#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48278858	48278858	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:48278858G>T	ENST00000435803.1	+	9	942	c.918G>T	c.(916-918)ttG>ttT	p.L306F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	306					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ACACTTCCTTGGAGAAGATGG	0.433																																					p.L306F		.											.	ABCA13	521	0			c.G918T						.						72.0	71.0	72.0					7																	48278858		1940	4140	6080	SO:0001583	missense	154664	exon9			TTCCTTGGAGAAG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.918G>T	7.37:g.48278858G>T	ENSP00000411096:p.Leu306Phe	Somatic	60.0	1.0		WXS	Illumina HiSeq	Phase_I	56.0	19.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.258592	0.23051	.	.	ENSG00000179869	ENST00000435803	D	0.92048	-2.96	4.87	-2.98	0.05513	.	0.561211	0.12857	N	0.433422	D	0.86715	0.5999	L	0.29908	0.895	0.27736	N	0.944653	D	0.54964	0.969	P	0.49276	0.605	T	0.80132	-0.1510	10	0.87932	D	0	.	5.9622	0.19305	0.5597:0.1417:0.2986:0.0	.	306	Q86UQ4	ABCAD_HUMAN	F	306	ENSP00000411096:L306F	ENSP00000411096:L306F	L	+	3	2	ABCA13	48249404	0.349000	0.24870	0.005000	0.12908	0.012000	0.07955	-0.471000	0.06631	-0.777000	0.04572	-0.140000	0.14226	TTG	.		0.433	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ADAMTSL4	54507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150531864	150531864	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:150531864C>G	ENST00000369038.2	+	15	3066	c.2865C>G	c.(2863-2865)caC>caG	p.H955Q	ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.H955Q|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.H978Q			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	955	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			ACTGTTCTCACCTCCCCAGGC	0.612											OREG0013787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H955Q		.											.	ADAMTSL4	92	0			c.C2865G						.						101.0	78.0	86.0					1																	150531864		2203	4300	6503	SO:0001583	missense	54507	exon17			TTCTCACCTCCCC	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2865C>G	1.37:g.150531864C>G	ENSP00000358034:p.His955Gln	Somatic	75.0	0.0	1733	WXS	Illumina HiSeq	Phase_I	97.0	18.0	NM_019032	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520478	0.64747	.	.	ENSG00000143382	ENST00000271643;ENST00000369039;ENST00000369038	T;T;T	0.60424	0.19;0.19;0.19	5.52	4.41	0.53225	.	.	.	.	.	T	0.49098	0.1537	N	0.26130	0.795	0.41225	D	0.986533	D;D;D	0.89917	1.0;0.961;1.0	D;P;D	0.91635	0.999;0.835;0.998	T	0.44574	-0.9319	9	0.29301	T	0.29	.	8.4415	0.32818	0.0:0.8175:0.0:0.1825	.	916;978;955	B7ZMJ3;F8WAD0;Q6UY14	.;.;ATL4_HUMAN	Q	955;978;955	ENSP00000271643:H955Q;ENSP00000358035:H978Q;ENSP00000358034:H955Q	ENSP00000271643:H955Q	H	+	3	2	ADAMTSL4	148798488	0.009000	0.17119	1.000000	0.80357	0.858000	0.48976	0.111000	0.15458	2.584000	0.87258	0.462000	0.41574	CAC	.		0.612	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032	
AICDA	57379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8759514	8759514	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:8759514T>A	ENST00000229335.6	-	2	206	c.103A>T	c.(103-105)Agg>Tgg	p.R35W	AICDA_ENST00000537228.1_Missense_Mutation_p.R35W	NM_020661.2	NP_065712.1	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	35					B cell differentiation (GO:0030183)|cellular response to lipopolysaccharide (GO:0071222)|DNA demethylation (GO:0080111)|isotype switching (GO:0045190)|mRNA processing (GO:0006397)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|somatic diversification of immunoglobulins (GO:0016445)|somatic hypermutation of immunoglobulin genes (GO:0016446)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)	16	Lung SC(5;0.184)					CTGTCACGCCTCTTCACTACG	0.463																																					p.R35W	GBM(62;896 1067 5527 26594 30137)	.											.	AICDA	229	0			c.A103T						.						90.0	86.0	88.0					12																	8759514		1971	4148	6119	SO:0001583	missense	57379	exon2			CACGCCTCTTCAC	AB040430	CCDS41747.1	12p13	2014-09-17			ENSG00000111732	ENSG00000111732		"""Apolipoprotein B mRNA editing enzymes"""	13203	protein-coding gene	gene with protein product		605257					Standard	NM_020661		Approved	HIGM2, CDA2, ARP2, AID	uc001qur.2	Q9GZX7	OTTHUMG00000168676	ENST00000229335.6:c.103A>T	12.37:g.8759514T>A	ENSP00000229335:p.Arg35Trp	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	14.0	NM_020661	Q6QJ81|Q8NFC1	Missense_Mutation	SNP	ENST00000229335.6	37	CCDS41747.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.48|19.48	3.834909|3.834909	0.71373|0.71373	.|.	.|.	ENSG00000111732|ENSG00000111732	ENST00000543081;ENST00000544516;ENST00000545512|ENST00000229335;ENST00000537228	.|D;D	.|0.85088	.|-1.94;-1.94	5.36|5.36	2.31|2.31	0.28768|0.28768	.|APOBEC-like, N-terminal (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.86560|0.86560	0.5962|0.5962	L|L	0.41236|0.41236	1.265|1.265	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D	.|0.64830	.|0.99;0.994;0.99	.|P;P;P	.|0.60345	.|0.873;0.873;0.873	D|D	0.85691|0.85691	0.1307|0.1307	6|10	.|0.72032	.|D	.|0.01	-21.6095|-21.6095	13.1484|13.1484	0.59477|0.59477	0.0:0.0:0.5278:0.4722|0.0:0.0:0.5278:0.4722	.|.	.|35;35;35	.|Q9GZX7;Q6QJ80;Q6QJ81	.|AICDA_HUMAN;.;.	S|W	33|35	.|ENSP00000229335:R35W;ENSP00000445691:R35W	.|ENSP00000229335:R35W	R|R	-|-	3|1	2|2	AICDA|AICDA	8650781|8650781	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.943000|0.943000	0.58893|0.58893	2.452000|2.452000	0.44961|0.44961	0.151000|0.151000	0.19162|0.19162	0.383000|0.383000	0.25322|0.25322	AGA|AGG	.		0.463	AICDA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400575.1	NM_020661	
ALK	238	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	30143210	30143210	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:30143210G>A	ENST00000389048.3	-	1	1222	c.316C>T	c.(316-318)Ccg>Tcg	p.P106S	ALK_ENST00000431873.1_Missense_Mutation_p.P106S	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	106					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GAGACCCCCGGCGCCGGCCCC	0.741			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.P106S		.	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	.	ALK	3833	0			c.C316T						.						4.0	5.0	5.0					2																	30143210		1897	3803	5700	SO:0001583	missense	238	exon1	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CCCCCGGCGCCGG	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.316C>T	2.37:g.30143210G>A	ENSP00000373700:p.Pro106Ser	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	5.0	NM_004304	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	ENST00000389048.3	37	CCDS33172.1	.	.	.	.	.	.	.	.	.	.	G	8.579	0.881786	0.17467	.	.	ENSG00000171094	ENST00000389048;ENST00000431873	T;T	0.78246	-1.16;2.83	5.21	0.0414	0.14213	.	.	.	.	.	T	0.57636	0.2067	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37174	-0.9717	8	.	.	.	.	5.4157	0.16372	0.242:0.275:0.483:0.0	.	106	Q9UM73	ALK_HUMAN	S	106	ENSP00000373700:P106S;ENSP00000414027:P106S	.	P	-	1	0	ALK	29996714	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.365000	0.20348	0.015000	0.14971	0.561000	0.74099	CCG	.		0.741	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324994.1	NM_004304	
ALPPL2	251	hgsc.bcm.edu;broad.mit.edu	37	2	233274441	233274441	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:233274441delC	ENST00000295453.3	+	11	1510	c.1458delC	c.(1456-1458)tgcfs	p.C486fs		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	486					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	TCGCCGCCTGCCTGGAGCCCT	0.746																																					p.C486fs		.											.	ALPPL2	91	0			c.1458delC						.						12.0	16.0	15.0					2																	233274441		2186	4256	6442	SO:0001589	frameshift_variant	251	exon11			CGCCTGCCTGGAG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1458delC	2.37:g.233274441delC	ENSP00000295453:p.Cys486fs	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	15.0	NM_031313	A8KAF2|Q16727|Q53S81|Q96CM1	Frame_Shift_Del	DEL	ENST00000295453.3	37	CCDS2491.1																																																																																			.		0.746	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
AMPH	273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	38670937	38670937	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:38670937C>A	ENST00000356264.2	-	1	230	c.15G>T	c.(13-15)aaG>aaT	p.K5N	AMPH_ENST00000428293.2_Missense_Mutation_p.K5N|AMPH_ENST00000325590.5_Missense_Mutation_p.K5N	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	5					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						AGATGCCCGTCTTGATGTCGG	0.741																																					p.K5N		.											.	AMPH	95	0			c.G15T						.						13.0	10.0	11.0					7																	38670937		2169	4254	6423	SO:0001583	missense	273	exon1			GCCCGTCTTGATG		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.15G>T	7.37:g.38670937C>A	ENSP00000348602:p.Lys5Asn	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	17.0	NM_139316	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.603794	0.66445	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000544070	T;T;T	0.62498	0.05;0.02;0.04	4.35	3.46	0.39613	.	0.000000	0.64402	D	0.000001	T	0.50701	0.1631	L	0.29908	0.895	0.48288	D	0.999625	P;D	0.53619	0.873;0.961	P;P	0.47206	0.466;0.541	T	0.44559	-0.9320	10	0.39692	T	0.17	-16.3014	7.0348	0.24987	0.1734:0.737:0.0:0.0896	.	5;5	P49418-2;P49418	.;AMPH_HUMAN	N	5	ENSP00000317441:K5N;ENSP00000348602:K5N;ENSP00000390734:K5N	ENSP00000317441:K5N	K	-	3	2	AMPH	38637462	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.497000	0.35649	0.786000	0.33708	0.467000	0.42956	AAG	.		0.741	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
AMZ2	51321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	66246521	66246521	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:66246521G>T	ENST00000359904.3	+	2	1325	c.193G>T	c.(193-195)Gag>Tag	p.E65*	AMZ2_ENST00000577273.1_Nonsense_Mutation_p.E65*|AMZ2_ENST00000359783.4_Nonsense_Mutation_p.E65*|AMZ2_ENST00000585050.1_3'UTR|AMZ2_ENST00000577985.1_Nonsense_Mutation_p.E65*|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000580753.1_Nonsense_Mutation_p.E65*|AMZ2_ENST00000392720.2_Nonsense_Mutation_p.E65*|AMZ2_ENST00000577866.1_Nonsense_Mutation_p.E65*	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	65							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTCCCACCCTGAGGCTCCCCA	0.458																																					p.E65X		.											.	AMZ2	22	0			c.G193T						.						115.0	113.0	114.0					17																	66246521		2203	4300	6503	SO:0001587	stop_gained	51321	exon2			CACCCTGAGGCTC	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.193G>T	17.37:g.66246521G>T	ENSP00000352976:p.Glu65*	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	19.0	NM_001033574	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Nonsense_Mutation	SNP	ENST00000359904.3	37	CCDS11674.1	.	.	.	.	.	.	.	.	.	.	G	32	5.111274	0.94339	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	.	.	.	3.58	1.54	0.23209	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-16.8236	7.6032	0.28087	0.2284:0.0:0.7716:0.0	.	.	.	.	X	65	.	ENSP00000352831:E65X	E	+	1	0	AMZ2	63758116	1.000000	0.71417	0.928000	0.36995	0.936000	0.57629	6.075000	0.71261	0.832000	0.34804	0.306000	0.20318	GAG	.		0.458	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448261.1	NM_016627	
APCDD1	147495	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	10488026	10488026	+	Silent	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr18:10488026C>A	ENST00000355285.5	+	5	1890	c.1536C>A	c.(1534-1536)atC>atA	p.I512I		NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		ATTGGAACATCCGCAGATAGA	0.473																																					p.I512I		.											.	APCDD1	90	0			c.C1536A						.						34.0	41.0	39.0					18																	10488026		2202	4299	6501	SO:0001819	synonymous_variant	147495	exon5			GAACATCCGCAGA	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1536C>A	18.37:g.10488026C>A		Somatic	34.0	1.0		WXS	Illumina HiSeq	Phase_I	33.0	14.0	NM_153000		Silent	SNP	ENST00000355285.5	37	CCDS11849.1																																																																																			.		0.473	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
APCS	325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159558103	159558103	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:159558103T>C	ENST00000255040.2	+	2	374	c.277T>C	c.(277-279)Tac>Cac	p.Y93H		NM_001639.3	NP_001630.1	P02743	SAMP_HUMAN	amyloid P component, serum	93	Pentaxin.				acute-phase response (GO:0006953)|chaperone-mediated protein complex assembly (GO:0051131)|innate immune response (GO:0045087)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral process (GO:0048525)|negative regulation of wound healing (GO:0061045)|protein folding (GO:0006457)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|unfolded protein binding (GO:0051082)|virion binding (GO:0046790)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(2)	20	all_hematologic(112;0.0429)					GTATAGTCTATACATTGGAAG	0.433																																					p.Y93H		.											.	APCS	154	0			c.T277C						.						93.0	93.0	93.0					1																	159558103		2203	4300	6503	SO:0001583	missense	325	exon2			AGTCTATACATTG		CCDS1186.1	1q21-q23	2012-10-02			ENSG00000132703	ENSG00000132703			584	protein-coding gene	gene with protein product	"""pentaxin-related"", ""9.5S alpha-1-glycoprotein"""	104770				2987268	Standard	NM_001639		Approved	SAP, PTX2, MGC88159	uc001ftv.3	P02743	OTTHUMG00000022741	ENST00000255040.2:c.277T>C	1.37:g.159558103T>C	ENSP00000255040:p.Tyr93His	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	18.0	NM_001639		Missense_Mutation	SNP	ENST00000255040.2	37	CCDS1186.1	.	.	.	.	.	.	.	.	.	.	T	5.452	0.268503	0.10349	.	.	ENSG00000132703	ENST00000255040	T	0.07216	3.21	4.25	-0.876	0.10624	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.475016	0.24048	N	0.042031	T	0.01627	0.0052	L	0.38733	1.17	0.09310	N	0.999993	B	0.14012	0.009	B	0.24848	0.056	T	0.46162	-0.9211	10	0.25106	T	0.35	-3.283	4.0745	0.09897	0.1461:0.2556:0.0:0.5983	.	93	P02743	SAMP_HUMAN	H	93	ENSP00000255040:Y93H	ENSP00000255040:Y93H	Y	+	1	0	APCS	157824727	0.000000	0.05858	0.003000	0.11579	0.012000	0.07955	-0.050000	0.11904	-0.270000	0.09285	-0.301000	0.09380	TAC	.		0.433	APCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059024.2	NM_001639	
ARHGAP39	80728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145780976	145780976	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr8:145780976A>T	ENST00000276826.5	-	3	765	c.564T>A	c.(562-564)gaT>gaA	p.D188E	ARHGAP39_ENST00000540274.1_Missense_Mutation_p.D188E|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.D188E			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	188					axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CCGCACTGTAATCCCGGTAAA	0.478																																					p.D188E		.											.	ARHGAP39	90	0			c.T564A						.						147.0	126.0	133.0					8																	145780976		2203	4300	6503	SO:0001583	missense	80728	exon5			ACTGTAATCCCGG		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.564T>A	8.37:g.145780976A>T	ENSP00000276826:p.Asp188Glu	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	25.0	NM_025251	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	37		.	.	.	.	.	.	.	.	.	.	A	12.87	2.068451	0.36470	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.21932	1.98;1.98;1.98	4.74	-0.936	0.10419	.	0.223982	0.37053	N	0.002273	T	0.11922	0.0290	L	0.47716	1.5	0.24093	N	0.995906	B;P	0.36837	0.435;0.571	B;B	0.31101	0.057;0.124	T	0.18241	-1.0343	10	0.28530	T	0.3	-6.549	4.3736	0.11260	0.4575:0.1789:0.3636:0.0	.	188;188	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	E	188	ENSP00000276826:D188E;ENSP00000366522:D188E;ENSP00000445075:D188E	ENSP00000276826:D188E	D	-	3	2	ARHGAP39	145751784	1.000000	0.71417	0.515000	0.27774	0.916000	0.54674	1.341000	0.33907	-0.293000	0.08986	0.533000	0.62120	GAT	.		0.478	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
ARSI	340075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149677632	149677632	+	Silent	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr5:149677632A>G	ENST00000328668.7	-	2	1434	c.855T>C	c.(853-855)ggT>ggC	p.G285G		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	285					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTTGTAGAAACCGTAGCGCT	0.592																																					p.G285G		.											.	ARSI	92	0			c.T855C						.						38.0	32.0	34.0					5																	149677632		2203	4300	6503	SO:0001819	synonymous_variant	340075	exon2			GTAGAAACCGTAG	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.855T>C	5.37:g.149677632A>G		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	27.0	NM_001012301	A1L3B0|B3KV22|B7XD03	Silent	SNP	ENST00000328668.7	37	CCDS34275.1																																																																																			.		0.592	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
ASPSCR1	79058	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	79974909	79974909	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:79974909T>A	ENST00000306739.4	+	15	1665	c.1568T>A	c.(1567-1569)gTc>gAc	p.V523D	ASPSCR1_ENST00000580534.1_Missense_Mutation_p.V471D|ASPSCR1_ENST00000306729.7_Missense_Mutation_p.V617D|ASPSCR1_ENST00000582404.1_3'UTR|STRA13_ENST00000583767.1_5'Flank	NM_024083.3	NP_076988.1	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region, candidate 1	523					glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|regulation of glucose import (GO:0046324)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)			ASPSCR1/TFE3(167)	breast(2)|large_intestine(2)	4	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GGGGCGCTGGTCCCCCCTGAG	0.692			T	TFE3	alveolar soft part sarcoma																																p.V617D		.		Dom	yes		17	17q25	79058	"""alveolar soft part sarcoma chromosome region, candidate 1"""		M	.	ASPSCR1	877	0			c.T1850A						.						21.0	25.0	24.0					17																	79974909		2199	4293	6492	SO:0001583	missense	79058	exon16			CGCTGGTCCCCCC	AF324219	CCDS11796.1, CCDS58611.1	17q25	2011-06-28				ENSG00000169696		"""UBX domain containing"""	13825	protein-coding gene	gene with protein product	"""UBX domain protein 9"""	606236				11244503, 10506710	Standard	NM_024083		Approved	ASPS, ASPL, UBXD9, UBXN9	uc002kcy.3	Q9BZE9		ENST00000306739.4:c.1568T>A	17.37:g.79974909T>A	ENSP00000302176:p.Val523Asp	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	14.0	NM_001251888	A8K3K9|Q7Z6N7|Q8WV59|Q96LS5|Q96M40	Missense_Mutation	SNP	ENST00000306739.4	37	CCDS11796.1	.	.	.	.	.	.	.	.	.	.	T	8.209	0.799968	0.16397	.	.	ENSG00000169696	ENST00000306739;ENST00000306729	T;T	0.21543	2.02;2.0	3.78	-2.34	0.06704	.	0.441437	0.19705	N	0.107954	T	0.06280	0.0162	N	0.08118	0	0.09310	N	1	B;P;B	0.39535	0.012;0.677;0.093	B;B;B	0.36719	0.012;0.231;0.06	T	0.25257	-1.0137	9	.	.	.	-2.1265	0.6568	0.00835	0.2611:0.1285:0.3451:0.2654	.	471;617;523	Q9BZE9-3;Q9BZE9-2;Q9BZE9	.;.;ASPC1_HUMAN	D	523;617	ENSP00000302176:V523D;ENSP00000306625:V617D	.	V	+	2	0	ASPSCR1	77568198	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.074000	0.11450	-0.312000	0.08741	-0.408000	0.06270	GTC	.		0.692	ASPSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441972.1	NM_024083	
ATP8A1	10396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	42583637	42583637	+	Splice_Site	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:42583637C>A	ENST00000381668.5	-	10	1066		c.e10+1		ATP8A1_ENST00000264449.10_Splice_Site	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1						cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	AAAAATTTCACCTGCATCAGC	0.438																																					.		.											.	ATP8A1	92	0			c.834+1G>T						.						121.0	110.0	114.0					4																	42583637		2203	4300	6503	SO:0001630	splice_region_variant	10396	exon11			ATTTCACCTGCAT	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.834+1G>T	4.37:g.42583637C>A		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	30.0	NM_001105529	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Splice_Site	SNP	ENST00000381668.5	37	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581908	0.86748	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3151	0.98650	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP8A1	42278394	1.000000	0.71417	0.995000	0.50966	0.909000	0.53808	7.818000	0.86416	2.809000	0.96659	0.467000	0.42956	.	.		0.438	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	Intron
BBS12	166379	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	123664403	123664404	+	Frame_Shift_Ins	INS	-	-	CAGG			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:123664403_123664404insCAGG	ENST00000314218.3	+	2	1549_1550	c.1356_1357insCAGG	c.(1357-1359)cagfs	p.-453fs	BBS12_ENST00000542236.1_Frame_Shift_Ins_p.-453fs	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12						cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						CAGGAGCAGTACAGGTGGCCTA	0.485									Bardet-Biedl syndrome																												p.V452fs		.											.	BBS12	92	0			c.1356_1357insCAGG						.																																			SO:0001589	frameshift_variant	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AGCAGTACAGGTG	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1357_1360dupCAGG	4.37:g.123664404_123664407dupCAGG	ENSP00000319062:p.Gln453fs	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	25.0	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Frame_Shift_Ins	INS	ENST00000314218.3	37	CCDS3728.1																																																																																			.		0.485	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
BIN2	51411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51693401	51693401	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:51693401T>A	ENST00000267012.4	-	6	567	c.506A>T	c.(505-507)aAg>aTg	p.K169M	BIN2_ENST00000544402.1_Missense_Mutation_p.K143M|BIN2_ENST00000604560.1_Missense_Mutation_p.K142M|BIN2_ENST00000452142.2_Missense_Mutation_p.K137M	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	169	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						CTTGGCAGTCTTGGCCTCATC	0.517																																					p.K169M		.											.	BIN2	91	0			c.A506T						.						144.0	146.0	146.0					12																	51693401		2203	4300	6503	SO:0001583	missense	51411	exon6			GCAGTCTTGGCCT	AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.506A>T	12.37:g.51693401T>A	ENSP00000267012:p.Lys169Met	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	13.0	NM_016293	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	ENST00000267012.4	37	CCDS8811.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.238883	0.79800	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	T;T;T	0.65916	-0.18;-0.18;-0.18	4.87	4.87	0.63330	BAR (3);	0.000000	0.85682	D	0.000000	T	0.80105	0.4562	M	0.85859	2.78	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.996;0.994	D	0.83437	0.0041	10	0.87932	D	0	-16.4707	12.761	0.57363	0.0:0.0:0.0:1.0	.	143;137;169	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	M	137;169;143	ENSP00000410217:K137M;ENSP00000267012:K169M;ENSP00000445874:K143M	ENSP00000267012:K169M	K	-	2	0	BIN2	49979668	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.431000	0.59915	2.180000	0.69256	0.533000	0.62120	AAG	.		0.517	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000469800.1		
BMPER	168667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34192707	34192707	+	Missense_Mutation	SNP	C	C	T	rs143727756		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:34192707C>T	ENST00000297161.2	+	16	2254	c.1880C>T	c.(1879-1881)aCc>aTc	p.T627I	BMPER_ENST00000426693.1_Missense_Mutation_p.T627I	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	627					blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TTTTCAGCCACCCAGTGTAAG	0.493																																					p.T627I		.											.	BMPER	92	0			c.C1880T						.	C	ILE/THR	0,4406		0,0,2203	190.0	176.0	181.0		1880	6.0	1.0	7	dbSNP_134	181	1,8599	1.2+/-3.3	0,1,4299	no	missense	BMPER	NM_133468.3	89	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	627/686	34192707	1,13005	2203	4300	6503	SO:0001583	missense	168667	exon16			CAGCCACCCAGTG		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1880C>T	7.37:g.34192707C>T	ENSP00000297161:p.Thr627Ile	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	37.0	NM_133468	A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045654	0.36085	0.0	1.16E-4	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.78816	-1.21;-1.21	6.04	6.04	0.98038	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (1);	0.091322	0.85682	D	0.000000	T	0.67951	0.2948	L	0.35723	1.085	0.53688	D	0.999973	B	0.23442	0.085	B	0.17979	0.02	T	0.61461	-0.7058	10	0.22109	T	0.4	.	13.7479	0.62887	0.0:0.9302:0.0:0.0698	.	627	Q8N8U9	BMPER_HUMAN	I	627	ENSP00000297161:T627I;ENSP00000393950:T627I	ENSP00000297161:T627I	T	+	2	0	BMPER	34159232	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.699000	0.61796	2.873000	0.98535	0.563000	0.77884	ACC	C|1.000;T|0.000		0.493	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
CA10	56934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	50235089	50235089	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:50235089A>G	ENST00000285273.4	-	2	1169	c.58T>C	c.(58-60)Tca>Cca	p.S20P	CA10_ENST00000340813.6_5'UTR|CA10_ENST00000451037.2_Missense_Mutation_p.S20P|CA10_ENST00000442502.2_Missense_Mutation_p.S20P|CA10_ENST00000570565.1_Intron	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	20					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	CCCGTACCTGATATGCAGACG	0.488																																					p.S20P		.											.	CA10	516	0			c.T58C						.						133.0	124.0	127.0					17																	50235089		2203	4300	6503	SO:0001583	missense	56934	exon2			TACCTGATATGCA	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.58T>C	17.37:g.50235089A>G	ENSP00000285273:p.Ser20Pro	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	32.0	NM_001082534	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.193883	0.38707	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037	T;T;T	0.26660	1.72;1.72;1.72	5.32	5.32	0.75619	.	.	.	.	.	T	0.25306	0.0615	N	0.14661	0.345	0.80722	D	1	P	0.45531	0.86	P	0.52217	0.693	T	0.04454	-1.0950	8	.	.	.	.	14.6182	0.68565	1.0:0.0:0.0:0.0	.	20	Q9NS85	CAH10_HUMAN	P	20	ENSP00000390666:S20P;ENSP00000285273:S20P;ENSP00000405388:S20P	.	S	-	1	0	CA10	47590088	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.553000	0.73918	2.233000	0.73108	0.533000	0.62120	TCA	.		0.488	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
CAMK2B	816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	44281927	44281927	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:44281927C>A	ENST00000395749.2	-	10	785	c.709G>T	c.(709-711)Gag>Tag	p.E237*	CAMK2B_ENST00000346990.4_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000502837.2_Nonsense_Mutation_p.E108*|CAMK2B_ENST00000395747.2_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000353625.4_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000440254.2_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000350811.3_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000258682.6_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000457475.1_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000347193.4_Nonsense_Mutation_p.E237*|CAMK2B_ENST00000358707.3_Nonsense_Mutation_p.E237*	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						GTGTCCCACTCAGGGGACGGG	0.607																																					p.E237X		.											.	CAMK2B	334	0			c.G709T						.						129.0	125.0	126.0					7																	44281927		2203	4300	6503	SO:0001587	stop_gained	816	exon10			CCCACTCAGGGGA	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.709G>T	7.37:g.44281927C>A	ENSP00000379098:p.Glu237*	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	28.0	NM_172081	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Nonsense_Mutation	SNP	ENST00000395749.2	37	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	C	36	5.863704	0.97043	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000502837;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.7614	0.85513	0.0:1.0:0.0:0.0	.	.	.	.	X	237;237;237;108;237;237;237;237;237;237;237	.	ENSP00000258682:E237X	E	-	1	0	CAMK2B	44248452	1.000000	0.71417	0.968000	0.41197	0.447000	0.32167	5.775000	0.68915	2.277000	0.76020	0.563000	0.77884	GAG	.		0.607	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084	
CCDC168	643677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103383301	103383301	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr13:103383301C>G	ENST00000322527.2	-	1	5858	c.5859G>C	c.(5857-5859)aaG>aaC	p.K1953N		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1953																	ATAAGGGTTTCTTTCTCTCAT	0.373																																					p.K6582N		.											.	.	.	0			c.G19746C						.						75.0	63.0	67.0					13																	103383301		692	1590	2282	SO:0001583	missense	643677	exon4			GGGTTTCTTTCTC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.5859G>C	13.37:g.103383301C>G	ENSP00000320232:p.Lys1953Asn	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	48.0	NM_001146197	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	37		.	.	.	.	.	.	.	.	.	.	C	4.477	0.088346	0.08583	.	.	ENSG00000175820	ENST00000322527	T	0.04083	3.71	5.39	0.457	0.16661	.	.	.	.	.	T	0.03263	0.0095	N	0.14661	0.345	0.09310	N	1	P	0.50528	0.936	P	0.45167	0.472	T	0.42189	-0.9466	9	0.40728	T	0.16	.	3.4674	0.07554	0.3547:0.3917:0.0:0.2535	.	1953	Q8NDH2	CC168_HUMAN	N	1953	ENSP00000320232:K1953N	ENSP00000320232:K1953N	K	-	3	2	CCDC168	102181302	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.301000	0.08232	0.120000	0.18254	-0.314000	0.08810	AAG	.		0.373	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
CDK13	8621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	40027408	40027408	+	Silent	SNP	A	A	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:40027408A>C	ENST00000181839.4	+	2	2027	c.1422A>C	c.(1420-1422)gcA>gcC	p.A474A	CDK13_ENST00000340829.5_Silent_p.A474A	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	474					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						cgaaagctgcagaagcaacTA	0.512																																					p.A474A		.											.	CDK13	548	0			c.A1422C						.						36.0	37.0	37.0					7																	40027408		2203	4300	6503	SO:0001819	synonymous_variant	8621	exon2			AGCTGCAGAAGCA	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.1422A>C	7.37:g.40027408A>C		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	40.0	NM_003718	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	ENST00000181839.4	37	CCDS5461.1																																																																																			.		0.512	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
CDRT1	374286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	15508540	15508541	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:15508540_15508541delAT	ENST00000395906.3	-	7	1428_1429	c.1429_1430delAT	c.(1429-1431)atcfs	p.I477fs	RP11-385D13.1_ENST00000455584.2_Frame_Shift_Del_p.I787fs	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	477										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		TCCTCACCTGATACTTAGGTCA	0.51																																					p.477_477del		.											.	CDRT1	68	0			c.1429_1430del						.																																			SO:0001589	frameshift_variant	374286	exon7			CACCTGATACTTA	U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1429_1430delAT	17.37:g.15508540_15508541delAT	ENSP00000379242:p.Ile477fs	Somatic	380.0	0.0		WXS	Illumina HiSeq	Phase_I	348.0	0.0	NM_006382	O43848|O95611	Frame_Shift_Del	DEL	ENST00000395906.3	37	CCDS45619.1																																																																																			.		0.510	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448127.1	NM_006382	
CLEC3B	7123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45077186	45077186	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:45077186A>T	ENST00000296130.4	+	3	559	c.379A>T	c.(379-381)Aac>Tac	p.N127Y	RNU5B-3P_ENST00000516601.1_RNA|CLEC3B_ENST00000428034.1_Missense_Mutation_p.N85Y|CLEC3B_ENST00000490386.1_3'UTR	NM_003278.2	NP_003269.2	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	127	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				bone mineralization (GO:0030282)|cellular response to organic substance (GO:0071310)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ossification (GO:0001503)|positive regulation of plasminogen activation (GO:0010756)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)|kringle domain binding (GO:0036143)			endometrium(1)|lung(3)	4				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Tenecteplase(DB00031)	GAGCGTGGGCAACGAGGCCGA	0.677																																					p.N127Y	GBM(139;1487 3263 30871)	.											.	CLEC3B	90	0			c.A379T						.						45.0	44.0	44.0					3																	45077186		2203	4300	6503	SO:0001583	missense	7123	exon3			GTGGGCAACGAGG		CCDS2726.1	3p22-p21.3	2010-04-27	2005-02-09	2005-02-09	ENSG00000163815	ENSG00000163815		"""C-type lectin domain containing"""	11891	protein-coding gene	gene with protein product		187520	"""tetranectin (plasminogen binding protein)"""	TNA			Standard	NM_003278		Approved	TN	uc003cok.4	P05452	OTTHUMG00000133087	ENST00000296130.4:c.379A>T	3.37:g.45077186A>T	ENSP00000296130:p.Asn127Tyr	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	19.0	NM_003278	Q6FGX6	Missense_Mutation	SNP	ENST00000296130.4	37	CCDS2726.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.780926	0.49891	.	.	ENSG00000163815	ENST00000296130;ENST00000428034	T;T	0.19394	2.15;2.15	4.53	-3.85	0.04243	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.573510	0.03288	N	0.187173	T	0.18341	0.0440	L	0.38531	1.155	0.09310	N	0.999998	P	0.42039	0.769	B	0.43754	0.43	T	0.25398	-1.0133	10	0.48119	T	0.1	-0.2591	4.4848	0.11785	0.6316:0.0915:0.1079:0.169	.	127	P05452	TETN_HUMAN	Y	127;85	ENSP00000296130:N127Y;ENSP00000396013:N85Y	ENSP00000296130:N127Y	N	+	1	0	CLEC3B	45052190	0.000000	0.05858	0.091000	0.20842	0.835000	0.47333	-1.159000	0.03150	-0.568000	0.06038	-0.366000	0.07423	AAC	.		0.677	CLEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256745.1	NM_003278	
CNTFR	1271	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	34552230	34552230	+	Silent	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr9:34552230G>T	ENST00000378980.3	-	9	1340	c.1047C>A	c.(1045-1047)ccC>ccA	p.P349P	CNTFR_ENST00000351266.4_Silent_p.P349P	NM_001207011.1|NM_147164.2	NP_001193940.1|NP_671693.1	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	349					brainstem development (GO:0003360)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|skeletal muscle organ development (GO:0060538)|suckling behavior (GO:0001967)	anchored component of membrane (GO:0031225)|CNTFR-CLCF1 complex (GO:0097059)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|cytokine binding (GO:0019955)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(4)|skin(1)	15	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		TGACCAAGAAGGGTGCCGAGG	0.667																																					p.P349P		.											.	CNTFR	518	0			c.C1047A						.						18.0	22.0	20.0					9																	34552230		2169	4260	6429	SO:0001819	synonymous_variant	1271	exon9			CAAGAAGGGTGCC	M73238	CCDS6558.1	9p13	2013-02-11			ENSG00000122756	ENSG00000122756		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2170	protein-coding gene	gene with protein product		118946				1648265	Standard	NM_001842		Approved		uc003zuq.2	P26992	OTTHUMG00000019821	ENST00000378980.3:c.1047C>A	9.37:g.34552230G>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	10.0	NM_147164	Q5U050	Silent	SNP	ENST00000378980.3	37	CCDS6558.1																																																																																			.		0.667	CNTFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052176.1		
COL11A1	1301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	103428289	103428289	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:103428289C>T	ENST00000370096.3	-	39	3256	c.2944G>A	c.(2944-2946)Ggg>Agg	p.G982R	COL11A1_ENST00000358392.2_Missense_Mutation_p.G994R|COL11A1_ENST00000512756.1_Missense_Mutation_p.G866R|COL11A1_ENST00000353414.4_Missense_Mutation_p.G943R	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	982	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCACGTTCCCCTATTGGACCA	0.458																																					p.G994R		.											.	COL11A1	586	0			c.G2980A						.						90.0	88.0	88.0					1																	103428289		2203	4300	6503	SO:0001583	missense	1301	exon39			GTTCCCCTATTGG	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2944G>A	1.37:g.103428289C>T	ENSP00000359114:p.Gly982Arg	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	57.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336260	0.81801	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.99429	-5.89;-5.89;-5.89;-5.89	5.67	5.67	0.87782	.	0.056693	0.64402	D	0.000001	D	0.99834	0.9925	H	0.98883	4.36	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;1.0;1.0;0.999;0.999	D	0.96751	0.9554	10	0.87932	D	0	.	19.7741	0.96385	0.0:1.0:0.0:0.0	.	866;943;994;982;202	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	R	982;994;943;202;866	ENSP00000359114:G982R;ENSP00000351163:G994R;ENSP00000302551:G943R;ENSP00000426533:G866R	ENSP00000302551:G943R	G	-	1	0	COL11A1	103200877	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.719000	0.84751	2.673000	0.90976	0.557000	0.71058	GGG	.		0.458	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
CPVL	54504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	29160618	29160618	+	Silent	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:29160618A>G	ENST00000409850.1	-	6	706	c.60T>C	c.(58-60)tgT>tgC	p.C20C	CPVL_ENST00000265394.5_Silent_p.C20C|CPVL_ENST00000488891.2_5'UTR|CPVL_ENST00000396276.3_Silent_p.C20C			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	20						extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						ACAGCCCATCACAGGGGCCAG	0.483																																					p.C20C		.											.	CPVL	92	0			c.T60C						.						90.0	83.0	86.0					7																	29160618		2203	4300	6503	SO:0001819	synonymous_variant	54504	exon2			CCCATCACAGGGG	AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.60T>C	7.37:g.29160618A>G		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	34.0	NM_019029	A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Silent	SNP	ENST00000409850.1	37	CCDS5419.1																																																																																			.		0.483	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328305.1	NM_019029	
CRHR1	1394	hgsc.bcm.edu;broad.mit.edu	37	17	43911988	43911988	+	Splice_Site	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:43911988A>T	ENST00000398285.3	+	14	1194		c.e14-1		CRHR1_ENST00000352855.5_Splice_Site|CRHR1_ENST00000577353.1_Splice_Site|CRHR1_ENST00000339069.5_Splice_Site|CRHR1_ENST00000293493.7_Splice_Site|CRHR1_ENST00000314537.5_Splice_Site	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		CTGTGCCCACAGGTCCGTTCT	0.677																																					.	Ovarian(110;57 1568 10207 38216 49865)	.											.	CRHR1	522	0			c.583-2A>T						.						42.0	50.0	47.0					17																	43911988		2172	4259	6431	SO:0001630	splice_region_variant	1394	exon15			GCCCACAGGTCCG	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.1195-1A>T	17.37:g.43911988A>T		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	4.0	NM_001256299	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Splice_Site	SNP	ENST00000398285.3	37	CCDS45712.1	.	.	.	.	.	.	.	.	.	.	A	19.84	3.901957	0.72754	.	.	ENSG00000120088	ENST00000293493;ENST00000339069;ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855;ENST00000535778	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1022	0.59226	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CRHR1	41267769	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	9.314000	0.96306	1.985000	0.57927	0.454000	0.30748	.	.		0.677	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		Intron
CSRNP3	80034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	166533005	166533005	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:166533005G>A	ENST00000342316.4	+	4	864	c.592G>A	c.(592-594)Gaa>Aaa	p.E198K	CSRNP3_ENST00000409420.1_Missense_Mutation_p.E230K|CSRNP3_ENST00000314499.7_Missense_Mutation_p.E198K	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	198					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						TGACGTGGAAGAAAAGCACGA	0.527																																					p.E198K		.											.	CSRNP3	157	0			c.G592A						.						111.0	112.0	112.0					2																	166533005		2203	4300	6503	SO:0001583	missense	80034	exon6			GTGGAAGAAAAGC	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.592G>A	2.37:g.166533005G>A	ENSP00000344042:p.Glu198Lys	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	29.0	NM_001172173	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	37	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012413	0.93346	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000342316;ENST00000409420	T;T;T;T	0.15952	2.38;2.38;2.38;2.38	5.77	5.77	0.91146	.	0.111898	0.64402	D	0.000014	T	0.48960	0.1529	M	0.84683	2.71	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	T	0.46176	-0.9210	10	0.51188	T	0.08	-17.1053	19.3504	0.94381	0.0:0.0:1.0:0.0	.	198	Q8WYN3	CSRN3_HUMAN	K	198;205;198;198;230	ENSP00000412081:E198K;ENSP00000318258:E198K;ENSP00000344042:E198K;ENSP00000387195:E230K	ENSP00000318258:E198K	E	+	1	0	CSRNP3	166241251	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	9.813000	0.99286	2.885000	0.99019	0.655000	0.94253	GAA	.		0.527	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	T	rs121913396|rs121913416		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:41266098A>T	ENST00000349496.5	+	3	375	c.95A>T	c.(94-96)gAc>gTc	p.D32V	CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32V|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32V	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1	CTNNB1	24361	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95T						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>T	3.37:g.41266098A>T	ENSP00000344456:p.Asp32Val	Somatic	183.0	1.0		WXS	Illumina HiSeq	Phase_I	179.0	61.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184569	0.78677	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.74325	-0.3702	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	V	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25V;ENSP00000385604:D32V;ENSP00000412219:D32V;ENSP00000379486:D32V;ENSP00000344456:D32V;ENSP00000411226:D25V;ENSP00000379488:D32V;ENSP00000409302:D32V;ENSP00000401599:D32V	ENSP00000344456:D32V	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DCAF4L1	285429	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	41984018	41984018	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:41984018C>T	ENST00000333141.5	+	1	306	c.209C>T	c.(208-210)gCg>gTg	p.A70V		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	70										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						TCCTCTTTGGCGAGCGACCGA	0.537																																					p.A70V		.											.	DCAF4L1	23	0			c.C209T						.						97.0	83.0	88.0					4																	41984018		2203	4300	6503	SO:0001583	missense	285429	exon1			CTTTGGCGAGCGA	BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.209C>T	4.37:g.41984018C>T	ENSP00000327796:p.Ala70Val	Somatic	181.0	1.0		WXS	Illumina HiSeq	Phase_I	149.0	64.0	NM_001029955	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	ENST00000333141.5	37	CCDS33978.1	.	.	.	.	.	.	.	.	.	.	C	3.653	-0.071101	0.07228	.	.	ENSG00000182308	ENST00000333141	T	0.39056	1.1	0.688	-0.52	0.11935	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.319623	0.39475	N	0.001342	T	0.26557	0.0649	L	0.51422	1.61	0.09310	N	1	B	0.24768	0.111	B	0.06405	0.002	T	0.18085	-1.0348	9	0.16896	T	0.51	.	.	.	.	.	70	Q3SXM0	DC4L1_HUMAN	V	70	ENSP00000327796:A70V	ENSP00000327796:A70V	A	+	2	0	DCAF4L1	41678775	0.987000	0.35691	0.004000	0.12327	0.005000	0.04900	-0.005000	0.12855	-0.335000	0.08451	-0.657000	0.03884	GCG	.		0.537	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360958.1	NM_001029955	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155157921	155157921	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:155157921C>T	ENST00000357232.4	-	25	6517	c.6518G>A	c.(6517-6519)aGt>aAt	p.S2173N		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2173	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATGGCTAGCACTTGCTTCTCT	0.413																																					p.S2173N		.											.	DCHS2	94	0			c.G6518A						.						70.0	69.0	69.0					4																	155157921		2203	4300	6503	SO:0001583	missense	54798	exon25			CTAGCACTTGCTT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6518G>A	4.37:g.155157921C>T	ENSP00000349768:p.Ser2173Asn	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	29.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	6.862	0.528390	0.13127	.	.	ENSG00000197410	ENST00000357232	T	0.51071	0.72	6.04	-0.489	0.12052	Cadherin (4);Cadherin-like (1);	1.482230	0.03819	N	0.267165	T	0.31199	0.0789	N	0.20986	0.625	0.09310	N	1	P	0.39920	0.695	B	0.40134	0.32	T	0.12041	-1.0563	10	0.11485	T	0.65	.	4.5108	0.11910	0.199:0.3225:0.3946:0.0839	.	2173	Q6V1P9	PCD23_HUMAN	N	2173	ENSP00000349768:S2173N	ENSP00000349768:S2173N	S	-	2	0	DCHS2	155377371	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.058000	0.11750	-0.066000	0.12998	-0.344000	0.07964	AGT	.		0.413	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DCHS2	54798	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155264728	155264728	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:155264728T>C	ENST00000357232.4	-	7	870	c.871A>G	c.(871-873)Aag>Gag	p.K291E	DCHS2_ENST00000339452.1_Intron|DCHS2_ENST00000507542.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	291	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		cgtcttcccttaaacctcatg	0.413																																					p.K291E		.											.	DCHS2	94	0			c.A871G						.						51.0	53.0	52.0					4																	155264728		1327	2309	3636	SO:0001583	missense	54798	exon7			TTCCCTTAAACCT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.871A>G	4.37:g.155264728T>C	ENSP00000349768:p.Lys291Glu	Somatic	29.0	1.0		WXS	Illumina HiSeq	Phase_I	34.0	12.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.704746	0.00719	.	.	ENSG00000197410	ENST00000357232	T	0.61040	0.14	0.593	0.593	0.17478	Cadherin (1);	.	.	.	.	T	0.27524	0.0676	N	0.08118	0	0.09310	N	1	B	0.23377	0.084	B	0.11329	0.006	T	0.25082	-1.0142	8	0.02654	T	1	.	.	.	.	.	291	Q6V1P9	PCD23_HUMAN	E	291	ENSP00000349768:K291E	ENSP00000349768:K291E	K	-	1	0	DCHS2	155484178	0.012000	0.17670	0.008000	0.14137	0.007000	0.05969	0.449000	0.21744	0.488000	0.27723	0.477000	0.44152	AAG	.		0.413	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DDC	1644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50595913	50595913	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:50595913A>T	ENST00000444124.2	-	6	836	c.636T>A	c.(634-636)gaT>gaA	p.D212E	DDC_ENST00000489162.1_5'UTR|DDC_ENST00000431062.1_Intron|DDC_ENST00000357936.5_Missense_Mutation_p.D212E|DDC_ENST00000380984.4_Missense_Mutation_p.D212E|DDC_ENST00000426377.1_Missense_Mutation_p.D134E	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	212					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	CGAAGTTGCCATCTGAGGGGA	0.522																																					p.D212E		.											.	DDC	92	0			c.T636A						.						107.0	106.0	106.0					7																	50595913		2203	4300	6503	SO:0001583	missense	1644	exon6			GTTGCCATCTGAG		CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.636T>A	7.37:g.50595913A>T	ENSP00000403644:p.Asp212Glu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	28.0	NM_001082971	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	ENST00000444124.2	37	CCDS5511.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.84|14.84	2.654103|2.654103	0.47362|0.47362	.|.	.|.	ENSG00000132437|ENSG00000132437	ENST00000357936;ENST00000426377;ENST00000444124;ENST00000380984|ENST00000430300	T;T;T;T|.	0.52057|.	0.68;0.68;0.68;0.68|.	6.06|6.06	-0.553|-0.553	0.11815|0.11815	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56337|0.56337	0.1978|0.1978	L|L	0.52364|0.52364	1.645|1.645	0.48632|0.48632	D|D	0.999688|0.999688	D;D|.	0.61080|.	0.989;0.989|.	D;D|.	0.70716|.	0.97;0.97|.	T|T	0.49744|0.49744	-0.8907|-0.8907	10|5	0.39692|.	T|.	0.17|.	7.1068|7.1068	10.374|10.374	0.44071|0.44071	0.6711:0.0:0.3289:0.0|0.6711:0.0:0.3289:0.0	.|.	212;212|.	Q53Y41;P20711|.	.;DDC_HUMAN|.	E|K	212;134;212;212|93	ENSP00000350616:D212E;ENSP00000395069:D134E;ENSP00000403644:D212E;ENSP00000370371:D212E|.	ENSP00000350616:D212E|.	D|M	-|-	3|2	2|0	DDC|DDC	50563407|50563407	0.968000|0.968000	0.33430|0.33430	0.918000|0.918000	0.36340|0.36340	0.367000|0.367000	0.29736|0.29736	0.469000|0.469000	0.22067|0.22067	-0.302000|-0.302000	0.08869|0.08869	-0.297000|-0.297000	0.09499|0.09499	GAT|ATG	.		0.522	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342593.1		
DMP1	1758	broad.mit.edu;bcgsc.ca	37	4	88584445	88584445	+	Silent	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:88584445T>C	ENST00000339673.6	+	6	1614	c.1515T>C	c.(1513-1515)gaT>gaC	p.D505D	RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA|RP11-742B18.1_ENST00000507894.1_RNA|DMP1_ENST00000282479.7_Silent_p.D489D	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	505					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		GGGACCAAGATGACAATGACT	0.413																																					p.D505D		.											.	DMP1	132	0			c.T1515C						.						152.0	151.0	151.0					4																	88584445		2203	4300	6503	SO:0001819	synonymous_variant	1758	exon6			CCAAGATGACAAT	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.1515T>C	4.37:g.88584445T>C		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	5.0	NM_004407	A1L4L3|O43265	Silent	SNP	ENST00000339673.6	37	CCDS3623.1																																																																																			.		0.413	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1		
DNM3	26052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	172017769	172017769	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:172017769C>A	ENST00000355305.5	+	10	1371	c.1214C>A	c.(1213-1215)cCa>cAa	p.P405Q	DNM3_ENST00000520906.1_Missense_Mutation_p.P405Q|DNM3_ENST00000367731.1_Missense_Mutation_p.P405Q|DNM3_ENST00000358155.4_Missense_Mutation_p.P405Q|DNM3_ENST00000367733.2_Missense_Mutation_p.P405Q			Q9UQ16	DYN3_HUMAN	dynamin 3	405					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						TTGTTTACTCCAGACATGGCA	0.343																																					p.P405Q		.											.	DNM3	90	0			c.C1214A						.						97.0	92.0	94.0					1																	172017769		1850	4088	5938	SO:0001583	missense	26052	exon10			TTACTCCAGACAT	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1214C>A	1.37:g.172017769C>A	ENSP00000347457:p.Pro405Gln	Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	229.0	100.0	NM_001136127	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	37		.	.	.	.	.	.	.	.	.	.	c	26.2	4.712336	0.89112	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.90246	0.6950	H	0.96111	3.77	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.92811	0.6264	10	0.87932	D	0	.	18.6647	0.91485	0.0:1.0:0.0:0.0	.	405;405;405;405	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	Q	405;405;405;405;405;405;295	ENSP00000350876:P405Q;ENSP00000356707:P405Q;ENSP00000347457:P405Q;ENSP00000356705:P405Q;ENSP00000429701:P405Q;ENSP00000429416:P295Q	ENSP00000347457:P405Q	P	+	2	0	DNM3	170284392	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.773000	0.85462	2.640000	0.89533	0.558000	0.71614	CCA	.		0.343	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
DPP6	1804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	154593130	154593130	+	Silent	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:154593130A>T	ENST00000377770.3	+	13	1506	c.1365A>T	c.(1363-1365)ggA>ggT	p.G455G	DPP6_ENST00000332007.3_Silent_p.G393G|DPP6_ENST00000404039.1_Silent_p.G391G|DPP6_ENST00000427557.1_Silent_p.G348G			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	455					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TCCCCCAGGGAGGACGAGGGA	0.522																																					p.G455G	NSCLC(125;1384 1783 2490 7422 34254)	.											.	DPP6	652	0			c.A1365T						.						58.0	55.0	56.0					7																	154593130		1931	4118	6049	SO:0001819	synonymous_variant	1804	exon13			CCAGGGAGGACGA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1365A>T	7.37:g.154593130A>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	15.0	NM_130797		Silent	SNP	ENST00000377770.3	37																																																																																				.		0.522	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
ERAP2	64167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	96232185	96232185	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr5:96232185T>C	ENST00000437043.3	+	8	2059	c.1348T>C	c.(1348-1350)Ttt>Ctt	p.F450L	ERAP2_ENST00000379904.4_Missense_Mutation_p.F405L|CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000515095.1_3'UTR	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	450					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		ACAGGAAATGTTTGATGAAGT	0.368																																					p.F450L		.											.	ERAP2	68	0			c.T1348C						.						69.0	72.0	71.0					5																	96232185		2203	4300	6503	SO:0001583	missense	64167	exon8			GAAATGTTTGATG	AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.1348T>C	5.37:g.96232185T>C	ENSP00000400376:p.Phe450Leu	Somatic	233.0	0.0		WXS	Illumina HiSeq	Phase_I	200.0	63.0	NM_001130140	Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Missense_Mutation	SNP	ENST00000437043.3	37	CCDS4086.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.909124	0.92107	.	.	ENSG00000164308	ENST00000437043;ENST00000510373;ENST00000513084;ENST00000379904	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	5.36	4.16	0.48862	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39009	0.1062	M	0.91561	3.22	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.83275	0.993;0.996	T	0.41945	-0.9480	10	0.87932	D	0	.	10.8578	0.46808	0.1417:0.0:0.0:0.8583	.	405;450	Q6P179-3;Q6P179	.;ERAP2_HUMAN	L	450;450;450;405	ENSP00000400376:F450L;ENSP00000421175:F450L;ENSP00000421849:F450L;ENSP00000369235:F405L	ENSP00000369235:F405L	F	+	1	0	ERAP2	96257941	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.684000	0.68197	0.932000	0.37266	0.460000	0.39030	TTT	.		0.368	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250623.2	NM_022350	
EXTL3	2137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28575255	28575255	+	Missense_Mutation	SNP	C	C	T	rs200494893		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr8:28575255C>T	ENST00000220562.4	+	3	2581	c.1679C>T	c.(1678-1680)gCg>gTg	p.A560V	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Missense_Mutation_p.A176V	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	560					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.A560V(1)		biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TCAGGCAAGGCGGCTGGAACT	0.617													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16582	0.0		0.0	False		,,,				2504	0.0				p.A560V		.											.	EXTL3	92	1	Substitution - Missense(1)	large_intestine(1)	c.C1679T						.	C	VAL/ALA	0,4406		0,0,2203	45.0	43.0	44.0		1679	5.9	1.0	8		44	2,8598	2.2+/-6.3	0,2,4298	yes	missense	EXTL3	NM_001440.2	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	560/920	28575255	2,13004	2203	4300	6503	SO:0001583	missense	2137	exon3			GCAAGGCGGCTGG	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.1679C>T	8.37:g.28575255C>T	ENSP00000220562:p.Ala560Val	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	16.0	NM_001440	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	ENST00000220562.4	37	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	C	3.404	-0.121681	0.06838	0.0	2.33E-4	ENSG00000012232	ENST00000523149;ENST00000220562	D;D	0.95272	-3.27;-3.66	5.95	5.95	0.96441	.	0.187488	0.47455	D	0.000230	D	0.88905	0.6564	N	0.14661	0.345	0.48632	D	0.999686	B	0.28512	0.214	B	0.13407	0.009	D	0.84690	0.0722	10	0.27082	T	0.32	-23.8028	20.3748	0.98911	0.0:1.0:0.0:0.0	.	560	O43909	EXTL3_HUMAN	V	176;560	ENSP00000428691:A176V;ENSP00000220562:A560V	ENSP00000220562:A560V	A	+	2	0	EXTL3	28631174	1.000000	0.71417	0.973000	0.42090	0.583000	0.36354	4.950000	0.63603	2.817000	0.96982	0.563000	0.77884	GCG	C|0.999;T|0.001		0.617	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
FAM179B	23116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45521641	45521641	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr14:45521641A>G	ENST00000361577.3	+	14	4371	c.4157A>G	c.(4156-4158)tAt>tGt	p.Y1386C	FAM179B_ENST00000382233.2_3'UTR|FAM179B_ENST00000361462.2_Missense_Mutation_p.Y1439C	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1386										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						ACTCACAGGTATTATGGTCGA	0.318																																					p.Y1386C		.											.	FAM179B	93	0			c.A4157G						.						54.0	54.0	54.0					14																	45521641		2202	4295	6497	SO:0001583	missense	23116	exon14			ACAGGTATTATGG	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4157A>G	14.37:g.45521641A>G	ENSP00000355045:p.Tyr1386Cys	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	17.0	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.698372	0.48307	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.23147	1.92;1.92	4.92	3.77	0.43336	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	0.964;1.0	P;D	0.91635	0.757;0.999	T	0.36866	-0.9730	10	0.54805	T	0.06	-11.5931	9.2229	0.37388	0.7109:0.0:0.0:0.289	.	1439;1386	G3XAE9;Q9Y4F4	.;F179B_HUMAN	C	1386;1439	ENSP00000355045:Y1386C;ENSP00000354917:Y1439C	ENSP00000354917:Y1439C	Y	+	2	0	FAM179B	44591391	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	4.595000	0.61048	0.812000	0.34326	-0.757000	0.03467	TAT	.		0.318	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
FAM83G	644815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18874756	18874756	+	Silent	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:18874756T>C	ENST00000388995.6	-	6	2611	c.2388A>G	c.(2386-2388)ctA>ctG	p.L796L	FAM83G_ENST00000345041.4_Silent_p.L796L|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395643.2_Intron|FAM83G_ENST00000585154.2_Silent_p.L796L			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	796					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						TCCTGGCCTTTAGGTGCTTCG	0.622																																					p.L796L		.											.	FAM83G	69	0			c.A2388G						.						71.0	85.0	80.0					17																	18874756		2084	4190	6274	SO:0001819	synonymous_variant	644815	exon6			GGCCTTTAGGTGC	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.2388A>G	17.37:g.18874756T>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	12.0	NM_001039999	Q3KQZ4|Q6ZW60	Silent	SNP	ENST00000388995.6	37	CCDS42276.1																																																																																			.		0.622	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253108.4		
FANCD2	2177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10102063	10102063	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:10102063T>C	ENST00000419585.1	+	19	1903	c.1742T>C	c.(1741-1743)aTg>aCg	p.M581T	FANCD2_ENST00000287647.3_Missense_Mutation_p.M581T|FANCD2_ENST00000383806.1_Missense_Mutation_p.M581T|FANCD2_ENST00000383807.1_Missense_Mutation_p.M581T			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	581					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GCTGTGACCATGGCTGGCATC	0.438			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.M581T		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	229	0			c.T1742C						.						121.0	99.0	107.0					3																	10102063		2203	4300	6503	SO:0001583	missense	2177	exon19	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TGACCATGGCTGG	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1742T>C	3.37:g.10102063T>C	ENSP00000398754:p.Met581Thr	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	26.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.784934	0.70222	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.43	5.43	0.79202	.	0.079031	0.85682	D	0.000000	T	0.67088	0.2856	M	0.68952	2.095	0.46749	D	0.999181	D;D	0.67145	0.996;0.991	D;P	0.64042	0.921;0.857	T	0.66548	-0.5896	10	0.36615	T	0.2	.	13.5743	0.61864	0.0:0.0:0.0:1.0	.	581;581	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	T	581	ENSP00000287647:M581T;ENSP00000373318:M581T;ENSP00000373317:M581T;ENSP00000398754:M581T	ENSP00000287647:M581T	M	+	2	0	FANCD2	10077063	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.965000	0.87945	2.089000	0.63090	0.372000	0.22366	ATG	.		0.438	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
FBN3	84467	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	8167618	8167618	+	Silent	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:8167618A>G	ENST00000600128.1	-	40	5493	c.5079T>C	c.(5077-5079)acT>acC	p.T1693T	FBN3_ENST00000601739.1_Silent_p.T1693T|FBN3_ENST00000270509.2_Silent_p.T1693T			Q75N90	FBN3_HUMAN	fibrillin 3	1693	TB 7.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GACTGATGGGAGTGGGGCAGG	0.527																																					p.T1693T		.											.	FBN3	100	0			c.T5079C						.						122.0	102.0	109.0					19																	8167618		2203	4300	6503	SO:0001819	synonymous_variant	84467	exon39			GATGGGAGTGGGG		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5079T>C	19.37:g.8167618A>G		Somatic	63.0	1.0		WXS	Illumina HiSeq	Phase_I	56.0	21.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	37	CCDS12196.1																																																																																			.		0.527	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79391155	79391155	+	Silent	SNP	G	G	A	rs546503799	byFrequency	TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:79391155G>A	ENST00000264895.6	+	51	7721	c.7281G>A	c.(7279-7281)ccG>ccA	p.P2427P		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2427					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CACCTCAGCCGTTCCGAGTAG	0.522													g|||	2	0.000399361	0.0015	0.0	5008	,	,		21392	0.0		0.0	False		,,,				2504	0.0				p.P2427P		.											.	FRAS1	68	0			c.G7281A						.						76.0	77.0	77.0					4																	79391155		2021	4188	6209	SO:0001819	synonymous_variant	80144	exon51			TCAGCCGTTCCGA	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.7281G>A	4.37:g.79391155G>A		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	22.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	g	0.425	-0.906168	0.02453	.	.	ENSG00000138759	ENST00000512123	.	.	.	5.52	-1.97	0.07503	.	.	.	.	.	T	0.42381	0.1200	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27971	-1.0058	4	.	.	.	.	3.6592	0.08232	0.284:0.0847:0.4717:0.1596	.	.	.	.	I	656	.	.	V	+	1	0	FRAS1	79610179	1.000000	0.71417	0.655000	0.29622	0.000000	0.00434	0.780000	0.26760	-0.421000	0.07416	-2.299000	0.00261	GTT	.		0.522	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
FGA	2243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155507134	155507134	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:155507134C>T	ENST00000302053.3	-	5	1525	c.1447G>A	c.(1447-1449)Gtg>Atg	p.V483M	FGA_ENST00000403106.3_Missense_Mutation_p.V483M	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	483					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCGGAGGTCACCACTTCTTTG	0.498																																					p.V483M	NSCLC(143;340 1922 20892 22370 48145)	.											.	FGA	93	0			c.G1447A						.						164.0	161.0	162.0					4																	155507134		2203	4300	6503	SO:0001583	missense	2243	exon5			AGGTCACCACTTC		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1447G>A	4.37:g.155507134C>T	ENSP00000306361:p.Val483Met	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	33.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983464	0.35036	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.61510	0.1;0.1	5.99	-0.172	0.13327	Fibrinogen alpha C domain (1);	40.022400	0.00166	N	0.000000	T	0.67924	0.2945	L	0.52759	1.655	0.09310	N	1	P;D	0.76494	0.89;0.999	B;D	0.75020	0.337;0.985	T	0.49835	-0.8897	10	0.40728	T	0.16	.	4.6302	0.12498	0.2186:0.3407:0.0:0.4407	.	483;483	P02671-2;P02671	.;FIBA_HUMAN	M	483	ENSP00000306361:V483M;ENSP00000385981:V483M	ENSP00000306361:V483M	V	-	1	0	FGA	155726584	0.000000	0.05858	0.156000	0.22583	0.375000	0.29983	-0.559000	0.05971	0.127000	0.18452	0.655000	0.94253	GTG	.		0.498	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
FSIP2	401024	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	186670429	186670429	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:186670429A>G	ENST00000424728.1	+	17	16396	c.16396A>G	c.(16396-16398)Aga>Gga	p.R5466G	FSIP2_ENST00000343098.5_Missense_Mutation_p.R5555G			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5466										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGAAATAAATAGAGGTACAAT	0.328																																					p.R5555G		.											.	FSIP2	90	0			c.A16663G						.						67.0	64.0	65.0					2																	186670429		1819	4067	5886	SO:0001583	missense	401024	exon17			ATAAATAGAGGTA	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.16396A>G	2.37:g.186670429A>G	ENSP00000401306:p.Arg5466Gly	Somatic	87.0	1.0		WXS	Illumina HiSeq	Phase_I	76.0	25.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	37		.	.	.	.	.	.	.	.	.	.	A	9.303	1.053622	0.19907	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.46819	0.86;0.86	4.61	-1.14	0.09741	.	.	.	.	.	T	0.26048	0.0635	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	T	0.20638	-1.0269	7	0.26408	T	0.33	.	0.6161	0.00769	0.4443:0.1886:0.2052:0.1619	.	.	.	.	G	5555;5466	ENSP00000344403:R5555G;ENSP00000401306:R5466G	ENSP00000344403:R5555G	R	+	1	2	FSIP2	186378674	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	0.003000	0.13083	-0.034000	0.13713	0.377000	0.23210	AGA	.		0.328	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
GABRA6	2559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	161118965	161118965	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr5:161118965C>A	ENST00000274545.5	+	8	1278	c.845C>A	c.(844-846)aCt>aAt	p.T282N	RP11-348M17.2_ENST00000521984.1_RNA|GABRA6_ENST00000523217.1_Missense_Mutation_p.T272N			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	282					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ACTGTTTTAACTATGACCACT	0.398										TCGA Ovarian(5;0.080)																											p.T282N		.											.	GABRA6	163	0			c.C845A						.						125.0	122.0	123.0					5																	161118965		2203	4300	6503	SO:0001583	missense	2559	exon8			TTTTAACTATGAC		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.845C>A	5.37:g.161118965C>A	ENSP00000274545:p.Thr282Asn	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	25.0	NM_000811	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593394	0.86953	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.87887	-2.31;-2.31	5.32	5.32	0.75619	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95468	0.8528	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96464	0.9343	10	0.87932	D	0	.	18.9984	0.92822	0.0:1.0:0.0:0.0	.	282	Q16445	GBRA6_HUMAN	N	282;272	ENSP00000274545:T282N;ENSP00000430527:T272N	ENSP00000274545:T282N	T	+	2	0	GABRA6	161051543	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.726000	0.84824	2.468000	0.83385	0.650000	0.86243	ACT	.		0.398	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
GALC	2581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	88411981	88411981	+	Missense_Mutation	SNP	G	G	A	rs200960659		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr14:88411981G>A	ENST00000261304.2	-	14	1692	c.1586C>T	c.(1585-1587)aCg>aTg	p.T529M	GALC_ENST00000393568.4_Missense_Mutation_p.T506M|GALC_ENST00000544807.2_Missense_Mutation_p.T473M|GALC_ENST00000393569.2_Missense_Mutation_p.T503M	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	529			T -> M (in GLD; infantile).		carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTGGCGTAGCGTGAAGTGATG	0.408																																					p.T529M		.											.	GALC	90	0			c.C1586T	GRCh37	CM970565	GALC	M		.	G	MET/THR,MET/THR,MET/THR	1,3749		0,1,1874	121.0	117.0	118.0		1586,1517,1508	5.5	1.0	14		118	2,8188		0,2,4093	yes	missense,missense,missense	GALC	NM_000153.3,NM_001201401.1,NM_001201402.1	81,81,81	0,3,5967	AA,AG,GG		0.0244,0.0267,0.0251	probably-damaging,probably-damaging,probably-damaging	529/686,506/663,503/660	88411981	3,11937	1875	4095	5970	SO:0001583	missense	2581	exon14			CGTAGCGTGAAGT	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.1586C>T	14.37:g.88411981G>A	ENSP00000261304:p.Thr529Met	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	46.0	NM_000153	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Missense_Mutation	SNP	ENST00000261304.2	37	CCDS9878.2	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246310	0.59103	2.67E-4	2.44E-4	ENSG00000054983	ENST00000261304;ENST00000544807;ENST00000393569;ENST00000539620;ENST00000393568	D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47	5.5	5.5	0.81552	.	0.043428	0.85682	D	0.000000	D	0.97745	0.9260	M	0.88842	2.985	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.995;0.995;0.995	D	0.97840	1.0268	10	0.59425	D	0.04	-16.3314	19.7586	0.96304	0.0:0.0:1.0:0.0	.	473;506;503;529	P54803-5;E7EPA4;P54803-4;P54803	.;.;.;GALC_HUMAN	M	529;473;503;318;506	ENSP00000261304:T529M;ENSP00000437513:T473M;ENSP00000377199:T503M;ENSP00000377198:T506M	ENSP00000261304:T529M	T	-	2	0	GALC	87481734	1.000000	0.71417	0.959000	0.39883	0.026000	0.11368	9.634000	0.98435	2.754000	0.94517	0.585000	0.79938	ACG	.		0.408	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071559.2		
GAPVD1	26130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	128064751	128064751	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr9:128064751G>T	ENST00000495955.1	+	5	965	c.675G>T	c.(673-675)agG>agT	p.R225S	GAPVD1_ENST00000312123.9_Missense_Mutation_p.R225S|RNU6-1020P_ENST00000363684.1_RNA|GAPVD1_ENST00000470056.1_Missense_Mutation_p.R225S|GAPVD1_ENST00000394084.1_Missense_Mutation_p.R225S|GAPVD1_ENST00000394104.2_Missense_Mutation_p.R225S|GAPVD1_ENST00000394083.2_Missense_Mutation_p.R225S|GAPVD1_ENST00000394105.2_Missense_Mutation_p.R225S|GAPVD1_ENST00000265956.4_Missense_Mutation_p.R225S|GAPVD1_ENST00000297933.6_Missense_Mutation_p.R225S			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	225	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TAATTGAGAGGTTCTCTCCAT	0.423																																					p.R225S		.											.	GAPVD1	93	0			c.G675T						.						60.0	56.0	57.0					9																	128064751		2203	4300	6503	SO:0001583	missense	26130	exon3			TGAGAGGTTCTCT		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.675G>T	9.37:g.128064751G>T	ENSP00000419063:p.Arg225Ser	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	25.0	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.99|16.99|16.99	3.273672|3.273672|3.273672	0.59649|0.59649|0.59649	.|.|.	.|.|.	ENSG00000165219|ENSG00000165219|ENSG00000165219	ENST00000431329|ENST00000394084;ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123|ENST00000436712	.|T;T;T;T;T;T;T;T;T;T|.	.|0.79749|.	.|-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-1.3|.	6.03|6.03|6.03	-1.11|-1.11|-1.11	0.09840|0.09840|0.09840	.|Rho GTPase activation protein (1);Ras GTPase-activating protein (3);|.	.|0.045406|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.50905|0.50905|0.50905	0.1643|0.1643|0.1643	L|L|L	0.37630|0.37630|0.37630	1.12|1.12|1.12	0.54753|0.54753|0.54753	D|D|D	0.999984|0.999984|0.999984	.|D;D;B;D;D;D;P|.	.|0.64830|.	.|0.992;0.994;0.218;0.981;0.981;0.992;0.94|.	.|D;D;B;D;D;D;P|.	.|0.75020|.	.|0.974;0.985;0.059;0.962;0.962;0.974;0.897|.	T|T|T	0.36089|0.36089|0.36089	-0.9762|-0.9762|-0.9762	5|10|5	.|0.35671|.	.|T|.	.|0.21|.	.|.|.	11.8016|11.8016|11.8016	0.52130|0.52130|0.52130	0.5301:0.0:0.4699:0.0|0.5301:0.0:0.4699:0.0|0.5301:0.0:0.4699:0.0	.|.|.	.|225;225;225;225;225;225;225|.	.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6;B0QZ65|.	.|.;GAPD1_HUMAN;.;.;.;.;.|.	V|S|F	88|225|56	.|ENSP00000377646:R225S;ENSP00000419767:R225S;ENSP00000377665:R225S;ENSP00000377664:R225S;ENSP00000265956:R225S;ENSP00000377645:R225S;ENSP00000419063:R225S;ENSP00000418747:R225S;ENSP00000297933:R225S;ENSP00000309582:R225S|.	.|ENSP00000265956:R225S|.	G|R|V	+|+|+	2|3|1	0|2|0	GAPVD1|GAPVD1|GAPVD1	127104572|127104572|127104572	0.999000|0.999000|0.999000	0.42202|0.42202|0.42202	0.975000|0.975000|0.975000	0.42487|0.42487|0.42487	0.992000|0.992000|0.992000	0.81027|0.81027|0.81027	0.524000|0.524000|0.524000	0.22940|0.22940|0.22940	-0.508000|-0.508000|-0.508000	0.06540|0.06540|0.06540	-0.150000|-0.150000|-0.150000	0.13652|0.13652|0.13652	GGT|AGG|GTT	.		0.423	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
GIMAP5	55340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150440117	150440117	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:150440117T>C	ENST00000358647.3	+	3	1257	c.890T>C	c.(889-891)tTc>tCc	p.F297S	GIMAP5_ENST00000479556.1_3'UTR	NM_018384.4	NP_060854.2	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	297					myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell activation (GO:0050868)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of membrane potential (GO:0045838)|positive regulation of natural killer cell cytokine production (GO:0002729)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of mitochondrial membrane permeability (GO:0046902)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|temperature homeostasis (GO:0001659)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|urinary_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATACTTTTTTTCATTATTTTT	0.363																																					p.F501S		.											.	.	.	0			c.T1502C						.						46.0	41.0	43.0					7																	150440117		2202	4297	6499	SO:0001583	missense	0	exon6			TTTTTTTCATTAT	AK002158	CCDS5907.1	7q36.1	2014-04-04	2004-10-29	2004-10-30	ENSG00000196329	ENSG00000196329		"""GTPases, IMAP"""	18005	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 5"""	608086	"""immune associated nucleotide 4 like 1 (mouse)"""	IAN4L1			Standard	NM_018384		Approved	HIMAP3, IAN5		Q96F15	OTTHUMG00000157542	ENST00000358647.3:c.890T>C	7.37:g.150440117T>C	ENSP00000351473:p.Phe297Ser	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	12.0	NM_001199577	D3DWZ5|Q6IA75|Q96NE4|Q9NUK9	Missense_Mutation	SNP	ENST00000358647.3	37	CCDS5907.1	.	.	.	.	.	.	.	.	.	.	T	6.582	0.475673	0.12521	.	.	ENSG00000196329	ENST00000358647;ENST00000447239	T	0.05580	3.42	3.65	3.65	0.41850	.	1.790210	0.02812	N	0.124450	T	0.07324	0.0185	L	0.29908	0.895	0.09310	N	1	B	0.22604	0.072	B	0.12156	0.007	T	0.24261	-1.0165	10	0.48119	T	0.1	.	8.5889	0.33674	0.0:0.0:0.0:1.0	.	297	Q96F15	GIMA5_HUMAN	S	297;333	ENSP00000351473:F297S	ENSP00000351473:F297S	F	+	2	0	GIMAP5	150071050	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	1.409000	0.34680	1.540000	0.49301	0.332000	0.21555	TTC	.		0.363	GIMAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349108.2	NM_018384	
GLB1L	79411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	220102300	220102300	+	Nonsense_Mutation	SNP	G	G	T	rs183755555	byFrequency	TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:220102300G>T	ENST00000295759.7	-	16	1936	c.1623C>A	c.(1621-1623)taC>taA	p.Y541*	GLB1L_ENST00000409640.1_Nonsense_Mutation_p.Y451*|GLB1L_ENST00000392089.2_Nonsense_Mutation_p.Y541*|GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000356283.3_Nonsense_Mutation_p.Y451*			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	541					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATGTTTTGGAGTAGAATGTGG	0.463																																					p.Y541X		.											.	GLB1L	90	0			c.C1623A						.						81.0	83.0	82.0					2																	220102300		2203	4300	6503	SO:0001587	stop_gained	79411	exon16			TTTGGAGTAGAAT		CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1623C>A	2.37:g.220102300G>T	ENSP00000295759:p.Tyr541*	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	35.0	NM_024506	Q96DR0	Nonsense_Mutation	SNP	ENST00000295759.7	37	CCDS2437.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.462781	0.84425	.	.	ENSG00000163521	ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283	.	.	.	5.09	3.96	0.45880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.2932	7.9902	0.30235	0.2227:0.0:0.7773:0.0	.	.	.	.	X	541;451;541;451	.	ENSP00000295759:Y541X	Y	-	3	2	GLB1L	219810544	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	2.674000	0.46867	1.023000	0.39654	0.655000	0.94253	TAC	G|0.999;A|0.001		0.463	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256822.2	NM_024506	
GMPPA	29926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220370193	220370193	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:220370193G>A	ENST00000358215.3	+	9	1138	c.769G>A	c.(769-771)Gcc>Acc	p.A257T	AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000341142.3_Missense_Mutation_p.A257T|GMPPA_ENST00000373917.3_Missense_Mutation_p.A257T|GMPPA_ENST00000373908.1_Missense_Mutation_p.A257T|GMPPA_ENST00000313597.5_Missense_Mutation_p.A257T	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	257					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		AGCCCTCTACGCCTCCCGCCT	0.672																																					p.A257T		.											.	GMPPA	90	0			c.G769A						.						28.0	32.0	31.0					2																	220370193		2197	4292	6489	SO:0001583	missense	29926	exon9			CTCTACGCCTCCC	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.769G>A	2.37:g.220370193G>A	ENSP00000350949:p.Ala257Thr	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	17.0	NM_205847	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	37	CCDS2441.1	.	.	.	.	.	.	.	.	.	.	g	24.9	4.581802	0.86748	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000435316;ENST00000341142	D;D;D;D;T;D	0.95788	-3.81;-3.81;-3.81;-3.81;1.42;-3.81	4.9	3.96	0.45880	.	0.178411	0.47852	D	0.000205	D	0.97711	0.9249	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.989	D	0.98335	1.0535	10	0.87932	D	0	-14.9034	14.2816	0.66216	0.0:0.1498:0.8502:0.0	.	257;257	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	T	257;257;257;257;222;257	ENSP00000315925:A257T;ENSP00000363027:A257T;ENSP00000350949:A257T;ENSP00000363016:A257T;ENSP00000411060:A222T;ENSP00000340760:A257T	ENSP00000315925:A257T	A	+	1	0	GMPPA	220078437	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	6.037000	0.70956	2.253000	0.74438	0.651000	0.88453	GCC	.		0.672	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	NM_013335	
GMPS	8833	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	155640077	155640077	+	Missense_Mutation	SNP	G	G	T	rs375802837		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:155640077G>T	ENST00000496455.2	+	11	1755	c.1420G>T	c.(1420-1422)Gca>Tca	p.A474S	GMPS_ENST00000295920.7_Missense_Mutation_p.A375S	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	474					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	TGATTTTTCTGCAAGTGTTAA	0.303			T	MLL	AML																																p.A474S	Ovarian(153;896 1876 4149 15499 28134)	.		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	.	GMPS	229	0			c.G1420T						.	G	SER/ALA	0,3588		0,0,1794	26.0	25.0	25.0		1420	5.8	1.0	3		25	1,8093		0,1,4046	no	missense	GMPS	NM_003875.2	99	0,1,5840	TT,TG,GG		0.0124,0.0,0.0086	benign	474/694	155640077	1,11681	1794	4047	5841	SO:0001583	missense	8833	exon11			TTTTCTGCAAGTG	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1420G>T	3.37:g.155640077G>T	ENSP00000419851:p.Ala474Ser	Somatic	492.0	2.0		WXS	Illumina HiSeq	Phase_I	420.0	139.0	NM_003875	A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	37	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026571	0.35797	0.0	1.24E-4	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.78	5.78	0.91487	.	0.061993	0.64402	D	0.000005	T	0.47040	0.1424	N	0.16478	0.41	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.44513	-0.9323	9	0.08381	T	0.77	-20.4768	20.0044	0.97430	0.0:0.0:1.0:0.0	.	375;474	F8W720;P49915	.;GUAA_HUMAN	S	474;375;423;474	.	ENSP00000295920:A375S	A	+	1	0	GMPS	157122771	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.731000	0.98807	2.714000	0.92807	0.650000	0.86243	GCA	.		0.303	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2		
GOLGA8A	23015	broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	34673744	34673744	+	Silent	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr15:34673744C>T	ENST00000359187.4	-	16	1744	c.1680G>A	c.(1678-1680)caG>caA	p.Q560Q	GOLGA8A_ENST00000360553.3_Silent_p.Q560Q|GOLGA8A_ENST00000543376.1_Silent_p.Q417Q|MIR1233-1_ENST00000408722.1_RNA|GOLGA8A_ENST00000432566.2_Silent_p.Q590Q	NM_181077.3	NP_851422.1	A7E2F4	GOG8A_HUMAN	golgin A8 family, member A	588	Golgi-targeting domain. {ECO:0000250}.					Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TAGGGTTGTCCTGGGAAGAAC	0.592																																					p.Q560Q		.											.	.	.	0			c.G1680A						.						83.0	71.0	75.0					15																	34673744		2199	4296	6495	SO:0001819	synonymous_variant	23015	exon16			GTTGTCCTGGGAA	BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000359187.4:c.1680G>A	15.37:g.34673744C>T		Somatic	303.0	0.0		WXS	Illumina HiSeq	Phase_I	270.0	37.0	NM_181077	A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	Silent	SNP	ENST00000359187.4	37	CCDS10038.1																																																																																			.		0.592	GOLGA8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251830.2	NM_181076	
GOLGA8B	440270	broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	34819965	34819965	+	Silent	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr15:34819965C>T	ENST00000342314.5	-	16	1777	c.1680G>A	c.(1678-1680)caG>caA	p.Q560Q	GOLGA8A_ENST00000543376.1_Intron|GOLGA8B_ENST00000267731.7_Silent_p.Q560Q|GOLGA8B_ENST00000438958.2_Silent_p.Q590Q|MIR1233-2_ENST00000408138.1_RNA	NM_001023567.4	NP_001018861.3	A8MQT2	GOG8B_HUMAN	golgin A8 family, member B	560	Golgi-targeting domain.					Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)	1		all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TAGGGTTGTCCTGGGAAGAAC	0.587																																					p.Q560Q		.											.	.	.	0			c.G1680A						.						19.0	29.0	26.0					15																	34819965		1963	4080	6043	SO:0001819	synonymous_variant	440270	exon16			GTTGTCCTGGGAA	AF164622	CCDS45211.1	15q14	2011-10-25	2010-02-12		ENSG00000215252	ENSG00000215252			31973	protein-coding gene	gene with protein product		609619	"""golgi autoantigen, golgin subfamily a, 8B"""				Standard	NM_001023567		Approved		uc001ziq.3	A8MQT2	OTTHUMG00000129549	ENST00000342314.5:c.1680G>A	15.37:g.34819965C>T		Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	26.0	NM_001023567	A6NLZ2|O94937|Q2M3S9|Q9NZG8|Q9NZW0|Q9NZW3	Silent	SNP	ENST00000342314.5	37	CCDS45211.1																																																																																			.		0.587	GOLGA8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251739.2	NM_001023567	
GRIN1	2902	broad.mit.edu;mdanderson.org	37	9	140056377	140056377	+	Splice_Site	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr9:140056377T>C	ENST00000371561.3	+	11	2566	c.1469T>C	c.(1468-1470)gTg>gCg	p.V490A	GRIN1_ENST00000371553.3_Splice_Site_p.V511A|GRIN1_ENST00000350902.5_Splice_Site_p.V490A|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371546.4_Splice_Site_p.V511A|GRIN1_ENST00000371550.4_Splice_Site_p.V490A|GRIN1_ENST00000371559.4_Splice_Site_p.V490A|GRIN1_ENST00000371560.3_Splice_Site_p.V511A|GRIN1_ENST00000315048.3_Splice_Site_p.V490A|GRIN1_ENST00000371555.4_Splice_Site_p.V511A	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	490					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCCTCGCAGGTGAACAACAGC	0.642																																					p.V511A	NSCLC(113;717 1653 2089 20474 37618)	.											.	GRIN1	187	0			c.T1532C						.						26.0	23.0	24.0					9																	140056377		2176	4256	6432	SO:0001630	splice_region_variant	2902	exon12			CGCAGGTGAACAA		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.1468-1T>C	9.37:g.140056377T>C		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	4.0	NM_001185091	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	37	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	-	13.65	2.299025	0.40694	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	4.02	4.02	0.46733	Extracellular solute-binding protein, family 3 (1);Glutamate receptor, L-glutamate/glycine-binding (1);Ionotropic glutamate receptor (1);	0.155023	0.44097	U	0.000497	T	0.45875	0.1364	L	0.41573	1.285	0.80722	D	1	B;B;B;B;P;B	0.34955	0.339;0.017;0.291;0.291;0.477;0.04	B;B;B;B;B;B	0.39068	0.198;0.073;0.125;0.19;0.289;0.115	T	0.42085	-0.9472	10	0.37606	T	0.19	.	11.7771	0.51991	0.0:0.0:0.0:1.0	.	511;511;490;490;490;490	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	A	490;490;490;490;511;511;511;490;511	ENSP00000360616:V490A;ENSP00000316696:V490A;ENSP00000316915:V490A;ENSP00000360605:V490A;ENSP00000360601:V511A;ENSP00000360610:V511A;ENSP00000360608:V511A;ENSP00000360614:V490A;ENSP00000360615:V511A	ENSP00000316696:V490A	V	+	2	0	GRIN1	139176198	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	5.570000	0.67398	1.462000	0.47948	0.370000	0.22315	GTG	.		0.642	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	Missense_Mutation
HAPLN4	404037	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	19369444	19369444	+	Silent	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:19369444C>T	ENST00000291481.7	-	4	768	c.705G>A	c.(703-705)ggG>ggA	p.G235G	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	235	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	CACTCCCGGTCCCCCCCAGGC	0.711																																					p.G235G		.											.	HAPLN4	91	0			c.G705A						.						23.0	24.0	23.0					19																	19369444		2202	4298	6500	SO:0001819	synonymous_variant	404037	exon4			CCCGGTCCCCCCC	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.705G>A	19.37:g.19369444C>T		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	21.0	NM_023002	A5PKW5|Q96PW2	Silent	SNP	ENST00000291481.7	37	CCDS12398.1																																																																																			.		0.711	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002	
HAUS6	54801	broad.mit.edu;mdanderson.org	37	9	19058467	19058467	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr9:19058467C>A	ENST00000380502.3	-	16	2765	c.2298G>T	c.(2296-2298)aaG>aaT	p.K766N	HAUS6_ENST00000380496.1_Missense_Mutation_p.K630N	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	766					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTTTAAAACTCTTAGAACTAA	0.323																																					p.K766N		.											.	HAUS6	92	0			c.G2298T						.						16.0	21.0	20.0					9																	19058467		2107	4264	6371	SO:0001583	missense	54801	exon16			AAAACTCTTAGAA	AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622	ENST00000380502.3:c.2298G>T	9.37:g.19058467C>A	ENSP00000369871:p.Lys766Asn	Somatic	184.0	1.0		WXS	Illumina HiSeq	Phase_I	167.0	43.0	NM_017645	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	ENST00000380502.3	37	CCDS6489.1	.	.	.	.	.	.	.	.	.	.	C	0.235	-1.018012	0.02078	.	.	ENSG00000147874	ENST00000380502;ENST00000380496	T;T	0.22336	1.96;1.97	4.76	0.0994	0.14502	.	0.747079	0.12654	N	0.450184	T	0.04724	0.0128	N	0.01352	-0.895	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.37911	-0.9685	10	0.12430	T	0.62	2.0512	0.7317	0.00958	0.3768:0.2302:0.2133:0.1797	.	731;630;766	Q7Z4H7-3;Q5VY60;Q7Z4H7	.;.;HAUS6_HUMAN	N	766;630	ENSP00000369871:K766N;ENSP00000369865:K630N	ENSP00000369865:K630N	K	-	3	2	HAUS6	19048467	0.000000	0.05858	0.294000	0.24946	0.532000	0.34746	-0.079000	0.11357	0.078000	0.16900	0.453000	0.30009	AAG	.		0.323	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051825.1	NM_017645	
HEPH	9843	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	65408258	65408258	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chrX:65408258T>C	ENST00000343002.2	+	4	1347	c.683T>C	c.(682-684)cTc>cCc	p.L228P	HEPH_ENST00000519389.1_Missense_Mutation_p.L282P|HEPH_ENST00000374727.3_Missense_Mutation_p.L231P|HEPH_ENST00000441993.2_Missense_Mutation_p.L231P|HEPH_ENST00000336279.5_5'UTR|HEPH_ENST00000419594.1_Missense_Mutation_p.L231P			Q9BQS7	HEPH_HUMAN	hephaestin	228	Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GATTTCTTCCTCCTCTTCAGT	0.488																																					p.L282P		.											.	HEPH	135	0			c.T845C						.						106.0	79.0	88.0					X																	65408258		2203	4300	6503	SO:0001583	missense	9843	exon5			TCTTCCTCCTCTT	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.683T>C	X.37:g.65408258T>C	ENSP00000343939:p.Leu228Pro	Somatic	128.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	68.0	NM_138737	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		.	.	.	.	.	.	.	.	.	.	T	20.9	4.073229	0.76415	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D	0.99129	-5.46;-5.46;-5.46;-5.46;-5.46;-5.46	4.78	4.78	0.61160	Cupredoxin (2);	0.087925	0.48767	D	0.000176	D	0.99426	0.9797	H	0.94886	3.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.99;0.997;0.99	D	0.98630	1.0671	10	0.87932	D	0	.	12.2371	0.54522	0.0:0.0:0.0:1.0	.	282;231;228	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	P	282;231;231;231;228;228	ENSP00000430620:L282P;ENSP00000363859:L231P;ENSP00000411687:L231P;ENSP00000413211:L231P;ENSP00000343939:L228P;ENSP00000398078:L228P	ENSP00000343939:L228P	L	+	2	0	HEPH	65324983	0.995000	0.38212	0.999000	0.59377	0.937000	0.57800	5.779000	0.68948	1.563000	0.49615	0.481000	0.45027	CTC	.		0.488	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
HERC2P3	283755	broad.mit.edu;bcgsc.ca	37	15	20644207	20644207	+	RNA	SNP	G	G	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr15:20644207G>C	ENST00000428453.1	-	0	3356							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CCGCAAAGCTGTGGGTGATGG	0.542																																					.		.											.	HERC2P3	92	0			.						.						3.0	3.0	3.0					15																	20644207		1740	3313	5053			283755	.			AAAGCTGTGGGTG	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644207G>C		Somatic	233.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	53.0	.		RNA	SNP	ENST00000428453.1	37																																																																																				.		0.542	HERC2P3-014	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347772.2	NG_008269	
HIP1	3092	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	75368213	75368213	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:75368213T>G	ENST00000336926.6	-	1	52	c.26A>C	c.(25-27)aAg>aCg	p.K9T	HIP1_ENST00000434438.2_Missense_Mutation_p.K9T|HIP1_ENST00000479835.1_5'UTR	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GGGCACCTGCTTCATGGAGCT	0.746			T	PDGFRB	CMML																																p.K9T		.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1	1085	0			c.A26C						.						5.0	6.0	6.0					7																	75368213		2075	4086	6161	SO:0001583	missense	3092	exon1			ACCTGCTTCATGG	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.26A>C	7.37:g.75368213T>G	ENSP00000336747:p.Lys9Thr	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	13.0	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	37	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	T	16.22	3.060300	0.55432	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.15487	2.63;2.42	4.96	4.96	0.65561	.	0.244954	0.26470	U	0.024198	T	0.08358	0.0208	N	0.08118	0	0.32133	N	0.586516	B	0.33694	0.421	B	0.26969	0.075	T	0.08680	-1.0710	10	0.48119	T	0.1	-26.5628	10.9991	0.47593	0.0:0.0:0.0:1.0	.	9	O00291	HIP1_HUMAN	T	9	ENSP00000336747:K9T;ENSP00000410300:K9T	ENSP00000336747:K9T	K	-	2	0	HIP1	75206149	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	1.884000	0.39668	1.845000	0.53610	0.377000	0.23210	AAG	.		0.746	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
PHYKPL	85007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	177637219	177637219	+	Intron	SNP	G	G	T	rs115721462	byFrequency	TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr5:177637219G>T	ENST00000308158.5	-	13	1619				HNRNPAB_ENST00000358344.3_Missense_Mutation_p.G292C|HNRNPAB_ENST00000515193.1_Intron|HNRNPAB_ENST00000506339.1_Missense_Mutation_p.G287C|HNRNPAB_ENST00000504898.1_Missense_Mutation_p.G292C|HNRNPAB_ENST00000514633.1_Intron|HNRNPAB_ENST00000506259.1_Intron|HNRNPAB_ENST00000355836.5_Intron|PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase							mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	TGGCTATGGCGGCTACGACTA	0.622																																					p.G292C		.											.	HNRNPAB	22	0			c.G874T						.						62.0	63.0	63.0					5																	177637219		2203	4300	6503	SO:0001627	intron_variant	3182	exon7			TATGGCGGCTACG	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1351-1303C>A	5.37:g.177637219G>T		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	18.0	NM_031266	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	ENST00000308158.5	37	CCDS4434.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372661	0.42003	.	.	ENSG00000197451	ENST00000358344;ENST00000506339;ENST00000504898	D;D;D	0.95756	-3.8;-3.8;-3.8	5.97	5.97	0.96955	.	0.343069	0.34580	N	0.003849	D	0.97514	0.9186	M	0.88512	2.96	0.80722	D	1	D	0.76494	0.999	D	0.63597	0.916	D	0.97506	1.0063	10	0.72032	D	0.01	.	11.2195	0.48846	0.0825:0.0:0.9175:0.0	.	292	Q99729-2	.	C	292;287;292	ENSP00000351108:G292C;ENSP00000422501:G287C;ENSP00000425031:G292C	ENSP00000351108:G292C	G	+	1	0	HNRNPAB	177569825	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.354000	0.52254	2.828000	0.97474	0.655000	0.94253	GGC	G|0.999;A|0.001		0.622	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
HTRA1	5654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124273831	124273831	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr10:124273831G>A	ENST00000368984.3	+	9	1527	c.1399G>A	c.(1399-1401)Gaa>Aaa	p.E467K		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	467	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				CAGGGGTAATGAAGATATCAT	0.498																																					p.E467K		.											.	HTRA1	90	0			c.G1399A						.						170.0	151.0	157.0					10																	124273831		2203	4300	6503	SO:0001583	missense	5654	exon9			GGTAATGAAGATA	AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.1399G>A	10.37:g.124273831G>A	ENSP00000357980:p.Glu467Lys	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	28.0	NM_002775	D3DRE4|Q9UNS5	Missense_Mutation	SNP	ENST00000368984.3	37	CCDS7630.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581644	0.46006	.	.	ENSG00000166033	ENST00000368984;ENST00000435263;ENST00000420892	D;D	0.82255	-1.59;-1.59	5.48	5.48	0.80851	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.81083	0.4749	L	0.45470	1.425	0.80722	D	1	B	0.26902	0.163	B	0.30716	0.119	T	0.76399	-0.2973	10	0.33141	T	0.24	-7.8902	19.387	0.94560	0.0:0.0:1.0:0.0	.	467	Q92743	HTRA1_HUMAN	K	467;434;208	ENSP00000357980:E467K;ENSP00000412676:E208K	ENSP00000357980:E467K	E	+	1	0	HTRA1	124263821	1.000000	0.71417	0.984000	0.44739	0.165000	0.22458	9.270000	0.95690	2.572000	0.86782	0.655000	0.94253	GAA	.		0.498	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128327.1	NM_002775	
IL9R	3581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	155233487	155233487	+	Silent	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chrX:155233487C>T	ENST00000244174.5	+	4	579	c.400C>T	c.(400-402)Ctg>Ttg	p.L134L	IL9R_ENST00000540897.1_Silent_p.A168A|IL9R_ENST00000424344.3_Silent_p.L113L|IL9R_ENST00000369423.2_Silent_p.A178A	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	134					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GCAGGTCAGCCTGGTGGACCC	0.617																																					p.A178A		.											.	IL9R	40	0			c.C534T						.						108.0	99.0	102.0					X																	155233487		2203	4296	6499	SO:0001819	synonymous_variant	3581	exon5			GTCAGCCTGGTGG	M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.400C>T	X.37:g.155233487C>T		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	38.0	NM_176786	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Silent	SNP	ENST00000244174.5	37	CCDS14771.4																																																																																			.		0.617	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058981.1	NM_002186	
ITGB6	3694	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	161029224	161029224	+	Silent	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:161029224C>A	ENST00000283249.2	-	6	1014	c.777G>T	c.(775-777)cgG>cgT	p.R259R	ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000428609.2_Silent_p.R217R|ITGB6_ENST00000409872.1_Silent_p.R259R|ITGB6_ENST00000409967.2_Silent_p.R259R	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	259	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GGGAGTCATTCCGCCAGCCAA	0.448																																					p.R259R		.											.	ITGB6	227	0			c.G777T						.						122.0	117.0	119.0					2																	161029224		2203	4300	6503	SO:0001819	synonymous_variant	3694	exon6			GTCATTCCGCCAG		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.777G>T	2.37:g.161029224C>A		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	19.0	NM_000888	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Silent	SNP	ENST00000283249.2	37	CCDS2212.1																																																																																			.		0.448	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255036.1	NM_000888	
KCNA1	3736	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	5020766	5020766	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:5020766delC	ENST00000382545.3	+	2	1329	c.222delC	c.(220-222)gacfs	p.D74fs	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	74					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	GCTACTTCGACCCCCTGAGGA	0.632																																					p.D74fs		.											.	KCNA1	228	0			c.222delC						.						67.0	68.0	67.0					12																	5020766		2203	4300	6503	SO:0001589	frameshift_variant	3736	exon2			CTTCGACCCCCTG	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.222delC	12.37:g.5020766delC	ENSP00000371985:p.Asp74fs	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	22.0	NM_000217	A6NM83|Q3MIQ9	Frame_Shift_Del	DEL	ENST00000382545.3	37	CCDS8535.1																																																																																			.		0.632	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103343.2	NM_000217	
KCNIP1	30820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170160865	170160865	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr5:170160865T>C	ENST00000411494.1	+	8	599	c.599T>C	c.(598-600)aTc>aCc	p.I200T	KCNIP1_ENST00000390656.4_Missense_Mutation_p.I189T|KCNIP1_ENST00000377360.4_Missense_Mutation_p.I198T|KCNIP1_ENST00000328939.4_Missense_Mutation_p.I189T|KCNIP1_ENST00000520740.1_Missense_Mutation_p.I161T|KCNIP1_ENST00000434108.1_Missense_Mutation_p.I214T			Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	200	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)			autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAAGATGGCATCGTAACTTTA	0.423																																					p.I200T		.											.	KCNIP1	92	0			c.T599C						.						118.0	113.0	114.0					5																	170160865		2203	4300	6503	SO:0001583	missense	30820	exon8			ATGGCATCGTAAC	AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000411494.1:c.599T>C	5.37:g.170160865T>C	ENSP00000395323:p.Ile200Thr	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	11.0	NM_001034837	B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Missense_Mutation	SNP	ENST00000411494.1	37	CCDS34286.1	.	.	.	.	.	.	.	.	.	.	T	17.29	3.352419	0.61293	.	.	ENSG00000182132	ENST00000377360;ENST00000328939;ENST00000390656;ENST00000520740;ENST00000434108;ENST00000411494	T;T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48;-0.48	5.66	5.66	0.87406	EF-hand-like domain (1);	0.102292	0.64402	D	0.000003	T	0.63920	0.2552	L	0.39898	1.24	0.51767	D	0.999934	B;B;B;B	0.33512	0.259;0.152;0.415;0.262	B;B;B;B	0.36766	0.232;0.177;0.118;0.074	T	0.61505	-0.7049	9	.	.	.	.	13.863	0.63573	0.0:0.0:0.0:1.0	.	214;189;200;198	Q3YAD0;Q3YAD2;Q9NZI2;Q3YAD3	.;.;KCIP1_HUMAN;.	T	198;189;189;161;214;200	ENSP00000366577:I198T;ENSP00000329686:I189T;ENSP00000375071:I189T;ENSP00000431102:I161T;ENSP00000414886:I214T;ENSP00000395323:I200T	.	I	+	2	0	KCNIP1	170093443	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.680000	0.84062	2.156000	0.67533	0.528000	0.53228	ATC	.		0.423	KCNIP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000371760.1		
KCNV2	169522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	2718181	2718181	+	Missense_Mutation	SNP	G	G	A	rs140256288		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr9:2718181G>A	ENST00000382082.3	+	1	680	c.442G>A	c.(442-444)Gaa>Aaa	p.E148K		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	148					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		GCAGACAGACGAATACTTCTT	0.657																																					p.E148K		.											.	KCNV2	515	0			c.G442A	GRCh37	CM080425	KCNV2	M	rs140256288	.	G	LYS/GLU	2,4402		0,2,2200	24.0	22.0	23.0		442	5.1	0.2	9	dbSNP_134	23	0,8596		0,0,4298	no	missense	KCNV2	NM_133497.3	56	0,2,6498	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	148/546	2718181	2,12998	2202	4298	6500	SO:0001583	missense	169522	exon1			ACAGACGAATACT	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.442G>A	9.37:g.2718181G>A	ENSP00000371514:p.Glu148Lys	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	38.0	NM_133497	Q5T6X0	Missense_Mutation	SNP	ENST00000382082.3	37	CCDS6447.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327786	0.81690	4.54E-4	0.0	ENSG00000168263	ENST00000423608;ENST00000382082	T	0.79454	-1.27	5.07	5.07	0.68467	BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.055998	0.64402	D	0.000001	D	0.92358	0.7575	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94993	0.8136	10	0.87932	D	0	.	18.4533	0.90711	0.0:0.0:1.0:0.0	.	148	Q8TDN2	KCNV2_HUMAN	K	148	ENSP00000371514:E148K	ENSP00000371514:E148K	E	+	1	0	KCNV2	2708181	1.000000	0.71417	0.245000	0.24217	0.616000	0.37450	7.995000	0.88328	2.352000	0.79861	0.462000	0.41574	GAA	G|1.000;A|0.000		0.657	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123128393	123128393	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:123128393G>A	ENST00000264501.4	+	16	2000	c.1627G>A	c.(1627-1629)Gac>Aac	p.D543N	KIAA1109_ENST00000388738.3_Missense_Mutation_p.D543N|KIAA1109_ENST00000455637.1_Missense_Mutation_p.D543N|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	543					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CAATTGGATCGACTGTTCTAC	0.299																																					p.D543N		.											.	KIAA1109	80	0			c.G1627A						.						95.0	87.0	89.0					4																	123128393		1815	4075	5890	SO:0001583	missense	84162	exon14			TGGATCGACTGTT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.1627G>A	4.37:g.123128393G>A	ENSP00000264501:p.Asp543Asn	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	40.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.316664|5.316664	0.95682|0.95682	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	T;T;T|.	0.28666|.	2.2;2.2;1.6|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.996761|.	0.08123|.	N|.	0.994407|.	T|T	0.73377|0.73377	0.3579|0.3579	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D|.	0.62365|.	0.991|.	P|.	0.49953|.	0.627|.	T|T	0.69840|0.69840	-0.5036|-0.5036	10|5	0.40728|.	T|.	0.16|.	.|.	19.7657|19.7657	0.96340|0.96340	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	543|.	Q2LD37|.	K1109_HUMAN|.	N|Q	543|375	ENSP00000264501:D543N;ENSP00000373390:D543N;ENSP00000389925:D543N|.	ENSP00000264501:D543N|.	D|R	+|+	1|2	0|0	KIAA1109|KIAA1109	123347843|123347843	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	9.394000|9.394000	0.97261|0.97261	2.649000|2.649000	0.89929|0.89929	0.655000|0.655000	0.94253|0.94253	GAC|CGA	.		0.299	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
CEMIP	57214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	81235392	81235392	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr15:81235392T>G	ENST00000394685.3	+	28	4225	c.3806T>G	c.(3805-3807)cTg>cGg	p.L1269R	KIAA1199_ENST00000356249.5_Missense_Mutation_p.L1269R|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Missense_Mutation_p.L1269R			Q8WUJ3	CEMIP_HUMAN		1269					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						AACTCCATTCTGCAAGGCATA	0.562																																					p.L1269R		.											.	KIAA1199	93	0			c.T3806G						.						380.0	351.0	361.0					15																	81235392		2203	4300	6503	SO:0001583	missense	57214	exon27			CCATTCTGCAAGG																												ENST00000394685.3:c.3806T>G	15.37:g.81235392T>G	ENSP00000378177:p.Leu1269Arg	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	34.0	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.969270	0.53614	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.66638	-0.22;-0.22;-0.22	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000016	T	0.79770	0.4503	M	0.71581	2.175	0.52099	D	0.99994	D	0.76494	0.999	D	0.87578	0.998	T	0.77354	-0.2619	10	0.24483	T	0.36	-16.7876	15.4306	0.75092	0.0:0.0:0.0:1.0	.	1269	Q8WUJ3	K1199_HUMAN	R	1269	ENSP00000220244:L1269R;ENSP00000378177:L1269R;ENSP00000348583:L1269R	ENSP00000220244:L1269R	L	+	2	0	KIAA1199	79022447	1.000000	0.71417	0.987000	0.45799	0.149000	0.21700	6.762000	0.74950	2.039000	0.60335	0.482000	0.46254	CTG	.		0.562	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
KIAA1683	80726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18375495	18375495	+	Intron	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:18375495C>A	ENST00000600328.3	-	3	2810				KIAA1683_ENST00000392413.4_Missense_Mutation_p.R952L|KIAA1683_ENST00000600359.3_Intron			Q9H0B3	K1683_HUMAN	KIAA1683							mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GGACAGGGCTCGGGACAGGGT	0.647																																					p.R952L		.											.	KIAA1683	92	0			c.G2855T						.						36.0	37.0	36.0					19																	18375495		692	1591	2283	SO:0001627	intron_variant	80726	exon3			AGGGCTCGGGACA	AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.2616+238G>T	19.37:g.18375495C>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	16.0	NM_001145304	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	ENST00000600328.3	37	CCDS32958.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978593	0.34942	.	.	ENSG00000130518	ENST00000392413	T	0.04758	3.56	4.67	1.39	0.22231	.	.	.	.	.	T	0.04588	0.0125	N	0.14661	0.345	0.09310	N	0.999999	D	0.53151	0.958	P	0.49451	0.611	T	0.42799	-0.9430	9	0.54805	T	0.06	.	6.0889	0.19983	0.0:0.6772:0.0:0.3228	.	952	E9PDE0	.	L	952	ENSP00000376213:R952L	ENSP00000376213:R952L	R	-	2	0	KIAA1683	18236495	0.000000	0.05858	0.003000	0.11579	0.081000	0.17604	0.270000	0.18607	0.419000	0.25927	-0.474000	0.04947	CGA	.		0.647	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
KIR2DL3	3804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55263136	55263136	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:55263136T>A	ENST00000342376.3	+	6	782	c.751T>A	c.(751-753)Tca>Aca	p.S251T	KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL3_ENST00000434419.2_Intron|KIR3DL1_ENST00000402254.2_Intron	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	251					immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		GATTGGGACCTCAGTGGtcat	0.468																																					p.S251T		.											.	KIR2DL3	92	0			c.T751A						.						173.0	147.0	156.0					19																	55263136		1424	2573	3997	SO:0001583	missense	3804	exon6			GGGACCTCAGTGG	L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.751T>A	19.37:g.55263136T>A	ENSP00000342215:p.Ser251Thr	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	7.0	NM_015868	O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	ENST00000342376.3	37	CCDS33107.1	.	.	.	.	.	.	.	.	.	.	T	7.003	0.555186	0.13436	.	.	ENSG00000243772	ENST00000342376	T	0.00492	7.01	0.635	0.635	0.17723	.	.	.	.	.	T	0.02156	0.0067	M	0.94142	3.5	0.09310	N	1	D;P;D;D	0.69078	0.972;0.877;0.997;0.997	P;D;D;D	0.69654	0.776;0.916;0.965;0.965	T	0.20107	-1.0285	8	0.87932	D	0	.	.	.	.	.	251;153;251;251	E3NZD7;P43628-2;P43628;E3NZD8	.;.;KI2L3_HUMAN;.	T	251	ENSP00000342215:S251T	ENSP00000342215:S251T	S	+	1	0	KIR2DL3	59954948	0.003000	0.15002	0.002000	0.10522	0.013000	0.08279	1.475000	0.35409	0.516000	0.28340	0.248000	0.18094	TCA	.		0.468	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000141150.1		
KLHL4	56062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	86877345	86877345	+	Silent	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chrX:86877345G>T	ENST00000373119.4	+	5	1204	c.1059G>T	c.(1057-1059)gtG>gtT	p.V353V	KLHL4_ENST00000373114.4_Silent_p.V353V	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	353						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TGCAGTGGGTGGGGCATGATG	0.443																																					p.V353V		.											.	KLHL4	133	0			c.G1059T						.						157.0	129.0	138.0					X																	86877345		2203	4300	6503	SO:0001819	synonymous_variant	56062	exon5			GTGGGTGGGGCAT	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1059G>T	X.37:g.86877345G>T		Somatic	173.0	1.0		WXS	Illumina HiSeq	Phase_I	122.0	83.0	NM_019117	B2RTW2|Q9Y3J5	Silent	SNP	ENST00000373119.4	37	CCDS14457.1																																																																																			.		0.443	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
LCE5A	254910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152484038	152484038	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:152484038T>C	ENST00000334269.2	+	2	204	c.28T>C	c.(28-30)Tgc>Cgc	p.C10R	CRCT1_ENST00000368790.3_5'Flank	NM_178438.4	NP_848525.1	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	10	Cys-rich.				keratinization (GO:0031424)					lung(3)|ovary(1)|prostate(3)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGCAGCAGTGCCAGCCTCC	0.517																																					p.C10R		.											.	LCE5A	91	0			c.T28C						.						83.0	79.0	80.0					1																	152484038		2203	4300	6503	SO:0001583	missense	254910	exon2			CAGCAGTGCCAGC	BI670518	CCDS1011.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000186207	ENSG00000186207		"""Late cornified envelopes"""	16614	protein-coding gene	gene with protein product		612619	"""small proline rich-like (epidermal differentiation complex) 5A"""	SPRL5A		11698679	Standard	NM_178438		Approved	LEP18	uc001ezy.3	Q5TCM9	OTTHUMG00000014401	ENST00000334269.2:c.28T>C	1.37:g.152484038T>C	ENSP00000333952:p.Cys10Arg	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	35.0	NM_178438		Missense_Mutation	SNP	ENST00000334269.2	37	CCDS1011.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.740932	0.30865	.	.	ENSG00000186207	ENST00000334269	T	0.05649	3.41	5.28	5.28	0.74379	.	.	.	.	.	T	0.17959	0.0431	M	0.87180	2.865	0.45621	D	0.99855	D	0.69078	0.997	D	0.66497	0.944	T	0.00950	-1.1503	9	0.87932	D	0	-16.4346	11.5291	0.50597	0.0:0.0:0.0:1.0	.	10	Q5TCM9	LCE5A_HUMAN	R	10	ENSP00000333952:C10R	ENSP00000333952:C10R	C	+	1	0	LCE5A	150750662	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.129000	0.42055	2.215000	0.71742	0.491000	0.48974	TGC	.		0.517	LCE5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040059.1	NM_178438	
LMAN1	3998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	57021788	57021788	+	Missense_Mutation	SNP	T	T	A	rs139797136		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr18:57021788T>A	ENST00000251047.5	-	4	1219	c.502A>T	c.(502-504)Ata>Tta	p.I168L	LMAN1_ENST00000587940.1_5'Flank	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	168	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TTGTTGCCTATAATTACTATA	0.284																																					p.I168L		.											.	LMAN1	91	0			c.A502T						.						76.0	71.0	73.0					18																	57021788		2201	4294	6495	SO:0001583	missense	3998	exon4			TGCCTATAATTAC	X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.502A>T	18.37:g.57021788T>A	ENSP00000251047:p.Ile168Leu	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	24.0	NM_005570	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Missense_Mutation	SNP	ENST00000251047.5	37	CCDS11974.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.096881	0.56075	.	.	ENSG00000074695	ENST00000251047	T	0.62639	0.01	5.6	0.66	0.17868	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.232980	0.42172	D	0.000745	T	0.43122	0.1233	N	0.17800	0.525	0.40219	D	0.977712	B;B	0.02656	0.0;0.0	B;B	0.20955	0.032;0.023	T	0.14035	-1.0487	10	0.32370	T	0.25	-5.6707	10.2186	0.43184	0.0:0.5154:0.0:0.4846	.	168;168	B4DVV0;P49257	.;LMAN1_HUMAN	L	168	ENSP00000251047:I168L	ENSP00000251047:I168L	I	-	1	0	LMAN1	55172768	1.000000	0.71417	0.987000	0.45799	0.999000	0.98932	1.955000	0.40372	-0.104000	0.12154	0.533000	0.62120	ATA	T|1.000;C|0.000		0.284	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256129.2	NM_005570	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170072882	170072882	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:170072882C>T	ENST00000263816.3	-	35	5992	c.5707G>A	c.(5707-5709)Gct>Act	p.A1903T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1903					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TCCATGTTAGCACTGGCGATC	0.483																																					p.A1903T		.											.	LRP2	175	0			c.G5707A						.						142.0	129.0	134.0					2																	170072882		2203	4300	6503	SO:0001583	missense	4036	exon35			TGTTAGCACTGGC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5707G>A	2.37:g.170072882C>T	ENSP00000263816:p.Ala1903Thr	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	44.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	36	5.695859	0.96802	.	.	ENSG00000081479	ENST00000263816	D	0.91464	-2.85	5.73	5.73	0.89815	Six-bladed beta-propeller, TolB-like (1);	0.107962	0.64402	D	0.000006	D	0.96716	0.8928	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96940	0.9687	10	0.66056	D	0.02	.	19.8961	0.96958	0.0:1.0:0.0:0.0	.	1903	P98164	LRP2_HUMAN	T	1903	ENSP00000263816:A1903T	ENSP00000263816:A1903T	A	-	1	0	LRP2	169781128	1.000000	0.71417	0.996000	0.52242	0.920000	0.55202	6.081000	0.71309	2.699000	0.92147	0.655000	0.94253	GCT	.		0.483	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRRC31	79782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	169565966	169565966	+	Silent	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:169565966A>T	ENST00000316428.5	-	8	1326	c.1269T>A	c.(1267-1269)tcT>tcA	p.S423S	LRRC31_ENST00000264676.5_Silent_p.S367S|LRRC31_ENST00000523069.1_Silent_p.S423S	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	423										cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			GCACTTGAAGAGACATGGAAA	0.498																																					p.S423S		.											.	LRRC31	93	0			c.G1269A						.						78.0	81.0	80.0					3																	169565966		2050	4197	6247	SO:0001819	synonymous_variant	79782	exon8			TTGAAGAGACATG	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.1269T>A	3.37:g.169565966A>T		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	24.0	NM_024727	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Silent	SNP	ENST00000316428.5	37	CCDS43167.1																																																																																			.		0.498	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727	
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85450884	85450884	+	Silent	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:85450884G>A	ENST00000393217.2	+	8	2374	c.2313G>A	c.(2311-2313)gtG>gtA	p.V771V		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	771										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AGAGACCTGTGAAATGCCCAG	0.358																																					p.V771V		.											.	LRRIQ1	95	0			c.G2313A						.						110.0	126.0	120.0					12																	85450884		2203	4300	6503	SO:0001819	synonymous_variant	84125	exon8			ACCTGTGAAATGC	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2313G>A	12.37:g.85450884G>A		Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	61.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Silent	SNP	ENST00000393217.2	37	CCDS41816.1																																																																																			.		0.358	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
MAB21L1	4081	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36049446	36049446	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr13:36049446A>G	ENST00000379919.4	-	1	1386	c.830T>C	c.(829-831)cTg>cCg	p.L277P	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_5'Flank	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	277					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GTAGGAAACCAGAGTCTTCAT	0.532																																					p.L277P		.											.	MAB21L1	92	0			c.T830C						.						85.0	79.0	81.0					13																	36049446		2203	4300	6503	SO:0001583	missense	4081	exon1			GAAACCAGAGTCT	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.830T>C	13.37:g.36049446A>G	ENSP00000369251:p.Leu277Pro	Somatic	169.0	1.0		WXS	Illumina HiSeq	Phase_I	142.0	40.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	37	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	A	17.72	3.459655	0.63401	.	.	ENSG00000180660	ENST00000379919	T	0.12255	2.7	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.42017	0.1184	M	0.83312	2.635	0.80722	D	1	D	0.60575	0.988	D	0.73708	0.981	T	0.41610	-0.9499	10	0.72032	D	0.01	-25.0201	16.0659	0.80870	1.0:0.0:0.0:0.0	.	277	Q13394	MB211_HUMAN	P	277	ENSP00000369251:L277P	ENSP00000369251:L277P	L	-	2	0	MAB21L1	34947446	1.000000	0.71417	0.898000	0.35279	0.938000	0.57974	9.339000	0.96797	2.209000	0.71365	0.533000	0.62120	CTG	.		0.532	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
MBD5	55777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	149227546	149227546	+	Silent	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:149227546T>C	ENST00000407073.1	+	9	3031	c.2034T>C	c.(2032-2034)tcT>tcC	p.S678S	MBD5_ENST00000404807.1_Silent_p.S678S	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	678					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TGGATAGTTCTGCAGTTCCTA	0.438																																					p.S678S		.											.	MBD5	95	0			c.T2034C						.						109.0	107.0	107.0					2																	149227546		2203	4300	6503	SO:0001819	synonymous_variant	55777	exon9			TAGTTCTGCAGTT	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2034T>C	2.37:g.149227546T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	13.0	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	ENST00000407073.1	37	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	T	2.720	-0.266769	0.05754	.	.	ENSG00000204406	ENST00000416015	.	.	.	4.84	3.69	0.42338	.	.	.	.	.	T	0.59142	0.2172	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55231	-0.8173	4	.	.	.	-3.8456	9.2701	0.37666	0.0:0.082:0.0:0.918	.	.	.	.	P	418	.	.	L	+	2	0	MBD5	148944016	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.124000	0.31320	0.994000	0.38892	0.533000	0.62120	CTG	.		0.438	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
MCOLN2	255231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	85403450	85403450	+	Silent	SNP	T	T	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:85403450T>G	ENST00000370608.3	-	11	1390	c.1323A>C	c.(1321-1323)ccA>ccC	p.P441P	MCOLN2_ENST00000284027.5_Silent_p.P413P|MCOLN2_ENST00000531325.1_5'UTR	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	441					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		TGTCATGGTATGGTCCTAAGA	0.478																																					p.P441P		.											.	MCOLN2	94	0			c.A1323C						.						99.0	84.0	89.0					1																	85403450		2203	4300	6503	SO:0001819	synonymous_variant	255231	exon11			ATGGTATGGTCCT	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.1323A>C	1.37:g.85403450T>G		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	26.0	NM_153259	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Silent	SNP	ENST00000370608.3	37	CCDS30762.1																																																																																			.		0.478	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259	
MECOM	2122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	168838896	168838896	+	Silent	SNP	C	C	A	rs185054275	byFrequency	TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:168838896C>A	ENST00000464456.1	-	6	1716	c.516G>T	c.(514-516)tcG>tcT	p.S172S	MECOM_ENST00000392736.3_Silent_p.S172S|MECOM_ENST00000472280.1_Silent_p.S173S|MECOM_ENST00000468789.1_Silent_p.S172S|MECOM_ENST00000460814.1_Silent_p.S172S|MECOM_ENST00000494292.1_Silent_p.S360S|MECOM_ENST00000433243.2_Silent_p.S173S|MECOM_ENST00000264674.3_Silent_p.S237S	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						TGAGGCCCGACGAAGTGGCAA	0.552																																					p.S360S		.											.	MECOM	853	0			c.G1080T						.						183.0	164.0	171.0					3																	168838896		2203	4300	6503	SO:0001819	synonymous_variant	2122	exon7			GCCCGACGAAGTG	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.516G>T	3.37:g.168838896C>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	30.0	NM_004991	Q13466|Q6FH90	Silent	SNP	ENST00000464456.1	37	CCDS54669.1																																																																																			C|0.999;T|0.001		0.552	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
KMT2C	58508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151860694	151860694	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:151860694T>G	ENST00000262189.6	-	43	10186	c.9968A>C	c.(9967-9969)cAt>cCt	p.H3323P	KMT2C_ENST00000355193.2_Missense_Mutation_p.H3323P	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3323	Gln-rich.|Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGGGCTAGTATGGCCAGAAAT	0.552																																					p.H3323P		.											.	MLL3	1398	0			c.A9968C						.						124.0	109.0	115.0					7																	151860694		2203	4300	6503	SO:0001583	missense	58508	exon43			CTAGTATGGCCAG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.9968A>C	7.37:g.151860694T>G	ENSP00000262189:p.His3323Pro	Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	56.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	T	8.240	0.806598	0.16467	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83673	-1.75;-1.74	5.28	5.28	0.74379	.	0.154227	0.30365	N	0.009789	T	0.80919	0.4716	L	0.44542	1.39	0.80722	D	1	B;B;P	0.41265	0.026;0.066;0.744	B;B;B	0.44044	0.004;0.024;0.439	T	0.80113	-0.1518	10	0.35671	T	0.21	.	15.2352	0.73422	0.0:0.0:0.0:1.0	.	3323;2384;3323	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	P	3323	ENSP00000262189:H3323P;ENSP00000347325:H3323P	ENSP00000262189:H3323P	H	-	2	0	MLL3	151491627	1.000000	0.71417	0.652000	0.29579	0.226000	0.24999	5.501000	0.66950	1.997000	0.58415	0.533000	0.62120	CAT	.		0.552	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
MLLT1	4298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	6226990	6226990	+	Nonsense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:6226990T>A	ENST00000252674.7	-	5	707	c.544A>T	c.(544-546)Aag>Tag	p.K182*		NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	182					negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)			endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						TCACTAACCTTGGAGCCGTGG	0.662			T	MLL	AL																																p.K182X		.		Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	.	MLLT1	658	0			c.A544T						.						171.0	141.0	151.0					19																	6226990		2203	4300	6503	SO:0001587	stop_gained	4298	exon5			TAACCTTGGAGCC		CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.544A>T	19.37:g.6226990T>A	ENSP00000252674:p.Lys182*	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	28.0	NM_005934	Q14768	Nonsense_Mutation	SNP	ENST00000252674.7	37	CCDS12160.1	.	.	.	.	.	.	.	.	.	.	T	39	7.388274	0.98252	.	.	ENSG00000130382	ENST00000252674	.	.	.	4.85	4.85	0.62838	.	0.106292	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.2253	13.2805	0.60212	0.0:0.0:0.0:1.0	.	.	.	.	X	182	.	ENSP00000252674:K182X	K	-	1	0	MLLT1	6177990	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.891000	0.87319	1.808000	0.52836	0.402000	0.26972	AAG	.		0.662	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452909.1	NM_005934	
MLST8	64223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2256124	2256124	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr16:2256124T>C	ENST00000569417.1	+	2	392	c.38T>C	c.(37-39)gTc>gCc	p.V13A	MLST8_ENST00000565250.1_Missense_Mutation_p.V13A|MLST8_ENST00000561651.1_3'UTR|MLST8_ENST00000382450.4_Missense_Mutation_p.V13A|AC009065.3_ENST00000517149.1_RNA|MLST8_ENST00000301725.7_Missense_Mutation_p.V32A|MLST8_ENST00000397124.1_Missense_Mutation_p.V13A|MLST8_ENST00000564088.1_Missense_Mutation_p.V13A|MLST8_ENST00000301724.10_Missense_Mutation_p.V13A	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	13					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				large_intestine(3)|lung(2)|skin(1)	6						AGTGACCCGGTCATCCTGGCC	0.657																																					p.V13A		.											.	MLST8	392	0			c.T38C						.						60.0	66.0	64.0					16																	2256124		2072	4204	6276	SO:0001583	missense	64223	exon2			ACCCGGTCATCCT		CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.38T>C	16.37:g.2256124T>C	ENSP00000456405:p.Val13Ala	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	15.0	NM_001199174	B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Missense_Mutation	SNP	ENST00000569417.1	37	CCDS10462.2	.	.	.	.	.	.	.	.	.	.	T	17.84	3.487233	0.63962	.	.	ENSG00000167965	ENST00000382450;ENST00000301724;ENST00000397124;ENST00000301725	T;T;T;T	0.68624	1.11;-0.12;1.11;-0.34	5.11	5.11	0.69529	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70762	0.3261	L	0.37561	1.115	0.80722	D	1	D;P;P	0.76494	0.999;0.954;0.776	D;D;P	0.80764	0.994;0.954;0.536	T	0.65380	-0.6182	10	0.10636	T	0.68	-61.3119	13.7076	0.62648	0.0:0.0:0.0:1.0	.	13;32;13	B4E2R3;Q9BVC4-4;Q9BVC4	.;.;LST8_HUMAN	A	13;13;13;32	ENSP00000371888:V13A;ENSP00000301724:V13A;ENSP00000380313:V13A;ENSP00000301725:V32A	ENSP00000301724:V13A	V	+	2	0	MLST8	2196125	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	5.876000	0.69667	1.919000	0.55581	0.358000	0.22013	GTC	.		0.657	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250763.2	NM_022372	
MOV10	4343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	113231596	113231596	+	Silent	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:113231596T>C	ENST00000413052.2	+	3	567	c.177T>C	c.(175-177)taT>taC	p.Y59Y	MOV10_ENST00000369644.1_Silent_p.Y3Y|MOV10_ENST00000357443.2_Silent_p.Y59Y|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369645.1_Silent_p.Y59Y	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	59					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		CCATGCTGTATGGAATGAAGA	0.602																																					p.Y59Y		.											.	MOV10	95	0			c.T177C						.						76.0	84.0	81.0					1																	113231596		2203	4300	6503	SO:0001819	synonymous_variant	4343	exon3			GCTGTATGGAATG	AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.177T>C	1.37:g.113231596T>C		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	32.0	NM_020963	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Silent	SNP	ENST00000413052.2	37	CCDS853.1																																																																																			.		0.602	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
MROH5	389690	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142505463	142505463	+	RNA	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr8:142505463T>A	ENST00000430863.1	-	0	463					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GAAGTAGTCGTGGATGGTTTC	0.572																																					.		.											.	.	.	0			.						.						118.0	113.0	115.0					8																	142505463		1971	4163	6134			389690	.			TAGTCGTGGATGG			8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142505463T>A		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	115.0	.		RNA	SNP	ENST00000430863.1	37		.	.	.	.	.	.	.	.	.	.	T	12.31	1.898269	0.33535	.	.	ENSG00000226807	ENST00000521161	.	.	.	4.6	2.16	0.27623	.	.	.	.	.	T	0.24736	0.0600	N	0.24115	0.695	.	.	.	P	0.48016	0.904	P	0.44394	0.448	T	0.21211	-1.0252	7	0.44086	T	0.13	.	5.8981	0.18951	0.0:0.2169:0.0:0.7831	.	128	Q6ZUA9	.	L	93	.	ENSP00000431031:H128L	H	-	2	0	AC100803.1	142574645	0.500000	0.26091	0.522000	0.27862	0.007000	0.05969	1.514000	0.35834	0.688000	0.31529	0.459000	0.35465	CAC	.		0.572	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	9072822	9072822	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:9072822G>T	ENST00000397910.4	-	3	14827	c.14624C>A	c.(14623-14625)tCa>tAa	p.S4875*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4877	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTAGGTATTGATCTGGAAAT	0.458																																					p.S4875X		.											.	MUC16	566	0			c.C14624A						.						224.0	211.0	215.0					19																	9072822		2029	4199	6228	SO:0001587	stop_gained	94025	exon3			GGTATTGATCTGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14624C>A	19.37:g.9072822G>T	ENSP00000381008:p.Ser4875*	Somatic	295.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	93.0	NM_024690	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	55	24.314818	0.99960	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.4	-1.2	0.09554	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	2.0647	0.03600	0.3242:0.0:0.4179:0.2578	.	.	.	.	X	4875	.	ENSP00000381008:S4875X	S	-	2	0	MUC16	8933822	0.016000	0.18221	0.000000	0.03702	0.060000	0.15804	1.989000	0.40707	-0.182000	0.10602	0.298000	0.19748	TCA	.		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9085379	9085379	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:9085379G>A	ENST00000397910.4	-	1	6639	c.6436C>T	c.(6436-6438)Ctt>Ttt	p.L2146F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2146	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.L2146V(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCCATTGGAAGAGGGACTTCA	0.498																																					p.L2146F		.											.	MUC16	566	2	Substitution - Missense(2)	lung(2)	c.C6436T						.						73.0	71.0	72.0					19																	9085379		1912	4127	6039	SO:0001583	missense	94025	exon1			TTGGAAGAGGGAC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6436C>T	19.37:g.9085379G>A	ENSP00000381008:p.Leu2146Phe	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	29.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.104	-1.148522	0.01714	.	.	ENSG00000181143	ENST00000397910	T	0.03124	4.04	0.235	-0.47	0.12131	.	.	.	.	.	T	0.01940	0.0061	N	0.08118	0	.	.	.	B	0.09022	0.002	B	0.04013	0.001	T	0.42916	-0.9423	7	0.87932	D	0	.	.	.	.	.	2146	B5ME49	.	F	2146	ENSP00000381008:L2146F	ENSP00000381008:L2146F	L	-	1	0	MUC16	8946379	0.003000	0.15002	0.001000	0.08648	0.001000	0.01503	-0.144000	0.10280	-0.671000	0.05274	-0.657000	0.03884	CTT	.		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1093298	1093298	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr11:1093298C>T	ENST00000441003.2	+	30	5144	c.5117C>T	c.(5116-5118)aCg>aTg	p.T1706M	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1673M|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccactacggtgacccca	0.637																																					p.T1706M		.											.	MUC2	90	0			c.C5117T						.						116.0	163.0	146.0					11																	1093298		1884	3471	5355	SO:0001583	missense	4583	exon30			CCACTACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5117C>T	11.37:g.1093298C>T	ENSP00000415183:p.Thr1706Met	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	8.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.981	-0.006376	0.07773	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.10763	2.84;3.0	1.45	1.45	0.22620	.	28.057100	0.02299	U	0.070964	T	0.07908	0.0198	.	.	.	0.09310	N	1	D	0.62365	0.991	B	0.37451	0.25	T	0.31779	-0.9931	9	0.42905	T	0.14	.	6.2785	0.20993	0.0:1.0:0.0:0.0	.	1706	E7EUV1	.	M	1706;1673	ENSP00000415183:T1706M;ENSP00000351956:T1673M	ENSP00000351956:T1673M	T	+	2	0	MUC2	1083298	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	0.616000	0.24344	0.794000	0.33899	0.184000	0.17185	ACG	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MYH1	4619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10408576	10408576	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:10408576A>G	ENST00000226207.5	-	21	2433	c.2339T>C	c.(2338-2340)aTg>aCg	p.M780T	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	780	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTCATCTCGCATCTCCTCTAG	0.463																																					p.M780T		.											.	MYH1	171	0			c.T2339C						.						71.0	72.0	72.0					17																	10408576		2203	4300	6503	SO:0001583	missense	4619	exon21			TCTCGCATCTCCT		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2339T>C	17.37:g.10408576A>G	ENSP00000226207:p.Met780Thr	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	39.0	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	A	18.98	3.737275	0.69304	.	.	ENSG00000109061	ENST00000226207	D	0.93247	-3.19	5.47	5.47	0.80525	Myosin head, motor domain (1);	0.000000	0.52532	U	0.000072	D	0.94218	0.8144	M	0.81179	2.53	0.58432	D	0.999999	P	0.41475	0.751	B	0.43445	0.42	D	0.94940	0.8090	10	0.87932	D	0	.	15.8518	0.78937	1.0:0.0:0.0:0.0	.	780	P12882	MYH1_HUMAN	T	780	ENSP00000226207:M780T	ENSP00000226207:M780T	M	-	2	0	MYH1	10349301	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.085000	0.94083	2.216000	0.71823	0.528000	0.53228	ATG	.		0.463	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
NALCN	259232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	101735199	101735199	+	Silent	SNP	T	T	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr13:101735199T>G	ENST00000251127.6	-	33	3807	c.3726A>C	c.(3724-3726)gcA>gcC	p.A1242A		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1242					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTGACATTGTTGCCAAAGGTA	0.507																																					p.A1242A		.											.	NALCN	167	0			c.A3726C						.						129.0	117.0	121.0					13																	101735199		2203	4300	6503	SO:0001819	synonymous_variant	259232	exon33			CATTGTTGCCAAA	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3726A>C	13.37:g.101735199T>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	32.0	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	ENST00000251127.6	37	CCDS9498.1																																																																																			.		0.507	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
NAP1L2	4674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	72434298	72434298	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chrX:72434298A>G	ENST00000373517.3	-	1	386	c.31T>C	c.(31-33)Tca>Cca	p.S11P	NAP1L2_ENST00000536638.1_Intron	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	11					nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					CTGGATTCTGACAGCTCCTTG	0.547																																					p.S11P		.											.	NAP1L2	130	0			c.T31C						.						53.0	58.0	56.0					X																	72434298		2179	4190	6369	SO:0001583	missense	4674	exon1			ATTCTGACAGCTC	AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.31T>C	X.37:g.72434298A>G	ENSP00000362616:p.Ser11Pro	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	86.0	NM_021963	B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	ENST00000373517.3	37	CCDS14423.1	.	.	.	.	.	.	.	.	.	.	a	3.261	-0.151099	0.06585	.	.	ENSG00000186462	ENST00000373517	T	0.32515	1.45	2.94	2.94	0.34122	.	1.336430	0.06283	U	0.697753	T	0.16854	0.0405	N	0.14661	0.345	0.23425	N	0.9977	P	0.38078	0.617	B	0.31614	0.133	T	0.12604	-1.0541	10	0.37606	T	0.19	-8.3847	6.7261	0.23357	1.0:0.0:0.0:0.0	.	11	Q9ULW6	NP1L2_HUMAN	P	11	ENSP00000362616:S11P	ENSP00000362616:S11P	S	-	1	0	NAP1L2	72351023	0.983000	0.35010	0.236000	0.24074	0.152000	0.21847	3.022000	0.49659	1.390000	0.46547	0.441000	0.28932	TCA	.		0.547	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057225.1	NM_021963	
NLRP1	22861	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	5462324	5462325	+	Frame_Shift_Ins	INS	-	-	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:5462324_5462325insA	ENST00000572272.1	-	4	1690_1691	c.1691_1692insT	c.(1690-1692)ttgfs	p.L564fs	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000345221.3_Frame_Shift_Ins_p.L564fs|NLRP1_ENST00000577119.1_Frame_Shift_Ins_p.L564fs|NLRP1_ENST00000262467.5_Frame_Shift_Ins_p.L564fs|NLRP1_ENST00000269280.4_Frame_Shift_Ins_p.L564fs|NLRP1_ENST00000354411.3_Frame_Shift_Ins_p.L564fs			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	564	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GCTGGGGTCCCAATGGCTGAGC	0.525																																					p.L564fs		.											.	NLRP1	274	0			c.1692_1693insT						.																																			SO:0001589	frameshift_variant	22861	exon4			GGGTCCCAATGGC	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.1692dupT	17.37:g.5462326_5462326dupA	ENSP00000460475:p.Leu564fs	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	37.0	NM_014922	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Frame_Shift_Ins	INS	ENST00000572272.1	37	CCDS42246.1																																																																																			.		0.525	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
NLRP12	91662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54301639	54301639	+	Missense_Mutation	SNP	C	C	T	rs146368839	byFrequency	TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:54301639C>T	ENST00000324134.6	-	8	2953	c.2785G>A	c.(2785-2787)Gcc>Acc	p.A929T	NLRP12_ENST00000391772.1_Intron|NLRP12_ENST00000535162.1_Missense_Mutation_p.A929T|NLRP12_ENST00000354278.3_Intron|NLRP12_ENST00000345770.5_Missense_Mutation_p.A930T|NLRP12_ENST00000391773.1_Missense_Mutation_p.A930T|NLRP12_ENST00000391775.3_Intron|NLRP12_ENST00000351894.4_Intron	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	929					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CCCTCACAGGCGGCAGAGCCC	0.627													C|||	4	0.000798722	0.0	0.0	5008	,	,		15761	0.003		0.001	False		,,,				2504	0.0				p.G929S		.											.	NLRP12	211	0			c.G2785A						.	C	,THR/ALA	0,4406		0,0,2203	39.0	38.0	38.0		,2785	3.3	0.9	19	dbSNP_134	38	1,8599	1.2+/-3.3	0,1,4299	yes	intron,missense	NLRP12	NM_033297.2,NM_144687.2	,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,probably-damaging	,929/1062	54301639	1,13005	2203	4300	6503	SO:0001583	missense	91662	exon8			CACAGGCGGCAGA	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.2785G>A	19.37:g.54301639C>T	ENSP00000319377:p.Ala929Thr	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	48.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	37	CCDS12864.1	4	0.0018315018315018315	0	0.0	0	0.0	3	0.005244755244755245	1	0.0013192612137203166	C	10.08	1.251588	0.22880	0.0	1.16E-4	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000391773;ENST00000345770	T;T;T	0.54071	0.59;0.59;0.59	4.42	3.31	0.37934	.	0.267312	0.19640	U	0.109469	T	0.36166	0.0957	L	0.58101	1.795	0.80722	D	1	B;B	0.22211	0.066;0.032	B;B	0.14023	0.01;0.01	T	0.33574	-0.9863	10	0.31617	T	0.26	.	9.1865	0.37174	0.2165:0.7835:0.0:0.0	.	929;929	A8K407;P59046	.;NAL12_HUMAN	T	929;929;930;930	ENSP00000319377:A929T;ENSP00000438030:A929T;ENSP00000375653:A930T	ENSP00000319377:A929T	A	-	1	0	NLRP12	58993451	0.313000	0.24554	0.915000	0.36163	0.008000	0.06430	0.506000	0.22658	2.484000	0.83849	0.638000	0.83543	GCC	C|0.998;T|0.002		0.627	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
NLRP8	126205	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	56485050	56485050	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:56485050G>T	ENST00000291971.3	+	7	2638	c.2567G>T	c.(2566-2568)tGt>tTt	p.C856F	NLRP8_ENST00000590542.1_Intron	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	856					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CAGCTTACTTGTGAAAGCCTT	0.483																																					p.C856F		.											.	NLRP8	361	0			c.G2567T						.						195.0	194.0	194.0					19																	56485050		2203	4300	6503	SO:0001583	missense	126205	exon7			TTACTTGTGAAAG	AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2567G>T	19.37:g.56485050G>T	ENSP00000291971:p.Cys856Phe	Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	112.0	27.0	NM_176811	Q7RTR4	Missense_Mutation	SNP	ENST00000291971.3	37	CCDS12937.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350053	0.24512	.	.	ENSG00000179709	ENST00000291971	T	0.53206	0.63	2.04	0.993	0.19825	.	.	.	.	.	T	0.60689	0.2288	M	0.76433	2.335	0.09310	N	0.999999	D	0.63046	0.992	D	0.67725	0.953	T	0.47262	-0.9131	9	0.72032	D	0.01	.	4.4669	0.11694	0.1966:0.0:0.8034:0.0	.	856	Q86W28	NALP8_HUMAN	F	856	ENSP00000291971:C856F	ENSP00000291971:C856F	C	+	2	0	NLRP8	61176862	0.395000	0.25254	0.001000	0.08648	0.003000	0.03518	1.699000	0.37804	0.422000	0.26005	0.514000	0.50259	TGT	.		0.483	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457462.1	NM_176811	
NOC4L	79050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	132636050	132636050	+	Silent	SNP	G	G	A	rs375514217		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:132636050G>A	ENST00000330579.1	+	12	1136	c.1095G>A	c.(1093-1095)gtG>gtA	p.V365V	NOC4L_ENST00000538784.1_5'UTR|NOC4L_ENST00000535343.1_3'UTR	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	365					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CCTACCTGGTGGCCGCCTTCG	0.721																																					p.V365V		.											.	NOC4L	90	0			c.G1095A						.	G		0,4358		0,0,2179	14.0	17.0	16.0		1095	1.3	1.0	12		16	1,8553		0,1,4276	no	coding-synonymous	NOC4L	NM_024078.1		0,1,6455	AA,AG,GG		0.0117,0.0,0.0077		365/517	132636050	1,12911	2179	4277	6456	SO:0001819	synonymous_variant	79050	exon12			CCTGGTGGCCGCC		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.1095G>A	12.37:g.132636050G>A		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	11.0	NM_024078	Q8N2S5|Q96I14	Silent	SNP	ENST00000330579.1	37	CCDS9277.1																																																																																			.		0.721	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398999.1	NM_024078	
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15280956	15280956	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:15280956T>A	ENST00000263388.2	-	28	5215	c.5140A>T	c.(5140-5142)Atg>Ttg	p.M1714L		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1714					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ACCTCCCCCATCAGGCTCTCA	0.627																																					p.M1714L		.											.	NOTCH3	855	0			c.A5140T						.						41.0	30.0	34.0					19																	15280956		2203	4300	6503	SO:0001583	missense	4854	exon28			CCCCCATCAGGCT	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5140A>T	19.37:g.15280956T>A	ENSP00000263388:p.Met1714Leu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	29.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	T	10.70	1.423401	0.25639	.	.	ENSG00000074181	ENST00000263388	T	0.81247	-1.47	5.22	4.19	0.49359	.	0.000000	0.38897	N	0.001526	T	0.60366	0.2263	N	0.04994	-0.135	0.32242	N	0.572649	B	0.06786	0.001	B	0.06405	0.002	T	0.59123	-0.7513	10	0.25106	T	0.35	.	10.6684	0.45745	0.1435:0.0:0.0:0.8564	.	1714	Q9UM47	NOTC3_HUMAN	L	1714	ENSP00000263388:M1714L	ENSP00000263388:M1714L	M	-	1	0	NOTCH3	15141956	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.323000	0.43823	0.978000	0.38470	0.482000	0.46254	ATG	.		0.627	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
NUP155	9631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	37351407	37351407	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr5:37351407T>C	ENST00000231498.3	-	6	811	c.608A>G	c.(607-609)gAt>gGt	p.D203G	NUP155_ENST00000513532.1_Missense_Mutation_p.D203G|NUP155_ENST00000381843.2_Missense_Mutation_p.D144G	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	203					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATATAAAGGATCTGGAAGCAA	0.338																																					p.D203G		.											.	NUP155	205	0			c.A608G						.						77.0	77.0	77.0					5																	37351407		2203	4298	6501	SO:0001583	missense	9631	exon6			AAAGGATCTGGAA	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.608A>G	5.37:g.37351407T>C	ENSP00000231498:p.Asp203Gly	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	39.0	NM_153485	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	37	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.597253	0.87055	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.35421	1.31;1.31;1.31	5.83	5.83	0.93111	Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.59797	0.2220	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.71870	0.93;0.975	T	0.57625	-0.7779	10	0.23891	T	0.37	-3.9675	16.2041	0.82108	0.0:0.0:0.0:1.0	.	203;203	E9PF10;O75694	.;NU155_HUMAN	G	203;144;165;203	ENSP00000231498:D203G;ENSP00000371265:D144G;ENSP00000422019:D203G	ENSP00000231498:D203G	D	-	2	0	NUP155	37387164	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.541000	0.82084	2.219000	0.72066	0.533000	0.62120	GAT	.		0.338	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228481978	228481978	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:228481978A>G	ENST00000422127.1	+	42	11301	c.11257A>G	c.(11257-11259)Aga>Gga	p.R3753G	RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000366707.4_Missense_Mutation_p.R872G|OBSCN_ENST00000284548.11_Missense_Mutation_p.R3753G|OBSCN_ENST00000570156.2_Missense_Mutation_p.R4182G|OBSCN_ENST00000359599.6_Missense_Mutation_p.R2600G|OBSCN_ENST00000366709.4_Missense_Mutation_p.R872G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3753	Ig-like 38.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGAGACCCTCAGAGATGGGGA	0.632																																					p.R4182G		.											.	OBSCN	403	0			c.A12544G						.						148.0	154.0	152.0					1																	228481978		2143	4235	6378	SO:0001583	missense	84033	exon47			ACCCTCAGAGATG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11257A>G	1.37:g.228481978A>G	ENSP00000409493:p.Arg3753Gly	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	36.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	A	12.80	2.045657	0.36085	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32	4.98	3.83	0.44106	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.623093	0.14761	N	0.299976	T	0.63058	0.2479	M	0.62088	1.915	0.09310	N	1	B;B	0.14805	0.011;0.003	B;B	0.23018	0.043;0.04	T	0.51553	-0.8691	10	0.22706	T	0.39	.	12.974	0.58527	0.8566:0.1434:0.0:0.0	.	3753;3753	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	3753;3753;872;872;2600	ENSP00000284548:R3753G;ENSP00000409493:R3753G;ENSP00000355668:R872G;ENSP00000355670:R872G;ENSP00000352613:R2600G	ENSP00000284548:R3753G	R	+	1	2	OBSCN	226548601	0.000000	0.05858	0.809000	0.32408	0.186000	0.23388	0.749000	0.26320	2.110000	0.64415	0.416000	0.27883	AGA	.		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSL1	23363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220422736	220422736	+	Missense_Mutation	SNP	G	G	A	rs373804245		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:220422736G>A	ENST00000404537.1	-	11	3655	c.3599C>T	c.(3598-3600)gCt>gTt	p.A1200V	OBSL1_ENST00000265317.5_Missense_Mutation_p.A191V|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000373876.1_Missense_Mutation_p.A1200V|OBSL1_ENST00000603926.1_Missense_Mutation_p.A1200V|OBSL1_ENST00000265318.4_Missense_Mutation_p.A1108V	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1200	Ig-like 10.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GGGGGCGCCAGCCCGGGACAG	0.677																																					p.A1200V		.											.	OBSL1	71	0			c.C3599T						.						16.0	18.0	17.0					2																	220422736		1939	4129	6068	SO:0001583	missense	23363	exon11			GCGCCAGCCCGGG	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.3599C>T	2.37:g.220422736G>A	ENSP00000385636:p.Ala1200Val	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	12.0	NM_001173431	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	37	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203130	0.58234	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000265317	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	4.16	4.16	0.48862	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.17280	0.0415	L	0.56280	1.765	0.31969	N	0.607378	D;D;D;D	0.69078	0.987;0.987;0.993;0.997	D;P;D;D	0.73380	0.964;0.867;0.963;0.98	T	0.02821	-1.1106	9	0.27785	T	0.31	.	11.1464	0.48432	0.0:0.0:0.8158:0.1842	.	99;1201;1200;191	B7Z5P5;A4KVA4;O75147;E7ER99	.;.;OBSL1_HUMAN;.	V	1108;1200;1200;191	ENSP00000265318:A1108V;ENSP00000385636:A1200V;ENSP00000362983:A1200V;ENSP00000265317:A191V	ENSP00000265317:A191V	A	-	2	0	OBSL1	220130980	0.003000	0.15002	0.859000	0.33776	0.464000	0.32679	1.363000	0.34159	2.061000	0.61500	0.313000	0.20887	GCT	.		0.677	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
OR52B4	143496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4388835	4388835	+	Missense_Mutation	SNP	G	G	A	rs200224336		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr11:4388835G>A	ENST00000408920.2	-	1	781	c.691C>T	c.(691-693)Cct>Tct	p.P231S		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	231					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTGGAGAAGGCATGTGGAAG	0.428																																					p.P231S		.											.	OR52B4	90	0			c.C691T						.						115.0	118.0	117.0					11																	4388835		2057	4206	6263	SO:0001583	missense	143496	exon1			GAGAAGGCATGTG	AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.691C>T	11.37:g.4388835G>A	ENSP00000386160:p.Pro231Ser	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	31.0	NM_001005161	A6NP68|Q6IFK6	Missense_Mutation	SNP	ENST00000408920.2	37	CCDS41609.1	.	.	.	.	.	.	.	.	.	.	G	9.252	1.041090	0.19669	.	.	ENSG00000221996	ENST00000408920	T	0.36878	1.23	5.27	2.22	0.28083	GPCR, rhodopsin-like superfamily (1);	0.193036	0.25052	N	0.033505	T	0.34978	0.0916	L	0.52266	1.64	0.09310	N	1	P	0.41673	0.759	P	0.48304	0.573	T	0.08391	-1.0724	10	0.30078	T	0.28	.	5.455	0.16586	0.0805:0.1412:0.6325:0.1458	.	231	Q8NGK2	O52B4_HUMAN	S	231	ENSP00000386160:P231S	ENSP00000386160:P231S	P	-	1	0	OR52B4	4345411	0.000000	0.05858	0.062000	0.19696	0.004000	0.04260	0.048000	0.14078	0.735000	0.32537	0.561000	0.74099	CCT	G|0.999;A|0.001		0.428	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161	
PCDH15	65217	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	55568990	55568990	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr10:55568990G>A	ENST00000395445.1	-	36	5214	c.4820C>T	c.(4819-4821)aCt>aTt	p.T1607I	PCDH15_ENST00000395440.1_Missense_Mutation_p.T541I|PCDH15_ENST00000395446.1_Missense_Mutation_p.T803I|PCDH15_ENST00000395442.1_Missense_Mutation_p.T472I|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000409834.1_3'UTR	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ACTGTATTCAGTATAGTCGCT	0.458										HNSCC(58;0.16)																											.		.											.	PCDH15	193	0			.						.						107.0	92.0	97.0					10																	55568990		1568	3582	5150	SO:0001583	missense	65217	.			TATTCAGTATAGT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.4820C>T	10.37:g.55568990G>A	ENSP00000378832:p.Thr1607Ile	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	39.0	.	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000395445.1	37		.	.	.	.	.	.	.	.	.	.	G	7.671	0.687021	0.14973	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;D	0.97161	-0.33;0.95;2.24;-4.27	5.68	3.76	0.43208	.	.	.	.	.	D	0.92031	0.7475	N	0.14661	0.345	0.09310	N	0.999998	B;B	0.24823	0.112;0.112	B;B	0.22386	0.039;0.039	D	0.84014	0.0350	9	0.26408	T	0.33	.	11.8185	0.52224	0.0:0.2839:0.6056:0.1105	.	1605;1607	C6ZEF5;A2A3E2	.;.	I	1607;803;472;541	ENSP00000378832:T1607I;ENSP00000378833:T803I;ENSP00000378829:T472I;ENSP00000378827:T541I	ENSP00000378827:T541I	T	-	2	0	PCDH15	55238996	0.804000	0.28969	0.173000	0.22940	0.210000	0.24377	3.206000	0.51098	1.379000	0.46325	-0.175000	0.13238	ACT	.		0.458	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000291335.1	NM_033056	
PCDHGB1	56104	hgsc.bcm.edu;broad.mit.edu	37	5	140730776	140730776	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr5:140730776G>T	ENST00000523390.1	+	1	949	c.949G>T	c.(949-951)Gct>Tct	p.A317S	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	317	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGTGTGGAAGCTAAGGATGG	0.418																																					p.A317S		.											.	PCDHGB1	33	0			c.G949T						.						105.0	106.0	106.0					5																	140730776		1966	4173	6139	SO:0001583	missense	56104	exon1			GTGGAAGCTAAGG	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.949G>T	5.37:g.140730776G>T	ENSP00000429273:p.Ala317Ser	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_018922	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	37	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	18.14	3.557170	0.65425	.	.	ENSG00000254221	ENST00000523390	T	0.58652	0.32	5.43	5.43	0.79202	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.84674	0.5524	H	0.96916	3.905	0.37380	D	0.91198	D;D	0.76494	0.999;0.999	D;D	0.73380	0.967;0.98	D	0.90993	0.4836	9	0.87932	D	0	.	19.2045	0.93724	0.0:0.0:1.0:0.0	.	317;317	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	S	317	ENSP00000429273:A317S	ENSP00000429273:A317S	A	+	1	0	PCDHGB1	140710960	1.000000	0.71417	1.000000	0.80357	0.518000	0.34316	9.692000	0.98682	2.706000	0.92434	0.563000	0.77884	GCT	.		0.418	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922	
PHF10	55274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	170114882	170114882	+	Silent	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr6:170114882G>T	ENST00000339209.4	-	7	873	c.750C>A	c.(748-750)gtC>gtA	p.V250V	PHF10_ENST00000366780.4_Silent_p.V248V|PHF10_ENST00000464779.1_5'Flank	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	250	SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		GGTAAGAACTGACCTTTGTTC	0.418																																					p.V250V		.											.	PHF10	226	0			c.C750A						.						189.0	180.0	183.0					6																	170114882		2203	4300	6503	SO:0001819	synonymous_variant	55274	exon7			AGAACTGACCTTT	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.750C>A	6.37:g.170114882G>T		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	38.0	NM_018288	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Silent	SNP	ENST00000339209.4	37	CCDS5308.2																																																																																			.		0.418	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
PKDREJ	10343	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46655628	46655628	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr22:46655628C>T	ENST00000253255.5	-	1	3591	c.3592G>A	c.(3592-3594)Gtg>Atg	p.V1198M		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1198					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		GCTAGGCCCACGTATAAGAGA	0.428																																					p.V1198M		.											.	PKDREJ	156	0			c.G3592A						.						124.0	127.0	126.0					22																	46655628		2203	4300	6503	SO:0001583	missense	10343	exon1			GGCCCACGTATAA	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.3592G>A	22.37:g.46655628C>T	ENSP00000253255:p.Val1198Met	Somatic	60.0	2.0		WXS	Illumina HiSeq	Phase_I	71.0	16.0	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	37	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	C	8.527	0.870208	0.17322	.	.	ENSG00000130943	ENST00000253255	T	0.38077	1.16	5.23	-7.21	0.01490	.	1.988140	0.02598	N	0.100789	T	0.15998	0.0385	N	0.11131	0.1	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.11743	-1.0575	10	0.46703	T	0.11	-0.9476	2.3818	0.04356	0.2229:0.3396:0.0837:0.3538	.	1198	Q9NTG1	PKDRE_HUMAN	M	1198	ENSP00000253255:V1198M	ENSP00000253255:V1198M	V	-	1	0	PKDREJ	45034292	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.078000	0.03413	-1.231000	0.02557	-1.421000	0.01109	GTG	.		0.428	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
PKP4	8502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	159526346	159526346	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:159526346A>G	ENST00000389759.3	+	17	2955	c.2843A>G	c.(2842-2844)aAa>aGa	p.K948R	PKP4_ENST00000389757.3_Missense_Mutation_p.K948R|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	948					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GTCACCAGCAAAAACATGGAG	0.592										HNSCC(62;0.18)																											p.K948R		.											.	PKP4	97	0			c.A2843G						.						50.0	50.0	50.0					2																	159526346		2203	4300	6503	SO:0001583	missense	8502	exon17			CCAGCAAAAACAT	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2843A>G	2.37:g.159526346A>G	ENSP00000374409:p.Lys948Arg	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	44.0	NM_001005476	Q86W91	Missense_Mutation	SNP	ENST00000389759.3	37	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.401250	0.62288	.	.	ENSG00000144283	ENST00000389757;ENST00000389759	T;T	0.50813	0.73;0.73	6.06	6.06	0.98353	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.41581	0.1165	L	0.33245	0.995	0.58432	D	0.999999	B;B;B	0.22276	0.011;0.067;0.053	B;B;B	0.23574	0.01;0.047;0.021	T	0.19549	-1.0302	10	0.46703	T	0.11	-15.8661	16.6127	0.84892	1.0:0.0:0.0:0.0	.	903;948;948	Q4W5T8;Q99569-2;Q99569	.;.;PKP4_HUMAN	R	948	ENSP00000374407:K948R;ENSP00000374409:K948R	ENSP00000374407:K948R	K	+	2	0	PKP4	159234592	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.187000	0.72039	2.322000	0.78497	0.528000	0.53228	AAA	.		0.592	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
POTEC	388468	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	14511960	14511960	+	Silent	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr18:14511960G>A	ENST00000358970.5	-	11	1565	c.1566C>T	c.(1564-1566)ctC>ctT	p.L522L		NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	522										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						TTTCACGCAAGAGATCTTCTT	0.343																																					p.L522L		.											.	POTEC	3	0			c.C1566T						.						78.0	59.0	64.0					18																	14511960		692	1591	2283	SO:0001819	synonymous_variant	388468	exon11			ACGCAAGAGATCT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.1566C>T	18.37:g.14511960G>A		Somatic	756.0	0.0		WXS	Illumina HiSeq	Phase_I	608.0	183.0	NM_001137671		Silent	SNP	ENST00000358970.5	37	CCDS45835.1																																																																																			.		0.343	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
PPDPF	79144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	62153144	62153144	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr20:62153144G>A	ENST00000370179.3	+	4	453	c.257G>A	c.(256-258)aGc>aAc	p.S86N	PPDPF_ENST00000473620.1_3'UTR|PPDPF_ENST00000370177.1_Missense_Mutation_p.S112N	NM_024299.2	NP_077275.1	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and proliferation factor	86					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)					kidney(1)|lung(2)|ovary(1)	4						GCCTCCAGCAGCATGACCGCC	0.672																																					p.S86N		.											.	PPDPF	90	0			c.G257A						.						27.0	28.0	28.0					20																	62153144		2200	4299	6499	SO:0001583	missense	79144	exon4			CCAGCAGCATGAC	AL121829	CCDS13523.1	20q13.33	2013-07-23	2013-07-23	2009-06-04	ENSG00000125534	ENSG00000125534			16142	protein-coding gene	gene with protein product	"""exocrine differentiation and proliferation factor"""		"""chromosome 20 open reading frame 149"", ""pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish)"""	C20orf149			Standard	NM_024299		Approved	dJ697K14.9, exdpf	uc002yff.3	Q9H3Y8	OTTHUMG00000032978	ENST00000370179.3:c.257G>A	20.37:g.62153144G>A	ENSP00000359198:p.Ser86Asn	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	21.0	NM_024299	E1P5J2|Q4VXP1|Q9H3Y7	Missense_Mutation	SNP	ENST00000370179.3	37	CCDS13523.1	.	.	.	.	.	.	.	.	.	.	.	0.017	-1.501254	0.01001	.	.	ENSG00000125534	ENST00000370179;ENST00000370177	.	.	.	4.38	3.43	0.39272	.	0.702747	0.14155	N	0.337752	T	0.36026	0.0952	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.21348	-1.0248	9	0.37606	T	0.19	-1.3352	11.9002	0.52680	0.0865:0.0:0.9135:0.0	.	86	Q9H3Y8	PPDPF_HUMAN	N	86;112	.	ENSP00000359196:S112N	S	+	2	0	PPDPF	61623588	0.001000	0.12720	0.003000	0.11579	0.013000	0.08279	0.691000	0.25467	0.837000	0.34925	-0.145000	0.13849	AGC	.		0.672	PPDPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080149.1		
PTPRU	10076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	29609329	29609329	+	Silent	SNP	G	G	C	rs142462225		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:29609329G>C	ENST00000345512.3	+	12	2139	c.2010G>C	c.(2008-2010)gcG>gcC	p.A670A	PTPRU_ENST00000356870.3_Silent_p.A670A|PTPRU_ENST00000460170.2_Silent_p.A670A|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000373779.3_Silent_p.A670A|PTPRU_ENST00000323874.8_Silent_p.A670A|PTPRU_ENST00000428026.2_Silent_p.A670A	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	670	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CCGAACTGGCGGCCAGCAGTC	0.637																																					p.A670A		.											.	PTPRU	291	0			c.G2010C						.						63.0	64.0	64.0					1																	29609329		2203	4300	6503	SO:0001819	synonymous_variant	10076	exon12			ACTGGCGGCCAGC	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2010G>C	1.37:g.29609329G>C		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	21.0	NM_133177	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	ENST00000345512.3	37	CCDS334.1																																																																																			G|1.000;A|0.000		0.637	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
PRSS38	339501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228004984	228004984	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:228004984G>T	ENST00000366757.3	+	3	410	c.386G>T	c.(385-387)tGg>tTg	p.W129L		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	129	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						CACACCCAGTGGTATGAGGTG	0.537																																					p.W129L		.											.	PRSS38	92	0			c.G386T						.						165.0	132.0	143.0					1																	228004984		2203	4300	6503	SO:0001583	missense	339501	exon3			CCCAGTGGTATGA		CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.386G>T	1.37:g.228004984G>T	ENSP00000355719:p.Trp129Leu	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	40.0	NM_183062	Q7RTY6	Missense_Mutation	SNP	ENST00000366757.3	37	CCDS1563.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801307	0.50315	.	.	ENSG00000185888	ENST00000366757	D	0.87729	-2.29	4.34	3.43	0.39272	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.182364	0.27331	N	0.019856	T	0.69450	0.3112	N	0.00190	-1.885	0.37097	D	0.899738	D	0.63046	0.992	P	0.61397	0.888	T	0.70543	-0.4843	10	0.12430	T	0.62	.	8.443	0.32826	0.1046:0.0:0.8954:0.0	.	129	A1L453	PRS38_HUMAN	L	129	ENSP00000355719:W129L	ENSP00000355719:W129L	W	+	2	0	PRSS38	226071607	0.996000	0.38824	0.998000	0.56505	0.804000	0.45430	1.004000	0.29822	1.429000	0.47314	0.655000	0.94253	TGG	.		0.537	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091981.1	NM_183062	
PYGL	5836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	51390766	51390766	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr14:51390766C>A	ENST00000216392.7	-	5	913	c.581G>T	c.(580-582)cGc>cTc	p.R194L	PYGL_ENST00000532462.1_Missense_Mutation_p.R194L|PYGL_ENST00000544180.2_Missense_Mutation_p.R160L	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	194					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)	p.R194L(1)		NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	GAATTCTGGGCGGGACTTCTC	0.438																																					p.R194L		.											.	PYGL	91	1	Substitution - Missense(1)	lung(1)	c.G581T						.						153.0	142.0	146.0					14																	51390766		2203	4300	6503	SO:0001583	missense	5836	exon5			TCTGGGCGGGACT		CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.581G>T	14.37:g.51390766C>A	ENSP00000216392:p.Arg194Leu	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	34.0	NM_002863	A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	ENST00000216392.7	37	CCDS32080.1	.	.	.	.	.	.	.	.	.	.	C	36	5.804547	0.96967	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.94417	-3.42;-3.42;-3.42	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.98570	0.9522	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.996	D	0.98903	1.0777	10	0.72032	D	0.01	-17.3855	19.8676	0.96824	0.0:1.0:0.0:0.0	.	160;216;194	F5H816;Q6P1L4;P06737	.;.;PYGL_HUMAN	L	194;160;194	ENSP00000431657:R194L;ENSP00000443787:R160L;ENSP00000216392:R194L	ENSP00000216392:R194L	R	-	2	0	PYGL	50460516	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	CGC	.		0.438	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390654.3	NM_002863	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33872221	33872221	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr15:33872221A>G	ENST00000389232.4	+	13	1383	c.1313A>G	c.(1312-1314)gAa>gGa	p.E438G	RYR3_ENST00000415757.3_Missense_Mutation_p.E438G	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	438					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTATAGAAGAAGTCCTGCAG	0.537																																					p.E438G		.											.	RYR3	520	0			c.A1313G						.						60.0	61.0	61.0					15																	33872221		2003	4169	6172	SO:0001583	missense	6263	exon13			TAGAAGAAGTCCT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1313A>G	15.37:g.33872221A>G	ENSP00000373884:p.Glu438Gly	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	41.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	A	10.07	1.250511	0.22880	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.88896	-2.44;-2.44	5.15	5.15	0.70609	Intracellular calcium-release channel (1);	0.057558	0.64402	D	0.000002	T	0.76343	0.3974	N	0.08118	0	0.48696	D	0.999695	P;P	0.38677	0.617;0.642	B;B	0.37144	0.242;0.182	T	0.76318	-0.3003	10	0.29301	T	0.29	.	10.3987	0.44216	0.8542:0.0:0.0:0.1458	.	438;438	Q15413-2;Q15413	.;RYR3_HUMAN	G	438	ENSP00000373884:E438G;ENSP00000399610:E438G	ENSP00000354735:E438G	E	+	2	0	RYR3	31659513	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	4.891000	0.63185	2.160000	0.67779	0.533000	0.62120	GAA	.		0.537	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SAAL1	113174	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	18105155	18105155	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr11:18105155delT	ENST00000524803.1	-	10	1215	c.1166delA	c.(1165-1167)gatfs	p.D390fs	SAAL1_ENST00000300013.4_Frame_Shift_Del_p.D389fs|SAAL1_ENST00000529318.1_Frame_Shift_Del_p.D392fs			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	390										breast(2)|large_intestine(5)|lung(8)	15						GTGGAAATCATCTTGGGTTAA	0.338																																					p.D389fs		.											.	SAAL1	90	0			c.1166delA						.						120.0	120.0	120.0					11																	18105155		2199	4293	6492	SO:0001589	frameshift_variant	113174	exon10			AAATCATCTTGGG	AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.1166delA	11.37:g.18105155delT	ENSP00000432487:p.Asp390fs	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	66.0	NM_138421	A6NH05	Frame_Shift_Del	DEL	ENST00000524803.1	37	CCDS31439.1																																																																																			.		0.338	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421	
SBF2	81846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	9868632	9868632	+	Splice_Site	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr11:9868632T>C	ENST00000256190.8	-	23	2944		c.e23-2		RP11-1H15.2_ENST00000533659.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2						cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GCTCACCCACTGTAAATAGAC	0.438																																					.		.											.	SBF2	93	0			c.2807-2A>G						.						153.0	134.0	140.0					11																	9868632		2201	4294	6495	SO:0001630	splice_region_variant	81846	exon24			ACCCACTGTAAAT	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.2807-2A>G	11.37:g.9868632T>C		Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	52.0	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Splice_Site	SNP	ENST00000256190.8	37	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.337280	0.60963	.	.	ENSG00000133812	ENST00000256190	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SBF2	9825208	1.000000	0.71417	0.984000	0.44739	0.502000	0.33828	7.798000	0.85924	2.308000	0.77769	0.533000	0.62120	.	.		0.438	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	Intron
SEC22B	9554	broad.mit.edu;bcgsc.ca	37	1	145109584	145109584	+	RNA	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:145109584G>A	ENST00000453618.1	+	0	573							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TCCCTAAGACGTTGGCTTTTG	0.428																																					.		.											.	.	.	0			.						.						474.0	466.0	469.0					1																	145109584		2038	4191	6229			9554	.			TAAGACGTTGGCT	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109584G>A		Somatic	357.0	0.0		WXS	Illumina HiSeq	Phase_I	486.0	38.0	.	A8K1G0	RNA	SNP	ENST00000453618.1	37																																																																																				.		0.428	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000038523.5	NM_004892	
SCNM1	79005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151139457	151139457	+	Missense_Mutation	SNP	C	C	T	rs587766695		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:151139457C>T	ENST00000368905.4	+	3	281	c.170C>T	c.(169-171)gCc>gTc	p.A57V	LYSMD1_ENST00000368908.5_5'Flank|SCNM1_ENST00000461862.1_3'UTR|LYSMD1_ENST00000440902.2_5'Flank	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	57					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GACACCCTGGCCATGCTGACT	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		18765	0.0		0.0	False		,,,				2504	0.001				p.A57V		.											.	SCNM1	94	0			c.C170T						.						85.0	71.0	76.0					1																	151139457		2203	4300	6503	SO:0001583	missense	79005	exon3			CCCTGGCCATGCT	BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.170C>T	1.37:g.151139457C>T	ENSP00000357901:p.Ala57Val	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	20.0	NM_024041	B4DWR1|Q5JR74	Missense_Mutation	SNP	ENST00000368905.4	37	CCDS987.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154406	0.78114	.	.	ENSG00000163156	ENST00000368905;ENST00000368902	.	.	.	5.81	5.81	0.92471	.	0.106317	0.64402	D	0.000009	T	0.15349	0.0370	L	0.29908	0.895	0.25115	N	0.990681	P;P	0.42296	0.775;0.617	B;B	0.39660	0.306;0.242	T	0.07028	-1.0794	9	0.46703	T	0.11	-2.7374	12.5078	0.55991	0.1667:0.8333:0.0:0.0	.	57;57	B4DWR1;Q9BWG6	.;SCNM1_HUMAN	V	57;22	.	ENSP00000357898:A22V	A	+	2	0	SCNM1	149406081	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.576000	0.60915	2.748000	0.94277	0.462000	0.41574	GCC	.		0.572	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034064.2	NM_024041	
SEL1L	6400	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	81965951	81965953	+	Splice_Site	DEL	ACC	ACC	-			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	ACC	ACC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr14:81965951_81965953delACC	ENST00000336735.4	-	7	947_948	c.831_832delGGT	c.(829-834)aaggtc>aatc	p.277_278KV>N	SEL1L_ENST00000555824.1_Splice_Site_p.277_278KV>N	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	277	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		TAATAGTATTACCTTTGCCTGAC	0.33																																					p.277_277del		.											.	SEL1L	227	0			c.831_831del						.																																			SO:0001630	splice_region_variant	6400	exon7			AGTATTACCTTTG		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.831+1GGT>-	14.37:g.81965951_81965953delACC		Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	30.0	NM_001244984	Q6UWT6|Q9P1T9|Q9UHK7	Frame_Shift_Del	DEL	ENST00000336735.4	37	CCDS9876.1																																																																																			.		0.330	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	In_Frame_Del
SHANK3	85358	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	51113571	51113571	+	Silent	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr22:51113571T>C	ENST00000414786.2	+	2	386	c.159T>C	c.(157-159)taT>taC	p.Y53Y	SHANK3_ENST00000262795.3_Silent_p.Y53Y|SHANK3_ENST00000445220.2_Silent_p.Y53Y			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	53	Intramolecular interaction with the ANK repeats. {ECO:0000250}.				adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CGCTCAACTATGGGCTTTTCC	0.711																																					p.Y53Y		.											.	SHANK3	69	0			c.T159C						.						6.0	7.0	7.0					22																	51113571		1811	3906	5717	SO:0001819	synonymous_variant	85358	exon2			CAACTATGGGCTT	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.159T>C	22.37:g.51113571T>C		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	24.0	NM_033517	D7UT47|Q8TET3	Silent	SNP	ENST00000414786.2	37																																																																																				.		0.711	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
SIGLEC9	27180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51633221	51633221	+	Missense_Mutation	SNP	T	T	C	rs377533277		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:51633221T>C	ENST00000250360.3	+	7	1344	c.1277T>C	c.(1276-1278)gTg>gCg	p.V426A	SIGLEC9_ENST00000440804.3_Intron	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	426					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CGCTCCTCAGTGGGGGAAGGA	0.617																																					p.V426A		.											.	SIGLEC9	91	0			c.T1277C						.						66.0	68.0	68.0					19																	51633221		2203	4300	6503	SO:0001583	missense	27180	exon7			CCTCAGTGGGGGA	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1277T>C	19.37:g.51633221T>C	ENSP00000250360:p.Val426Ala	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	29.0	NM_014441	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	0.026	-1.374328	0.01214	.	.	ENSG00000129450	ENST00000250360	T	0.04406	3.63	1.68	-3.36	0.04913	.	.	.	.	.	T	0.01592	0.0051	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.45116	-0.9283	9	0.02654	T	1	.	0.6084	0.00757	0.1948:0.3204:0.2742:0.2107	.	426	Q9Y336	SIGL9_HUMAN	A	426	ENSP00000250360:V426A	ENSP00000250360:V426A	V	+	2	0	SIGLEC9	56325033	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.773000	0.04689	-0.757000	0.04697	-0.505000	0.04504	GTG	.		0.617	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
SLCO1B1	10599	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	21325651	21325651	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:21325651C>A	ENST00000256958.2	+	3	248	c.152C>A	c.(151-153)tCc>tAc	p.S51Y		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	51					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	ATGAAAAGTTCCATCATTCAT	0.338																																					p.S51Y		.											.	SLCO1B1	97	0			c.C152A						.						168.0	154.0	159.0					12																	21325651		2202	4299	6501	SO:0001583	missense	10599	exon3			AAAGTTCCATCAT		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.152C>A	12.37:g.21325651C>A	ENSP00000256958:p.Ser51Tyr	Somatic	136.0	1.0		WXS	Illumina HiSeq	Phase_I	118.0	48.0	NM_006446	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	C	16.68	3.189140	0.57909	.	.	ENSG00000134538	ENST00000256958	T	0.58652	0.32	3.36	3.36	0.38483	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.109197	0.64402	D	0.000004	T	0.77805	0.4185	M	0.91510	3.215	0.44268	D	0.997124	D	0.59357	0.985	D	0.72075	0.976	T	0.81415	-0.0943	10	0.66056	D	0.02	.	10.1478	0.42774	0.0:0.8987:0.0:0.1013	.	51	Q9Y6L6	SO1B1_HUMAN	Y	51	ENSP00000256958:S51Y	ENSP00000256958:S51Y	S	+	2	0	SLCO1B1	21216918	0.931000	0.31567	1.000000	0.80357	0.783000	0.44284	1.280000	0.33202	1.874000	0.54306	0.313000	0.20887	TCC	.		0.338	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446	
SLMAP	7871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57898307	57898307	+	Silent	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:57898307T>A	ENST00000428312.1	+	18	1942	c.1848T>A	c.(1846-1848)ctT>ctA	p.L616L	SLMAP_ENST00000449503.2_Silent_p.L578L|SLMAP_ENST00000495364.1_Silent_p.L150L|SLMAP_ENST00000472546.1_3'UTR|SLMAP_ENST00000416870.1_Silent_p.L109L|SLMAP_ENST00000442599.2_Silent_p.L84L|SLMAP_ENST00000494088.1_Silent_p.L109L|SLMAP_ENST00000295952.3_Silent_p.L599L|SLMAP_ENST00000295951.3_Silent_p.L599L			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	616					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		GAGCTGAGCTTGAGCGGTGGC	0.463																																					p.L599L		.											.	SLMAP	90	0			c.T1797A						.						86.0	88.0	88.0					3																	57898307		2203	4300	6503	SO:0001819	synonymous_variant	7871	exon17			TGAGCTTGAGCGG	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.1848T>A	3.37:g.57898307T>A		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	18.0	NM_007159	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Silent	SNP	ENST00000428312.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.40|10.40	1.339658|1.339658	0.24339|0.24339	.|.	.|.	ENSG00000163681|ENSG00000163681	ENST00000417128|ENST00000416658;ENST00000438794	.|.	.|.	.|.	5.18|5.18	0.879|0.879	0.19155|0.19155	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	-4.2163|-4.2163	10.3039|10.3039	0.43670|0.43670	0.0:0.0748:0.5269:0.3983|0.0:0.0748:0.5269:0.3983	.|.	.|.	.|.	.|.	X|R	200|224;154	.|.	ENSP00000412829:L200X|.	L|X	+|+	2|1	0|0	SLMAP|SLMAP	57873347|57873347	0.913000|0.913000	0.31002|0.31002	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	-0.397000|-0.397000	0.07269|0.07269	0.352000|0.352000	0.24053|0.24053	0.459000|0.459000	0.35465|0.35465	TTG|TGA	.		0.463	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	
SNTG1	54212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	51617237	51617237	+	Silent	SNP	G	G	A	rs189241890		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr8:51617237G>A	ENST00000522124.1	+	16	1777	c.1116G>A	c.(1114-1116)gtG>gtA	p.V372V	SNTG1_ENST00000517473.1_Silent_p.V372V|SNTG1_ENST00000518864.1_Silent_p.V372V|SNTG1_ENST00000276467.5_Silent_p.V372V	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	372	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				ACTTCTCAGTGGAGCTGGAAA	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		17377	0.001		0.0	False		,,,				2504	0.0				p.V372V		.											.	SNTG1	95	0			c.G1116A						.						134.0	110.0	118.0					8																	51617237		2203	4300	6503	SO:0001819	synonymous_variant	54212	exon16			CTCAGTGGAGCTG	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1116G>A	8.37:g.51617237G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	14.0	NM_018967	Q2M3Q0|Q9NY98	Silent	SNP	ENST00000522124.1	37	CCDS6147.1																																																																																			G|0.999;A|0.000		0.542	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		
SSX1	6756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48125757	48125757	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chrX:48125757C>A	ENST00000376919.3	+	7	638	c.502C>A	c.(502-504)Ctg>Atg	p.L168M		NM_001278691.1|NM_005635.2	NP_001265620.1|NP_005626.1	Q16384	SSX1_HUMAN	synovial sarcoma, X breakpoint 1	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|transcription corepressor activity (GO:0003714)		SS18/SSX1(1169)|SS18L1/SSX1(2)	endometrium(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9						GACCCACAGACTGCGTGAGAG	0.498			T	SS18	synovial sarcoma																																p.L168M	Esophageal Squamous(175;994 1982 2214 6527 18857)	.		Dom	yes		X	Xp11.23-p11.22	6756	"""synovial sarcoma, X breakpoint 1"""		M	.	SSX1	522	0			c.C502A						.						289.0	281.0	284.0					X																	48125757		1511	2706	4217	SO:0001583	missense	6756	exon7			CACAGACTGCGTG	BC001003	CCDS14290.1	Xp11.23	2009-03-12			ENSG00000126752	ENSG00000126752			11335	protein-coding gene	gene with protein product	"""cancer/testis antigen family 5, member 1"""	312820				7655467	Standard	NM_005635		Approved	CT5.1	uc004djb.1	Q16384	OTTHUMG00000021488	ENST00000376919.3:c.502C>A	X.37:g.48125757C>A	ENSP00000366118:p.Leu168Met	Somatic	238.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	170.0	NM_005635	A3KN76|Q08AJ2|Q5JQ64	Missense_Mutation	SNP	ENST00000376919.3	37	CCDS14290.1	.	.	.	.	.	.	.	.	.	.	N	11.26	1.587650	0.28268	.	.	ENSG00000126752	ENST00000376919	T	0.19806	2.12	2.39	-1.68	0.08212	SSXRD motif (1);	0.211314	0.23727	N	0.045164	T	0.34337	0.0894	L	0.61218	1.895	0.09310	N	1	D	0.69078	0.997	D	0.79108	0.992	T	0.14615	-1.0466	10	0.87932	D	0	.	6.4281	0.21780	0.0:0.338:0.0:0.662	.	168	Q16384	SSX1_HUMAN	M	168	ENSP00000366118:L168M	ENSP00000366118:L168M	L	+	1	2	SSX1	48010701	0.004000	0.15560	0.000000	0.03702	0.031000	0.12232	-0.573000	0.05874	-0.651000	0.05415	0.380000	0.24917	CTG	.		0.498	SSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056485.1	NM_005635	
SPRY3	10251	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	155003829	155003829	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chrX:155003829T>C	ENST00000302805.2	+	2	727	c.296T>C	c.(295-297)cTc>cCc	p.L99P		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	99					multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GATCAAAGGCTCTTGGCCAGC	0.557																																					p.L99P		.											.	SPRY3	136	0			c.T296C						.						187.0	158.0	168.0					X																	155003829		2203	4296	6499	SO:0001583	missense	10251	exon2			AAAGGCTCTTGGC	AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.296T>C	X.37:g.155003829T>C	ENSP00000302978:p.Leu99Pro	Somatic	164.0	1.0		WXS	Illumina HiSeq	Phase_I	167.0	65.0	NM_005840	A8K0H8	Missense_Mutation	SNP	ENST00000302805.2	37	CCDS14769.4	.	.	.	.	.	.	.	.	.	.	T	12.76	2.033465	0.35893	.	.	ENSG00000168939	ENST00000302805	T	0.64618	-0.11	3.14	3.14	0.36123	.	0.000000	0.64402	D	0.000004	T	0.44603	0.1301	.	.	.	0.24216	N	0.995451	B	0.31290	0.318	B	0.18263	0.021	T	0.40040	-0.9584	9	0.49607	T	0.09	-26.6615	8.9341	0.35688	0.0:0.0:0.0:1.0	.	99	O43610	SPY3_HUMAN	P	99	ENSP00000302978:L99P	ENSP00000302978:L99P	L	+	2	0	SPRY3	154657023	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	5.693000	0.68264	1.286000	0.44565	0.231000	0.17811	CTC	.		0.557	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058823.2	NM_005840	
STK33	65975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	8457664	8457664	+	Silent	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr11:8457664A>G	ENST00000447869.1	-	9	1888	c.970T>C	c.(970-972)Ttg>Ctg	p.L324L	STK33_ENST00000315204.1_Silent_p.L324L|STK33_ENST00000358872.3_Silent_p.L137L|STK33_ENST00000396673.1_Silent_p.L324L|STK33_ENST00000473980.1_5'UTR|STK33_ENST00000396672.1_Silent_p.L324L|STK33_ENST00000534493.1_Silent_p.L283L			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	324	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		GAGCTTGCCAAAAAGGGTGGT	0.323																																					p.L324L		.											.	STK33	337	0			c.T970C						.						46.0	42.0	44.0					11																	8457664		2201	4296	6497	SO:0001819	synonymous_variant	65975	exon11			TTGCCAAAAAGGG	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.970T>C	11.37:g.8457664A>G		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	32.0	NM_030906	Q658S6|Q8NEF5	Silent	SNP	ENST00000447869.1	37	CCDS7789.1																																																																																			.		0.323	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276819.2	NM_030906	
STK40	83931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36809505	36809505	+	Silent	SNP	G	G	A	rs575567942	byFrequency	TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:36809505G>A	ENST00000373129.3	-	10	1366	c.960C>T	c.(958-960)gcC>gcT	p.A320A	STK40_ENST00000359297.2_Silent_p.A320A|STK40_ENST00000373130.3_Silent_p.A325A|STK40_ENST00000373132.3_Silent_p.A320A	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	320	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				CGTCGGCGGCGGCCAGGCGCT	0.642													G|||	7	0.00139776	0.0	0.0	5008	,	,		19335	0.0		0.0	False		,,,				2504	0.0072				p.A320A		.											.	STK40	83	0			c.C960T						.						28.0	30.0	29.0					1																	36809505		2202	4296	6498	SO:0001819	synonymous_variant	83931	exon10			GGCGGCGGCCAGG	BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.960C>T	1.37:g.36809505G>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	33.0	NM_032017	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Silent	SNP	ENST00000373129.3	37	CCDS407.1																																																																																			.		0.642	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022592.1	NM_032017	
STPG2	285555	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	98893569	98893569	+	Silent	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:98893569C>T	ENST00000295268.3	-	7	884	c.795G>A	c.(793-795)ttG>ttA	p.L265L		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	265																	TAGTATTGTTCAAGACATTAT	0.308																																					p.L265L		.											.	.	.	0			c.G795A						.						46.0	48.0	47.0					4																	98893569		2203	4300	6503	SO:0001819	synonymous_variant	285555	exon7			ATTGTTCAAGACA	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.795G>A	4.37:g.98893569C>T		Somatic	295.0	1.0		WXS	Illumina HiSeq	Phase_I	300.0	97.0	NM_174952		Silent	SNP	ENST00000295268.3	37	CCDS3645.1																																																																																			.		0.308	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
STPG2	285555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	98902423	98902423	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr4:98902423T>A	ENST00000295268.3	-	6	748	c.659A>T	c.(658-660)aAt>aTt	p.N220I		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	220																	TCGAGGTTCATTATATGTGCC	0.378																																					p.N220I		.											.	.	.	0			c.A659T						.						122.0	121.0	121.0					4																	98902423		2203	4300	6503	SO:0001583	missense	285555	exon6			GGTTCATTATATG	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.659A>T	4.37:g.98902423T>A	ENSP00000295268:p.Asn220Ile	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	28.0	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.646291	0.47258	.	.	ENSG00000163116	ENST00000295268	T	0.13657	2.57	5.58	5.58	0.84498	.	0.339492	0.29707	N	0.011413	T	0.34048	0.0884	M	0.61703	1.905	0.35258	D	0.779367	D	0.62365	0.991	D	0.66847	0.947	T	0.46091	-0.9216	10	0.87932	D	0	-26.004	14.7372	0.69424	0.0:0.0:0.0:1.0	.	220	Q8N412	CD037_HUMAN	I	220	ENSP00000295268:N220I	ENSP00000295268:N220I	N	-	2	0	C4orf37	99121446	1.000000	0.71417	0.567000	0.28434	0.140000	0.21249	3.460000	0.53028	2.118000	0.64928	0.460000	0.39030	AAT	.		0.378	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
SULF1	23213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	70551048	70551048	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr8:70551048C>T	ENST00000260128.4	+	21	3223	c.2506C>T	c.(2506-2508)Caa>Taa	p.Q836*	SULF1_ENST00000402687.4_Nonsense_Mutation_p.Q836*|SULF1_ENST00000458141.2_Nonsense_Mutation_p.Q836*|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Nonsense_Mutation_p.Q836*	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	836					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CAGAAGCTGTCAAGGATATAA	0.383																																					p.Q836X		.											.	SULF1	518	0			c.C2506T						.						94.0	82.0	86.0					8																	70551048		2203	4300	6503	SO:0001587	stop_gained	23213	exon21			AGCTGTCAAGGAT	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2506C>T	8.37:g.70551048C>T	ENSP00000260128:p.Gln836*	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	333.0	72.0	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Nonsense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	C	48	14.004790	0.99774	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3457	0.94362	0.0:1.0:0.0:0.0	.	.	.	.	X	836	.	ENSP00000260128:Q836X	Q	+	1	0	SULF1	70713602	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.748000	0.85085	2.645000	0.89757	0.650000	0.86243	CAA	.		0.383	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
TERF1	7013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	73944310	73944310	+	Silent	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr8:73944310A>G	ENST00000276603.5	+	8	1004	c.981A>G	c.(979-981)caA>caG	p.Q327Q	TERF1_ENST00000276602.6_Silent_p.Q307Q|TERF1_ENST00000520783.1_3'UTR	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	327	Interaction with RLIM.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			CTAAGTTGCAACATGGAACCC	0.353																																					p.Q327Q		.											.	TERF1	228	0			c.A981G						.						81.0	76.0	78.0					8																	73944310		2203	4300	6503	SO:0001819	synonymous_variant	7013	exon8			GTTGCAACATGGA	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.981A>G	8.37:g.73944310A>G		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	106.0	NM_017489	A7XP29|Q15553|Q8NHT6|Q93029	Silent	SNP	ENST00000276603.5	37	CCDS6211.1																																																																																			.		0.353	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	70333914	70333914	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr10:70333914A>G	ENST00000373644.4	+	2	2028	c.1819A>G	c.(1819-1821)Act>Gct	p.T607A		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	607	Sufficient for binding to genomic CpG islands.				chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TGGTGAATGCACTTACTGCAA	0.438																																					p.T607A		.											.	TET1	663	0			c.A1819G						.						89.0	95.0	93.0					10																	70333914		2203	4300	6503	SO:0001583	missense	80312	exon2			GAATGCACTTACT	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1819A>G	10.37:g.70333914A>G	ENSP00000362748:p.Thr607Ala	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	14.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531756	0.64972	.	.	ENSG00000138336	ENST00000373644	T	0.07114	3.22	5.27	4.12	0.48240	Zinc finger, CXXC-type (2);	0.401888	0.21188	N	0.078690	T	0.06690	0.0171	N	0.05078	-0.115	0.29792	N	0.833118	P	0.52463	0.953	P	0.49752	0.621	T	0.07385	-1.0775	10	0.54805	T	0.06	.	9.9056	0.41375	0.9207:0.0:0.0793:0.0	.	607	Q8NFU7	TET1_HUMAN	A	607	ENSP00000362748:T607A	ENSP00000362748:T607A	T	+	1	0	TET1	70003920	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.158000	0.77470	1.985000	0.57927	0.383000	0.25322	ACT	.		0.438	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
TICRR	90381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90159653	90159653	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr15:90159653A>T	ENST00000268138.7	+	16	2992	c.2887A>T	c.(2887-2889)Act>Tct	p.T963S	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Missense_Mutation_p.T962S			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	963					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										CAAACTGCTGACTAAGAGTGT	0.453																																					p.T963S		.											.	.	.	0			c.A2887T						.						62.0	63.0	63.0					15																	90159653		1971	4150	6121	SO:0001583	missense	90381	exon16			CTGCTGACTAAGA	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2887A>T	15.37:g.90159653A>T	ENSP00000268138:p.Thr963Ser	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	20.0	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	A	26.0	4.697531	0.88830	.	.	ENSG00000140534	ENST00000268138	T	0.31510	1.49	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.51058	0.1652	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.44205	-0.9343	10	0.36615	T	0.2	-21.6679	14.3845	0.66934	1.0:0.0:0.0:0.0	.	963	Q7Z2Z1	TICRR_HUMAN	S	963	ENSP00000268138:T963S	ENSP00000268138:T963S	T	+	1	0	C15orf42	87960657	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.892000	0.87324	2.211000	0.71520	0.533000	0.62120	ACT	.		0.453	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
TMEM132B	114795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	126068404	126068404	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:126068404A>T	ENST00000299308.3	+	5	1294	c.1286A>T	c.(1285-1287)gAg>gTg	p.E429V		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	429						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		TAGGACACCGAGGTTTTGAAC	0.547																																					p.E429V		.											.	TMEM132B	185	0			c.A1286T						.						221.0	217.0	218.0					12																	126068404		1981	4130	6111	SO:0001583	missense	114795	exon5			ACACCGAGGTTTT	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1286A>T	12.37:g.126068404A>T	ENSP00000299308:p.Glu429Val	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	15.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	A	16.47	3.132318	0.56828	.	.	ENSG00000139364	ENST00000299308	T	0.17854	2.25	4.83	4.83	0.62350	.	0.000000	0.37219	U	0.002196	T	0.41811	0.1175	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39881	-0.9592	10	0.87932	D	0	.	13.3917	0.60827	1.0:0.0:0.0:0.0	.	429	Q14DG7	T132B_HUMAN	V	429	ENSP00000299308:E429V	ENSP00000299308:E429V	E	+	2	0	TMEM132B	124634357	1.000000	0.71417	0.994000	0.49952	0.126000	0.20510	7.988000	0.88194	1.800000	0.52685	0.533000	0.62120	GAG	.		0.547	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
TMEM87A	25963	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	42519078	42519078	+	Silent	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr15:42519078G>A	ENST00000389834.4	-	15	1593	c.1329C>T	c.(1327-1329)gcC>gcT	p.A443A	TMEM87A_ENST00000448392.1_Silent_p.A382A|RP11-546B15.1_ENST00000563846.1_RNA	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	443						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		AGCGCCAGATGGCATCGTCTA	0.468																																					p.A443A		.											.	TMEM87A	91	0			c.C1329T						.						132.0	120.0	124.0					15																	42519078		2203	4299	6502	SO:0001819	synonymous_variant	25963	exon15			CCAGATGGCATCG	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.1329C>T	15.37:g.42519078G>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	14.0	NM_015497	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Silent	SNP	ENST00000389834.4	37	CCDS32205.1																																																																																			.		0.468	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2	NM_015497	
TNK2	10188	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195609177	195609177	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:195609177C>A	ENST00000333602.6	-	6	1249	c.632G>T	c.(631-633)gGa>gTa	p.G211V	TNK2_ENST00000468819.1_5'UTR|TNK2_ENST00000392400.1_Missense_Mutation_p.G211V|TNK2_ENST00000381916.2_Missense_Mutation_p.G274V|TNK2_ENST00000428187.1_Missense_Mutation_p.G243V|TNK2_ENST00000316664.3_Missense_Mutation_p.G211V	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	211	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CAACAACGATCCCAGAGGTGC	0.657																																					p.G274V		.											.	TNK2	957	0			c.G821T						.						49.0	47.0	47.0					3																	195609177		2203	4300	6503	SO:0001583	missense	10188	exon6			AACGATCCCAGAG	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.632G>T	3.37:g.195609177C>A	ENSP00000329425:p.Gly211Val	Somatic	131.0	1.0		WXS	Illumina HiSeq	Phase_I	127.0	36.0	NM_001010938	Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	ENST00000333602.6	37	CCDS33928.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.2|24.2	4.502779|4.502779	0.85176|0.85176	.|.	.|.	ENSG00000061938|ENSG00000061938	ENST00000438207|ENST00000333602;ENST00000381916;ENST00000428187;ENST00000392400;ENST00000316664	.|D;D;D;D;D	.|0.90004	.|-2.6;-2.6;-2.6;-2.6;-2.6	5.41|5.41	4.53|4.53	0.55603|0.55603	.|Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97056|0.97056	0.9038|0.9038	H|H	0.99573|0.99573	4.635|4.635	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0	D|D	0.98395|0.98395	1.0565|1.0565	5|10	.|0.87932	.|D	.|0	.|.	14.5028|14.5028	0.67734|0.67734	0.1481:0.8519:0.0:0.0|0.1481:0.8519:0.0:0.0	.|.	.|211;87;211;274;243	.|Q07912-2;Q59FX1;Q07912;Q07912-3;C9J1X3	.|.;.;ACK1_HUMAN;.;.	Y|V	136|211;274;243;211;211	.|ENSP00000329425:G211V;ENSP00000371341:G274V;ENSP00000392546:G243V;ENSP00000376201:G211V;ENSP00000323216:G211V	.|ENSP00000323216:G211V	D|G	-|-	1|2	0|0	TNK2|TNK2	197093574|197093574	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.998000|0.998000	0.95712|0.95712	7.669000|7.669000	0.83911|0.83911	1.387000|1.387000	0.46486|0.46486	0.655000|0.655000	0.94253|0.94253	GAT|GGA	.		0.657	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
TPTE	7179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	10942966	10942966	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr21:10942966A>T	ENST00000361285.4	-	12	950	c.621T>A	c.(619-621)caT>caA	p.H207Q	TPTE_ENST00000298232.7_Missense_Mutation_p.H189Q|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.H169Q	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	207					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GATGAAACAGATGAAAAATTC	0.318																																					p.H207Q		.											.	TPTE	344	0			c.T621A						.						87.0	81.0	83.0					21																	10942966		2203	4299	6502	SO:0001583	missense	7179	exon12			AAACAGATGAAAA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.621T>A	21.37:g.10942966A>T	ENSP00000355208:p.His207Gln	Somatic	695.0	0.0		WXS	Illumina HiSeq	Phase_I	572.0	99.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	0.723	-0.782935	0.02907	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.97404	-4.37;-4.37;-4.37	2.07	-0.677	0.11357	Ion transport (1);	0.250767	0.35708	N	0.003023	D	0.92977	0.7765	L	0.51422	1.61	0.23156	N	0.998209	B;B;B	0.32862	0.12;0.2;0.387	B;B;B	0.35813	0.112;0.112;0.211	D	0.85531	0.1209	10	0.30854	T	0.27	-21.1403	3.6276	0.08119	0.5657:0.22:0.0:0.2143	.	169;189;207	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	Q	189;207;169	ENSP00000298232:H189Q;ENSP00000355208:H207Q;ENSP00000344441:H169Q	ENSP00000298232:H189Q	H	-	3	2	TPTE	9964837	0.825000	0.29262	0.243000	0.24186	0.026000	0.11368	-0.312000	0.08113	-0.144000	0.11314	0.163000	0.16589	CAT	.		0.318	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
TRPC6	7225	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	101375213	101375213	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr11:101375213delC	ENST00000344327.3	-	2	911	c.487delG	c.(487-489)gatfs	p.D163fs	TRPC6_ENST00000532133.1_Frame_Shift_Del_p.D163fs|TRPC6_ENST00000348423.4_Frame_Shift_Del_p.D163fs|TRPC6_ENST00000526713.1_5'Flank|TRPC6_ENST00000360497.4_Frame_Shift_Del_p.D163fs	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	163					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AGCAAAGCATCCCCAACTCGA	0.463																																					p.D163fs	Colon(166;1315 1927 11094 12848 34731)	.											.	TRPC6	93	0			c.487delG						.						63.0	63.0	63.0					11																	101375213		2203	4299	6502	SO:0001589	frameshift_variant	7225	exon2			AAGCATCCCCAAC	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.487delG	11.37:g.101375213delC	ENSP00000340913:p.Asp163fs	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	21.0	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Frame_Shift_Del	DEL	ENST00000344327.3	37	CCDS8311.1																																																																																			.		0.463	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
TRPM6	140803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	77442785	77442785	+	Silent	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr9:77442785C>T	ENST00000360774.1	-	7	987	c.750G>A	c.(748-750)ctG>ctA	p.L250L	TRPM6_ENST00000451710.3_Silent_p.L250L|TRPM6_ENST00000376871.3_Silent_p.L250L|TRPM6_ENST00000376864.4_Silent_p.L250L|TRPM6_ENST00000359047.2_Silent_p.L250L|TRPM6_ENST00000376872.3_Silent_p.L250L|TRPM6_ENST00000483186.1_5'UTR|TRPM6_ENST00000361255.3_Silent_p.L245L|TRPM6_ENST00000449912.2_Silent_p.L245L	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	250					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CATCATCAGACAGGATGAAGT	0.502																																					p.L250L		.											.	TRPM6	335	0			c.G750A						.						186.0	163.0	171.0					9																	77442785		2203	4300	6503	SO:0001819	synonymous_variant	140803	exon7			ATCAGACAGGATG	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.750G>A	9.37:g.77442785C>T		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	28.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	ENST00000360774.1	37	CCDS6647.1																																																																																			.		0.502	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
TSPAN31	6302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	58140038	58140038	+	Splice_Site	SNP	A	A	C			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:58140038A>C	ENST00000257910.3	+	3	585	c.311A>C	c.(310-312)cAg>cCg	p.Q104P	TSPAN31_ENST00000547472.1_Intron|CDK4_ENST00000551888.1_5'Flank|TSPAN31_ENST00000553221.1_3'UTR|TSPAN31_ENST00000547992.1_Intron	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31	104					positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CGAAGCAAACAGGTAAGACAG	0.403																																					p.Q104P		.											.	TSPAN31	446	0			c.A311C						.						213.0	192.0	199.0					12																	58140038		2202	4300	6502	SO:0001630	splice_region_variant	6302	exon3			GCAAACAGGTAAG		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999		ENST00000257910.3:c.312+1A>C	12.37:g.58140038A>C		Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	40.0	NM_005981	O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	37	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.446890	0.84101	.	.	ENSG00000135452	ENST00000257910;ENST00000552816;ENST00000548167	T	0.79352	-1.26	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.88058	0.6335	M	0.84948	2.725	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.88178	0.2869	10	0.39692	T	0.17	-2.103	13.804	0.63218	1.0:0.0:0.0:0.0	.	104	Q12999	TSN31_HUMAN	P	104;26;26	ENSP00000257910:Q104P	ENSP00000257910:Q104P	Q	+	2	0	TSPAN31	56426305	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	8.356000	0.90085	2.152000	0.67230	0.455000	0.32223	CAG	.		0.403	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1		Missense_Mutation
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179432581	179432581	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:179432581C>T	ENST00000591111.1	-	276	73579	c.73355G>A	c.(73354-73356)gGa>gAa	p.G24452E	TTN_ENST00000342992.6_Missense_Mutation_p.G23525E|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.G17028E|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.G26093E|TTN_ENST00000342175.6_Missense_Mutation_p.G17220E|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.G17153E|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24452	Fibronectin type-III 78. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTGGGGTTCCTGGTGGGTC	0.403																																					p.G26093E		.											.	TTN	636	0			c.G78278A						.						187.0	178.0	181.0					2																	179432581		1877	4112	5989	SO:0001583	missense	7273	exon326			GGGGTTCCTGGTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.73355G>A	2.37:g.179432581C>T	ENSP00000465570:p.Gly24452Glu	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	40.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	13.86	2.362576	0.41902	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.58	5.58	0.84498	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74419	0.3714	M	0.74546	2.27	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.76697	-0.2864	9	0.87932	D	0	.	19.5644	0.95388	0.0:1.0:0.0:0.0	.	17028;17153;17220;24452	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	23525;17028;17220;17153;17026	ENSP00000343764:G23525E;ENSP00000434586:G17028E;ENSP00000340554:G17220E;ENSP00000352154:G17153E	ENSP00000340554:G17220E	G	-	2	0	TTN	179140827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.770000	0.85390	2.615000	0.88500	0.555000	0.69702	GGA	.		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179554080	179554080	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:179554080T>G	ENST00000591111.1	-	122	31221	c.30997A>C	c.(30997-30999)Aaa>Caa	p.K10333Q	TTN_ENST00000342992.6_Missense_Mutation_p.K9406Q|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K10650Q|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGGAACTTTCTTCTTTGGT	0.368																																					p.K10650Q		.											.	TTN	636	0			c.A31948C						.						127.0	123.0	124.0					2																	179554080		1835	4086	5921	SO:0001583	missense	7273	exon124			GAACTTTCTTCTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30997A>C	2.37:g.179554080T>G	ENSP00000465570:p.Lys10333Gln	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	35.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	10.68	1.418144	0.25552	.	.	ENSG00000155657	ENST00000342992;ENST00000414766;ENST00000473181	T;T	0.64618	-0.11;-0.11	5.08	3.92	0.45320	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.48059	0.1479	L	0.36672	1.1	0.80722	D	1	B;B	0.20671	0.047;0.032	B;B	0.21917	0.025;0.037	T	0.53683	-0.8404	9	0.87932	D	0	.	4.5138	0.11924	0.0:0.15:0.3344:0.5156	.	10333;10333	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	Q	9406;528;133	ENSP00000343764:K9406Q;ENSP00000401501:K528Q	ENSP00000343764:K9406Q	K	-	1	0	TTN	179262325	0.000000	0.05858	1.000000	0.80357	0.769000	0.43574	-0.763000	0.04740	2.048000	0.60808	0.482000	0.46254	AAA	.		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179614607	179614607	+	Intron	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:179614607C>A	ENST00000591111.1	-	45	10585				TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.D4174Y|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGATGGAATCCCCTTCTCTA	0.373																																					p.D4174Y		.											.	TTN	636	0			c.G12520T						.						67.0	72.0	70.0					2																	179614607		2202	4298	6500	SO:0001627	intron_variant	7273	exon46			TGGAATCCCCTTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3243G>T	2.37:g.179614607C>A		Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	59.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	16.50	3.139506	0.56936	.	.	ENSG00000155657	ENST00000360870	T	0.47177	0.85	5.77	4.89	0.63831	.	.	.	.	.	T	0.53481	0.1799	L	0.53617	1.68	0.53688	D	0.999979	P	0.52692	0.955	P	0.50537	0.643	T	0.57808	-0.7747	9	0.66056	D	0.02	.	13.9172	0.63905	0.0:0.926:0.0:0.074	.	4174	Q8WZ42-6	.	Y	4174	ENSP00000354117:D4174Y	ENSP00000354117:D4174Y	D	-	1	0	TTN	179322852	0.907000	0.30839	0.643000	0.29450	0.967000	0.64934	2.205000	0.42770	1.417000	0.47077	0.655000	0.94253	GAT	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TUBGCP3	10426	broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	113210371	113210371	+	Missense_Mutation	SNP	G	G	A	rs186110739		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr13:113210371G>A	ENST00000261965.3	-	6	902	c.716C>T	c.(715-717)aCg>aTg	p.T239M	TUBGCP3_ENST00000375669.3_Missense_Mutation_p.T239M	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	239					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CTCACCACCCGTATCCCCTTC	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		18470	0.001		0.0	False		,,,				2504	0.0				p.T239M		.											.	TUBGCP3	90	0			c.C716T						.						168.0	138.0	148.0					13																	113210371		2203	4300	6503	SO:0001583	missense	10426	exon6			CCACCCGTATCCC	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.716C>T	13.37:g.113210371G>A	ENSP00000261965:p.Thr239Met	Somatic	88.0	1.0		WXS	Illumina HiSeq	Phase_I	74.0	24.0	NM_006322	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	ENST00000261965.3	37	CCDS9525.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	8.053	0.766478	0.15983	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.23552	1.9;1.9	5.07	3.3	0.37823	.	1.186530	0.05794	N	0.610854	T	0.25717	0.0626	L	0.36672	1.1	0.09310	N	1	B;D;B;B	0.56746	0.33;0.977;0.317;0.33	B;P;B;B	0.45167	0.094;0.472;0.299;0.094	T	0.17410	-1.0370	10	0.48119	T	0.1	-1.5659	7.9724	0.30134	0.1459:0.1328:0.7213:0.0	.	229;239;239;239	B4DYP7;Q96CW5-3;Q96CW5-2;Q96CW5	.;.;.;GCP3_HUMAN	M	239	ENSP00000261965:T239M;ENSP00000364821:T239M	ENSP00000261965:T239M	T	-	2	0	TUBGCP3	112258372	0.009000	0.17119	0.000000	0.03702	0.475000	0.33008	1.752000	0.38349	0.632000	0.30432	0.638000	0.83543	ACG	G|0.999;A|0.000		0.468	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2	NM_006322	
UHRF1BP1L	23074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	100452950	100452950	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr12:100452950C>T	ENST00000279907.7	-	14	2317	c.2105G>A	c.(2104-2106)tGg>tAg	p.W702*	UHRF1BP1L_ENST00000545232.2_Nonsense_Mutation_p.W352*	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	702										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						ATAATCTATCCAAAATTGAGA	0.358																																					p.W702X		.											.	UHRF1BP1L	24	0			c.G2105A						.						77.0	84.0	81.0					12																	100452950		2203	4300	6503	SO:0001587	stop_gained	23074	exon14			TCTATCCAAAATT		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.2105G>A	12.37:g.100452950C>T	ENSP00000279907:p.Trp702*	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	46.0	NM_015054	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Nonsense_Mutation	SNP	ENST00000279907.7	37	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	C	38	7.178588	0.98118	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-4.5418	20.0118	0.97458	0.0:1.0:0.0:0.0	.	.	.	.	X	702;352	.	ENSP00000279907:W702X	W	-	2	0	UHRF1BP1L	98977081	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.625000	0.83145	2.742000	0.94016	0.650000	0.86243	TGG	.		0.358	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
VWDE	221806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	12375836	12375836	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr7:12375836C>A	ENST00000275358.3	-	27	4773	c.4585G>T	c.(4585-4587)Ggt>Tgt	p.G1529C		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1529	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						CATTCACCACCGTTTTTACAT	0.393																																					p.G1529C		.											.	VWDE	68	0			c.G4585T						.						105.0	99.0	101.0					7																	12375836		692	1591	2283	SO:0001583	missense	221806	exon27			CACCACCGTTTTT		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.4585G>T	7.37:g.12375836C>A	ENSP00000275358:p.Gly1529Cys	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	45.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497463	0.44455	.	.	ENSG00000146530	ENST00000275358	T	0.67698	-0.28	4.93	4.05	0.47172	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.112905	0.64402	D	0.000010	D	0.88190	0.6370	H	0.98701	4.305	0.33785	D	0.624754	D	0.89917	1.0	D	0.69654	0.965	D	0.94734	0.7912	10	0.87932	D	0	.	13.7701	0.63019	0.0:0.9257:0.0:0.0743	.	1529	Q8N2E2	VWDE_HUMAN	C	1529	ENSP00000275358:G1529C	ENSP00000275358:G1529C	G	-	1	0	VWDE	12342361	0.990000	0.36364	0.238000	0.24106	0.015000	0.08874	3.827000	0.55745	1.434000	0.47414	0.655000	0.94253	GGT	.		0.393	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168115372	168115372	+	Silent	SNP	G	G	A	rs371997749		TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr2:168115372G>A	ENST00000409728.1	+	11	2504	c.2415G>A	c.(2413-2415)tcG>tcA	p.S805S	XIRP2_ENST00000409043.1_Silent_p.S772S|XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000409756.2_Silent_p.S772S|XIRP2_ENST00000420519.1_Silent_p.S805S|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409605.1_Silent_p.S550S|XIRP2_ENST00000295237.9_3'UTR	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	94					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGACTTATTCGAGGAATGTAC	0.413																																					p.S805S		.											.	XIRP2	104	0			c.G2415A						.	G	,,,,	0,3678		0,0,1839	41.0	40.0	40.0		2316,2415,,1650,	-11.3	0.0	2		40	1,8185		0,1,4092	no	coding-synonymous,coding-synonymous,utr-3,coding-synonymous,utr-3	XIRP2	NM_001079810.3,NM_001199143.1,NM_001199144.1,NM_001199145.1,NM_152381.5	,,,,	0,1,5931	AA,AG,GG		0.0122,0.0,0.0084	,,,,	772/939,805/972,,550/717,	168115372	1,11863	1839	4093	5932	SO:0001819	synonymous_variant	129446	exon11			TTATTCGAGGAAT	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2415G>A	2.37:g.168115372G>A		Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	47.0	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409728.1	37	CCDS56143.1																																																																																			.		0.413	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
ZBP1	81030	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	20	56179629	56179629	+	Silent	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr20:56179629C>T	ENST00000371173.3	-	8	1467	c.1290G>A	c.(1288-1290)taG>taA	p.*430*	ZBP1_ENST00000340462.4_Silent_p.*407*|ZBP1_ENST00000395822.3_Silent_p.*355*	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	0					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			AGGCTGTGCACTAAATCCCAC	0.562																																					p.X430X		.											.	ZBP1	228	0			c.G1290A						.						91.0	82.0	85.0					20																	56179629		2203	4300	6503	SO:0001819	synonymous_variant	81030	exon8			TGTGCACTAAATC	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.1290G>A	20.37:g.56179629C>T		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	12.0	NM_030776	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Silent	SNP	ENST00000371173.3	37	CCDS13461.1																																																																																			.		0.562	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
ZMPSTE24	10269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40735691	40735691	+	Silent	SNP	G	G	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr1:40735691G>T	ENST00000372759.3	+	5	684	c.519G>T	c.(517-519)gtG>gtT	p.V173V		NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	173					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AATTTGTTGTGACTCAGTGTA	0.338																																					p.V173V		.											.	ZMPSTE24	226	0			c.G519T						.						190.0	196.0	194.0					1																	40735691		2203	4300	6503	SO:0001819	synonymous_variant	10269	exon5			TGTTGTGACTCAG	Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.519G>T	1.37:g.40735691G>T		Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	60.0	NM_005857	B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Silent	SNP	ENST00000372759.3	37	CCDS449.1																																																																																			.		0.338	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015766.1		
ZNF417	147687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58419943	58419943	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:58419943C>T	ENST00000312026.5	-	3	1867	c.1703G>A	c.(1702-1704)aGt>aAt	p.S568N	ZNF417_ENST00000536263.1_Missense_Mutation_p.S369N|ZNF417_ENST00000595559.1_Missense_Mutation_p.S567N|CTD-2583A14.9_ENST00000602124.1_Intron	NM_152475.2	NP_689688.2	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	568					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|stomach(3)|upper_aerodigestive_tract(1)	18		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		CCTGTGTGAACTCTGATGATG	0.423																																					p.S568N		.											.	ZNF417	90	0			c.G1703A						.						76.0	78.0	77.0					19																	58419943		2203	4297	6500	SO:0001583	missense	147687	exon3			TGTGAACTCTGAT	BC025783	CCDS12965.1, CCDS74469.1	19q13.43	2013-01-08				ENSG00000173480		"""Zinc fingers, C2H2-type"", ""-"""	20646	protein-coding gene	gene with protein product							Standard	NM_152475		Approved	MGC34079	uc002qqq.3	Q8TAU3		ENST00000312026.5:c.1703G>A	19.37:g.58419943C>T	ENSP00000311319:p.Ser568Asn	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	346.0	66.0	NM_152475	B4DEU1	Missense_Mutation	SNP	ENST00000312026.5	37	CCDS12965.1	.	.	.	.	.	.	.	.	.	.	.	10.07	1.249834	0.22880	.	.	ENSG00000173480	ENST00000312026;ENST00000536263	T;T	0.06687	3.4;3.27	2.65	-2.31	0.06765	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06050	0.0157	L	0.28274	0.84	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.38265	-0.9669	9	0.87932	D	0	.	8.291	0.31958	0.0:0.5528:0.0:0.4472	.	568	Q8TAU3	ZN417_HUMAN	N	568;369	ENSP00000311319:S568N;ENSP00000442760:S369N	ENSP00000311319:S568N	S	-	2	0	ZNF417	63111755	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.066000	0.03454	-0.328000	0.08539	0.461000	0.40582	AGT	.		0.423	ZNF417-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466860.1	NM_152475	
ZNF502	91392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	44762400	44762400	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr3:44762400G>A	ENST00000296091.4	+	4	347	c.91G>A	c.(91-93)Gat>Aat	p.D31N	ZNF502_ENST00000449836.1_Missense_Mutation_p.D31N|ZNF502_ENST00000436624.2_Missense_Mutation_p.D31N	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	31					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		TCTGGAGCAGGATGTCTGTAA	0.423																																					p.D31N		.											.	ZNF502	90	0			c.G91A						.						64.0	68.0	67.0					3																	44762400		2203	4300	6503	SO:0001583	missense	91392	exon4			GAGCAGGATGTCT	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.91G>A	3.37:g.44762400G>A	ENSP00000296091:p.Asp31Asn	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	36.0	NM_001134440		Missense_Mutation	SNP	ENST00000296091.4	37	CCDS2719.1	.	.	.	.	.	.	.	.	.	.	G	8.359	0.832743	0.16820	.	.	ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624;ENST00000427783;ENST00000411443	T;T;T;T	0.55588	3.17;3.17;3.17;0.51	4.41	1.6	0.23607	.	.	.	.	.	T	0.26774	0.0655	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20874	-1.0262	9	0.17832	T	0.49	-0.8579	5.797	0.18392	0.1845:0.1613:0.6542:0.0	.	31	Q8TBZ5	ZN502_HUMAN	N	31	ENSP00000397390:D31N;ENSP00000296091:D31N;ENSP00000406469:D31N;ENSP00000401717:D31N	ENSP00000296091:D31N	D	+	1	0	ZNF502	44737404	0.000000	0.05858	0.027000	0.17364	0.015000	0.08874	0.066000	0.14489	0.230000	0.21059	-0.176000	0.13171	GAT	.		0.423	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
ZNF737	100129842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	20736517	20736517	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:20736517A>G	ENST00000427401.4	-	2	222	c.128T>C	c.(127-129)cTt>cCt	p.L43P	ZNF737_ENST00000596797.1_Missense_Mutation_p.L43P|CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	43	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						TTTCTCACCAAGGAAGACCAG	0.333																																					p.L43P		.											.	ZNF737	1	0			c.T128C						.						58.0	52.0	54.0					19																	20736517		692	1591	2283	SO:0001583	missense	100129842	exon2			TCACCAAGGAAGA	BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.128T>C	19.37:g.20736517A>G	ENSP00000395733:p.Leu43Pro	Somatic	442.0	0.0		WXS	Illumina HiSeq	Phase_I	399.0	162.0	NM_001159293	C9JHM3	Missense_Mutation	SNP	ENST00000427401.4	37	CCDS54238.1	.	.	.	.	.	.	.	.	.	.	a	9.912	1.209746	0.22289	.	.	ENSG00000237440	ENST00000427401	T	0.02837	4.14	0.819	0.819	0.18785	.	.	.	.	.	T	0.20901	0.0503	H	0.98721	4.31	0.53688	D	0.999974	D	0.76494	0.999	D	0.73380	0.98	T	0.00491	-1.1708	9	0.87932	D	0	.	3.7374	0.08515	1.0:0.0:0.0:0.0	.	43	C9JHM3	.	P	43	ENSP00000395733:L43P	ENSP00000395733:L43P	L	-	2	0	ZNF737	20528357	0.968000	0.33430	0.623000	0.29173	0.623000	0.37688	1.610000	0.36869	0.165000	0.19558	0.163000	0.16589	CTT	.		0.333	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447844.2	NM_145289	
ZNF841	284371	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52570807	52570807	+	5'UTR	SNP	C	C	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:52570807C>T	ENST00000426391.2	-	0	531				ZNF841_ENST00000359973.2_5'Flank|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000594295.1_Missense_Mutation_p.G110R|ZNF841_ENST00000389534.4_Missense_Mutation_p.G110R			Q6ZN19	ZN841_HUMAN	zinc finger protein 841						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						AATTTTTCTCCTGTGTTACTG	0.348																																					p.G110R		.											.	.	.	0			c.G328A						.						125.0	96.0	105.0					19																	52570807		692	1591	2283	SO:0001623	5_prime_UTR_variant	284371	exon7			TTTCTCCTGTGTT	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.-21G>A	19.37:g.52570807C>T		Somatic	188.0	1.0		WXS	Illumina HiSeq	Phase_I	292.0	38.0	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	ENST00000426391.2	37		.	.	.	.	.	.	.	.	.	.	C	5.414	0.261598	0.10239	.	.	ENSG00000197608	ENST00000389534	T	0.05025	3.51	2.88	-1.99	0.07457	.	.	.	.	.	T	0.04137	0.0115	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.42241	-0.9463	8	0.33940	T	0.23	.	7.4449	0.27205	0.0:0.5134:0.0:0.4866	.	110	Q6ZN19-3	.	R	110	ENSP00000374185:G110R	ENSP00000374185:G110R	G	-	1	0	ZNF841	57262619	0.000000	0.05858	0.000000	0.03702	0.104000	0.19210	-0.435000	0.06931	-0.189000	0.10482	-0.657000	0.03884	GGA	.		0.348	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	
ZNF845	91664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53854549	53854549	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:53854549A>T	ENST00000595091.1	+	5	840	c.621A>T	c.(619-621)gaA>gaT	p.E207D	ZNF845_ENST00000458035.1_Missense_Mutation_p.E207D			Q96IR2	ZN845_HUMAN	zinc finger protein 845	207					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						AAAAGCAGGAAGTACACATGA	0.353																																					p.E207D		.											.	.	.	0			c.A621T						.						62.0	47.0	51.0					19																	53854549		692	1591	2283	SO:0001583	missense	91664	exon4			GCAGGAAGTACAC	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.621A>T	19.37:g.53854549A>T	ENSP00000470005:p.Glu207Asp	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	35.0	NM_138374		Missense_Mutation	SNP	ENST00000595091.1	37	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	A	12.52	1.962186	0.34659	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	T	0.28454	1.61	1.5	0.452	0.16634	.	.	.	.	.	T	0.25044	0.0608	L	0.50333	1.59	0.09310	N	1	B	0.21309	0.054	B	0.20184	0.028	T	0.25537	-1.0129	9	0.48119	T	0.1	.	5.7115	0.17937	0.8385:0.0:0.1615:0.0	.	207	Q96IR2	ZN845_HUMAN	D	207	ENSP00000388311:E207D	ENSP00000412086:E207D	E	+	3	2	ZNF845	58546361	0.000000	0.05858	0.001000	0.08648	0.346000	0.29079	-2.079000	0.01369	0.075000	0.16796	0.172000	0.16884	GAA	.		0.353	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
ZNF845	91664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	53856524	53856524	+	Nonsense_Mutation	SNP	A	A	T			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:53856524A>T	ENST00000595091.1	+	5	2815	c.2596A>T	c.(2596-2598)Aag>Tag	p.K866*	ZNF845_ENST00000458035.1_Nonsense_Mutation_p.K866*			Q96IR2	ZN845_HUMAN	zinc finger protein 845	866					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						TGAATGTGGCAAGGTTTTTAA	0.368																																					p.K866X		.											.	.	.	0			c.A2596T						.						41.0	38.0	39.0					19																	53856524		692	1591	2283	SO:0001587	stop_gained	91664	exon4			TGTGGCAAGGTTT	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.2596A>T	19.37:g.53856524A>T	ENSP00000470005:p.Lys866*	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	37.0	NM_138374		Nonsense_Mutation	SNP	ENST00000595091.1	37	CCDS46170.1	.	.	.	.	.	.	.	.	.	.	A	35	5.523278	0.96431	.	.	ENSG00000213799	ENST00000458035;ENST00000427984	.	.	.	2.07	0.986	0.19784	.	.	.	.	.	.	.	.	.	.	.	0.48452	D	0.999652	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.0713	0.19891	0.8554:0.0:0.1446:0.0	.	.	.	.	X	866;782	.	ENSP00000412086:K782X	K	+	1	0	ZNF845	58548336	0.119000	0.22226	0.000000	0.03702	0.017000	0.09413	2.116000	0.41930	0.069000	0.16605	0.378000	0.23410	AAG	.		0.368	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
ZNF813	126017	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53995183	53995183	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr19:53995183T>A	ENST00000396403.4	+	4	1825	c.1697T>A	c.(1696-1698)cTt>cAt	p.L566H	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	566					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		AAAGCACACCTTGCACGTCAC	0.373																																					p.L566H		.											.	ZNF813	67	0			c.T1697A						.						47.0	49.0	48.0					19																	53995183		2198	4297	6495	SO:0001583	missense	126017	exon4			CACACCTTGCACG	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1697T>A	19.37:g.53995183T>A	ENSP00000379684:p.Leu566His	Somatic	128.0	1.0		WXS	Illumina HiSeq	Phase_I	168.0	34.0	NM_001004301		Missense_Mutation	SNP	ENST00000396403.4	37	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	t	13.70	2.314329	0.40996	.	.	ENSG00000198346	ENST00000396403	T	0.54071	0.59	1.28	1.28	0.21552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63283	0.2498	M	0.89478	3.035	0.80722	D	1	P	0.36465	0.554	P	0.45998	0.5	T	0.64542	-0.6383	9	0.87932	D	0	.	7.1933	0.25839	0.0:0.0:0.0:1.0	.	566	Q6ZN06	ZN813_HUMAN	H	566	ENSP00000379684:L566H	ENSP00000379684:L566H	L	+	2	0	ZNF813	58686995	0.339000	0.24784	0.004000	0.12327	0.007000	0.05969	4.342000	0.59341	0.383000	0.24910	0.158000	0.16466	CTT	.		0.373	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301	
ZXDA	7789	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	X	57936473	57936473	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chrX:57936473T>G	ENST00000358697.4	-	1	594	c.382A>C	c.(382-384)Agc>Cgc	p.S128R		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	128					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						TTCGCGCCGCTCTCGTCCCCC	0.786																																					p.S128R		.											.	ZXDA	131	0			c.A382C						.						4.0	5.0	4.0					X																	57936473		1900	3614	5514	SO:0001583	missense	7789	exon1			CGCCGCTCTCGTC	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.382A>C	X.37:g.57936473T>G	ENSP00000351530:p.Ser128Arg	Somatic	8.0	0.0		WXS	Illumina HiSeq	Phase_I	9.0	8.0	NM_007156	Q9UJP7	Missense_Mutation	SNP	ENST00000358697.4	37	CCDS14376.1	.	.	.	.	.	.	.	.	.	.	.	7.693	0.691444	0.15039	.	.	ENSG00000198205	ENST00000358697	T	0.49720	0.77	3.98	-1.53	0.08611	.	1.037060	0.07616	N	0.926158	T	0.33323	0.0859	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23833	-1.0177	9	.	.	.	.	5.1565	0.15038	0.0:0.3586:0.3706:0.2708	.	128	P98168	ZXDA_HUMAN	R	128	ENSP00000351530:S128R	.	S	-	1	0	ZXDA	57953198	0.000000	0.05858	0.004000	0.12327	0.044000	0.14063	-1.923000	0.01567	-0.178000	0.10672	0.235000	0.17854	AGC	.		0.786	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156	
KRTAP1-5	83895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39183121	39183122	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-MI-A75H-01A-11D-A32G-10	TCGA-MI-A75H-10A-01D-A32G-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2f0c1405-3730-4b0c-a6c4-679e1bd0c6cf	9804bf31-f0fd-4531-bca1-3ac172fc2b29	g.chr17:39183121_39183122CC>AA	ENST00000361883.5	-	1	332_333	c.286_287GG>TT	c.(286-288)GGc>TTc	p.G96F		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	96	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			ACCACCAATGCCACAGCCAGTT	0.634																																					p.G96F		.											.	.	.	0			.						.																																			SO:0001583	missense	83895	.			CCAATGCCACAGC	AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.286_287delinsAA	17.37:g.39183121_39183122delinsAA	ENSP00000355302:p.Gly96Phe	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	21.0	.	A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Missense_Mutation	DNP	ENST00000361883.5	37	CCDS42321.1																																																																																			.		0.634	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257691.1		
