.											.	.	.	0			c.C726A						.						37.0	42.0	40.0					19																	15569403		2092	4221	6313	SO:0001819	synonymous_variant	64926	exon7			CCGCTCGGCACCC		CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.726C>A	19.37:g.15569403G>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	16.0	NM_022904	Q8N2T9|Q9H735	Silent	SNP	ENST00000343625.7	37	CCDS46006.1																																																																																			.		0.637	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461331.3	NM_022904	
RBP3	5949	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	48390301	48390301	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr10:48390301T>C	ENST00000224600.4	-	1	690	c.577A>G	c.(577-579)Atc>Gtc	p.I193V	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	193	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	ACGTGCAGGATGGTGTTCCCT	0.602																																					p.I193V		.											.	RBP3	153	0			c.A577G						.						112.0	108.0	109.0					10																	48390301		2203	4300	6503	SO:0001583	missense	5949	exon1			GCAGGATGGTGTT	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.577A>G	10.37:g.48390301T>C	ENSP00000224600:p.Ile193Val	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	6.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	37	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.249440	0.00268	.	.	ENSG00000107618	ENST00000224600	T	0.63580	-0.05	5.71	1.29	0.21616	Interphotoreceptor retinol-binding (2);	1.002030	0.08041	N	0.995104	T	0.24699	0.0599	N	0.00282	-1.705	0.09310	N	1	B	0.20550	0.046	B	0.34824	0.19	T	0.43572	-0.9383	10	0.02654	T	1	-38.3308	5.9919	0.19472	0.0:0.5154:0.143:0.3416	.	193	P10745	RET3_HUMAN	V	193	ENSP00000224600:I193V	ENSP00000224600:I193V	I	-	1	0	RBP3	48010307	0.000000	0.05858	0.009000	0.14445	0.350000	0.29205	0.105000	0.15333	0.355000	0.24131	-0.959000	0.02639	ATC	.		0.602	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
RECK	8434	hgsc.bcm.edu;broad.mit.edu	37	9	36116999	36116999	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr9:36116999A>T	ENST00000377966.3	+	17	2644	c.2078A>T	c.(2077-2079)cAg>cTg	p.Q693L		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	693					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			CCCAAACCACAGGTCTGCCTG	0.498																																					p.Q693L		.											.	RECK	93	0			c.A2078T						.						150.0	132.0	138.0					9																	36116999		2203	4300	6503	SO:0001583	missense	8434	exon17			AACCACAGGTCTG	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.2078A>T	9.37:g.36116999A>T	ENSP00000367202:p.Gln693Leu	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_021111	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	ENST00000377966.3	37	CCDS6597.1	.	.	.	.	.	.	.	.	.	.	A	16.60	3.168416	0.57584	.	.	ENSG00000122707	ENST00000377966	T	0.45668	0.89	5.91	5.91	0.95273	.	0.068805	0.64402	D	0.000007	T	0.36880	0.0983	L	0.46157	1.445	0.41849	D	0.99016	P;P	0.35328	0.495;0.495	B;B	0.30716	0.119;0.119	T	0.27365	-1.0076	10	0.51188	T	0.08	-11.7409	14.3004	0.66346	1.0:0.0:0.0:0.0	.	693;693	A8K9D8;O95980	.;RECK_HUMAN	L	693	ENSP00000367202:Q693L	ENSP00000367202:Q693L	Q	+	2	0	RECK	36106999	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.193000	0.65120	2.254000	0.74563	0.533000	0.62120	CAG	.		0.498	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1		
REV1	51455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	100046405	100046405	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:100046405T>C	ENST00000258428.3	-	9	1672	c.1444A>G	c.(1444-1446)Ata>Gta	p.I482V	REV1_ENST00000465835.1_5'UTR|REV1_ENST00000393445.3_Missense_Mutation_p.I481V	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	482	UmuC. {ECO:0000255|PROSITE- ProRule:PRU00216}.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAATCTGGTATATCTGCttta	0.303								Direct reversal of damage																													p.I482V		.											.	REV1	92	0			c.A1444G						.						57.0	54.0	55.0					2																	100046405		2203	4300	6503	SO:0001583	missense	51455	exon9			CTGGTATATCTGC	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.1444A>G	2.37:g.100046405T>C	ENSP00000258428:p.Ile482Val	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	62.0	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	T	3.157	-0.173004	0.06421	.	.	ENSG00000135945	ENST00000393445;ENST00000258428;ENST00000450415	T;T;T	0.42513	1.72;1.68;0.97	5.53	3.11	0.35812	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.346611	0.31113	N	0.008222	T	0.20210	0.0486	N	0.12746	0.255	0.25954	N	0.982715	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.14337	-1.0476	10	0.25751	T	0.34	.	4.8658	0.13607	0.1371:0.1444:0.0:0.7185	.	482;481	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	V	481;482;119	ENSP00000377091:I481V;ENSP00000258428:I482V;ENSP00000414875:I119V	ENSP00000258428:I482V	I	-	1	0	REV1	99412837	1.000000	0.71417	0.799000	0.32177	0.086000	0.17979	1.617000	0.36943	0.365000	0.24400	-0.250000	0.11733	ATA	.		0.303	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
RGS12	6002	broad.mit.edu;mdanderson.org	37	4	3415912	3415912	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr4:3415912T>A	ENST00000344733.5	+	5	3038	c.2134T>A	c.(2134-2136)Tgg>Agg	p.W712R	RGS12_ENST00000336727.3_Missense_Mutation_p.W712R|RGS12_ENST00000382788.3_Missense_Mutation_p.W712R|RGS12_ENST00000338806.4_Missense_Mutation_p.W64R|RGS12_ENST00000306648.7_Missense_Mutation_p.W110R|RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000538395.1_Missense_Mutation_p.W54R|RGS12_ENST00000543385.1_3'UTR	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	712					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGTCGCCAGCTGGGCCGTGTC	0.662																																					p.W712R		.											.	RGS12	226	0			c.T2134A						.						27.0	31.0	30.0					4																	3415912		2164	4259	6423	SO:0001583	missense	6002	exon5			GCCAGCTGGGCCG	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2134T>A	4.37:g.3415912T>A	ENSP00000339381:p.Trp712Arg	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	3.0	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	37	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517280	0.85495	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	T;T;T;T;T;T	0.02682	4.2;4.2;4.2;4.2;4.2;4.2	4.27	4.27	0.50696	Regulator of G protein signalling (1);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.08582	0.0213	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.15178	-1.0446	10	0.87932	D	0	-18.964	12.8876	0.58053	0.0:0.0:0.0:1.0	.	54;54;54;64;110;712;712	B7Z764;B7Z8B8;O14924-2;O14924-3;Q8WX95;O14924;O14924-4	.;.;.;.;.;RGS12_HUMAN;.	R	712;712;712;110;64;54	ENSP00000339381:W712R;ENSP00000338509:W712R;ENSP00000372238:W712R;ENSP00000304459:W110R;ENSP00000342133:W64R;ENSP00000438888:W54R	ENSP00000304459:W110R	W	+	1	0	RGS12	3385710	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.707000	0.84623	1.701000	0.51217	0.533000	0.62120	TGG	.		0.662	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
RIPK3	11035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24808429	24808429	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr14:24808429G>A	ENST00000216274.5	-	3	481	c.263C>T	c.(262-264)cCc>cTc	p.P88L	RIPK3_ENST00000554338.1_5'UTR|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	88	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		AGCCGGCTTGGGATCTTGGTC	0.592																																					p.P88L	Pancreas(58;918 1191 4668 13304 15331)	.											.	RIPK3	946	0			c.C263T						.						93.0	81.0	85.0					14																	24808429		2203	4300	6503	SO:0001583	missense	11035	exon3			GGCTTGGGATCTT	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.263C>T	14.37:g.24808429G>A	ENSP00000216274:p.Pro88Leu	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	26.0	NM_006871	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	37	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	G	5.317	0.243830	0.10077	.	.	ENSG00000129465	ENST00000216274	T	0.62639	0.01	4.69	-1.91	0.07641	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.081980	0.07194	N	0.856180	T	0.48095	0.1481	L	0.43923	1.385	0.09310	N	1	B;B	0.24132	0.008;0.098	B;B	0.25987	0.006;0.065	T	0.45026	-0.9289	10	0.56958	D	0.05	-0.336	1.2119	0.01906	0.2589:0.2936:0.3098:0.1377	.	88;88	B4DJZ5;Q9Y572	.;RIPK3_HUMAN	L	88	ENSP00000216274:P88L	ENSP00000216274:P88L	P	-	2	0	RIPK3	23878269	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.164000	0.09983	-0.218000	0.10018	-0.254000	0.11334	CCC	.		0.592	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
ROCK1	6093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	18586398	18586398	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr18:18586398T>G	ENST00000399799.2	-	16	2739	c.1799A>C	c.(1798-1800)gAc>gCc	p.D600A		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	600	Interaction with FHOD1.				actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					ATAATCTTTGTCTGTTTGTGA	0.378																																					p.D600A		.											.	ROCK1	1026	0			c.A1799C						.						143.0	136.0	139.0					18																	18586398		2203	4300	6503	SO:0001583	missense	6093	exon16			TCTTTGTCTGTTT		CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.1799A>C	18.37:g.18586398T>G	ENSP00000382697:p.Asp600Ala	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	19.0	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Missense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	T	17.69	3.452443	0.63290	.	.	ENSG00000067900	ENST00000399799	T	0.65916	-0.18	5.44	5.44	0.79542	.	0.050567	0.85682	D	0.000000	T	0.47967	0.1474	N	0.19112	0.55	0.53688	D	0.999979	B	0.31174	0.311	B	0.26094	0.066	T	0.50906	-0.8772	10	0.52906	T	0.07	.	15.6661	0.77230	0.0:0.0:0.0:1.0	.	600	Q13464	ROCK1_HUMAN	A	600	ENSP00000382697:D600A	ENSP00000382697:D600A	D	-	2	0	ROCK1	16840396	1.000000	0.71417	0.999000	0.59377	0.946000	0.59487	7.525000	0.81892	2.285000	0.76669	0.533000	0.62120	GAC	.		0.378	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	55533949	55533949	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:55533949C>T	ENST00000220676.1	+	2	571	c.423C>T	c.(421-423)ccC>ccT	p.P141P		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	141					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CGCCCCACCCCGTAGCCGTCG	0.697																																					p.P141P	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.C423T						.						28.0	34.0	32.0					8																	55533949		2193	4296	6489	SO:0001819	synonymous_variant	6101	exon2			CCACCCCGTAGCC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.423C>T	8.37:g.55533949C>T		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	25.0	NM_006269		Silent	SNP	ENST00000220676.1	37	CCDS6160.1																																																																																			.		0.697	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
SAR1B	51128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	133945276	133945276	+	Silent	SNP	T	T	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr5:133945276T>A	ENST00000402673.2	-	5	611	c.333A>T	c.(331-333)tcA>tcT	p.S111S	SAR1B_ENST00000502539.1_Silent_p.S43S|SAR1B_ENST00000507419.1_Silent_p.S43S|SAR1B_ENST00000439578.1_Silent_p.S111S|SAR1B_ENST00000509937.1_Silent_p.S43S	NM_016103.3	NP_057187.1	Q9Y6B6	SAR1B_HUMAN	secretion associated, Ras related GTPase 1B	111					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|GTP catabolic process (GO:0006184)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			kidney(2)|lung(2)|urinary_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTTCTTCTTTTGACTCTAACA	0.393																																					p.S111S		.											.	SAR1B	227	0			c.A333T						.						115.0	104.0	107.0					5																	133945276		2203	4300	6503	SO:0001819	synonymous_variant	51128	exon6			TTCTTTTGACTCT	AF092130	CCDS4177.1	5q31.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000152700	ENSG00000152700			10535	protein-coding gene	gene with protein product		607690	"""SAR1a gene homolog (S. cerevisiae) 2"", ""SAR1a gene homolog 2 (S. cerevisiae)"", ""SAR1 homolog B (S. cerevisiae)"""	SARA2			Standard	NM_001033503		Approved		uc003kzr.3	Q9Y6B6	OTTHUMG00000129114	ENST00000402673.2:c.333A>T	5.37:g.133945276T>A		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	29.0	NM_001033503	D3DQA4|Q567T4	Silent	SNP	ENST00000402673.2	37	CCDS4177.1																																																																																			.		0.393	SAR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251158.2	NM_016103	
SEC16A	9919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139371483	139371483	+	Silent	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr9:139371483C>A	ENST00000371706.3	-	1	84	c.51G>T	c.(49-51)gtG>gtT	p.V17V	SEC16A_ENST00000290037.6_Silent_p.V17V|SEC16A_ENST00000431893.2_Silent_p.V17V|SEC16A_ENST00000313050.7_Silent_p.V195V			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	17					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CTGGGGTGACCACACCGTCAT	0.642																																					p.V195V		.											.	.	.	0			c.G585T						.						59.0	66.0	63.0					9																	139371483		2105	4211	6316	SO:0001819	synonymous_variant	9919	exon3			GGTGACCACACCG	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.51G>T	9.37:g.139371483C>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	24.0	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	37																																																																																				.		0.642	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
SESN2	83667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	28595721	28595721	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:28595721G>A	ENST00000253063.3	+	2	439	c.118G>A	c.(118-120)Ggc>Agc	p.G40S		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	40					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		GGCTCGGCGAGGCCCTCGAGG	0.547																																					p.G40S		.											.	SESN2	230	0			c.G118A						.						56.0	61.0	59.0					1																	28595721		2203	4300	6503	SO:0001583	missense	83667	exon2			CGGCGAGGCCCTC	AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.118G>A	1.37:g.28595721G>A	ENSP00000253063:p.Gly40Ser	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	9.0	NM_031459	Q5T7D0|Q96SI5	Missense_Mutation	SNP	ENST00000253063.3	37	CCDS321.1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872634	0.33069	.	.	ENSG00000130766	ENST00000253063	T	0.16324	2.35	4.85	2.88	0.33553	.	0.389236	0.25801	N	0.028211	T	0.06962	0.0177	N	0.08118	0	0.33998	D	0.649929	B	0.30068	0.267	B	0.25140	0.058	T	0.29941	-0.9995	10	0.12766	T	0.61	-25.8367	9.5877	0.39526	0.0768:0.2509:0.6723:0.0	.	40	P58004	SESN2_HUMAN	S	40	ENSP00000253063:G40S	ENSP00000253063:G40S	G	+	1	0	SESN2	28468308	0.547000	0.26465	0.998000	0.56505	0.890000	0.51754	0.685000	0.25378	1.282000	0.44496	-0.140000	0.14226	GGC	.		0.547	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009840.1		
SFRP2	6423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	154709533	154709533	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr4:154709533C>A	ENST00000274063.4	-	1	739	c.455G>T	c.(454-456)tGc>tTc	p.C152F		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	152	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				GAGGGGGATGCAAAGGTCGTT	0.657																																					p.C152F		.											.	SFRP2	659	0			c.G455T						.						69.0	67.0	68.0					4																	154709533		2203	4300	6503	SO:0001583	missense	6423	exon1			GGGATGCAAAGGT	AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.455G>T	4.37:g.154709533C>A	ENSP00000274063:p.Cys152Phe	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	25.0	NM_003013	B3KQR2|O14778|Q9HAP5	Missense_Mutation	SNP	ENST00000274063.4	37	CCDS34082.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564531	0.65651	.	.	ENSG00000145423	ENST00000274063	D	0.93547	-3.24	5.1	5.1	0.69264	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.97860	0.9297	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99013	1.0815	10	0.87932	D	0	.	18.8637	0.92282	0.0:1.0:0.0:0.0	.	152	Q96HF1	SFRP2_HUMAN	F	152	ENSP00000274063:C152F	ENSP00000274063:C152F	C	-	2	0	SFRP2	154928983	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.685000	0.84117	2.528000	0.85240	0.591000	0.81541	TGC	.		0.657	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365296.1		
SHOX	6473	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	595367	595368	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chrX:595367_595368delAA	ENST00000554971.1	+	2	383_384	c.292_293delAA	c.(292-294)aaafs	p.K98fs	SHOX_ENST00000334060.3_Frame_Shift_Del_p.K98fs|SHOX_ENST00000381578.1_Frame_Shift_Del_p.K98fs|SHOX_ENST00000381575.1_Frame_Shift_Del_p.K98fs			O15266	SHOX_HUMAN	short stature homeobox	98					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTATGAATGCAAAGAGAAGCGC	0.624																																					p.98_98del	Ovarian(95;18 1419 12424 14056 28266)	.											.	SHOX	40	0			c.292_293del						.																																			SO:0001589	frameshift_variant	6473	exon3			GAATGCAAAGAGA	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.292_293delAA	X.37:g.595367_595368delAA	ENSP00000452016:p.Lys98fs	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	22.0	NM_000451	O00412|O00413|O15267	Frame_Shift_Del	DEL	ENST00000554971.1	37	CCDS14107.1																																																																																			.		0.624	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411999.3	NM_000451	
SLC12A2	6558	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127466833	127466833	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr5:127466833G>T	ENST00000262461.2	+	5	1312	c.1123G>T	c.(1123-1125)Gcc>Tcc	p.A375S	SLC12A2_ENST00000343225.4_Missense_Mutation_p.A375S	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	375					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	CTTCGCCTTTGCCAACGCTGT	0.393																																					p.A375S		.											.	SLC12A2	94	0			c.G1123T						.						267.0	253.0	257.0					5																	127466833		2203	4300	6503	SO:0001583	missense	6558	exon5			GCCTTTGCCAACG		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1123G>T	5.37:g.127466833G>T	ENSP00000262461:p.Ala375Ser	Somatic	208.0	1.0		WXS	Illumina HiSeq	Phase_I	123.0	48.0	NM_001046	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	37	CCDS4144.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813969	0.90790	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.99220	-5.58;-5.58	4.93	4.93	0.64822	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99155	0.9708	M	0.83774	2.66	0.80722	D	1	P;P	0.42941	0.755;0.794	P;P	0.50082	0.496;0.63	D	0.99875	1.1102	10	0.87932	D	0	.	18.3301	0.90265	0.0:0.0:1.0:0.0	.	375;375	P55011-3;P55011	.;S12A2_HUMAN	S	375	ENSP00000262461:A375S;ENSP00000340878:A375S	ENSP00000262461:A375S	A	+	1	0	SLC12A2	127494732	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	9.263000	0.95617	2.573000	0.86826	0.563000	0.77884	GCC	.		0.393	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
SLCO2A1	6578	broad.mit.edu;bcgsc.ca	37	3	133673920	133673920	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr3:133673920A>G	ENST00000310926.4	-	4	788	c.515T>C	c.(514-516)cTg>cCg	p.L172P	SLCO2A1_ENST00000478651.1_5'Flank|SLCO2A1_ENST00000493729.1_Intron	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	172					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	AACCACCATCAGGCCCCACAT	0.607																																					p.L172P		.											.	SLCO2A1	90	0			c.T515C						.						70.0	70.0	70.0					3																	133673920		2203	4300	6503	SO:0001583	missense	6578	exon4			ACCATCAGGCCCC		CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.515T>C	3.37:g.133673920A>G	ENSP00000311291:p.Leu172Pro	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	5.0	NM_005630	Q86V98|Q8IUN2	Missense_Mutation	SNP	ENST00000310926.4	37	CCDS3084.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.447468	0.63178	.	.	ENSG00000174640	ENST00000310926	T	0.52057	0.68	5.89	5.89	0.94794	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.240394	0.42172	D	0.000755	T	0.73125	0.3547	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74348	0.983;0.983	T	0.78534	-0.2167	10	0.87932	D	0	.	16.3123	0.82883	1.0:0.0:0.0:0.0	.	172;172	F8W9W8;Q92959	.;SO2A1_HUMAN	P	172	ENSP00000311291:L172P	ENSP00000311291:L172P	L	-	2	0	SLCO2A1	135156610	1.000000	0.71417	0.979000	0.43373	0.166000	0.22503	8.973000	0.93428	2.254000	0.74563	0.459000	0.35465	CTG	.		0.607	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357131.1	NM_005630	
SMEK2	57223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55844336	55844336	+	Missense_Mutation	SNP	G	G	A	rs200421664	byFrequency	TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:55844336G>A	ENST00000345102.5	-	1	387	c.86C>T	c.(85-87)tCc>tTc	p.S29F	RP11-554J4.1_ENST00000608113.1_RNA|SMEK2_ENST00000477749.1_5'UTR|SMEK2_ENST00000272313.5_Missense_Mutation_p.S29F|SMEK2_ENST00000407823.3_Missense_Mutation_p.S29F	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	29	WH1.				positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CACGTAAGTGGAGGAGACGTG	0.592																																					p.S29F		.											.	SMEK2	228	0			c.C86T						.	G	PHE/SER,PHE/SER	0,4406		0,0,2203	70.0	64.0	66.0		86,86	5.2	1.0	2		66	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	SMEK2	NM_001122964.1,NM_020463.2	155,155	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign,benign	29/850,29/765	55844336	4,13002	2203	4300	6503	SO:0001583	missense	57223	exon1			TAAGTGGAGGAGA	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.86C>T	2.37:g.55844336G>A	ENSP00000339769:p.Ser29Phe	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	23.0	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	ENST00000345102.5	37	CCDS46289.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445392	0.84101	0.0	4.65E-4	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.48201	0.82;0.82;0.82	5.19	5.19	0.71726	Pleckstrin homology-type (1);	0.049778	0.85682	D	0.000000	T	0.60983	0.2311	L	0.46157	1.445	0.80722	D	1	P;D;B	0.54601	0.942;0.967;0.053	P;P;B	0.61275	0.847;0.886;0.037	T	0.57774	-0.7753	10	0.42905	T	0.14	-4.0076	18.9179	0.92513	0.0:0.0:1.0:0.0	.	29;29;29	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3	.;P4R3B_HUMAN;.	F	29	ENSP00000272313:S29F;ENSP00000385912:S29F;ENSP00000339769:S29F	ENSP00000272313:S29F	S	-	2	0	SMEK2	55697840	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.254000	0.95512	2.705000	0.92388	0.655000	0.94253	TCC	G|0.997;A|0.003		0.592	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
SNRPN	6638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	25222974	25222974	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr15:25222974C>A	ENST00000400100.1	+	11	1360	c.470C>A	c.(469-471)gCg>gAg	p.A157E	SNRPN_ENST00000577565.1_Missense_Mutation_p.A157E|SNRPN_ENST00000390687.4_Missense_Mutation_p.A157E|SNRPN_ENST00000400098.1_Missense_Mutation_p.A157E|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000444203.2_Missense_Mutation_p.A161E|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000346403.6_Missense_Mutation_p.A157E|SNRPN_ENST00000400097.1_Missense_Mutation_p.A157E|SNHG14_ENST00000551631.2_RNA|SNRPN_ENST00000554227.2_Missense_Mutation_p.A161E	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	157					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		GCTGTTGCTGCGACTGCCAGT	0.587									Prader-Willi syndrome																												p.A157E		.											.	SNRPN	469	0			c.C470A						.						32.0	35.0	34.0					15																	25222974		1978	4184	6162	SO:0001583	missense	6638	exon11	Familial Cancer Database	Prader-Labhart-Willi syndrome	TTGCTGCGACTGC	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.470C>A	15.37:g.25222974C>A	ENSP00000382972:p.Ala157Glu	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	14.0	NM_022807	B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	ENST00000400100.1	37	CCDS10017.1	.	.	.	.	.	.	.	.	.	.	C	14.24	2.477692	0.44044	.	.	ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000214265	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203;ENST00000346403	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	4.3	3.38	0.38709	.	0.167207	0.41097	D	0.000956	T	0.42653	0.1212	M	0.64997	1.995	0.80722	D	1	D;D	0.54397	0.966;0.966	P;P	0.45195	0.473;0.473	T	0.49163	-0.8968	10	0.87932	D	0	-13.5608	10.5289	0.44965	0.0:0.9041:0.0:0.0959	.	161;157	B3KVR1;P63162	.;RSMN_HUMAN	E	157;157;157;161;157;161;16	ENSP00000382972:A157E;ENSP00000382970:A157E;ENSP00000382969:A157E;ENSP00000452342:A161E;ENSP00000375105:A157E;ENSP00000408767:A161E	ENSP00000306223:A16E	A	+	2	0	SNRPN;SNURF	22774067	1.000000	0.71417	0.845000	0.33349	0.003000	0.03518	4.384000	0.59607	1.403000	0.46800	-0.142000	0.14014	GCG	.		0.587	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097	
SOX30	11063	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	157053726	157053726	+	Silent	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr5:157053726T>C	ENST00000265007.6	-	5	2225	c.1884A>G	c.(1882-1884)acA>acG	p.T628T	SOX30_ENST00000519442.1_Silent_p.T323T|SOX30_ENST00000311371.5_Missense_Mutation_p.H464R	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	628	Pro-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGTAAGGGCATGTACTGCAGC	0.433																																					p.H464R	Esophageal Squamous(31;525 799 19355 21125 41744)	.											.	SOX30	91	0			c.A1391G						.						42.0	43.0	43.0					5																	157053726		2199	4293	6492	SO:0001819	synonymous_variant	11063	exon4			AGGGCATGTACTG	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1884A>G	5.37:g.157053726T>C		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	17.0	NM_007017	O94995|Q8IYX6	Missense_Mutation	SNP	ENST00000265007.6	37	CCDS4339.1	.	.	.	.	.	.	.	.	.	.	T	5.009	0.187393	0.09547	.	.	ENSG00000039600	ENST00000311371	D	0.97575	-4.44	5.56	-8.43	0.00953	.	.	.	.	.	D	0.91382	0.7281	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.67821	-0.5571	8	0.52906	T	0.07	.	3.7413	0.08532	0.0889:0.2643:0.1751:0.4717	.	464	O94993-2	.	R	464	ENSP00000309343:H464R	ENSP00000309343:H464R	H	-	2	0	SOX30	156986304	0.070000	0.21116	0.581000	0.28614	0.301000	0.27625	-1.231000	0.02939	-1.599000	0.01605	-1.253000	0.01494	CAT	.		0.433	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
SPATA31C1	441452	bcgsc.ca;mdanderson.org	37	9	90537352	90537352	+	RNA	SNP	C	C	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr9:90537352C>G	ENST00000602681.1	+	0	1927							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTCTCTACTCCCTAGAATGTC	0.537																																					p.P844A		.											.	.	.	0			c.C2530G						.						5.0	6.0	6.0					9																	90537352		677	1560	2237			441452	exon4			CTACTCCCTAGAA	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		9.37:g.90537352C>G		Somatic	293.0	1.0		WXS	Illumina HiSeq	Phase_1	245.0	66.0	NM_001145124		Missense_Mutation	SNP	ENST00000602681.1	37																																																																																				.		0.537	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
SRGAP3	9901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9101941	9101941	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr3:9101941T>G	ENST00000383836.3	-	6	1202	c.775A>C	c.(775-777)Atc>Ctc	p.I259L	SRGAP3_ENST00000360413.3_Missense_Mutation_p.I259L|SRGAP3_ENST00000433332.3_5'UTR	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	259	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		ACATCATGGATGTAGTATTTG	0.542			T	RAF1	pilocytic astrocytoma																																p.I259L		.		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	.	SRGAP3	344	0			c.A775C						.						202.0	176.0	184.0					3																	9101941		2203	4300	6503	SO:0001583	missense	9901	exon6			CATGGATGTAGTA	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.775A>C	3.37:g.9101941T>G	ENSP00000373347:p.Ile259Leu	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	33.0	NM_014850	Q8IX13|Q8IZV8	Missense_Mutation	SNP	ENST00000383836.3	37	CCDS2572.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.460174	0.63401	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.13420	2.59;2.59	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	L	0.46157	1.445	0.54753	D	0.999987	B;B;P;P	0.47106	0.296;0.026;0.89;0.606	B;B;B;B	0.40477	0.109;0.022;0.33;0.127	T	0.08953	-1.0697	10	0.21540	T	0.41	.	14.8468	0.70267	0.0:0.0:0.0:1.0	.	259;128;259;259	C7TPG7;Q9ULR4;O43295-2;O43295	.;.;.;SRGP2_HUMAN	L	259;259;139	ENSP00000373347:I259L;ENSP00000353587:I259L	ENSP00000353587:I259L	I	-	1	0	SRGAP3	9076941	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.810000	0.86072	1.992000	0.58205	0.377000	0.23210	ATC	.		0.542	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207137.3		
SRSF12	135295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	89827583	89827583	+	Silent	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr6:89827583G>A	ENST00000452027.2	-	1	217	c.24C>T	c.(22-24)ccC>ccT	p.P8P		NM_080743.4	NP_542781.3	Q8WXF0	SRS12_HUMAN	serine/arginine-rich splicing factor 12	8					cytoplasmic transport (GO:0016482)|mRNA 5'-splice site recognition (GO:0000395)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|spliceosomal tri-snRNP complex assembly (GO:0000244)	nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RS domain binding (GO:0050733)|unfolded protein binding (GO:0051082)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)	8						GGGAGGTGTTGGGGGGCCTCG	0.711																																					p.P8P		.											.	SRSF12	90	0			c.C24T						.						19.0	27.0	24.0					6																	89827583		2035	4179	6214	SO:0001819	synonymous_variant	135295	exon1			GGTGTTGGGGGGC	AF449428	CCDS47459.1	6q16.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000154548	ENSG00000154548		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	21220	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 19"", ""SR splicing factor 12"""		"""splicing factor, arginine/serine-rich 13B"""	SFRS13B		11684676, 20516191	Standard	NM_080743		Approved	SRrp35, SFRS19	uc021zcq.1	Q8WXF0	OTTHUMG00000015192	ENST00000452027.2:c.24C>T	6.37:g.89827583G>A		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	43.0	NM_080743	B2RA22|Q5T7K0|Q8WW25	Silent	SNP	ENST00000452027.2	37	CCDS47459.1																																																																																			.		0.711	SRSF12-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041474.2	NM_080743	
STMN4	81551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	27099966	27099966	+	Silent	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:27099966G>A	ENST00000265770.7	-	3	193	c.57C>T	c.(55-57)ttC>ttT	p.F19F	STMN4_ENST00000519614.1_Silent_p.F19F|STMN4_ENST00000523048.1_Silent_p.F19F|STMN4_ENST00000350889.4_Silent_p.F19F|STMN4_ENST00000522908.1_Silent_p.F19F|STMN4_ENST00000519997.1_Silent_p.F10F			Q9H169	STMN4_HUMAN	stathmin-like 4	19					regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	AGCAGGAGCAGAACAAGGACA	0.577																																					p.F19F		.											.	STMN4	154	0			c.C57T						.						105.0	99.0	101.0					8																	27099966		2203	4300	6503	SO:0001819	synonymous_variant	81551	exon3			GGAGCAGAACAAG		CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.57C>T	8.37:g.27099966G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	29.0	NM_030795	B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Silent	SNP	ENST00000265770.7	37																																																																																				.		0.577	STMN4-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000375941.1	NM_030795	
STOX2	56977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	184931082	184931082	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr4:184931082G>A	ENST00000308497.4	+	3	2526	c.1091G>A	c.(1090-1092)cGg>cAg	p.R364Q	STOX2_ENST00000438269.1_Missense_Mutation_p.R364Q	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	364					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		AGGACTCATCGGAAGTCCCAT	0.517																																					p.R364Q		.											.	STOX2	22	0			c.G1091A						.						33.0	32.0	32.0					4																	184931082		1898	4122	6020	SO:0001583	missense	56977	exon3			CTCATCGGAAGTC	AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.1091G>A	4.37:g.184931082G>A	ENSP00000311257:p.Arg364Gln	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	21.0	NM_020225	A6H8U4|Q9NPS8	Missense_Mutation	SNP	ENST00000308497.4	37	CCDS47167.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713573	0.89112	.	.	ENSG00000173320	ENST00000308497;ENST00000438269	T;T	0.80824	-0.42;-1.42	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.85423	0.5693	L	0.32530	0.975	0.80722	D	1	D;D	0.71674	0.991;0.998	P;D	0.66602	0.585;0.945	D	0.84479	0.0604	10	0.51188	T	0.08	-14.2328	20.8794	0.99867	0.0:0.0:1.0:0.0	.	364;364	Q9P2F5-2;Q9P2F5	.;STOX2_HUMAN	Q	364	ENSP00000311257:R364Q;ENSP00000390127:R364Q	ENSP00000311257:R364Q	R	+	2	0	STOX2	185168076	1.000000	0.71417	0.764000	0.31436	0.807000	0.45602	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CGG	.		0.517	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225	
SUSD2	56241	broad.mit.edu;bcgsc.ca	37	22	24583365	24583365	+	Missense_Mutation	SNP	G	G	T	rs141759016	byFrequency	TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr22:24583365G>T	ENST00000358321.3	+	11	2099	c.1838G>T	c.(1837-1839)cGc>cTc	p.R613L		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	613	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CACAGCGGGCGCGTCCTGCCC	0.647																																					p.R613L		.											.	SUSD2	91	0			c.G1838T						.						97.0	84.0	89.0					22																	24583365		2203	4300	6503	SO:0001583	missense	56241	exon11			GCGGGCGCGTCCT	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1838G>T	22.37:g.24583365G>T	ENSP00000351075:p.Arg613Leu	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	4.0	NM_019601	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	37	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	G	5.450	0.268051	0.10349	.	.	ENSG00000099994	ENST00000358321	T	0.20738	2.05	4.59	-1.41	0.08941	von Willebrand factor, type D domain (1);	3.172790	0.00766	N	0.001174	T	0.13457	0.0326	L	0.28400	0.85	0.09310	N	1	B	0.20261	0.043	B	0.18871	0.023	T	0.13442	-1.0509	10	0.23891	T	0.37	-0.8681	1.0301	0.01536	0.3066:0.3128:0.24:0.1406	.	613	Q9UGT4	SUSD2_HUMAN	L	613	ENSP00000351075:R613L	ENSP00000351075:R613L	R	+	2	0	SUSD2	22913365	0.000000	0.05858	0.004000	0.12327	0.029000	0.11900	-0.251000	0.08818	-0.062000	0.13088	-0.377000	0.06932	CGC	G|0.999;A|0.001		0.647	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
TAL2	6887	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	108425042	108425042	+	Missense_Mutation	SNP	G	G	T	rs573416391		TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr9:108425042G>T	ENST00000334077.3	+	1	305	c.265G>T	c.(265-267)Gac>Tac	p.D89Y		NM_005421.2	NP_005412.1	Q16559	TAL2_HUMAN	T-cell acute lymphocytic leukemia 2	89					midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)		DNA binding (GO:0003677)										AGGCCTGGAGGACAGAACTCT	0.587			T	TRB@	T-ALL																																p.D89Y		.		Dom	yes		9	9q31	6887	T-cell acute lymphocytic leukemia 2		L	.	TAL2	636	0			c.G265T						.						49.0	47.0	48.0					9																	108425042		2203	4300	6503	SO:0001583	missense	6887	exon1			CTGGAGGACAGAA		CCDS6767.1	9q32	2013-05-21			ENSG00000186051	ENSG00000186051		"""Basic helix-loop-helix proteins"""	11557	protein-coding gene	gene with protein product		186855				1763056	Standard	NM_005421		Approved	bHLHa19	uc004bct.3	Q16559	OTTHUMG00000020424	ENST00000334077.3:c.265G>T	9.37:g.108425042G>T	ENSP00000334547:p.Asp89Tyr	Somatic	91.0	1.0		WXS	Illumina HiSeq	Phase_I	76.0	36.0	NM_005421	A0AVI7	Missense_Mutation	SNP	ENST00000334077.3	37	CCDS6767.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.431133	0.43122	.	.	ENSG00000186051	ENST00000334077	D	0.96459	-4.02	4.04	3.09	0.35607	.	0.571506	0.20357	N	0.093922	D	0.93864	0.8037	L	0.53249	1.67	0.42671	D	0.993511	B	0.32425	0.371	B	0.33750	0.169	D	0.91658	0.5340	10	0.66056	D	0.02	-1.897	9.6827	0.40080	0.1126:0.0:0.8874:0.0	.	89	Q16559	TAL2_HUMAN	Y	89	ENSP00000334547:D89Y	ENSP00000334547:D89Y	D	+	1	0	TAL2	107464863	0.988000	0.35896	0.796000	0.32109	0.178000	0.23041	0.715000	0.25822	0.705000	0.31890	0.655000	0.94253	GAC	.		0.587	TAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053504.1	NM_005421	
ATG14	22863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	55881125	55881125	+	5'Flank	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr14:55881125G>T	ENST00000247178.5	-	0	0				TBPL2_ENST00000247219.5_Missense_Mutation_p.P367H	NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14						autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						TTTTAGAATAGGATAGATGTT	0.318																																					p.P367H		.											.	TBPL2	90	0			c.C1100A						.						79.0	81.0	80.0					14																	55881125		2202	4300	6502	SO:0001631	upstream_gene_variant	387332	exon7			AGAATAGGATAGA	AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129		14.37:g.55881125G>T	Exception_encountered	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	16.0	NM_199047	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Missense_Mutation	SNP	ENST00000247178.5	37	CCDS32087.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273794	0.80580	.	.	ENSG00000182521	ENST00000247219	T	0.58060	0.36	5.34	5.34	0.76211	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80660	0.4665	H	0.94620	3.56	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	D	0.85789	0.1366	10	0.87932	D	0	-10.6571	18.2043	0.89850	0.0:0.0:1.0:0.0	.	367	Q6SJ96	TBPL2_HUMAN	H	367	ENSP00000247219:P367H	ENSP00000247219:P367H	P	-	2	0	TBPL2	54950878	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	8.686000	0.91250	2.775000	0.95449	0.655000	0.94253	CCT	.		0.318	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
TEKT1	83659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	6718550	6718550	+	Silent	SNP	G	G	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:6718550G>T	ENST00000338694.2	-	5	690	c.561C>A	c.(559-561)atC>atA	p.I187I	TEKT1_ENST00000535086.1_Silent_p.I41I	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	187						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.I187I(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				GCGAGAAGCAGATATCATCTA	0.488																																					p.I187I		.											.	TEKT1	92	1	Substitution - coding silent(1)	lung(1)	c.C561A						.						238.0	214.0	222.0					17																	6718550		2203	4300	6503	SO:0001819	synonymous_variant	83659	exon5			GAAGCAGATATCA		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.561C>A	17.37:g.6718550G>T		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	6.0	NM_053285	D3DTM7	Silent	SNP	ENST00000338694.2	37	CCDS11083.1																																																																																			.		0.488	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	
TIAM2	26230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155498070	155498070	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr6:155498070C>T	ENST00000461783.3	+	12	3755	c.2482C>T	c.(2482-2484)Cca>Tca	p.P828S	TIAM2_ENST00000528391.2_Missense_Mutation_p.P164S|TIAM2_ENST00000456877.2_Missense_Mutation_p.P140S|TIAM2_ENST00000360366.4_Missense_Mutation_p.P852S|TIAM2_ENST00000318981.5_Missense_Mutation_p.P828S|TIAM2_ENST00000529824.2_Missense_Mutation_p.P828S|TIAM2_ENST00000367174.2_Missense_Mutation_p.P204S|TIAM2_ENST00000456144.1_Missense_Mutation_p.P828S			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	828	RBD. {ECO:0000255|PROSITE- ProRule:PRU00262}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AGGGATCAAGCCAGAGCACAG	0.398																																					p.P828S		.											.	TIAM2	93	0			c.C2482T						.						150.0	134.0	139.0					6																	155498070		2203	4300	6503	SO:0001583	missense	26230	exon9			ATCAAGCCAGAGC		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2482C>T	6.37:g.155498070C>T	ENSP00000437188:p.Pro828Ser	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	30.0	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	C	14.52	2.561315	0.45590	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391	T;T;T;T;T;T;T;T;T	0.05513	3.64;3.56;3.61;3.64;3.43;3.6;3.61;3.45;3.43	5.55	5.55	0.83447	Raf-like Ras-binding (2);	0.211686	0.42294	D	0.000721	T	0.03348	0.0097	L	0.48362	1.52	0.40816	D	0.983466	B;B;B;B	0.23058	0.079;0.023;0.048;0.013	B;B;B;B	0.19946	0.027;0.016;0.023;0.007	T	0.31052	-0.9957	10	0.39692	T	0.17	.	12.4036	0.55426	0.0:0.9225:0.0:0.0775	.	164;828;852;828	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	S	828;1074;828;828;828;204;852;828;140;164	ENSP00000437188:P828S;ENSP00000434901:P828S;ENSP00000407746:P828S;ENSP00000327315:P828S;ENSP00000356142:P204S;ENSP00000353528:P852S;ENSP00000433348:P828S;ENSP00000407183:P140S;ENSP00000435335:P164S	ENSP00000327315:P828S	P	+	1	0	TIAM2	155539762	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.217000	0.51184	2.768000	0.95171	0.655000	0.94253	CCA	.		0.398	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
TNFRSF4	7293	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	1148033	1148033	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:1148033C>A	ENST00000379236.3	-	4	426	c.422G>T	c.(421-423)tGc>tTc	p.C141F	TNFRSF4_ENST00000453580.1_5'UTR	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	141					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCAGGGCTTGCAGGCCTGGTT	0.706																																					p.C141F		.											.	TNFRSF4	227	0			c.G422T						.						7.0	7.0	7.0					1																	1148033		2129	4208	6337	SO:0001583	missense	7293	exon4			GGCTTGCAGGCCT	X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.422G>T	1.37:g.1148033C>A	ENSP00000368538:p.Cys141Phe	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	18.0	NM_003327	Q13663|Q2M312|Q5T7M0	Missense_Mutation	SNP	ENST00000379236.3	37	CCDS11.1	.	.	.	.	.	.	.	.	.	.	c	15.01	2.704974	0.48412	.	.	ENSG00000186827	ENST00000379236	T	0.41758	0.99	3.69	3.69	0.42338	TNFR/CD27/30/40/95 cysteine-rich region (1);	0.242450	0.33075	N	0.005301	T	0.67277	0.2876	M	0.85945	2.785	0.52099	D	0.999944	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.974	T	0.75204	-0.3400	10	0.87932	D	0	-20.1569	14.9756	0.71269	0.0:1.0:0.0:0.0	.	86;141	B1AME4;P43489	.;TNR4_HUMAN	F	141	ENSP00000368538:C141F	ENSP00000368538:C141F	C	-	2	0	TNFRSF4	1137896	0.995000	0.38212	0.998000	0.56505	0.535000	0.34838	2.644000	0.46613	2.081000	0.62600	0.472000	0.43445	TGC	.		0.706	TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004086.1		
TNIP1	10318	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150441768	150441768	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr5:150441768C>A	ENST00000389378.2	-	4	865	c.277G>T	c.(277-279)Gac>Tac	p.D93Y	TNIP1_ENST00000522226.1_Missense_Mutation_p.D93Y|TNIP1_ENST00000523338.1_Missense_Mutation_p.D93Y|TNIP1_ENST00000521591.1_Missense_Mutation_p.D93Y|TNIP1_ENST00000518977.1_Missense_Mutation_p.D93Y|TNIP1_ENST00000315050.7_Missense_Mutation_p.D93Y|TNIP1_ENST00000523200.1_Missense_Mutation_p.D93Y|TNIP1_ENST00000524280.1_Missense_Mutation_p.D93Y|TNIP1_ENST00000520931.1_Missense_Mutation_p.D40Y	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	93					defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACATTTGAGTCCTTTCCTGGA	0.522																																					p.D93Y		.											.	TNIP1	91	0			c.G277T						.						121.0	109.0	113.0					5																	150441768		2203	4300	6503	SO:0001583	missense	10318	exon4			TTGAGTCCTTTCC	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.277G>T	5.37:g.150441768C>A	ENSP00000374029:p.Asp93Tyr	Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	60.0	28.0	NM_001252385	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.457785	0.26161	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840;ENST00000522100;ENST00000520695;ENST00000521001	T;T;T;T;T;T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.11	-0.173	0.13322	.	1.122620	0.06389	N	0.716698	T	0.30293	0.0760	L	0.51422	1.61	0.09310	N	1	P;P;P;P;P;P;B	0.51351	0.904;0.875;0.944;0.875;0.923;0.588;0.36	P;B;P;B;P;B;B	0.51135	0.563;0.424;0.66;0.424;0.544;0.17;0.17	T	0.21895	-1.0232	10	0.62326	D	0.03	-4.1557	3.4424	0.07468	0.1765:0.4225:0.0:0.401	.	93;47;47;93;93;93;93	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	Y	40;93;93;93;50;50;55;93;93;93;93;93;50;40;93;93	ENSP00000429891:D40Y;ENSP00000374029:D93Y;ENSP00000317891:D93Y;ENSP00000428243:D93Y;ENSP00000428187:D93Y;ENSP00000430760:D93Y;ENSP00000430971:D93Y;ENSP00000429912:D93Y;ENSP00000431105:D93Y;ENSP00000428487:D40Y;ENSP00000430279:D93Y;ENSP00000428404:D93Y	ENSP00000317891:D93Y	D	-	1	0	TNIP1	150421961	0.169000	0.23002	0.018000	0.16275	0.007000	0.05969	0.256000	0.18351	0.046000	0.15833	0.650000	0.86243	GAC	.		0.522	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058	
TONSL	4796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145660436	145660436	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr8:145660436C>G	ENST00000409379.3	-	19	2999	c.2970G>C	c.(2968-2970)caG>caC	p.Q990H	AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	990					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GGATGAGGTCCTGTGGGGCCA	0.706																																					p.Q990H		.											.	TONSL	92	0			c.G2970C						.						20.0	22.0	21.0					8																	145660436		2201	4298	6499	SO:0001583	missense	4796	exon19			GAGGTCCTGTGGG		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.2970G>C	8.37:g.145660436C>G	ENSP00000386239:p.Gln990His	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	26.0	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617331	0.28801	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.44083	0.93	4.81	1.97	0.26223	.	0.069344	0.64402	D	0.000020	T	0.29620	0.0739	L	0.41824	1.3	0.46167	D	0.998906	B	0.18461	0.028	B	0.13407	0.009	T	0.06770	-1.0808	10	0.39692	T	0.17	-27.5114	7.156	0.25637	0.0:0.6178:0.0:0.3822	.	990	Q96HA7	TONSL_HUMAN	H	990;989	ENSP00000386239:Q990H	ENSP00000386239:Q990H	Q	-	3	2	TONSL	145631244	0.993000	0.37304	0.992000	0.48379	0.875000	0.50365	0.297000	0.19101	0.452000	0.26830	0.491000	0.48974	CAG	.		0.706	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
TOPORS	10210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	32543636	32543636	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr9:32543636A>G	ENST00000360538.2	-	3	1003	c.887T>C	c.(886-888)tTa>tCa	p.L296S	TOPORS_ENST00000379858.1_Missense_Mutation_p.L231S	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	296	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CCAGGGGACTAATCTGTGAAG	0.403																																					p.L296S		.											.	TOPORS	230	0			c.T887C						.						56.0	56.0	56.0					9																	32543636		2203	4299	6502	SO:0001583	missense	10210	exon3			GGGACTAATCTGT	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.887T>C	9.37:g.32543636A>G	ENSP00000353735:p.Leu296Ser	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	9.0	NM_005802	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	A	14.09	2.432275	0.43122	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.35789	1.29;1.32	5.93	5.93	0.95920	.	0.000000	0.36066	N	0.002810	T	0.64216	0.2578	M	0.83312	2.635	0.50632	D	0.999885	D	0.89917	1.0	D	0.85130	0.997	T	0.69566	-0.5111	10	0.87932	D	0	-20.062	15.3592	0.74457	1.0:0.0:0.0:0.0	.	296	Q9NS56	TOPRS_HUMAN	S	296;231	ENSP00000353735:L296S;ENSP00000369187:L231S	ENSP00000353735:L296S	L	-	2	0	TOPORS	32533636	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.927000	0.92846	2.263000	0.75096	0.533000	0.62120	TTA	.		0.403	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
TPO	7173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	1459934	1459934	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:1459934G>A	ENST00000345913.4	+	7	790	c.699G>A	c.(697-699)tgG>tgA	p.W233*	TPO_ENST00000349624.3_Nonsense_Mutation_p.W233*|TPO_ENST00000346956.3_Nonsense_Mutation_p.W233*|TPO_ENST00000329066.4_Nonsense_Mutation_p.W233*|TPO_ENST00000382201.3_Nonsense_Mutation_p.W233*|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Nonsense_Mutation_p.W233*|TPO_ENST00000337415.3_Nonsense_Mutation_p.W233*	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	233					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TGATGGCATGGGGACAATACA	0.527																																					p.W233X		.											.	TPO	332	0			c.G699A						.						125.0	90.0	102.0					2																	1459934		2203	4300	6503	SO:0001587	stop_gained	7173	exon7			GGCATGGGGACAA		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.699G>A	2.37:g.1459934G>A	ENSP00000318820:p.Trp233*	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	22.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Nonsense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	32	5.180168	0.94846	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.4484	18.7337	0.91746	0.0:0.0:1.0:0.0	.	.	.	.	X	233;233;233;233;233;233;233;162	.	ENSP00000329869:W233X	W	+	3	0	TPO	1438941	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	8.763000	0.91715	2.485000	0.83878	0.563000	0.77884	TGG	.		0.527	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TRAK2	66008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	202254174	202254174	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:202254174C>T	ENST00000332624.3	-	12	1674	c.1246G>A	c.(1246-1248)Ggc>Agc	p.G416S		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	416	Interaction with HGS. {ECO:0000250}.				protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						ATAGAGCGGCCCCGTGTGTCA	0.478																																					p.G416S		.											.	TRAK2	90	0			c.G1246A						.						106.0	103.0	104.0					2																	202254174		2203	4300	6503	SO:0001583	missense	66008	exon12			AGCGGCCCCGTGT	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.1246G>A	2.37:g.202254174C>T	ENSP00000328875:p.Gly416Ser	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	14.0	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Missense_Mutation	SNP	ENST00000332624.3	37	CCDS2347.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488016	0.26686	.	.	ENSG00000115993	ENST00000332624;ENST00000542292	T	0.41400	1.0	5.9	4.94	0.65067	Trafficking kinesin-binding protein domain (1);	0.302356	0.33327	N	0.005031	T	0.25754	0.0627	N	0.25144	0.715	0.80722	D	1	B	0.24092	0.097	B	0.23574	0.047	T	0.05869	-1.0859	10	0.08837	T	0.75	.	11.168	0.48554	0.1378:0.792:0.0:0.0703	.	416	O60296	TRAK2_HUMAN	S	416;322	ENSP00000328875:G416S	ENSP00000328875:G416S	G	-	1	0	TRAK2	201962419	0.061000	0.20836	0.910000	0.35882	0.649000	0.38597	0.249000	0.18216	2.788000	0.95919	0.650000	0.86243	GGC	.		0.478	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
TSKU	25987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	76506706	76506706	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr11:76506706A>G	ENST00000527881.1	+	2	1072	c.46A>G	c.(46-48)Aca>Gca	p.T16A	TSKU_ENST00000333090.4_Missense_Mutation_p.T16A			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	16					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					TGGGGCCCAGACAACCCGGCC	0.632																																					p.T16A		.											.	TSKU	90	0			c.A46G						.						40.0	44.0	42.0					11																	76506706		2200	4292	6492	SO:0001583	missense	25987	exon2			GCCCAGACAACCC	AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.46A>G	11.37:g.76506706A>G	ENSP00000434847:p.Thr16Ala	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	10.0	NM_015516	B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Missense_Mutation	SNP	ENST00000527881.1	37	CCDS8246.1	.	.	.	.	.	.	.	.	.	.	A	5.577	0.291267	0.10567	.	.	ENSG00000182704	ENST00000533752;ENST00000333090;ENST00000439807;ENST00000525167;ENST00000527881	T;T;T	0.51817	0.69;1.53;1.53	5.14	1.11	0.20524	.	0.450566	0.25316	N	0.031552	T	0.16557	0.0398	N	0.04203	-0.255	0.29110	N	0.880902	B	0.02656	0.0	B	0.04013	0.001	T	0.29150	-1.0021	10	0.02654	T	1	-0.9992	4.7239	0.12931	0.5912:0.0:0.2692:0.1396	.	16	Q8WUA8	TSK_HUMAN	A	16	ENSP00000435133:T16A;ENSP00000332668:T16A;ENSP00000434847:T16A	ENSP00000332668:T16A	T	+	1	0	TSKU	76184354	0.810000	0.29049	0.901000	0.35422	0.482000	0.33219	1.277000	0.33167	0.303000	0.22785	0.533000	0.62120	ACA	.		0.632	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382871.1	NM_015516	
USP40	55230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234442150	234442150	+	Silent	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:234442150T>C	ENST00000427112.2	-	10	1478	c.1443A>G	c.(1441-1443)aaA>aaG	p.K481K	USP40_ENST00000251722.6_Silent_p.K481K|USP40_ENST00000450966.1_Silent_p.K493K			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	481	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GCAACTGGGATTTCCGATAAA	0.363																																					p.K493K		.											.	USP40	455	0			c.A1479G						.						114.0	109.0	111.0					2																	234442150		1844	4084	5928	SO:0001819	synonymous_variant	55230	exon10			CTGGGATTTCCGA	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.1443A>G	2.37:g.234442150T>C		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	26.0	NM_018218	Q6NX38|Q70EL0	Silent	SNP	ENST00000427112.2	37	CCDS46547.1																																																																																			.		0.363	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
USP9X	8239	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	41002598	41002598	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chrX:41002598C>G	ENST00000324545.8	+	10	1849	c.1216C>G	c.(1216-1218)Cag>Gag	p.Q406E	USP9X_ENST00000378308.2_Missense_Mutation_p.Q406E	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	406					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TAGTCTTCATCAGCCACAGTA	0.353																																					p.Q406E	Ovarian(172;1807 2695 35459 49286)	.											.	USP9X	563	0			c.C1216G						.						61.0	55.0	57.0					X																	41002598		1998	4200	6198	SO:0001583	missense	8239	exon10			CTTCATCAGCCAC	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1216C>G	X.37:g.41002598C>G	ENSP00000316357:p.Gln406Glu	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	129.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	37	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596387	0.66332	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.75821	-0.97;-0.97	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.77164	0.4090	M	0.79475	2.455	0.80722	D	1	P;P	0.41910	0.607;0.764	B;B	0.39590	0.304;0.16	T	0.81865	-0.0736	10	0.72032	D	0.01	.	18.1174	0.89561	0.0:1.0:0.0:0.0	.	406;406	Q93008-1;Q93008	.;USP9X_HUMAN	E	406	ENSP00000367558:Q406E;ENSP00000316357:Q406E	ENSP00000316357:Q406E	Q	+	1	0	USP9X	40887542	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.442000	0.80503	2.304000	0.77564	0.415000	0.27848	CAG	.		0.353	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82816091	82816091	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr5:82816091T>C	ENST00000265077.3	+	7	2531	c.1966T>C	c.(1966-1968)Ttt>Ctt	p.F656L	VCAN_ENST00000512590.2_Missense_Mutation_p.F608L|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.F656L	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	656	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AATAGAATTGTTTCCTTATTC	0.358																																					p.F656L		.											.	VCAN	238	0			c.T1966C						.						104.0	104.0	104.0					5																	82816091		2203	4299	6502	SO:0001583	missense	1462	exon7			GAATTGTTTCCTT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.1966T>C	5.37:g.82816091T>C	ENSP00000265077:p.Phe656Leu	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	19.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	10.37	1.331274	0.24167	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.17054	2.3;2.3;2.3	5.81	0.539	0.17156	.	0.427521	0.22294	N	0.061951	T	0.08846	0.0219	L	0.36672	1.1	0.19300	N	0.999971	B;B	0.26445	0.021;0.149	B;B	0.23716	0.013;0.048	T	0.28038	-1.0056	10	0.17369	T	0.5	.	0.8554	0.01181	0.1658:0.1772:0.1547:0.5024	.	656;656	P13611-3;P13611	.;CSPG2_HUMAN	L	656;656;608	ENSP00000265077:F656L;ENSP00000342768:F656L;ENSP00000425959:F608L	ENSP00000265077:F656L	F	+	1	0	VCAN	82851847	0.002000	0.14202	0.070000	0.20053	0.942000	0.58702	0.010000	0.13242	-0.125000	0.11703	0.533000	0.62120	TTT	.		0.358	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168102933	168102933	+	Silent	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr2:168102933C>T	ENST00000409195.1	+	9	5120	c.5031C>T	c.(5029-5031)atC>atT	p.I1677I	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Silent_p.I1455I|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Silent_p.I1677I	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1502					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGAAAGGCATCTTAATTCAGG	0.343																																					p.I1677I		.											.	XIRP2	104	0			c.C5031T						.						93.0	88.0	90.0					2																	168102933		1859	4081	5940	SO:0001819	synonymous_variant	129446	exon9			AGGCATCTTAATT	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.5031C>T	2.37:g.168102933C>T		Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	32.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1																																																																																			.		0.343	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ZC3H7A	29066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	11859416	11859416	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr16:11859416T>A	ENST00000396516.2	-	13	1845	c.1648A>T	c.(1648-1650)Aat>Tat	p.N550Y	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.N550Y			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	550						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						ATCTTTCCATTGCCGCCAAAG	0.453																																					p.N550Y		.											.	ZC3H7A	94	0			c.A1648T						.						96.0	95.0	96.0					16																	11859416		2197	4300	6497	SO:0001583	missense	29066	exon14			TTCCATTGCCGCC	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1648A>T	16.37:g.11859416T>A	ENSP00000379773:p.Asn550Tyr	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	13.0	NM_014153	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	T	10.99	1.506772	0.26949	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.10668	2.85;2.85	5.81	4.69	0.59074	.	0.342317	0.37393	N	0.002107	T	0.14700	0.0355	L	0.60455	1.87	0.80722	D	1	B;P	0.40376	0.178;0.715	B;B	0.40864	0.308;0.342	T	0.01013	-1.1481	10	0.56958	D	0.05	.	12.073	0.53628	0.0:0.0:0.2707:0.7293	.	271;550	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	Y	550	ENSP00000347999:N550Y;ENSP00000379773:N550Y	ENSP00000347999:N550Y	N	-	1	0	ZC3H7A	11766917	1.000000	0.71417	0.971000	0.41717	0.373000	0.29922	2.264000	0.43302	0.979000	0.38497	0.533000	0.62120	AAT	.		0.453	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	68274609	68274609	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr14:68274609G>A	ENST00000347230.4	-	5	530	c.392C>T	c.(391-393)gCa>gTa	p.A131V	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.A131V	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	131					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GTGGCCTACTGCACCCTGTGT	0.537																																					p.A131V		.											.	ZFYVE26	162	0			c.C392T						.						100.0	100.0	100.0					14																	68274609		2203	4299	6502	SO:0001583	missense	23503	exon5			CCTACTGCACCCT	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.392C>T	14.37:g.68274609G>A	ENSP00000251119:p.Ala131Val	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	27.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.915620	0.33815	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.27720	1.79;1.65	5.64	3.63	0.41609	.	1.383960	0.04182	N	0.326651	T	0.18383	0.0441	N	0.08118	0	0.09310	N	1	B;B;B	0.23442	0.085;0.02;0.012	B;B;B	0.21917	0.037;0.025;0.01	T	0.17471	-1.0368	10	0.28530	T	0.3	0.7986	7.4073	0.26998	0.0:0.1539:0.6081:0.2381	.	131;131;131	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	V	131	ENSP00000251119:A131V;ENSP00000450603:A131V	ENSP00000251119:A131V	A	-	2	0	ZFYVE26	67344362	0.029000	0.19370	0.002000	0.10522	0.433000	0.31745	2.372000	0.44257	1.360000	0.45960	0.591000	0.81541	GCA	.		0.537	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZNF217	7764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	52198188	52198188	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr20:52198188T>C	ENST00000371471.2	-	2	1603	c.1178A>G	c.(1177-1179)cAc>cGc	p.H393R	ZNF217_ENST00000302342.3_Missense_Mutation_p.H393R|ZNF217_ENST00000540425.1_5'Flank			O75362	ZN217_HUMAN	zinc finger protein 217	393					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GACCCTGGAGTGCAAGACCAG	0.642																																					p.H393R		.											.	ZNF217	723	0			c.A1178G						.						67.0	68.0	68.0					20																	52198188		2203	4300	6503	SO:0001583	missense	7764	exon1			CTGGAGTGCAAGA	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1178A>G	20.37:g.52198188T>C	ENSP00000360526:p.His393Arg	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	26.0	NM_006526	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	37	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.559472	0.86335	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.60548	0.18;0.18	5.7	5.7	0.88788	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.78868	0.4351	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82637	-0.0359	10	0.87932	D	0	-40.9404	15.6258	0.76855	0.0:0.0:0.0:1.0	.	393	O75362	ZN217_HUMAN	R	393	ENSP00000360526:H393R;ENSP00000304308:H393R	ENSP00000304308:H393R	H	-	2	0	ZNF217	51631595	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.595000	0.82710	2.170000	0.68504	0.482000	0.46254	CAC	.		0.642	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
ZNF415	55786	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	53612297	53612297	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr19:53612297C>G	ENST00000500065.4	-	4	1334	c.1001G>C	c.(1000-1002)gGc>gCc	p.G334A	ZNF415_ENST00000601493.1_Missense_Mutation_p.G104A|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.G334A|ZNF415_ENST00000455735.2_Missense_Mutation_p.G382A|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.G321A|ZNF415_ENST00000421033.1_Missense_Mutation_p.G346A|ZNF415_ENST00000448501.1_Missense_Mutation_p.G382A	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		AAAGGCTTTGCCACACTCTTT	0.403																																					p.G334A		.											.	ZNF415	91	0			c.G1001C						.						85.0	78.0	81.0					19																	53612297		2203	4300	6503	SO:0001583	missense	55786	exon4			GCTTTGCCACACT	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.1001G>C	19.37:g.53612297C>G	ENSP00000439435:p.Gly334Ala	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	12.0	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	37	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	C	10.48	1.361411	0.24684	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01	2.78	1.72	0.24424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40247	0.1109	M	0.70903	2.155	0.24520	N	0.994165	D;D;D;D;D;D	0.71674	0.998;0.997;0.998;0.998;0.998;0.998	P;D;D;D;P;D	0.76575	0.812;0.97;0.911;0.988;0.855;0.988	T	0.10590	-1.0623	9	0.72032	D	0.01	.	6.5532	0.22446	0.0:0.7444:0.0:0.2556	.	334;382;382;334;321;346	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	A	334;334;382;346;382;321	ENSP00000243643:G334A;ENSP00000439435:G334A;ENSP00000396492:G382A;ENSP00000395055:G346A;ENSP00000388787:G382A;ENSP00000414601:G321A	ENSP00000243643:G334A	G	-	2	0	ZNF415	58304109	0.598000	0.26882	0.080000	0.20451	0.011000	0.07611	0.618000	0.24373	0.511000	0.28236	-0.339000	0.08088	GGC	.		0.403	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
ZNF695	57116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247150556	247150556	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr1:247150556A>G	ENST00000339986.7	-	4	1408	c.1261T>C	c.(1261-1263)Tca>Cca	p.S421P	ZNF695_ENST00000498046.2_Intron|ZNF695_ENST00000487338.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	421					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GTAAGGTATGAAAACCAGGTA	0.368																																					p.S421P		.											.	.	.	0			c.T1261C						.						49.0	53.0	52.0					1																	247150556		2125	4266	6391	SO:0001583	missense	57116	exon4			GGTATGAAAACCA		CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.1261T>C	1.37:g.247150556A>G	ENSP00000341236:p.Ser421Pro	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	15.0	NM_020394	Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Missense_Mutation	SNP	ENST00000339986.7	37	CCDS44344.1	.	.	.	.	.	.	.	.	.	.	A	10.66	1.412971	0.25465	.	.	ENSG00000197472	ENST00000339986	T	0.07908	3.15	0.642	0.642	0.17765	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08582	0.0213	M	0.84219	2.685	0.09310	N	1	P	0.50156	0.932	B	0.31290	0.127	T	0.35101	-0.9802	9	0.72032	D	0.01	.	3.4433	0.07472	0.5679:0.432:0.0:1.0E-4	.	421	Q8IW36	ZN695_HUMAN	P	421	ENSP00000341236:S421P	ENSP00000341236:S421P	S	-	1	0	ZNF695	245217179	0.000000	0.05858	0.001000	0.08648	0.219000	0.24729	0.720000	0.25896	0.534000	0.28695	0.172000	0.16884	TCA	.		0.368	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097823.5	NM_020394	
ZNF595	152687	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	4	59395	59395	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr4:59395C>T	ENST00000509152.2	+	2	261	c.76C>T	c.(76-78)Cag>Tag	p.Q26*	ZNF595_ENST00000526473.2_Nonsense_Mutation_p.Q26*|ZNF595_ENST00000339368.6_3'UTR			Q8IYB9	ZN595_HUMAN	zinc finger protein 595	26	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CCCTGCCCAGCAGAATTTGTA	0.428																																					p.Q26X		.											.	.	.	0			c.C76T						.						369.0	402.0	391.0					4																	59395		2203	4300	6503	SO:0001587	stop_gained	255403	exon2			GCCCAGCAGAATT	BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.76C>T	4.37:g.59395C>T	ENSP00000434858:p.Gln26*	Somatic	268.0	0.0		WXS	Illumina HiSeq	Phase_I	226.0	13.0	NM_001039127		Nonsense_Mutation	SNP	ENST00000509152.2	37		.	.	.	.	.	.	.	.	.	.	C	13.23	2.176256	0.38413	.	.	ENSG00000197701	ENST00000509152;ENST00000526473	.	.	.	1.26	-1.81	0.07882	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	2.1827	0.03879	0.4478:0.3171:0.0:0.235	.	.	.	.	X	26	.	ENSP00000434858:Q26X	Q	+	1	0	ZNF595	49395	0.480000	0.25933	0.019000	0.16419	0.037000	0.13140	-0.178000	0.09782	-0.157000	0.11059	0.484000	0.47621	CAG	.		0.428	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000357817.2	NM_182524	
ZNF831	128611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	57766654	57766654	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr20:57766654C>T	ENST00000371030.2	+	1	580	c.580C>T	c.(580-582)Cag>Tag	p.Q194*		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	194							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CAGGCGGACGCAGACGCACCT	0.662																																					p.Q194X		.											.	ZNF831	126	0			c.C580T						.						47.0	55.0	52.0					20																	57766654		2054	4195	6249	SO:0001587	stop_gained	128611	exon1			CGGACGCAGACGC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.580C>T	20.37:g.57766654C>T	ENSP00000360069:p.Gln194*	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	9.0	NM_178457	Q5TDR4|Q8TCP0	Nonsense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.698101	0.88830	.	.	ENSG00000124203	ENST00000371030	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-11.7536	18.1834	0.89786	0.0:1.0:0.0:0.0	.	.	.	.	X	194	.	ENSP00000360069:Q194X	Q	+	1	0	ZNF831	57200049	1.000000	0.71417	1.000000	0.80357	0.087000	0.18053	7.755000	0.85180	2.538000	0.85594	0.561000	0.74099	CAG	.		0.662	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
HGS	9146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	79661868	79661869	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-MI-A75C-01A-11D-A32G-10	TCGA-MI-A75C-10A-01D-A32G-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ea50cd47-c60a-4696-bd52-1e5fd735adad	95a91613-2d3d-4a43-a127-c826c46835e9	g.chr17:79661868_79661869GG>TC	ENST00000329138.4	+	12	1095_1096	c.960_961GG>TC	c.(958-963)gaGGac>gaTCac	p.320_321ED>DH		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	320	Interaction with SNX1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CTCTGGCTGAGGACATCGACCC	0.609																																					p.ED320DH		.											.	.	.	0			.						.																																			SO:0001583	missense	9146	.			GGCTGAGGACATC	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		Exception_encountered	17.37:g.79661868_79661869delinsTC	ENSP00000331201:p.E320_D321delinsDH	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	27.0	.	Q9NR36	Missense_Mutation	DNP	ENST00000329138.4	37	CCDS11784.1																																																																																			.		0.609	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	
