#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABHD12B	145447	ucsc.edu;bcgsc.ca;mdanderson.org	37	14	51368576	51368576	+	Silent	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr14:51368576T>A	ENST00000337334.2	+	10	825	c.810T>A	c.(808-810)cgT>cgA	p.R270R	ABHD12B_ENST00000353130.1_Silent_p.R193R|ABHD12B_ENST00000395752.1_Silent_p.R163R|PYGL_ENST00000532462.1_Intron	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B	270							hydrolase activity (GO:0016787)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					GATTTTTACGTACACTTATGG	0.294																																					p.R270R		.											.	ABHD12B	153	0			c.T810A						.						72.0	67.0	69.0					14																	51368576		2203	4297	6500	SO:0001819	synonymous_variant	145447	exon10			TTTACGTACACTT	BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.810T>A	14.37:g.51368576T>A		Somatic	330.0	2.0		WXS	Illumina HiSeq	.	319.0	99.0	NM_001206673	Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	Silent	SNP	ENST00000337334.2	37	CCDS55916.1																																																																																			.		0.294	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411030.1		
ACOT12	134526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	80640019	80640019	+	Missense_Mutation	SNP	A	A	C	rs533220517		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:80640019A>C	ENST00000307624.3	-	9	968	c.940T>G	c.(940-942)Tat>Gat	p.Y314D	ACOT12_ENST00000508234.1_5'UTR	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	314					acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		GCTCCCCGATAGCGTCTGAAA	0.328													A|||	1	0.000199681	0.0	0.0	5008	,	,		17862	0.0		0.0	False		,,,				2504	0.001				p.Y314D		.											.	ACOT12	92	0			c.T940G						.						65.0	67.0	66.0					5																	80640019		2203	4300	6503	SO:0001583	missense	134526	exon9			CCCGATAGCGTCT	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.940T>G	5.37:g.80640019A>C	ENSP00000303246:p.Tyr314Asp	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	51.0	NM_130767	B3KVK9|Q5FWE9	Missense_Mutation	SNP	ENST00000307624.3	37	CCDS4055.1	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509989	0.64522	.	.	ENSG00000172497	ENST00000307624	T	0.34072	1.38	5.45	5.45	0.79879	.	0.073069	0.56097	D	0.000038	T	0.62575	0.2439	M	0.89287	3.02	0.80722	D	1	D	0.63046	0.992	P	0.62184	0.899	T	0.69602	-0.5101	10	0.59425	D	0.04	-23.7265	13.3403	0.60540	1.0:0.0:0.0:0.0	.	314	Q8WYK0	ACO12_HUMAN	D	314	ENSP00000303246:Y314D	ENSP00000303246:Y314D	Y	-	1	0	ACOT12	80675775	0.993000	0.37304	0.640000	0.29408	0.878000	0.50629	7.166000	0.77553	2.201000	0.70794	0.533000	0.62120	TAT	.		0.328	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	NM_130767	
ACSM2B	348158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	20554485	20554485	+	Missense_Mutation	SNP	G	G	A	rs143500332		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr16:20554485G>A	ENST00000329697.6	-	11	1549	c.1381C>T	c.(1381-1383)Cgg>Tgg	p.R461W	ACSM2B_ENST00000567288.1_5'Flank|ACSM2B_ENST00000565322.1_Missense_Mutation_p.R382W|ACSM2B_ENST00000567001.1_Missense_Mutation_p.R461W|ACSM2B_ENST00000565232.1_Missense_Mutation_p.R461W	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	461					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						TCATCTGCCCGTCCCATAAAC	0.502																																					p.R461W		.											.	ACSM2B	94	0			c.C1381T						.	G	TRP/ARG,TRP/ARG	1,4399	2.1+/-5.4	0,1,2199	337.0	355.0	349.0		1381,1381	-0.7	0.0	16	dbSNP_134	349	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense	ACSM2B	NM_001105069.1,NM_182617.3	101,101	0,2,6497	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	461/578,461/578	20554485	2,12996	2200	4299	6499	SO:0001583	missense	348158	exon12			CTGCCCGTCCCAT	AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1381C>T	16.37:g.20554485G>A	ENSP00000327453:p.Arg461Trp	Somatic	263.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	47.0	NM_182617	Q86YT1	Missense_Mutation	SNP	ENST00000329697.6	37	CCDS10586.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504327	0.26949	2.27E-4	1.16E-4	ENSG00000066813	ENST00000329697	D	0.83163	-1.69	3.1	-0.684	0.11331	AMP-dependent synthetase/ligase (1);	0.200461	0.23734	N	0.045098	D	0.91064	0.7188	H	0.94582	3.555	0.20489	N	0.999897	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81750	-0.0790	10	0.87932	D	0	-7.7757	6.4757	0.22034	0.0:0.1372:0.2742:0.5886	.	461;461	A8K051;Q68CK6	.;ACS2B_HUMAN	W	461	ENSP00000327453:R461W	ENSP00000327453:R461W	R	-	1	2	ACSM2B	20461986	0.000000	0.05858	0.012000	0.15200	0.150000	0.21749	-0.157000	0.10085	0.137000	0.18759	0.508000	0.49915	CGG	G|1.000;A|0.000		0.502	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254417.2	NM_182617	
ADAMTS1	9510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	28210528	28210528	+	Silent	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr21:28210528C>T	ENST00000284984.3	-	9	2728	c.2274G>A	c.(2272-2274)caG>caA	p.Q758Q		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	758	Spacer.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		TGGATCCCCTCTGGTTCCGCT	0.448																																					p.Q758Q		.											.	ADAMTS1	272	0			c.G2274A						.						90.0	72.0	78.0					21																	28210528		2203	4300	6503	SO:0001819	synonymous_variant	9510	exon9			TCCCCTCTGGTTC	AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.2274G>A	21.37:g.28210528C>T		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	29.0	NM_006988	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Silent	SNP	ENST00000284984.3	37	CCDS33524.1																																																																																			.		0.448	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171650.2		
ADH1A	124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100205700	100205700	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:100205700G>T	ENST00000209668.2	-	5	536	c.423C>A	c.(421-423)ttC>ttA	p.F141L	ADH1A_ENST00000511656.1_5'Flank|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	141					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TGATGCCAAGGAAGTGGTGGA	0.517																																					p.F141L		.											.	ADH1A	227	0			c.C423A						.						90.0	86.0	88.0					4																	100205700		2203	4300	6503	SO:0001583	missense	124	exon5			GCCAAGGAAGTGG	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.423C>A	4.37:g.100205700G>T	ENSP00000209668:p.Phe141Leu	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	32.0	NM_000667	A8K3E3|Q17R68	Missense_Mutation	SNP	ENST00000209668.2	37	CCDS3648.1	.	.	.	.	.	.	.	.	.	.	G	9.770	1.172558	0.21704	.	.	ENSG00000187758	ENST00000209668	T	0.03441	3.93	2.59	0.673	0.17941	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.048449	0.85682	N	0.000000	T	0.11836	0.0288	M	0.69358	2.11	0.41767	D	0.989742	D	0.89917	1.0	D	0.97110	1.0	T	0.01504	-1.1338	10	0.87932	D	0	-9.2382	6.7327	0.23393	0.4393:0.0:0.5607:0.0	.	141	P07327	ADH1A_HUMAN	L	141	ENSP00000209668:F141L	ENSP00000209668:F141L	F	-	3	2	ADH1A	100424723	0.000000	0.05858	0.437000	0.26809	0.029000	0.11900	-0.320000	0.08028	0.364000	0.24374	0.460000	0.39030	TTC	.		0.517	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	
AFF2	2334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	148072845	148072845	+	Missense_Mutation	SNP	G	G	C	rs149966195		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:148072845G>C	ENST00000370460.2	+	21	4398	c.3919G>C	c.(3919-3921)Gat>Cat	p.D1307H	AFF2_ENST00000342251.3_Missense_Mutation_p.D1274H|AFF2_ENST00000286437.5_Missense_Mutation_p.D948H|AFF2_ENST00000370457.5_Missense_Mutation_p.D1272H	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1307					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.D1307N(2)|p.D948N(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GCTGCGCATCGATGCCCACTT	0.552																																					p.D1307H		.											.	AFF2	135	3	Substitution - Missense(3)	endometrium(3)	c.G3919C						.						236.0	157.0	184.0					X																	148072845		2203	4300	6503	SO:0001583	missense	2334	exon21			CGCATCGATGCCC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3919G>C	X.37:g.148072845G>C	ENSP00000359489:p.Asp1307His	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	25.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	37	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.758870	0.69763	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.46	5.46	0.80206	.	0.066769	0.56097	D	0.000029	T	0.77974	0.4211	M	0.62723	1.935	0.41587	D	0.988773	P;D;D;D;D;D	0.76494	0.883;0.999;0.997;0.999;0.999;0.999	P;D;D;D;D;D	0.87578	0.778;0.998;0.994;0.964;0.964;0.979	T	0.79470	-0.1790	10	0.56958	D	0.05	.	18.3753	0.90433	0.0:0.0:1.0:0.0	.	948;1272;1272;1268;1297;1307	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	H	1307;1272;1274;948	ENSP00000359489:D1307H;ENSP00000359486:D1272H;ENSP00000345459:D1274H;ENSP00000286437:D948H	ENSP00000286437:D948H	D	+	1	0	AFF2	147880551	1.000000	0.71417	0.995000	0.50966	0.836000	0.47400	7.871000	0.87180	2.279000	0.76181	0.594000	0.82650	GAT	G|1.000;A|0.000		0.552	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
AGAP3	116988	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	150817090	150817090	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:150817090G>T	ENST00000463381.1	+	8	798	c.302G>T	c.(301-303)gGc>gTc	p.G101V	AGAP3_ENST00000473312.1_Missense_Mutation_p.G329V|AGAP3_ENST00000335367.3_Missense_Mutation_p.G509V|AGAP3_ENST00000397238.2_Missense_Mutation_p.G329V|AGAP3_ENST00000479901.1_Intron	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	293	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						AATGGCGGCGGCAGCGCCTTC	0.682																																					p.G329V		.											.	AGAP3	92	0			c.G986T						.						25.0	34.0	31.0					7																	150817090		2098	4222	6320	SO:0001583	missense	116988	exon8			GCGGCGGCAGCGC	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.302G>T	7.37:g.150817090G>T	ENSP00000418016:p.Gly101Val	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	16.0	NM_001042535	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000463381.1	37		.	.	.	.	.	.	.	.	.	.	g	20.7	4.027970	0.75390	.	.	ENSG00000133612	ENST00000463381;ENST00000473312;ENST00000397238;ENST00000335355;ENST00000335367;ENST00000468796	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	3.61	3.61	0.41365	.	0.621363	0.14897	U	0.292007	T	0.32912	0.0845	M	0.68593	2.085	0.80722	D	1	B;B;B;B	0.33940	0.029;0.433;0.047;0.226	B;B;B;B	0.36845	0.017;0.234;0.022;0.093	T	0.07712	-1.0758	10	0.16420	T	0.52	.	12.8158	0.57665	0.0:0.0:1.0:0.0	.	509;329;329;101	E7ESL9;Q96P47-4;E9PAL8;B3KNZ8	.;.;.;.	V	101;329;329;293;509;94	ENSP00000418016:G101V;ENSP00000418921:G329V;ENSP00000380413:G329V;ENSP00000335589:G509V;ENSP00000418159:G94V	ENSP00000334157:G293V	G	+	2	0	AGAP3	150448023	1.000000	0.71417	0.995000	0.50966	0.939000	0.58152	3.550000	0.53691	1.853000	0.53794	0.306000	0.20318	GGC	.		0.682	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946	
PHYKPL	85007	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	177649437	177649437	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:177649437G>A	ENST00000308158.5	-	8	1080	c.846C>T	c.(844-846)aaC>aaT	p.N282N	PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	282						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	CAGGGTGGCCGTTGCCAATGG	0.592																																					p.N282N		.											.	AGXT2L2	91	0			c.C846T						.						74.0	77.0	76.0					5																	177649437		2203	4300	6503	SO:0001819	synonymous_variant	85007	exon8			GTGGCCGTTGCCA	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.846C>T	5.37:g.177649437G>A		Somatic	120.0	1.0		WXS	Illumina HiSeq	Phase_I	170.0	78.0	NM_153373	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	ENST00000308158.5	37	CCDS4434.1																																																																																			.		0.592	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
AHR	196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	17379497	17379497	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:17379497A>G	ENST00000242057.4	+	10	2691	c.2048A>G	c.(2047-2049)cAa>cGa	p.Q683R		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	683					apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	GGGATCAGTCAAGAGTTCCCC	0.373																																					p.Q683R		.											.	AHR	227	0			c.A2048G						.						117.0	113.0	114.0					7																	17379497		2203	4300	6503	SO:0001583	missense	196	exon10			TCAGTCAAGAGTT	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2048A>G	7.37:g.17379497A>G	ENSP00000242057:p.Gln683Arg	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	19.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	7.358	0.624283	0.14193	.	.	ENSG00000106546	ENST00000242057	T	0.49432	0.78	5.9	3.33	0.38152	.	0.644386	0.15487	N	0.259768	T	0.46737	0.1408	M	0.70275	2.135	0.09310	N	1	B	0.33413	0.411	B	0.27608	0.081	T	0.40079	-0.9582	10	0.46703	T	0.11	.	14.7511	0.69528	0.718:0.282:0.0:0.0	.	683	P35869	AHR_HUMAN	R	683	ENSP00000242057:Q683R	ENSP00000242057:Q683R	Q	+	2	0	AHR	17346022	0.005000	0.15991	0.342000	0.25602	0.230000	0.25150	2.026000	0.41069	1.021000	0.39600	0.528000	0.53228	CAA	.		0.373	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
AKAP9	10142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	91669986	91669986	+	Splice_Site	SNP	A	A	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:91669986A>C	ENST00000359028.2	+	19	4953		c.e19-1		AKAP9_ENST00000358100.2_Splice_Site|AKAP9_ENST00000356239.3_Splice_Site			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTACTATTAAAGATTCATGAT	0.294			T	BRAF	papillary thyroid																																.		.		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	AKAP9	755	0			c.4693-2A>C						.						29.0	29.0	29.0					7																	91669986		2202	4300	6502	SO:0001630	splice_region_variant	10142	exon18			TATTAAAGATTCA	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.4729-1A>C	7.37:g.91669986A>C		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	32.0	NM_005751	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Splice_Site	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	A	9.334	1.061236	0.19987	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	.	.	.	4.23	4.23	0.50019	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8334	0.29355	0.9014:0.0:0.0986:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AKAP9	91507922	1.000000	0.71417	0.224000	0.23877	0.075000	0.17131	5.412000	0.66392	1.895000	0.54865	0.477000	0.44152	.	.		0.294	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	Intron
AMER3	205147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	131520150	131520150	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:131520150A>G	ENST00000423981.1	+	2	615	c.505A>G	c.(505-507)Aac>Gac	p.N169D	AMER3_ENST00000321420.4_Missense_Mutation_p.N169D	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	169					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										CATTCGGAGAAACAAGACTGA	0.607																																					p.N169D		.											.	.	.	0			c.A505G						.						56.0	59.0	58.0					2																	131520150		2199	4294	6493	SO:0001583	missense	205147	exon2			CGGAGAAACAAGA	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.505A>G	2.37:g.131520150A>G	ENSP00000392700:p.Asn169Asp	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	10.0	NM_152698	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.033216	0.75504	.	.	ENSG00000178171	ENST00000321420;ENST00000458606;ENST00000423981	T;T;T	0.17370	2.28;2.28;2.28	5.1	5.1	0.69264	.	0.396710	0.27349	N	0.019775	T	0.22627	0.0546	L	0.29908	0.895	0.25782	N	0.984715	P	0.51240	0.943	P	0.54544	0.755	T	0.05084	-1.0907	10	0.37606	T	0.19	.	13.1336	0.59397	1.0:0.0:0.0:0.0	.	169	Q8N944	F123C_HUMAN	D	169	ENSP00000314914:N169D;ENSP00000389242:N169D;ENSP00000392700:N169D	ENSP00000314914:N169D	N	+	1	0	FAM123C	131236620	1.000000	0.71417	0.986000	0.45419	0.858000	0.48976	7.161000	0.77505	2.043000	0.60533	0.459000	0.35465	AAC	.		0.607	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
AMPH	273	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	38457550	38457550	+	Splice_Site	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:38457550C>A	ENST00000356264.2	-	17	1488	c.1273G>T	c.(1273-1275)Gct>Tct	p.A425S	AMPH_ENST00000325590.5_Intron|AMPH_ENST00000428293.2_Intron|AMPH_ENST00000471913.1_Intron	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	425					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TCAGATTCAGCCTTGGAGTGT	0.463																																					p.A425S		.											.	AMPH	95	0			c.G1273T						.						115.0	110.0	112.0					7																	38457550		2203	4300	6503	SO:0001630	splice_region_variant	273	exon17			ATTCAGCCTTGGA		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1273-1G>T	7.37:g.38457550C>A		Somatic	95.0	1.0		WXS	Illumina HiSeq	Phase_I	107.0	42.0	NM_001635	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056525	0.36277	.	.	ENSG00000078053	ENST00000356264	T	0.59772	0.24	5.24	5.24	0.73138	.	.	.	.	.	T	0.36331	0.0963	N	0.08118	0	0.80722	D	1	B	0.15141	0.012	B	0.12837	0.008	T	0.19910	-1.0291	9	0.36615	T	0.2	1.4114	10.9007	0.47049	0.0:0.9054:0.0:0.0946	.	425	P49418	AMPH_HUMAN	S	425	ENSP00000348602:A425S	ENSP00000348602:A425S	A	-	1	0	AMPH	38424075	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	0.544000	0.23253	2.458000	0.83093	0.543000	0.68304	GCT	.		0.463	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	Missense_Mutation
ANO7	50636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242148731	242148731	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:242148731T>C	ENST00000274979.8	+	12	1374	c.1271T>C	c.(1270-1272)gTg>gCg	p.V424A	ANO7_ENST00000402430.3_Missense_Mutation_p.V423A	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	424					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GGCGGCACCGTGTTCTTCAGC	0.647																																					p.V424A		.											.	ANO7	92	0			c.T1271C						.						29.0	24.0	26.0					2																	242148731		2187	4278	6465	SO:0001583	missense	50636	exon12			GCACCGTGTTCTT	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1271T>C	2.37:g.242148731T>C	ENSP00000274979:p.Val424Ala	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	7.0	NM_001001891	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	37	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.877334	0.51801	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.68765	-0.35;-0.35	3.33	3.33	0.38152	.	0.208574	0.31156	N	0.008150	T	0.80711	0.4675	M	0.84219	2.685	0.40986	D	0.984815	D	0.89917	1.0	D	0.80764	0.994	T	0.83168	-0.0095	10	0.87932	D	0	.	10.6969	0.45905	0.0:0.0:0.0:1.0	.	424	Q6IWH7	ANO7_HUMAN	A	424;423	ENSP00000274979:V424A;ENSP00000385418:V423A	ENSP00000274979:V424A	V	+	2	0	ANO7	241797404	0.999000	0.42202	0.187000	0.23214	0.169000	0.22640	6.510000	0.73729	1.149000	0.42402	0.260000	0.18958	GTG	.		0.647	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
APOBEC3B	9582	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	39388141	39388141	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr22:39388141delG	ENST00000333467.3	+	7	1166	c.1121delG	c.(1120-1122)cggfs	p.R374fs	APOBEC3B_ENST00000407298.3_Frame_Shift_Del_p.R349fs|APOBEC3B-AS1_ENST00000513758.2_RNA|APOBEC3B_ENST00000402182.3_Frame_Shift_Del_p.R374fs	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	374					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					GGGAGGCTGCGGGCCATTCTC	0.647																																					p.R374fs		.											.	APOBEC3B	227	0			c.1121delG						.						76.0	64.0	68.0					22																	39388141		2198	4282	6480	SO:0001589	frameshift_variant	9582	exon7			GGCTGCGGGCCAT	AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.1121delG	22.37:g.39388141delG	ENSP00000327459:p.Arg374fs	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	20.0	NM_004900	B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Frame_Shift_Del	DEL	ENST00000333467.3	37	CCDS13982.1																																																																																			.		0.647	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321233.1	NM_004900	
ARC	23237	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	143695326	143695326	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:143695326C>G	ENST00000356613.2	-	1	1507	c.307G>C	c.(307-309)Gcc>Ccc	p.A103P	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				TCCAGGTTGGCGATGGTCTCC	0.672																																					p.A103P		.											.	ARC	135	0			c.G307C						.						36.0	30.0	32.0					8																	143695326		2203	4299	6502	SO:0001583	missense	23237	exon1			GGTTGGCGATGGT	AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.307G>C	8.37:g.143695326C>G	ENSP00000349022:p.Ala103Pro	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	6.0	NM_015193	B4DFL0|O60937	Missense_Mutation	SNP	ENST00000356613.2	37	CCDS34950.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.197187	0.79015	.	.	ENSG00000198576	ENST00000356613	T	0.31247	1.5	4.46	4.46	0.54185	.	0.108387	0.39083	U	0.001467	T	0.41003	0.1140	L	0.27053	0.805	0.37958	D	0.932866	D	0.76494	0.999	D	0.63703	0.917	T	0.50750	-0.8791	10	0.72032	D	0.01	.	16.0761	0.80969	0.0:1.0:0.0:0.0	.	103	Q7LC44	ARC_HUMAN	P	103	ENSP00000349022:A103P	ENSP00000349022:A103P	A	-	1	0	ARC	143692328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.107000	0.50329	2.027000	0.59764	0.563000	0.77884	GCC	.		0.672	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259274.2		
ARHGEF37	389337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	148996303	148996303	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:148996303A>G	ENST00000333677.6	+	5	795	c.632A>G	c.(631-633)aAt>aGt	p.N211S		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	211	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						ACCAATATCAATGAGTACAAG	0.473																																					p.N211S		.											.	ARHGEF37	90	0			c.A632G						.						115.0	107.0	110.0					5																	148996303		1963	4164	6127	SO:0001583	missense	389337	exon5			ATATCAATGAGTA	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.632A>G	5.37:g.148996303A>G	ENSP00000328083:p.Asn211Ser	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	33.0	NM_001001669	Q6ZW51	Missense_Mutation	SNP	ENST00000333677.6	37	CCDS43385.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555867	0.86231	.	.	ENSG00000183111	ENST00000333677	T	0.75589	-0.95	5.42	5.42	0.78866	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.88618	0.6485	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91018	0.4855	10	0.87932	D	0	-6.5827	15.7747	0.78204	1.0:0.0:0.0:0.0	.	211	A1IGU5	ARH37_HUMAN	S	211	ENSP00000328083:N211S	ENSP00000328083:N211S	N	+	2	0	ARHGEF37	148976496	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.825000	0.92029	2.194000	0.70268	0.533000	0.62120	AAT	.		0.473	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373763.1	NM_001001669	
ATAD2B	54454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24011501	24011501	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:24011501C>A	ENST00000238789.5	-	20	3000	c.2657G>T	c.(2656-2658)aGa>aTa	p.R886I	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	886						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATACTGTATTCTAAAGATACA	0.303																																					p.R886I		.											.	ATAD2B	68	0			c.G2657T						.						66.0	58.0	60.0					2																	24011501		1799	4065	5864	SO:0001583	missense	54454	exon20			TGTATTCTAAAGA	AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2657G>T	2.37:g.24011501C>A	ENSP00000238789:p.Arg886Ile	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	36.0	NM_001242338	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.72|10.72	1.428684|1.428684	0.25726|0.25726	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000381024|ENST00000238789;ENST00000546030	.|D	.|0.91894	.|-2.93	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|3.143910	.|0.00678	.|N	.|0.000666	.|D	.|0.90242	.|0.6949	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|B;B	.|0.25609	.|0.08;0.13	.|B;B	.|0.22386	.|0.017;0.039	.|T	.|0.63897	.|-0.6533	.|10	.|0.37606	.|T	.|0.19	.|.	14.0477|14.0477	0.64714|0.64714	0.0:0.9278:0.0:0.0722|0.0:0.9278:0.0:0.0722	.|.	.|886;886	.|Q9ULI0;Q9ULI0-2	.|ATD2B_HUMAN;.	X|I	167|886;54	.|ENSP00000238789:R886I	.|ENSP00000238789:R886I	E|R	-|-	1|2	0|0	ATAD2B|ATAD2B	23865005|23865005	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.841000|3.841000	0.55850|0.55850	2.760000|2.760000	0.94817|0.94817	0.655000|0.655000	0.94253|0.94253	GAA|AGA	.		0.303	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
ATF6	22926	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	161762113	161762114	+	Frame_Shift_Ins	INS	-	-	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:161762113_161762114insA	ENST00000367942.3	+	6	751_752	c.684_685insA	c.(685-687)aaafs	p.K229fs		NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	229					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	CTGCACCCACTAAAGGTACCTG	0.391																																					p.T228fs		.											.	ATF6	93	0			c.684_685insA						.																																			SO:0001589	frameshift_variant	22926	exon6			ACCCACTAAAGGT	AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.687dupA	1.37:g.161762116_161762116dupA	ENSP00000356919:p.Lys229fs	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	11.0	NM_007348	O15139|Q5VW62|Q6IPB5|Q9UEC9	Frame_Shift_Ins	INS	ENST00000367942.3	37	CCDS1235.1																																																																																			.		0.391	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060304.2	NM_007348	
ATG4B	23192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242590731	242590731	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:242590731G>A	ENST00000404914.3	+	3	268	c.165G>A	c.(163-165)agG>agA	p.R55R	ATG4B_ENST00000402096.1_5'UTR|ATG4B_ENST00000396411.3_5'UTR|ATG4B_ENST00000491867.1_3'UTR|ATG4B_ENST00000405546.3_Silent_p.R55R|ATG4B_ENST00000474739.2_Missense_Mutation_p.G11E	NM_013325.4|NM_178326.2	NP_037457.3|NP_847896.1	Q9Y4P1	ATG4B_HUMAN	autophagy related 4B, cysteine peptidase	55					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|positive regulation of autophagy (GO:0010508)|positive regulation of protein catabolic process (GO:0045732)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		TTACATACAGGAAAAACTTTC	0.373																																					p.R55R	Melanoma(78;458 1323 6342 12171 39523)	.											.	.	.	0			c.G165A						.						109.0	99.0	102.0					2																	242590731		1862	4094	5956	SO:0001819	synonymous_variant	23192	exon3			ATACAGGAAAAAC	AB023160	CCDS46564.1, CCDS46565.1	2q37.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000168397	ENSG00000168397			20790	protein-coding gene	gene with protein product		611338	"""APG4 autophagy 4 homolog B (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog B (S. cerevisiae)"""	APG4B		12446702	Standard	NM_013325		Approved	Apg4B, KIAA0943, DKFZp586D1822, AUTL1	uc002wbv.3	Q9Y4P1	OTTHUMG00000151514	ENST00000404914.3:c.165G>A	2.37:g.242590731G>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	21.0	NM_178326	B7WNK2|Q53NU4|Q6ZUV8|Q8WYM9|Q96K07|Q96K96|Q96SZ1|Q9Y2F2	Silent	SNP	ENST00000404914.3	37	CCDS46564.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336973	0.41398	.	.	ENSG00000168397	ENST00000474739	T	0.47177	0.85	5.36	4.48	0.54585	.	.	.	.	.	T	0.30978	0.0782	.	.	.	0.80722	D	1	B	0.21309	0.054	B	0.19666	0.026	T	0.08576	-1.0715	7	.	.	.	-21.0015	7.4735	0.27363	0.2532:0.0:0.7468:0.0	.	11	F5H7P2	.	E	11	ENSP00000442378:G11E	.	G	+	2	0	ATG4B	242239404	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.128000	0.42045	1.274000	0.44362	0.561000	0.74099	GGA	.		0.373	ATG4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322967.3	NM_013325	
BAGE2	85319	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	11049620	11049620	+	RNA	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr21:11049620C>T	ENST00000470054.1	-	0	488							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CATCTTCCTTCGCTATAATTA	0.373																																					p.R94Q		.											.	.	.	0			c.G281A						.						138.0	98.0	111.0					21																	11049620		692	1591	2283			85318	exon4			TTCCTTCGCTATA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11049620C>T		Somatic	545.0	0.0		WXS	Illumina HiSeq	Phase_I	551.0	31.0	NM_182481	A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	37																																																																																				.		0.373	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
BOD1L1	259282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	13610294	13610294	+	Splice_Site	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:13610294T>C	ENST00000040738.5	-	8	1739		c.e8-2			NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1							nucleus (GO:0005634)	DNA binding (GO:0003677)										TACTCCTGCCTAGAAAAGAAG	0.299																																					.		.											.	.	.	0			c.1604-2A>G						.						39.0	36.0	37.0					4																	13610294		2200	4296	6496	SO:0001630	splice_region_variant	259282	exon9			CCTGCCTAGAAAA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.1604-2A>G	4.37:g.13610294T>C		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	36.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Splice_Site	SNP	ENST00000040738.5	37	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	T	12.58	1.979184	0.34942	.	.	ENSG00000038219	ENST00000040738	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4085	0.67099	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	BOD1L	13219392	1.000000	0.71417	0.936000	0.37596	0.364000	0.29643	4.060000	0.57477	2.152000	0.67230	0.528000	0.53228	.	.		0.299	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	Intron
BTN3A1	11119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26409957	26409957	+	Silent	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:26409957A>G	ENST00000289361.6	+	5	1280	c.912A>G	c.(910-912)acA>acG	p.T304T	BTN3A1_ENST00000425234.2_Silent_p.T304T|BTN3A1_ENST00000414912.2_Silent_p.T252T|BTN3A1_ENST00000476549.2_Silent_p.T304T	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	304					activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						AACAAAGCACAAGAGGTAGCT	0.493																																					p.T304T		.											.	BTN3A1	92	0			c.A912G						.						152.0	164.0	160.0					6																	26409957		2203	4300	6503	SO:0001819	synonymous_variant	11119	exon5			AAGCACAAGAGGT	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.912A>G	6.37:g.26409957A>G		Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	9.0	NM_007048	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Silent	SNP	ENST00000289361.6	37	CCDS4608.1																																																																																			.		0.493	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
C10orf90	118611	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	128118392	128118392	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:128118392C>T	ENST00000284694.7	-	7	2045	c.1925G>A	c.(1924-1926)tGc>tAc	p.C642Y	C10orf90_ENST00000454341.1_Missense_Mutation_p.C545Y|C10orf90_ENST00000480379.1_Missense_Mutation_p.C46Y|C10orf90_ENST00000356858.3_Missense_Mutation_p.C595Y|C10orf90_ENST00000544758.1_Missense_Mutation_p.C739Y	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	642	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CTCTGAAATGCACCGTTCTTT	0.398																																					p.C642Y		.											.	C10orf90	92	0			c.G1925A						.						207.0	185.0	193.0					10																	128118392		2203	4300	6503	SO:0001583	missense	118611	exon7			GAAATGCACCGTT	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1925G>A	10.37:g.128118392C>T	ENSP00000284694:p.Cys642Tyr	Somatic	90.0	1.0		WXS	Illumina HiSeq	Phase_I	95.0	33.0	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	37	CCDS31310.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.359|0.359	-0.940720|-0.940720	0.02322|0.02322	.|.	.|.	ENSG00000154493|ENSG00000154493	ENST00000424927|ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642	.|T;T;T;T	.|0.17854	.|2.25;2.27;2.26;2.25	4.78|4.78	0.318|0.318	0.15867|0.15867	.|.	.|0.302628	.|0.24291	.|N	.|0.039802	T|T	0.05410|0.05410	0.0143|0.0143	N|N	0.11201|0.11201	0.11|0.11	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.25169	.|0.002;0.002;0.119	.|B;B;B	.|0.20384	.|0.006;0.006;0.029	T|T	0.38394|0.38394	-0.9663|-0.9663	5|10	.|0.02654	.|T	.|1	-1.7311|-1.7311	4.2853|4.2853	0.10851|0.10851	0.2489:0.5103:0.0:0.2407|0.2489:0.5103:0.0:0.2407	.|.	.|739;642;545	.|F5GZL2;Q96M02;Q96M02-2	.|.;CJ090_HUMAN;.	T|Y	185|595;642;545;739;642	.|ENSP00000284694:C642Y;ENSP00000398786:C545Y;ENSP00000444369:C739Y;ENSP00000405995:C642Y	.|ENSP00000284694:C642Y	A|C	-|-	1|2	0|0	C10orf90|C10orf90	128108382|128108382	0.986000|0.986000	0.35501|0.35501	0.999000|0.999000	0.59377|0.59377	0.998000|0.998000	0.95712|0.95712	0.368000|0.368000	0.20399|0.20399	0.142000|0.142000	0.18901|0.18901	0.655000|0.655000	0.94253|0.94253	GCA|TGC	.		0.398	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
C12orf42	374470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	103762676	103762676	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:103762676A>T	ENST00000378113.2	-	4	473	c.248T>A	c.(247-249)cTg>cAg	p.L83Q	C12orf42_ENST00000315192.8_Missense_Mutation_p.L83Q|C12orf42_ENST00000548789.1_5'UTR|C12orf42_ENST00000548048.1_Missense_Mutation_p.L16Q|C12orf42_ENST00000548883.1_Missense_Mutation_p.L83Q	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	83										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						TGGAAAATTCAGAAAGTGTAG	0.348																																					p.L83Q		.											.	C12orf42	91	0			c.T248A						.						39.0	38.0	38.0					12																	103762676		1801	4062	5863	SO:0001583	missense	374470	exon4			AAATTCAGAAAGT	AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.248T>A	12.37:g.103762676A>T	ENSP00000367353:p.Leu83Gln	Somatic	256.0	0.0		WXS	Illumina HiSeq	Phase_I	242.0	72.0	NM_001099336	Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.336666	0.41398	.	.	ENSG00000179088	ENST00000315192;ENST00000548883;ENST00000548048;ENST00000378113;ENST00000552578	T;T;T;T;T	0.60920	0.15;0.87;0.29;0.87;0.86	4.07	2.94	0.34122	.	.	.	.	.	T	0.58538	0.2129	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.60424	-0.7266	9	0.87932	D	0	-1.9286	5.4022	0.16303	0.875:0.0:0.125:0.0	.	83	Q96LP6	CL042_HUMAN	Q	83;83;16;83;83	ENSP00000324984:L83Q;ENSP00000447908:L83Q;ENSP00000449362:L16Q;ENSP00000367353:L83Q;ENSP00000447795:L83Q	ENSP00000324984:L83Q	L	-	2	0	C12orf42	102286806	0.004000	0.15560	0.035000	0.18076	0.003000	0.03518	0.486000	0.22340	1.786000	0.52430	0.533000	0.62120	CTG	.		0.348	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521	
C2CD2	25966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43332526	43332526	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr21:43332526C>A	ENST00000380486.3	-	7	1109	c.868G>T	c.(868-870)Gtg>Ttg	p.V290L	C2CD2_ENST00000329623.7_Missense_Mutation_p.V135L	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	290	C2.					cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						TTCAGCTGCACGACGCACACT	0.433																																					p.V290L		.											.	C2CD2	91	0			c.G868T						.						84.0	61.0	69.0					21																	43332526		2203	4300	6503	SO:0001583	missense	25966	exon7			GCTGCACGACGCA	AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.868G>T	21.37:g.43332526C>A	ENSP00000369853:p.Val290Leu	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	20.0	NM_015500	Q5R2V7|Q6AHX8|Q9NSE6	Missense_Mutation	SNP	ENST00000380486.3	37	CCDS42933.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.504031	0.26949	.	.	ENSG00000157617	ENST00000329623;ENST00000380486	T;T	0.71579	-0.58;-0.58	5.29	2.33	0.28932	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.421745	0.26915	N	0.021860	T	0.54351	0.1853	L	0.32530	0.975	0.09310	N	1	B;B	0.22346	0.068;0.025	B;B	0.25405	0.057;0.06	T	0.35895	-0.9770	10	0.21014	T	0.42	-5.3501	7.6487	0.28336	0.0:0.5982:0.2689:0.1328	.	135;290	Q6P6D1;Q9Y426	.;CU025_HUMAN	L	135;290	ENSP00000329302:V135L;ENSP00000369853:V290L	ENSP00000329302:V135L	V	-	1	0	C2CD2	42205595	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	0.080000	0.14802	0.658000	0.30925	0.655000	0.94253	GTG	.		0.433	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195228.2	NM_015500	
C4orf45	152940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	159956201	159956201	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:159956201T>G	ENST00000434826.2	-	1	132	c.48A>C	c.(46-48)aaA>aaC	p.K16N	C4orf45_ENST00000508011.1_Intron	NM_152543.2	NP_689756.2	Q96LM5	CD045_HUMAN	chromosome 4 open reading frame 45	16										large_intestine(2)|lung(3)	5						AAATCATTTGTTTTCCCACAG	0.328																																					p.K16N		.											.	.	.	0			c.A48C						.						107.0	102.0	103.0					4																	159956201		1830	4085	5915	SO:0001583	missense	152940	exon1			CATTTGTTTTCCC		CCDS47156.1	4q32.1	2012-03-02			ENSG00000164123	ENSG00000164123			26342	protein-coding gene	gene with protein product							Standard	NM_152543		Approved	FLJ25371	uc003iqf.1	Q96LM5	OTTHUMG00000161988	ENST00000434826.2:c.48A>C	4.37:g.159956201T>G	ENSP00000412215:p.Lys16Asn	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	33.0	NM_152543	A8MPU3|C9J0T8	Missense_Mutation	SNP	ENST00000434826.2	37	CCDS47156.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.498974	0.44455	.	.	ENSG00000164123	ENST00000434826	T	0.17054	2.3	5.4	-1.42	0.08913	.	0.651684	0.14766	N	0.299718	T	0.26159	0.0638	L	0.57536	1.79	0.09310	N	0.999993	D	0.61697	0.99	P	0.57152	0.814	T	0.10870	-1.0611	9	.	.	.	-15.1744	9.2284	0.37421	0.0:0.4775:0.0:0.5225	.	16	Q96LM5	CD045_HUMAN	N	16	ENSP00000412215:K16N	.	K	-	3	2	C4orf45	160175651	0.704000	0.27836	0.243000	0.24186	0.772000	0.43724	-0.425000	0.07017	-0.372000	0.07992	0.533000	0.62120	AAA	.		0.328	C4orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366636.1	NM_152543	
C4orf47	441054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	186366160	186366160	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:186366160C>A	ENST00000378850.4	+	6	779	c.757C>A	c.(757-759)Cat>Aat	p.H253N		NM_001114357.1	NP_001107829.1	A7E2U8	CD047_HUMAN	chromosome 4 open reading frame 47	253										breast(2)|endometrium(1)	3						TTACCCATCACATTCTGCTGA	0.403																																					p.H253N		.											.	.	.	0			c.C757A						.						140.0	117.0	124.0					4																	186366160		692	1591	2283	SO:0001583	missense	441054	exon6			CCATCACATTCTG	AY947525, BC127739, BC141967	CCDS47169.1	4q35.1	2008-07-18			ENSG00000205129	ENSG00000205129			34346	protein-coding gene	gene with protein product						12477932	Standard	NM_001114357		Approved	LOC441054	uc003ixt.2	A7E2U8	OTTHUMG00000160458	ENST00000378850.4:c.757C>A	4.37:g.186366160C>A	ENSP00000368127:p.His253Asn	Somatic	203.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	7.0	NM_001114357	Q5BLP7	Missense_Mutation	SNP	ENST00000378850.4	37	CCDS47169.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684538	0.68157	.	.	ENSG00000205129	ENST00000378850	.	.	.	5.68	4.66	0.58398	.	.	.	.	.	T	0.78155	0.4239	M	0.80616	2.505	0.39443	D	0.967284	D	0.76494	0.999	D	0.66196	0.942	T	0.80772	-0.1233	8	0.51188	T	0.08	-1.8641	15.2351	0.73422	0.0:0.9202:0.0:0.0798	.	253	A7E2U8	CD047_HUMAN	N	253	.	ENSP00000368127:H253N	H	+	1	0	C4orf47	186603154	0.993000	0.37304	1.000000	0.80357	0.962000	0.63368	3.158000	0.50723	2.668000	0.90789	0.563000	0.77884	CAT	.		0.403	C4orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360667.1	NM_001114357	
C5orf55	116349	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	442609	442609	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:442609G>A	ENST00000408966.2	-	1	649	c.329C>T	c.(328-330)tCa>tTa	p.S110L	EXOC3_ENST00000512944.1_5'Flank	NM_138464.2	NP_612473.1	Q8N2X6	CE055_HUMAN	chromosome 5 open reading frame 55	110						extracellular region (GO:0005576)				large_intestine(1)|lung(2)	3						GCGGCCCAGTGACCCACATTC	0.642																																					p.S110L		.											.	.	.	0			c.C329T						.						39.0	43.0	41.0					5																	442609		1906	4122	6028	SO:0001583	missense	116349	exon1			CCCAGTGACCCAC	BC014011	CCDS43298.1	5p15.33	2012-02-24			ENSG00000221990	ENSG00000221990			25175	protein-coding gene	gene with protein product						12477932	Standard	NM_138464		Approved		uc010ita.3	Q8N2X6	OTTHUMG00000162235	ENST00000408966.2:c.329C>T	5.37:g.442609G>A	ENSP00000386139:p.Ser110Leu	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	16.0	NM_138464	Q96CR9	Missense_Mutation	SNP	ENST00000408966.2	37	CCDS43298.1	.	.	.	.	.	.	.	.	.	.	G	7.018	0.558114	0.13436	.	.	ENSG00000221990	ENST00000408966	T	0.38401	1.14	0.849	-0.208	0.13185	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.19877	-1.0292	9	0.87932	D	0	.	4.5407	0.12056	0.0:0.5635:0.4365:0.0	.	110	Q8N2X6	CE055_HUMAN	L	110	ENSP00000386139:S110L	ENSP00000386139:S110L	S	-	2	0	C5orf55	495609	0.000000	0.05858	0.000000	0.03702	0.267000	0.26476	-0.139000	0.10358	-0.106000	0.12110	0.205000	0.17691	TCA	.		0.642	C5orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368033.1	NM_138464	
CACNA1A	773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	13365942	13365942	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:13365942C>T	ENST00000360228.5	-	29	4721	c.4722G>A	c.(4720-4722)atG>atA	p.M1574I	CACNA1A_ENST00000573710.2_Missense_Mutation_p.M1575I|CACNA1A_ENST00000574822.1_5'Flank	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1575					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGAGGGCGATCATGGCCATGA	0.567																																					p.M1575I		.											.	CACNA1A	67	0			c.G4725A						.						90.0	100.0	97.0					19																	13365942		2126	4241	6367	SO:0001583	missense	773	exon29			GGCGATCATGGCC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4722G>A	19.37:g.13365942C>T	ENSP00000353362:p.Met1574Ile	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	9.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599304	0.46318	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084;ENST00000445042	D	0.97279	-4.32	4.8	4.8	0.61643	.	0.111141	0.56097	D	0.000025	D	0.95306	0.8477	L	0.57536	1.79	0.46725	D	0.99917	P;P;B;B	0.40431	0.594;0.717;0.278;0.377	B;B;B;B	0.38985	0.15;0.287;0.057;0.103	D	0.95475	0.8555	10	0.72032	D	0.01	.	12.5949	0.56463	0.0:0.8325:0.1675:0.0	.	1575;1578;1574;1575	O00555;E9PD31;Q9NS88;E7EVF2	CAC1A_HUMAN;.;.;.	I	1574;1578;1575;1575;191	ENSP00000353362:M1574I	ENSP00000317661:M1575I	M	-	3	0	CACNA1A	13226942	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.778000	0.55371	2.227000	0.72691	0.650000	0.86243	ATG	.		0.567	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CALR3	125972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16601349	16601349	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:16601349C>T	ENST00000269881.3	-	3	288	c.226G>A	c.(226-228)Gcc>Acc	p.A76T	CTD-3222D19.2_ENST00000409035.1_Intron	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	76	N-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						GCAGAGATGGCATAGAATCGG	0.443																																					p.A76T		.											.	CALR3	90	0			c.G226A						.						154.0	145.0	148.0					19																	16601349		2203	4300	6503	SO:0001583	missense	125972	exon3			AGATGGCATAGAA	AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.226G>A	19.37:g.16601349C>T	ENSP00000269881:p.Ala76Thr	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	30.0	NM_145046	D9N574|Q96LN3	Missense_Mutation	SNP	ENST00000269881.3	37	CCDS12344.1	.	.	.	.	.	.	.	.	.	.	C	35	5.558203	0.96514	.	.	ENSG00000141979	ENST00000269881	T	0.54675	0.56	5.79	5.79	0.91817	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.81814	0.4902	H	0.95328	3.655	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.86641	0.1892	10	0.87932	D	0	-38.5102	18.6591	0.91465	0.0:1.0:0.0:0.0	.	76	Q96L12	CALR3_HUMAN	T	76	ENSP00000269881:A76T	ENSP00000269881:A76T	A	-	1	0	CALR3	16462349	1.000000	0.71417	0.990000	0.47175	0.986000	0.74619	7.494000	0.81503	2.756000	0.94617	0.644000	0.83932	GCC	.		0.443	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461089.1	NM_145046	
CAMKK1	84254	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	3779538	3779538	+	Silent	SNP	G	G	T	rs560406629	byFrequency	TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:3779538G>T	ENST00000348335.2	-	10	1123	c.975C>A	c.(973-975)tcC>tcA	p.S325S	CAMKK1_ENST00000158166.5_Silent_p.S363S|CAMKK1_ENST00000381771.2_Silent_p.S363S|CAMKK1_ENST00000381769.2_Silent_p.S352S	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	325	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		AGCTCTGGCCGGAATCAGAAA	0.622																																					p.S363S		.											.	CAMKK1	334	0			c.C1089A						.						48.0	44.0	46.0					17																	3779538		2203	4300	6503	SO:0001819	synonymous_variant	84254	exon11			CTGGCCGGAATCA	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.975C>A	17.37:g.3779538G>T		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	23.0	NM_172207	Q9BQH3	Silent	SNP	ENST00000348335.2	37	CCDS11038.1																																																																																			.		0.622	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207456.1	NM_032294, NM_172206, NM_172207	
CCDC178	374864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	30554599	30554599	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr18:30554599A>T	ENST00000383096.3	-	22	2617	c.2435T>A	c.(2434-2436)tTc>tAc	p.F812Y	CCDC178_ENST00000579916.1_Missense_Mutation_p.F132Y|CCDC178_ENST00000406524.2_Missense_Mutation_p.F836Y|CCDC178_ENST00000581852.1_Missense_Mutation_p.F17Y|CCDC178_ENST00000402325.1_Missense_Mutation_p.F762Y|CCDC178_ENST00000300227.8_Missense_Mutation_p.F774Y|CCDC178_ENST00000583930.1_Missense_Mutation_p.F836Y|CCDC178_ENST00000403303.1_Missense_Mutation_p.F812Y|CCDC178_ENST00000579947.1_Missense_Mutation_p.F812Y			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	812																	CACCAGTTTGAAGTGCTCCTG	0.498																																					p.F812Y		.											.	.	.	0			c.T2435A						.						56.0	50.0	52.0					18																	30554599		2203	4300	6503	SO:0001583	missense	374864	exon21			AGTTTGAAGTGCT	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.2435T>A	18.37:g.30554599A>T	ENSP00000372576:p.Phe812Tyr	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	34.0	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	A	11.51	1.661105	0.29515	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.26957	1.86;1.86;1.98;1.7;1.7	5.5	5.5	0.81552	.	.	.	.	.	T	0.36853	0.0982	L	0.43152	1.355	0.30875	N	0.732087	D;D;D;D;D;D	0.76494	0.999;0.996;0.999;0.999;0.999;0.999	D;P;D;D;D;D	0.67548	0.952;0.892;0.935;0.952;0.952;0.952	T	0.09862	-1.0655	9	0.08381	T	0.77	-10.9787	12.7018	0.57038	0.8629:0.1371:0.0:0.0	.	836;812;762;812;774;812	F8W7A7;A1L4G8;Q5BJE1-3;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;.;CR034_HUMAN	Y	812;812;774;836;762	ENSP00000385591:F812Y;ENSP00000372576:F812Y;ENSP00000300227:F774Y;ENSP00000385867:F836Y;ENSP00000385234:F762Y	ENSP00000300227:F774Y	F	-	2	0	C18orf34	28808597	1.000000	0.71417	0.990000	0.47175	0.968000	0.65278	5.669000	0.68081	2.084000	0.62774	0.460000	0.39030	TTC	.		0.498	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
CCDC65	85478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49298898	49298898	+	Splice_Site	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:49298898T>C	ENST00000320516.4	+	2	488		c.e2+2		RP11-302B13.5_ENST00000398092.4_Intron|CCDC65_ENST00000266984.5_Splice_Site	NM_033124.4	NP_149115.2	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65											breast(1)|large_intestine(4)|lung(7)|ovary(1)|skin(2)	15						GTCATCAAGGTAGGCACTCTT	0.458																																					.		.											.	CCDC65	92	0			c.300+2T>C						.						149.0	126.0	134.0					12																	49298898		2203	4300	6503	SO:0001630	splice_region_variant	85478	exon2			TCAAGGTAGGCAC		CCDS8772.1	12q13.12	2014-07-18			ENSG00000139537	ENSG00000139537			29937	protein-coding gene	gene with protein product		611088				17089017, 21700706	Standard	NM_033124		Approved	NYD-SP28, FLJ35732, FAP250, CILD27	uc001rso.3	Q8IXS2		ENST00000320516.4:c.300+2T>C	12.37:g.49298898T>C		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	18.0	NM_033124	A6NJG5|B2RBE2|Q8N7G4|Q8NA91|Q96JA0	Splice_Site	SNP	ENST00000320516.4	37	CCDS8772.1	.	.	.	.	.	.	.	.	.	.	T	16.17	3.047002	0.55110	.	.	ENSG00000139537	ENST00000266984;ENST00000552942;ENST00000320516	.	.	.	4.7	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6655	0.34118	0.0:0.0962:0.0:0.9038	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC65	47585165	0.999000	0.42202	0.831000	0.32960	0.939000	0.58152	3.172000	0.50832	0.957000	0.37930	0.482000	0.46254	.	.		0.458	CCDC65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408922.1	NM_033124	Intron
CCNO	10309	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	54528358	54528358	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:54528358C>A	ENST00000282572.4	-	2	554	c.398G>T	c.(397-399)cGc>cTc	p.R133L	RP11-506H20.1_ENST00000506435.1_RNA	NM_021147.3	NP_066970.3	P22674	CCNO_HUMAN	cyclin O	133					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cell cycle (GO:0007049)|cell division (GO:0051301)|cilium assembly (GO:0042384)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)|embryo development (GO:0009790)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	uracil DNA N-glycosylase activity (GO:0004844)			endometrium(1)|lung(3)|skin(1)	5		Lung NSC(810;4.08e-05)|Breast(144;0.0735)|Prostate(74;0.183)	LUSC - Lung squamous cell carcinoma(15;0.142)|Lung(15;0.161)			CAGCTTACAGCGGGATTCCGC	0.647																																					p.R133L		.											.	CCNO	90	0			c.G398T						.						42.0	38.0	39.0					5																	54528358		2203	4300	6503	SO:0001583	missense	10309	exon2			TTACAGCGGGATT	M87499	CCDS34157.1	5q11.2	2010-11-15	2007-07-26	2007-07-26	ENSG00000152669	ENSG00000152669			18576	protein-coding gene	gene with protein product		607752	"""cyclin U"""	CCNU			Standard	NR_125346		Approved	UDG2, FLJ22422, UNG2	uc003jpw.3	P22674	OTTHUMG00000162598	ENST00000282572.4:c.398G>T	5.37:g.54528358C>A	ENSP00000282572:p.Arg133Leu	Somatic	72.0	1.0		WXS	Illumina HiSeq	Phase_I	127.0	65.0	NM_021147	A8K1W5|Q0P6J2|Q9H6B0|Q9UMD5	Missense_Mutation	SNP	ENST00000282572.4	37	CCDS34157.1	.	.	.	.	.	.	.	.	.	.	C	36	5.756769	0.96898	.	.	ENSG00000152669	ENST00000282572	T	0.53857	0.6	5.51	5.51	0.81932	Cyclin, N-terminal (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	D	0.82563	0.5064	H	0.96943	3.91	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.88385	0.3004	10	0.87932	D	0	.	18.1705	0.89744	0.0:1.0:0.0:0.0	.	133	P22674	CCNO_HUMAN	L	133	ENSP00000282572:R133L	ENSP00000282572:R133L	R	-	2	0	CCNO	54564115	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.581000	0.82535	2.598000	0.87819	0.561000	0.74099	CGC	.		0.647	CCNO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369707.1	NM_021147	
CCSER1	401145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	91645123	91645123	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:91645123A>T	ENST00000509176.1	+	7	2279	c.1991A>T	c.(1990-1992)gAa>gTa	p.E664V	CCSER1_ENST00000432775.2_Missense_Mutation_p.E664V|CCSER1_ENST00000333691.8_Missense_Mutation_p.E664V|CCSER1_ENST00000504150.1_3'UTR	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	664																	CCTCTTACTGAAGAGCCAGTG	0.333																																					p.E664V		.											.	.	.	0			c.A1991T						.						30.0	28.0	28.0					4																	91645123		1831	4084	5915	SO:0001583	missense	401145	exon7			TTACTGAAGAGCC		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1991A>T	4.37:g.91645123A>T	ENSP00000425040:p.Glu664Val	Somatic	360.0	0.0		WXS	Illumina HiSeq	Phase_I	349.0	135.0	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	37	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	A	17.20	3.328131	0.60743	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365;ENST00000503421	T;T;T	0.54279	1.22;0.58;1.22	4.63	4.63	0.57726	.	0.200481	0.41194	D	0.000938	T	0.59878	0.2226	L	0.60455	1.87	0.32985	D	0.524207	D;D	0.61080	0.989;0.989	P;P	0.53518	0.728;0.728	T	0.73350	-0.4010	10	0.87932	D	0	-14.8246	12.2264	0.54463	1.0:0.0:0.0:0.0	.	664;664	Q9C0I3-2;Q9C0I3	.;F190A_HUMAN	V	664;664;664;664;17	ENSP00000425040:E664V;ENSP00000389283:E664V;ENSP00000329482:E664V	ENSP00000329482:E664V	E	+	2	0	FAM190A	91864146	1.000000	0.71417	0.987000	0.45799	0.747000	0.42532	4.856000	0.62932	2.026000	0.59711	0.454000	0.30748	GAA	.		0.333	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
CD1E	913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158325807	158325807	+	Silent	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:158325807C>A	ENST00000368167.3	+	4	1055	c.816C>A	c.(814-816)acC>acA	p.T272T	CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368165.3_Silent_p.T182T|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000452291.2_Silent_p.T83T|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368161.3_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368166.3_Silent_p.T83T|CD1E_ENST00000368163.3_Intron|CD1E_ENST00000368160.3_Silent_p.T272T|CD1E_ENST00000444681.2_Silent_p.T173T|CD1E_ENST00000434258.1_Silent_p.T270T|CD1E_ENST00000368156.1_Silent_p.T182T	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	272	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					TCCGAGCAACCCTGGATGTGG	0.612																																					p.T272T		.											.	CD1E	93	0			c.C816A						.						97.0	97.0	97.0					1																	158325807		2203	4300	6503	SO:0001819	synonymous_variant	913	exon4			AGCAACCCTGGAT	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.816C>A	1.37:g.158325807C>A		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	28.0	NM_030893	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Silent	SNP	ENST00000368167.3	37	CCDS41417.1																																																																																			.		0.612	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
CDH11	1009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	65025685	65025685	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr16:65025685delG	ENST00000268603.4	-	6	1412	c.797delC	c.(796-798)ccafs	p.P266fs	CDH11_ENST00000566827.1_Frame_Shift_Del_p.P140fs|CDH11_ENST00000394156.3_Frame_Shift_Del_p.P266fs	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	266	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CGGAAACTTTGGTGGGTTGTC	0.517			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.P266fs		.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	852	0			c.797delC						.						269.0	189.0	216.0					16																	65025685		2203	4300	6503	SO:0001589	frameshift_variant	1009	exon6			AACTTTGGTGGGT	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.797delC	16.37:g.65025685delG	ENSP00000268603:p.Pro266fs	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	22.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Frame_Shift_Del	DEL	ENST00000268603.4	37	CCDS10803.1																																																																																			.		0.517	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CDK5RAP1	51654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31967440	31967440	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr20:31967440C>G	ENST00000357886.4	-	9	1129	c.976G>C	c.(976-978)Gag>Cag	p.E326Q	CDK5RAP1_ENST00000544843.1_Missense_Mutation_p.E312Q|CDK5RAP1_ENST00000339269.5_Intron|CDK5RAP1_ENST00000477105.1_5'UTR|CDK5RAP1_ENST00000473997.1_Missense_Mutation_p.E222Q|CDK5RAP1_ENST00000346416.2_Missense_Mutation_p.E312Q			Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1	326					brain development (GO:0007420)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|regulation of neuron differentiation (GO:0045664)|tRNA modification (GO:0006400)	cytoplasm (GO:0005737)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(3)|lung(12)|ovary(3)|skin(3)|urinary_tract(1)	26						AACTGGACCTCCGAATTGTCC	0.413																																					p.E312Q		.											.	CDK5RAP1	230	0			c.G934C						.						124.0	122.0	122.0					20																	31967440		2203	4300	6503	SO:0001583	missense	51654	exon8			GGACCTCCGAATT	AF152097	CCDS13219.1, CCDS63255.1	20q11.21	2012-09-20	2002-07-22	2002-07-26	ENSG00000101391	ENSG00000101391			15880	protein-coding gene	gene with protein product		608200	"""chromosome 20 open reading frame 34"""	C20orf34		10721722, 11882646, 15329498	Standard	NM_016408		Approved	CGI-05, HSPC167, C42	uc002wyy.4	Q96SZ6	OTTHUMG00000032256	ENST00000357886.4:c.976G>C	20.37:g.31967440C>G	ENSP00000350558:p.Glu326Gln	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	44.0	NM_016408	A8K7R0|Q5QP46|Q5QP47|Q5QP48|Q675N4|Q675N5|Q9BVG6|Q9BWZ5|Q9H859|Q9NZZ9|Q9Y3F0	Missense_Mutation	SNP	ENST00000357886.4	37		.	.	.	.	.	.	.	.	.	.	C	9.765	1.171176	0.21621	.	.	ENSG00000101391	ENST00000346416;ENST00000357886;ENST00000452723;ENST00000544843	.	.	.	5.37	4.41	0.53225	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.270973	0.41823	D	0.000815	T	0.30792	0.0776	L	0.35793	1.09	0.22562	N	0.998984	B;B;B;B;B	0.33777	0.425;0.203;0.203;0.169;0.066	B;B;B;B;B	0.36289	0.221;0.221;0.221;0.141;0.048	T	0.12502	-1.0545	9	0.31617	T	0.26	-21.9306	7.1777	0.25755	0.1691:0.7441:0.0:0.0868	.	326;312;312;312;222	Q96SZ6;Q675N5;Q53H36;Q96SZ6-3;Q96SZ6-2	CK5P1_HUMAN;.;.;.;.	Q	312;326;222;312	.	ENSP00000217372:E312Q	E	-	1	0	CDK5RAP1	31431101	0.974000	0.33945	0.940000	0.37924	0.274000	0.26718	2.884000	0.48562	2.786000	0.95864	0.561000	0.74099	GAG	.		0.413	CDK5RAP1-011	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000078697.1	NM_016408	
CLASP2	23122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33638205	33638205	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:33638205T>C	ENST00000468888.2	-	19	1995	c.1949A>G	c.(1948-1950)gAt>gGt	p.D650G	CLASP2_ENST00000399362.4_Missense_Mutation_p.D649G|CLASP2_ENST00000539981.1_Missense_Mutation_p.D401G|CLASP2_ENST00000480013.1_Missense_Mutation_p.D416G|CLASP2_ENST00000359576.5_Missense_Mutation_p.D649G|CLASP2_ENST00000307312.7_Missense_Mutation_p.D138G|CLASP2_ENST00000461133.3_Missense_Mutation_p.D416G			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	416					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						GTTCTTACCATCCAGCTTGTC	0.289																																					p.D650G		.											.	CLASP2	93	0			c.A1949G						.						20.0	20.0	20.0					3																	33638205		1797	4050	5847	SO:0001583	missense	23122	exon19			TTACCATCCAGCT	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.1949A>G	3.37:g.33638205T>C	ENSP00000419974:p.Asp650Gly	Somatic	334.0	0.0		WXS	Illumina HiSeq	Phase_I	358.0	134.0	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	T	15.15	2.747666	0.49257	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000539981;ENST00000480013;ENST00000461133	T;T;T	0.18174	2.23;2.23;2.24	5.72	5.72	0.89469	Armadillo-type fold (1);	0.379923	0.24470	N	0.038249	T	0.29817	0.0745	L	0.29908	0.895	0.44736	D	0.997737	D;D	0.67145	0.993;0.996	D;D	0.76071	0.971;0.987	T	0.01688	-1.1295	10	0.36615	T	0.2	-8.177	14.8667	0.70422	0.0:0.0:0.0:1.0	.	416;649	O75122;F5H604	CLAP2_HUMAN;.	G	650;649;649;138;401;416;416	ENSP00000419974:D650G;ENSP00000382297:D649G;ENSP00000352581:D649G	ENSP00000304743:D138G	D	-	2	0	CLASP2	33613209	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.779000	0.75057	2.304000	0.77564	0.528000	0.53228	GAT	.		0.289	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
CLCA2	9635	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	86913417	86913417	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:86913417A>T	ENST00000370565.4	+	11	2102	c.1940A>T	c.(1939-1941)gAg>gTg	p.E647V		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	647					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		GTTGAGCCAGAGACTGGAGAT	0.433																																					p.E647V	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	.											.	CLCA2	155	0			c.A1940T						.						83.0	80.0	81.0					1																	86913417		2203	4300	6503	SO:0001583	missense	9635	exon11			AGCCAGAGACTGG		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1940A>T	1.37:g.86913417A>T	ENSP00000359596:p.Glu647Val	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	11.0	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	37	CCDS708.1	.	.	.	.	.	.	.	.	.	.	A	3.324	-0.138179	0.06669	.	.	ENSG00000137975	ENST00000370565	T	0.31510	1.49	5.72	4.6	0.57074	Domain of unknown function DUF1973 (1);	0.252260	0.37623	N	0.002012	T	0.09555	0.0235	L	0.46670	1.46	0.09310	N	1	B	0.24186	0.099	B	0.27608	0.081	T	0.22695	-1.0209	10	0.32370	T	0.25	-9.1903	3.3521	0.07156	0.6491:0.1413:0.0739:0.1358	.	647	Q9UQC9	CLCA2_HUMAN	V	647	ENSP00000359596:E647V	ENSP00000359596:E647V	E	+	2	0	CLCA2	86686005	0.993000	0.37304	0.657000	0.29651	0.017000	0.09413	2.602000	0.46257	1.018000	0.39521	0.533000	0.62120	GAG	.		0.433	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
CLCA4	22802	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	87029375	87029375	+	Silent	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:87029375C>G	ENST00000370563.3	+	4	522	c.480C>G	c.(478-480)ctC>ctG	p.L160L	CLCA4_ENST00000263723.5_5'UTR	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	160	Metalloprotease domain. {ECO:0000250|UniProtKB:A8K7I4}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		GGGCTCACCTCCGGTGGGGAG	0.393																																					p.L160L		.											.	CLCA4	92	0			c.C480G						.						91.0	90.0	90.0					1																	87029375		1948	4182	6130	SO:0001819	synonymous_variant	22802	exon4			TCACCTCCGGTGG	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.480C>G	1.37:g.87029375C>G		Somatic	134.0	1.0		WXS	Illumina HiSeq	Phase_I	138.0	50.0	NM_012128	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Silent	SNP	ENST00000370563.3	37	CCDS41355.1																																																																																			.		0.393	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
CMPK2	129607	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	7003625	7003625	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:7003625C>T	ENST00000256722.5	-	2	759	c.760G>A	c.(760-762)Gtt>Att	p.V254I	CMPK2_ENST00000458098.1_Missense_Mutation_p.V254I|CMPK2_ENST00000478738.1_5'UTR|CMPK2_ENST00000404168.1_Missense_Mutation_p.V254I	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	254					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGGCAACAACCTGGAACTTT	0.443																																					p.V254I		.											.	CMPK2	68	0			c.G760A						.						133.0	133.0	133.0					2																	7003625		1904	4117	6021	SO:0001583	missense	129607	exon2			CAACAACCTGGAA		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.760G>A	2.37:g.7003625C>T	ENSP00000256722:p.Val254Ile	Somatic	43.0	1.0		WXS	Illumina HiSeq	Phase_I	81.0	26.0	NM_001256478	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Missense_Mutation	SNP	ENST00000256722.5	37	CCDS42648.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203604	0.58234	.	.	ENSG00000134326	ENST00000458098;ENST00000256722;ENST00000404168	D;D;D	0.94184	-3.37;-3.37;-3.37	5.21	4.33	0.51752	.	0.064498	0.64402	N	0.000009	D	0.94098	0.8108	M	0.66939	2.045	0.48040	D	0.999579	D;P	0.54772	0.968;0.896	P;B	0.52758	0.708;0.15	D	0.93068	0.6480	10	0.40728	T	0.16	-17.66	13.6566	0.62341	0.0:0.9249:0.0:0.0751	.	254;254	Q5EBM0-3;Q5EBM0	.;CMPK2_HUMAN	I	254	ENSP00000396385:V254I;ENSP00000256722:V254I;ENSP00000384915:V254I	ENSP00000256722:V254I	V	-	1	0	CMPK2	6921076	0.997000	0.39634	0.014000	0.15608	0.365000	0.29674	3.731000	0.55013	1.187000	0.43000	0.557000	0.71058	GTT	.		0.443	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
CNTN2	6900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	205041085	205041085	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:205041085G>T	ENST00000331830.4	+	20	2839	c.2555G>T	c.(2554-2556)tGg>tTg	p.W852L		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	852	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ATCCGCTACTGGAAAGCTGGG	0.612																																					p.W852L	Melanoma(183;2548 2817 37099 41192)	.											.	CNTN2	91	0			c.G2555T						.						56.0	54.0	54.0					1																	205041085		2203	4300	6503	SO:0001583	missense	6900	exon20			GCTACTGGAAAGC	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2555G>T	1.37:g.205041085G>T	ENSP00000330633:p.Trp852Leu	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	20.0	NM_005076	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	37	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	G	32	5.137740	0.94517	.	.	ENSG00000184144	ENST00000331830	T	0.56941	0.43	5.46	5.46	0.80206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.46145	D	0.000312	T	0.70962	0.3284	L	0.58810	1.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73036	-0.4109	10	0.87932	D	0	.	18.9039	0.92453	0.0:0.0:1.0:0.0	.	852;743	Q02246;Q68DA2	CNTN2_HUMAN;.	L	852	ENSP00000330633:W852L	ENSP00000330633:W852L	W	+	2	0	CNTN2	203307708	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.531000	0.98054	2.570000	0.86706	0.655000	0.94253	TGG	.		0.612	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
COL4A2	1284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	111090978	111090978	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr13:111090978A>C	ENST00000360467.5	+	15	1181	c.875A>C	c.(874-876)aAg>aCg	p.K292T		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	292	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			ATTTCCTTGAAGGGAGAAGAA	0.547																																					p.K292T		.											.	COL4A2	95	0			c.A875C						.						146.0	148.0	147.0					13																	111090978		1892	4121	6013	SO:0001583	missense	1284	exon15			CCTTGAAGGGAGA	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.875A>C	13.37:g.111090978A>C	ENSP00000353654:p.Lys292Thr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	39.0	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	37	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	A	10.23	1.294103	0.23564	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.96619	-4.07	4.52	3.34	0.38264	.	0.155857	0.28504	N	0.015105	D	0.96602	0.8891	M	0.82056	2.57	0.37765	D	0.926489	D	0.63046	0.992	P	0.56865	0.808	D	0.95966	0.8966	10	0.45353	T	0.12	.	6.2121	0.20636	0.8868:0.0:0.1132:0.0	.	292	P08572	CO4A2_HUMAN	T	292	ENSP00000353654:K292T	ENSP00000257309:K292T	K	+	2	0	COL4A2	109888979	0.999000	0.42202	0.956000	0.39512	0.326000	0.28443	1.776000	0.38594	1.807000	0.52817	0.455000	0.32223	AAG	.		0.547	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
COL9A1	1297	ucsc.edu;bcgsc.ca	37	6	71004221	71004221	+	Silent	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:71004221C>A	ENST00000357250.6	-	5	503	c.345G>T	c.(343-345)acG>acT	p.T115T	COL9A1_ENST00000370496.3_Silent_p.T115T	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	115	Laminin G-like.|Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						TTCGAAACGTCGTCAAGAAGG	0.398																																					p.T115T		.											.	COL9A1	94	0			c.G345T						.						119.0	124.0	123.0					6																	71004221		2203	4300	6503	SO:0001819	synonymous_variant	1297	exon5			AAACGTCGTCAAG		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.345G>T	6.37:g.71004221C>A		Somatic	122.0	2.0		WXS	Illumina HiSeq	.	71.0	40.0	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	ENST00000357250.6	37	CCDS4971.1																																																																																			.		0.398	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
COX6B1	1340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36142167	36142167	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:36142167A>G	ENST00000592141.1	+	2	287	c.22A>G	c.(22-24)Aaa>Gaa	p.K8E	COX6B1_ENST00000246554.3_Missense_Mutation_p.K8E|COX6B1_ENST00000392201.1_Missense_Mutation_p.K8E			P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)	8					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			lung(6)|prostate(1)|stomach(1)	8	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CATGGAGACCAAAATCAAGAA	0.567																																					p.K8E		.											.	COX6B1	226	0			c.A22G						.						96.0	82.0	87.0					19																	36142167		2203	4300	6503	SO:0001583	missense	1340	exon2			GAGACCAAAATCA	BC001015	CCDS12469.1	19q13.1	2011-07-04	2010-01-07	2004-08-12	ENSG00000126267	ENSG00000126267	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2280	protein-coding gene	gene with protein product		124089	"""cytochrome c oxidase subunit Vib"", ""cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)"""	COX6B		1650756	Standard	NM_001863		Approved	COXG	uc002oav.3	P14854	OTTHUMG00000048112	ENST00000592141.1:c.22A>G	19.37:g.36142167A>G	ENSP00000466818:p.Lys8Glu	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	19.0	NM_001863	B2R5C9|Q6IBL4	Missense_Mutation	SNP	ENST00000592141.1	37	CCDS12469.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019076	0.75275	.	.	ENSG00000126267	ENST00000246554;ENST00000392201	D	0.83163	-1.69	5.31	5.31	0.75309	.	0.056377	0.64402	D	0.000002	D	0.85784	0.5777	.	.	.	0.52099	D	0.99994	D	0.62365	0.991	P	0.58928	0.848	T	0.83142	-0.0108	9	0.21540	T	0.41	-38.4036	11.6541	0.51306	1.0:0.0:0.0:0.0	.	8	P14854	CX6B1_HUMAN	E	8;25	ENSP00000246554:K8E	ENSP00000246554:K8E	K	+	1	0	COX6B1	40834007	1.000000	0.71417	0.999000	0.59377	0.709000	0.40893	8.116000	0.89574	2.017000	0.59298	0.523000	0.50628	AAA	.		0.567	COX6B1-004	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459068.3	NM_001863	
CR2	1380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207644213	207644213	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:207644213C>G	ENST00000367058.3	+	7	1543	c.1354C>G	c.(1354-1356)Cag>Gag	p.Q452E	CR2_ENST00000367057.3_Missense_Mutation_p.Q452E|CR2_ENST00000458541.2_Missense_Mutation_p.Q452E|CR2_ENST00000367059.3_Missense_Mutation_p.Q452E	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	452	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						AGAATCCATACAGTGTACCTC	0.463																																					p.Q452E		.											.	CR2	232	0			c.C1354G						.						68.0	69.0	68.0					1																	207644213		2203	4300	6503	SO:0001583	missense	1380	exon7			TCCATACAGTGTA	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1354C>G	1.37:g.207644213C>G	ENSP00000356025:p.Gln452Glu	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	24.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	37	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728734	0.30593	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	4.57	4.57	0.56435	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.44414	0.1292	N	0.10664	0.02	0.21290	N	0.999731	B;B;B	0.23377	0.084;0.015;0.015	B;B;B	0.29524	0.103;0.028;0.026	T	0.27606	-1.0069	9	0.25751	T	0.34	.	13.6005	0.62015	0.0:1.0:0.0:0.0	.	452;452;452	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	E	452	ENSP00000356025:Q452E;ENSP00000356024:Q452E;ENSP00000356026:Q452E;ENSP00000404222:Q452E	ENSP00000356024:Q452E	Q	+	1	0	CR2	205710836	0.003000	0.15002	0.858000	0.33744	0.664000	0.39144	0.533000	0.23082	2.473000	0.83533	0.655000	0.94253	CAG	.		0.463	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
CSPP1	79848	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	68062027	68062027	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:68062027A>G	ENST00000262210.5	+	16	2001	c.1970A>G	c.(1969-1971)aAt>aGt	p.N657S	CSPP1_ENST00000412460.1_Intron	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	692					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GCTGATTTGAATAGGATGCAC	0.333																																					p.N657S		.											.	CSPP1	138	0			c.A1970G						.						184.0	179.0	180.0					8																	68062027		1823	4078	5901	SO:0001583	missense	79848	exon16			ATTTGAATAGGAT	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.1970A>G	8.37:g.68062027A>G	ENSP00000262210:p.Asn657Ser	Somatic	181.0	1.0		WXS	Illumina HiSeq	Phase_I	320.0	17.0	NM_024790	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	ENST00000262210.5	37	CCDS43744.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.237851	0.79800	.	.	ENSG00000104218	ENST00000262210;ENST00000389042	T	0.62788	0.0	5.96	5.96	0.96718	.	0.313426	0.18516	U	0.138908	T	0.68403	0.2997	L	0.40543	1.245	0.80722	D	1	D;D;D	0.69078	0.991;0.997;0.997	P;P;P	0.61800	0.801;0.894;0.894	T	0.61840	-0.6980	10	0.16896	T	0.51	-17.9878	16.1061	0.81223	1.0:0.0:0.0:0.0	.	657;692;692	Q1MSJ5-1;Q1MSJ5;F8W7C3	.;CSPP1_HUMAN;.	S	657;692	ENSP00000262210:N657S	ENSP00000262210:N657S	N	+	2	0	CSPP1	68224581	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.724000	0.74747	2.284000	0.76573	0.528000	0.53228	AAT	.		0.333	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	113314168	113314168	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:113314168G>T	ENST00000297405.5	-	53	8538	c.8294C>A	c.(8293-8295)cCt>cAt	p.P2765H	CSMD3_ENST00000455883.2_Missense_Mutation_p.P2596H|CSMD3_ENST00000352409.3_Missense_Mutation_p.P2695H|CSMD3_ENST00000343508.3_Missense_Mutation_p.P2725H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2765	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCATTTGGAGGTGTAGGTAG	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.P2765H		.											CSMD3,NS,carcinoma,-1	CSMD3	1132	0			c.C8294A						.						97.0	98.0	98.0					8																	113314168		2203	4300	6503	SO:0001583	missense	114788	exon53			TTTGGAGGTGTAG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8294C>A	8.37:g.113314168G>T	ENSP00000297405:p.Pro2765His	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	17.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310624	0.81358	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17	5.59	5.59	0.84812	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.87022	0.6074	H	0.97940	4.11	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.991;0.995;0.996	D	0.87451	0.2401	10	0.23302	T	0.38	.	19.9636	0.97259	0.0:0.0:1.0:0.0	.	2596;2765;2725	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	H	2725;2765;2035;2596;2695	ENSP00000345799:P2725H;ENSP00000297405:P2765H;ENSP00000341558:P2035H;ENSP00000412263:P2596H;ENSP00000343124:P2695H	ENSP00000297405:P2765H	P	-	2	0	CSMD3	113383344	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.811000	0.86092	2.795000	0.96236	0.637000	0.83480	CCT	.		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CXCL14	9547	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	134914414	134914414	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:134914414G>A	ENST00000337225.5	-	1	555	c.91C>T	c.(91-93)Cgt>Tgt	p.R31C	CXCL14_ENST00000512158.1_Missense_Mutation_p.R19C|CTC-321K16.1_ENST00000509372.1_RNA|CTC-321K16.1_ENST00000514446.1_RNA	NM_004887.4	NP_004878.2	O95715	CXL14_HUMAN	chemokine (C-X-C motif) ligand 14	31					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inner ear development (GO:0048839)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	chemokine activity (GO:0008009)			large_intestine(2)|lung(2)|prostate(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCGTCCACACGCGCGGTGTAC	0.697																																					p.R31C		.											.	CXCL14	650	0			c.C91T						.						10.0	9.0	9.0					5																	134914414		2016	3979	5995	SO:0001583	missense	9547	exon1			CCACACGCGCGGT	AF073957	CCDS4188.1	5q31	2010-04-30	2002-08-22	2002-08-23	ENSG00000145824	ENSG00000145824			10640	protein-coding gene	gene with protein product	"""breast and kidney"""	604186	"""small inducible cytokine subfamily B (Cys-X-Cys), member 14 (BRAK)"""	SCYB14		10049774	Standard	NM_004887		Approved	BRAK, NJAC, bolekine, Kec, MIP-2g, BMAC, KS1	uc003lay.3	O95715	OTTHUMG00000129139	ENST00000337225.5:c.91C>T	5.37:g.134914414G>A	ENSP00000337065:p.Arg31Cys	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	32.0	NM_004887	B3KQU8|Q6UW97|Q86U69|Q9BTR1|Q9NS21	Missense_Mutation	SNP	ENST00000337225.5	37	CCDS4188.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.488725	0.44249	.	.	ENSG00000145824	ENST00000337225;ENST00000512158	.	.	.	4.67	2.78	0.32641	Chemokine interleukin-8-like domain (1);	0.586313	0.19383	N	0.115618	T	0.28333	0.0700	L	0.36672	1.1	0.09310	N	0.999994	D	0.61697	0.99	P	0.44946	0.465	T	0.09818	-1.0657	9	0.52906	T	0.07	1.6211	6.7845	0.23665	0.0:0.3784:0.397:0.2246	.	31	O95715	CXL14_HUMAN	C	31;19	.	ENSP00000337065:R31C	R	-	1	0	CXCL14	134942313	1.000000	0.71417	0.996000	0.52242	0.868000	0.49771	1.825000	0.39081	0.934000	0.37316	0.563000	0.77884	CGT	.		0.697	CXCL14-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_004887	
CXCR3	2833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70836903	70836903	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:70836903A>T	ENST00000373693.3	-	2	486	c.419T>A	c.(418-420)cTc>cAc	p.L140H	CXCR3_ENST00000373691.4_Missense_Mutation_p.L187H	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	140					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					GGCCAGCAGGAGGGCTCCTGC	0.642																																					p.L187H		.											.	CXCR3	660	0			c.T560A						.						23.0	21.0	22.0					X																	70836903		2203	4298	6501	SO:0001583	missense	2833	exon2			AGCAGGAGGGCTC	U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.419T>A	X.37:g.70836903A>T	ENSP00000362797:p.Leu140His	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	13.0	NM_001142797	B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	ENST00000373693.3	37	CCDS14416.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.760641	0.49468	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.42900	0.96;0.96	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.208085	0.40554	N	0.001072	T	0.64560	0.2609	M	0.89214	3.015	0.26427	N	0.976003	D;P	0.61080	0.989;0.635	P;P	0.58721	0.844;0.465	T	0.65504	-0.6152	10	0.87932	D	0	.	12.1786	0.54199	1.0:0.0:0.0:0.0	.	187;140	P49682-2;P49682	.;CXCR3_HUMAN	H	187;140;140	ENSP00000362795:L187H;ENSP00000362797:L140H	ENSP00000362791:L140H	L	-	2	0	CXCR3	70753628	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	7.064000	0.76721	2.006000	0.58801	0.481000	0.45027	CTC	.		0.642	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144141.1		
DDX3Y	8653	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	15024659	15024659	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrY:15024659G>T	ENST00000336079.3	+	5	408	c.302G>T	c.(301-303)aGt>aTt	p.S101I	DDX3Y_ENST00000360160.4_Missense_Mutation_p.S101I	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked	101						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5						CGTGGACGGAGTGACTATGAT	0.433																																					p.S101I		.											.	DDX3Y	136	0			c.G302T						.						127.0	124.0	124.0					Y																	15024659		631	1994	2625	SO:0001583	missense	8653	exon5			GACGGAGTGACTA	AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048		"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY		9381176	Standard	NM_004660		Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.302G>T	Y.37:g.15024659G>T	ENSP00000336725:p.Ser101Ile	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	85.0	NM_004660	B4DK29|B4DXX7|Q8IYV7	Missense_Mutation	SNP	ENST00000336079.3	37	CCDS14782.1																																																																																			.		0.433	DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088407.1	NM_004660	
DEDD2	162989	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	42713936	42713936	+	Nonsense_Mutation	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:42713936T>A	ENST00000595337.1	-	4	592	c.505A>T	c.(505-507)Aga>Tga	p.R169*	DEDD2_ENST00000596251.1_Nonsense_Mutation_p.R169*|DEDD2_ENST00000598727.1_Nonsense_Mutation_p.R169*|DEDD2_ENST00000593804.1_5'UTR|DEDD2_ENST00000336034.4_Nonsense_Mutation_p.R164*	NM_001270614.1	NP_001257543.1	Q8WXF8	DEDD2_HUMAN	death effector domain containing 2	169					apoptotic nuclear changes (GO:0030262)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|RNA processing (GO:0006396)|rRNA catabolic process (GO:0016075)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|large_intestine(1)|ovary(1)|prostate(2)	5		Prostate(69;0.0704)				CGCCGCCGTCTGGCACCACCA	0.667																																					p.R169X		.											.	DEDD2	90	0			c.A505T						.						23.0	26.0	25.0					19																	42713936		2191	4276	6467	SO:0001587	stop_gained	162989	exon4			GCCGTCTGGCACC	AY125488	CCDS12597.1, CCDS59391.1	19q13.31	2008-02-05				ENSG00000160570			24450	protein-coding gene	gene with protein product						11965497, 12235123	Standard	NM_133328		Approved	FLAME-3	uc031rkv.1	Q8WXF8		ENST00000595337.1:c.505A>T	19.37:g.42713936T>A	ENSP00000470082:p.Arg169*	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	11.0	NM_133328	Q8NBR2|Q8NES1|Q8TAA8|Q96D35	Nonsense_Mutation	SNP	ENST00000595337.1	37	CCDS12597.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.892140	0.91889	.	.	ENSG00000160570	ENST00000336034	.	.	.	3.81	0.099	0.14501	.	0.260060	0.31660	N	0.007262	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.428	12.0896	0.53717	0.0:0.0:0.7078:0.2922	.	.	.	.	X	169	.	ENSP00000336972:R169X	R	-	1	2	DEDD2	47405776	0.997000	0.39634	0.988000	0.46212	0.961000	0.63080	0.651000	0.24873	-0.036000	0.13669	0.383000	0.25322	AGA	.		0.667	DEDD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463508.1	NM_133328	
DGKB	1607	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	14741336	14741336	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:14741336G>A	ENST00000403951.2	-	7	905	c.486C>T	c.(484-486)gaC>gaT	p.D162D	DGKB_ENST00000402815.1_Silent_p.D162D|DGKB_ENST00000407950.1_Silent_p.D155D|DGKB_ENST00000258767.5_Silent_p.D162D|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000444700.2_Silent_p.D155D|DGKB_ENST00000406247.3_Silent_p.D162D|DGKB_ENST00000399322.3_Silent_p.D162D			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	162	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TCCCATCCGTGTCATAAAGGC	0.308																																					p.D162D		.											.	DGKB	276	0			c.C486T						.						86.0	84.0	84.0					7																	14741336		1835	4084	5919	SO:0001819	synonymous_variant	1607	exon6			ATCCGTGTCATAA	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.486C>T	7.37:g.14741336G>A		Somatic	214.0	1.0		WXS	Illumina HiSeq	Phase_I	191.0	66.0	NM_145695	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Silent	SNP	ENST00000403951.2	37	CCDS47547.1																																																																																			.		0.308	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
DENND2A	27147	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	140221816	140221816	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:140221816A>G	ENST00000275884.6	-	17	3167	c.2750T>C	c.(2749-2751)tTc>tCc	p.F917S	DENND2A_ENST00000496613.1_Missense_Mutation_p.F917S|DENND2A_ENST00000537639.1_Missense_Mutation_p.F917S			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	917	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					CGACGTCAGGAACAAAGAGTA	0.587																																					p.F917S		.											.	DENND2A	138	0			c.T2750C						.						60.0	64.0	63.0					7																	140221816		2036	4189	6225	SO:0001583	missense	27147	exon16			GTCAGGAACAAAG	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.2750T>C	7.37:g.140221816A>G	ENSP00000275884:p.Phe917Ser	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	29.0	NM_015689	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	ENST00000275884.6	37	CCDS43659.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.659085	0.47467	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613	T;T;T	0.54279	0.58;0.58;0.58	5.26	5.26	0.73747	dDENN (3);	0.000000	0.64402	D	0.000012	T	0.55752	0.1940	M	0.67953	2.075	0.50632	D	0.999885	B	0.19935	0.04	B	0.30716	0.119	T	0.54649	-0.8262	10	0.40728	T	0.16	-18.5382	15.2034	0.73159	1.0:0.0:0.0:0.0	.	917	Q9ULE3	DEN2A_HUMAN	S	917	ENSP00000275884:F917S;ENSP00000442245:F917S;ENSP00000419654:F917S	ENSP00000275884:F917S	F	-	2	0	DENND2A	139868285	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	6.980000	0.76160	1.989000	0.58080	0.455000	0.32223	TTC	.		0.587	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348742.1	NM_015689	
DIP2C	22982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	329266	329266	+	Missense_Mutation	SNP	G	G	T	rs534481067		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:329266G>T	ENST00000280886.6	-	35	4327	c.4240C>A	c.(4240-4242)Cgc>Agc	p.R1414S	RNA5SP298_ENST00000364991.1_RNA	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1414						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		TAGCCTGTGCGTGCCCAGATG	0.547																																					p.R1414S		.											.	DIP2C	156	0			c.C4240A						.						120.0	114.0	116.0					10																	329266		2203	4300	6503	SO:0001583	missense	22982	exon35			CTGTGCGTGCCCA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.4240C>A	10.37:g.329266G>T	ENSP00000280886:p.Arg1414Ser	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	37.0	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055110	0.75960	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.50277	0.75	5.92	4.06	0.47325	AMP-dependent synthetase/ligase (1);	0.064948	0.64402	N	0.000005	T	0.65523	0.2699	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.67146	-0.5744	10	0.87932	D	0	-14.0495	10.1202	0.42616	0.0643:0.0:0.6908:0.2449	.	1414	Q9Y2E4	DIP2C_HUMAN	S	1414;339	ENSP00000280886:R1414S	ENSP00000280886:R1414S	R	-	1	0	DIP2C	319266	1.000000	0.71417	0.337000	0.25536	0.981000	0.71138	3.432000	0.52824	0.828000	0.34709	0.549000	0.68633	CGC	.		0.547	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
DIRAS1	148252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2717599	2717599	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:2717599G>C	ENST00000323469.4	-	2	389	c.206C>G	c.(205-207)cCg>cGg	p.P69R	DIRAS1_ENST00000585334.1_Missense_Mutation_p.P69R	NM_145173.3	NP_660156.1	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	69					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|lung(2)|ovary(2)|prostate(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCATGGCCGGGAACTGGTG	0.622																																					p.P69R		.											.	DIRAS1	659	0			c.C206G						.						77.0	63.0	68.0					19																	2717599		2203	4299	6502	SO:0001583	missense	148252	exon2			ATGGCCGGGAACT	BC030660	CCDS12092.1	19p13.3	2014-05-09				ENSG00000176490			19127	protein-coding gene	gene with protein product		607862				12107278	Standard	NM_145173		Approved	Di-Ras1, GBTS1, RIG	uc002lwf.3	O95057		ENST00000323469.4:c.206C>G	19.37:g.2717599G>C	ENSP00000325836:p.Pro69Arg	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	15.0	NM_145173		Missense_Mutation	SNP	ENST00000323469.4	37	CCDS12092.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475625	0.63737	.	.	ENSG00000176490	ENST00000323469	T	0.74947	-0.89	4.07	4.07	0.47477	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	N	0.03268	-0.37	0.80722	D	1	D	0.67145	0.996	D	0.69307	0.963	T	0.76545	-0.2920	10	0.52906	T	0.07	.	13.7485	0.62890	0.0:0.0:1.0:0.0	.	69	O95057	DIRA1_HUMAN	R	69	ENSP00000325836:P69R	ENSP00000325836:P69R	P	-	2	0	DIRAS1	2668599	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.502000	0.97981	1.813000	0.52934	0.549000	0.68633	CCG	.		0.622	DIRAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451350.1		
DPY19L1	23333	broad.mit.edu;bcgsc.ca	37	7	34981498	34981498	+	Splice_Site	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:34981498T>C	ENST00000310974.4	-	18	1495		c.e18-2		MIR548N_ENST00000408742.1_RNA	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)							integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						GTAAACCAGCTGAAAGAAAGA	0.353																																					.		.											.	DPY19L1	68	0			c.1351-2A>G						.						48.0	49.0	49.0					7																	34981498		1806	4064	5870	SO:0001630	splice_region_variant	23333	exon19			ACCAGCTGAAAGA	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1351-2A>G	7.37:g.34981498T>C		Somatic	278.0	1.0		WXS	Illumina HiSeq	Phase_I	307.0	92.0	NM_015283	O94954|Q4G151	Splice_Site	SNP	ENST00000310974.4	37	CCDS43567.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.147839	0.78001	.	.	ENSG00000173852	ENST00000310974	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4375	0.67293	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DPY19L1	34948023	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.896000	0.87350	2.072000	0.62099	0.472000	0.43445	.	.		0.353	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337506.1		Intron
DSP	1832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	7571705	7571705	+	Silent	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:7571705A>T	ENST00000379802.3	+	14	2132	c.1791A>T	c.(1789-1791)tcA>tcT	p.S597S	DSP_ENST00000418664.2_Silent_p.S597S	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	597	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCCAAGGCTCAGAGATGTTTG	0.473																																					p.S597S		.											.	DSP	518	0			c.A1791T						.						224.0	215.0	218.0					6																	7571705		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon14			AGGCTCAGAGATG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1791A>T	6.37:g.7571705A>T		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	43.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	37	CCDS4501.1																																																																																			.		0.473	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
EEF2K	29904	ucsc.edu;bcgsc.ca	37	16	22291635	22291635	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr16:22291635C>T	ENST00000263026.5	+	17	2480	c.2006C>T	c.(2005-2007)gCc>gTc	p.A669V		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	669					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		ATGATGCTGGCCAGGGAGGCC	0.637																																					p.A669V	NSCLC(195;1411 2157 20319 27471 51856)	.											.	EEF2K	856	0			c.C2006T						.						80.0	58.0	66.0					16																	22291635		2197	4300	6497	SO:0001583	missense	29904	exon17			TGCTGGCCAGGGA	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.2006C>T	16.37:g.22291635C>T	ENSP00000263026:p.Ala669Val	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_013302	Q8N588	Missense_Mutation	SNP	ENST00000263026.5	37	CCDS10604.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.739262	0.69304	.	.	ENSG00000103319	ENST00000263026	T	0.54071	0.59	5.58	5.58	0.84498	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.60170	0.2248	M	0.64567	1.98	0.80722	D	1	P	0.35844	0.524	B	0.42112	0.376	T	0.60052	-0.7338	10	0.48119	T	0.1	-23.3254	19.563	0.95380	0.0:1.0:0.0:0.0	.	669	O00418	EF2K_HUMAN	V	669	ENSP00000263026:A669V	ENSP00000263026:A669V	A	+	2	0	EEF2K	22199136	1.000000	0.71417	1.000000	0.80357	0.403000	0.30841	7.459000	0.80802	2.630000	0.89119	0.561000	0.74099	GCC	.		0.637	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211580.2	NM_013302	
ENTPD1	953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	97602202	97602202	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:97602202C>A	ENST00000371205.4	+	4	647	c.364C>A	c.(364-366)Caa>Aaa	p.Q122K	ENTPD1_ENST00000490659.1_3'UTR|ENTPD1_ENST00000543964.1_Missense_Mutation_p.Q14K|ENTPD1_ENST00000371207.3_Missense_Mutation_p.Q134K|RP11-429G19.3_ENST00000433113.1_RNA|ENTPD1_ENST00000453258.2_Missense_Mutation_p.Q129K|ENTPD1_ENST00000371203.5_Intron|ENTPD1_ENST00000539125.1_Intron|ENTPD1-AS1_ENST00000416301.1_RNA			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	122					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		GTCCCAGCACCAAGAGACACC	0.488																																					p.Q134K		.											.	ENTPD1	93	0			c.C400A						.						87.0	89.0	88.0					10																	97602202		2203	4300	6503	SO:0001583	missense	953	exon4			CAGCACCAAGAGA	S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.364C>A	10.37:g.97602202C>A	ENSP00000360248:p.Gln122Lys	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	52.0	NM_001164178	A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	Missense_Mutation	SNP	ENST00000371205.4	37	CCDS7444.1	.	.	.	.	.	.	.	.	.	.	C	8.851	0.944604	0.18356	.	.	ENSG00000138185	ENST00000453258;ENST00000371206;ENST00000371207;ENST00000543964;ENST00000371205	T;T;T;T	0.10960	2.82;2.82;2.82;2.82	5.26	1.29	0.21616	.	1.485950	0.03397	N	0.202833	T	0.05593	0.0147	N	0.16708	0.43	0.09310	N	1	B;B;B;B;B	0.14012	0.009;0.007;0.007;0.009;0.004	B;B;B;B;B	0.16722	0.016;0.009;0.006;0.016;0.012	T	0.28681	-1.0036	10	0.02654	T	1	5.5126	1.3911	0.02250	0.3172:0.3784:0.1376:0.1668	.	134;134;129;122;129	B4DWB9;G3XAF6;P49961-2;P49961;P49961-3	.;.;.;ENTP1_HUMAN;.	K	129;129;134;14;122	ENSP00000390955:Q129K;ENSP00000360250:Q134K;ENSP00000442968:Q14K;ENSP00000360248:Q122K	ENSP00000360248:Q122K	Q	+	1	0	ENTPD1	97592192	0.000000	0.05858	0.000000	0.03702	0.932000	0.56968	-0.252000	0.08806	0.073000	0.16731	0.591000	0.81541	CAA	.		0.488	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049566.1	NM_001776	
EIF3A	8661	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	120801558	120801558	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:120801558G>A	ENST00000369144.3	-	19	3601	c.3474C>T	c.(3472-3474)ccC>ccT	p.P1158P	EIF3A_ENST00000541549.1_Silent_p.P1124P	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		CACCCCGTCTGGGAAACCGAT	0.473																																					p.P1158P		.											.	EIF3A	226	0			c.C3474T						.						137.0	109.0	118.0					10																	120801558		2203	4300	6503	SO:0001819	synonymous_variant	8661	exon19			CCGTCTGGGAAAC	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.3474C>T	10.37:g.120801558G>A		Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	42.0	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Silent	SNP	ENST00000369144.3	37	CCDS7608.1																																																																																			.		0.473	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
EPHA6	285220	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	97185271	97185271	+	Silent	SNP	A	A	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:97185271A>C	ENST00000514100.1	+	4	257	c.15A>C	c.(13-15)ccA>ccC	p.P5P	EPHA6_ENST00000442602.2_Intron|EPHA6_ENST00000389672.5_Intron|EPHA6_ENST00000502694.1_Silent_p.P5P	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						aggactctccatttcaagtga	0.413																																					p.P5P		.											.	EPHA6	1561	0			c.A15C						.						113.0	107.0	109.0					3																	97185271		1854	4102	5956	SO:0001819	synonymous_variant	285220	exon5			CTCTCCATTTCAA	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.15A>C	3.37:g.97185271A>C		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	30.0	NM_173655	D6RAL5	Silent	SNP	ENST00000514100.1	37																																																																																				.		0.413	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
ERMN	57471	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	158177872	158177872	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:158177872A>G	ENST00000410096.1	-	3	1057	c.766T>C	c.(766-768)Tcc>Ccc	p.S256P	ERMN_ENST00000535935.1_Missense_Mutation_p.S150P|ERMN_ENST00000420719.2_Missense_Mutation_p.S236P|ERMN_ENST00000397283.2_Missense_Mutation_p.S269P	NM_020711.1	NP_065762.1	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein	256					actin filament organization (GO:0007015)|morphogenesis of a branching structure (GO:0001763)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|internode region of axon (GO:0033269)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|paranode region of axon (GO:0033270)				endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12						TTGTATCTGGAATAAGCATTT	0.413																																					p.S269P		.											.	ERMN	92	0			c.T805C						.						160.0	157.0	158.0					2																	158177872		1947	4135	6082	SO:0001583	missense	57471	exon4			ATCTGGAATAAGC	AB033015	CCDS42764.1, CCDS46431.1	2q24	2008-02-05	2008-01-15	2008-01-15	ENSG00000136541	ENSG00000136541			29208	protein-coding gene	gene with protein product	"""juxtanodin"", ""ermin"""	610072	"""KIAA1189"""	KIAA1189		16051705, 16421295	Standard	NM_020711		Approved	JN, ERMIN	uc002tzi.3	Q8TAM6	OTTHUMG00000153843	ENST00000410096.1:c.766T>C	2.37:g.158177872A>G	ENSP00000387047:p.Ser256Pro	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_001009959	B4DKA6|Q9ULN1	Missense_Mutation	SNP	ENST00000410096.1	37	CCDS46431.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.192325	0.38707	.	.	ENSG00000136541	ENST00000410096;ENST00000397283;ENST00000535935;ENST00000420719	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	6.07	4.91	0.64330	.	0.110120	0.41396	D	0.000897	D	0.91123	0.7205	L	0.36672	1.1	0.36994	D	0.894939	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.99;0.99	D	0.93138	0.6539	10	0.87932	D	0	-52.8423	13.2643	0.60125	0.8674:0.1326:0.0:0.0	.	236;269;256	B4DIZ1;Q8TAM6-2;Q8TAM6	.;.;ERMIN_HUMAN	P	256;269;150;236	ENSP00000387047:S256P;ENSP00000380453:S269P;ENSP00000438397:S150P;ENSP00000410646:S236P	ENSP00000380453:S269P	S	-	1	0	ERMN	157886118	1.000000	0.71417	0.994000	0.49952	0.207000	0.24258	2.288000	0.43514	1.094000	0.41399	-0.316000	0.08728	TCC	.		0.413	ERMN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332659.1	NM_001009959	
ERICH6	131831	hgsc.bcm.edu;broad.mit.edu	37	3	150421522	150421523	+	In_Frame_Ins	INS	-	-	CCTCCT	rs372003402		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:150421522_150421523insCCTCCT	ENST00000295910.6	-	1	215_216	c.163_164insAGGAGG	c.(163-165)gtg>gAGGAGGtg	p.54_55insEE	RP11-103G8.2_ENST00000475393.1_RNA|FAM194A_ENST00000491361.1_Intron|RP11-103G8.2_ENST00000471093.1_RNA	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ctcctccaccacctcctcctcc	0.604																																					p.V55delinsEEV		.											.	FAM194A	93	0			c.164_165insAGGAGG						.																																			SO:0001652	inframe_insertion	131831	exon1			TCCACCACCTCCT																												ENST00000295910.6:c.158_163dupAGGAGG	3.37:g.150421523_150421528dupCCTCCT	ENSP00000295910:p.Glu53_Glu54dup	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	14.0	NM_152394		In_Frame_Ins	INS	ENST00000295910.6	37	CCDS3151.2																																																																																			.		0.604	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257666.1		
FAM196B	100131897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169310676	169310676	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:169310676G>A	ENST00000377365.3	-	2	1608	c.227C>T	c.(226-228)cCc>cTc	p.P76L	DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000540750.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000520908.1_Intron|DOCK2_ENST00000256935.8_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	76										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						GTAGGTGGGGGGAAGATGGTG	0.562																																					p.P76L		.											.	.	.	0			c.C227T						.						106.0	112.0	110.0					5																	169310676		692	1591	2283	SO:0001583	missense	100131897	exon2			GTGGGGGGAAGAT		CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.227C>T	5.37:g.169310676G>A	ENSP00000366582:p.Pro76Leu	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	31.0	NM_001129891		Missense_Mutation	SNP	ENST00000377365.3	37	CCDS47336.1	.	.	.	.	.	.	.	.	.	.	G	0.876	-0.730258	0.03135	.	.	ENSG00000204767	ENST00000377365	T	0.38401	1.14	5.43	3.36	0.38483	.	0.208142	0.34245	N	0.004127	T	0.10809	0.0264	N	0.01410	-0.885	0.20703	N	0.999864	B	0.02656	0.0	B	0.04013	0.001	T	0.20306	-1.0279	10	0.20519	T	0.43	-7.6609	4.9166	0.13849	0.6667:0.0:0.3333:0.0	.	76	A6NMK8	F196B_HUMAN	L	76	ENSP00000366582:P76L	ENSP00000366582:P76L	P	-	2	0	FAM196B	169243254	0.024000	0.19004	0.973000	0.42090	0.844000	0.47949	1.461000	0.35255	1.105000	0.41606	0.655000	0.94253	CCC	.		0.562	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371629.1	NM_001129891	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80040839	80040839	+	Silent	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:80040839C>T	ENST00000306749.2	-	33	5936	c.5718G>A	c.(5716-5718)caG>caA	p.Q1906Q	FASN_ENST00000579758.1_5'UTR	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1906	Beta-ketoacyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GCACCCCACGCTGTATCAGCC	0.647																																					p.Q1906Q	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.G5718A						.						85.0	71.0	75.0					17																	80040839		2200	4298	6498	SO:0001819	synonymous_variant	2194	exon33			CCCACGCTGTATC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5718G>A	17.37:g.80040839C>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	21.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			.		0.647	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92616284	92616284	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:92616284T>C	ENST00000298047.6	+	23	12679	c.12662T>C	c.(12661-12663)gTc>gCc	p.V4221A	FAT3_ENST00000525166.1_Missense_Mutation_p.V4071A|FAT3_ENST00000533797.1_Missense_Mutation_p.V556A|FAT3_ENST00000409404.2_Missense_Mutation_p.V4221A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4221					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGCCGCAACGTCTACCAGGAG	0.652										TCGA Ovarian(4;0.039)																											p.V4221A		.											.	FAT3	73	0			c.T12662C						.						57.0	71.0	66.0					11																	92616284		1959	4130	6089	SO:0001583	missense	120114	exon23			GCAACGTCTACCA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12662T>C	11.37:g.92616284T>C	ENSP00000298047:p.Val4221Ala	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	13.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	T	15.28	2.787965	0.49997	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;D	0.85629	-0.87;-0.87;-0.88;-2.01	5.85	3.54	0.40534	.	.	.	.	.	T	0.73179	0.3554	N	0.19112	0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.62248	-0.6894	9	0.30078	T	0.28	.	10.1022	0.42511	0.0:0.1355:0.0:0.8645	.	4221;4221	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	A	4221;4221;4071;556	ENSP00000298047:V4221A;ENSP00000387040:V4221A;ENSP00000432586:V4071A;ENSP00000436399:V556A	ENSP00000298047:V4221A	V	+	2	0	FAT3	92255932	1.000000	0.71417	0.932000	0.37286	0.874000	0.50279	4.058000	0.57463	0.477000	0.27464	0.533000	0.62120	GTC	.		0.652	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FBN1	2200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48764821	48764821	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr15:48764821G>A	ENST00000316623.5	-	35	4718	c.4263C>T	c.(4261-4263)ctC>ctT	p.L1421L		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1421	EGF-like 24; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CTGGTGCATTGAGGCACTGGC	0.542																																					p.L1421L		.											.	FBN1	92	0			c.C4263T						.						133.0	123.0	127.0					15																	48764821		2198	4296	6494	SO:0001819	synonymous_variant	2200	exon35			TGCATTGAGGCAC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4263C>T	15.37:g.48764821G>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	17.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1																																																																																			.		0.542	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FERMT1	55612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	6057861	6057861	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr20:6057861C>T	ENST00000217289.4	-	15	2781	c.1993G>A	c.(1993-1995)Gat>Aat	p.D665N	FERMT1_ENST00000478194.1_5'UTR|FERMT1_ENST00000536936.1_Missense_Mutation_p.D408N	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	665					cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						AAGTCCTCATCGAGTGTTTCA	0.537											OREG0025763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D665N		.											.	FERMT1	495	0			c.G1993A						.						103.0	95.0	98.0					20																	6057861		2203	4300	6503	SO:0001583	missense	55612	exon15			CCTCATCGAGTGT	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.1993G>A	20.37:g.6057861C>T	ENSP00000217289:p.Asp665Asn	Somatic	56.0	0.0	631	WXS	Illumina HiSeq	Phase_I	74.0	30.0	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	37	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.606196	0.46527	.	.	ENSG00000101311	ENST00000217289;ENST00000536936	T;T	0.51574	0.7;0.7	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.46151	0.1378	N	0.24115	0.695	0.80722	D	1	D	0.65815	0.995	P	0.54499	0.754	T	0.19976	-1.0289	10	0.06236	T	0.91	-4.5069	20.0027	0.97425	0.0:1.0:0.0:0.0	.	665	Q9BQL6	FERM1_HUMAN	N	665;408	ENSP00000217289:D665N;ENSP00000441063:D408N	ENSP00000217289:D665N	D	-	1	0	FERMT1	6005861	1.000000	0.71417	0.123000	0.21794	0.843000	0.47879	5.995000	0.70631	2.733000	0.93635	0.655000	0.94253	GAT	.		0.537	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	
FMNL2	114793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	153471456	153471456	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:153471456C>A	ENST00000288670.9	+	12	1521	c.1154C>A	c.(1153-1155)gCt>gAt	p.A385D		NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	385	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CTGGAAGATGCTGAAACTAAG	0.408																																					p.A385D		.											.	FMNL2	516	0			c.C1154A						.						103.0	104.0	104.0					2																	153471456		1971	4163	6134	SO:0001583	missense	114793	exon12			AAGATGCTGAAAC	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1154C>A	2.37:g.153471456C>A	ENSP00000288670:p.Ala385Asp	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	40.0	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	37	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	C	34	5.374161	0.95923	.	.	ENSG00000157827	ENST00000288670	T	0.22539	1.95	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.47673	0.1458	M	0.73319	2.225	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.23868	-1.0176	10	0.33940	T	0.23	.	19.419	0.94713	0.0:1.0:0.0:0.0	.	385	Q96PY5-3	.	D	385	ENSP00000288670:A385D	ENSP00000288670:A385D	A	+	2	0	FMNL2	153179702	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	7.776000	0.85560	2.665000	0.90641	0.650000	0.86243	GCT	.		0.408	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
FOXD3	27022	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	63788839	63788839	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:63788839A>G	ENST00000371116.2	+	1	110	c.110A>G	c.(109-111)gAg>gGg	p.E37G	RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	37					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						GGGCTGGAAGAGAAGGACAGC	0.731																																					p.E37G	Pancreas(68;276 1750 11966 31252)	.											.	FOXD3	226	0			c.A110G						.						23.0	21.0	22.0					1																	63788839		2169	4263	6432	SO:0001583	missense	27022	exon1			TGGAAGAGAAGGA	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.110A>G	1.37:g.63788839A>G	ENSP00000360157:p.Glu37Gly	Somatic	10.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	7.0	NM_012183	Q9BYM2|Q9UDD1	Missense_Mutation	SNP	ENST00000371116.2	37	CCDS624.1	.	.	.	.	.	.	.	.	.	.	A	14.58	2.577013	0.45902	.	.	ENSG00000187140	ENST00000371116	D	0.94232	-3.38	3.01	3.01	0.34805	.	.	.	.	.	T	0.72859	0.3513	N	0.12182	0.205	0.32214	N	0.576097	P	0.39480	0.675	B	0.30943	0.122	T	0.65788	-0.6083	9	0.22109	T	0.4	.	11.0679	0.47987	1.0:0.0:0.0:0.0	.	37	Q9UJU5	FOXD3_HUMAN	G	37	ENSP00000360157:E37G	ENSP00000360157:E37G	E	+	2	0	FOXD3	63561427	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.940000	0.49003	1.618000	0.50286	0.374000	0.22700	GAG	.		0.731	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1		
GABBR1	2550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29572726	29572726	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:29572726A>G	ENST00000377034.4	-	21	2814	c.2479T>C	c.(2479-2481)Tcc>Ccc	p.S827P	GABBR1_ENST00000377012.4_Missense_Mutation_p.S710P|GABBR1_ENST00000377016.4_Missense_Mutation_p.S765P|GABBR1_ENST00000355973.3_Missense_Mutation_p.S710P|GABBR1_ENST00000376977.3_3'UTR	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	827					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TGCTGGCTGGACAGAATCATG	0.507																																					p.S827P		.											.	GABBR1	521	0			c.T2479C						.						103.0	70.0	82.0					6																	29572726		1511	2709	4220	SO:0001583	missense	2550	exon21			GGCTGGACAGAAT	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2479T>C	6.37:g.29572726A>G	ENSP00000366233:p.Ser827Pro	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	27.0	NM_001470	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	37	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	A	19.90	3.912876	0.72983	.	.	ENSG00000204681	ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	5.16	3.97	0.46021	GPCR, family 3, C-terminal (2);	0.130213	0.52532	D	0.000061	D	0.88872	0.6555	L	0.55213	1.73	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.83275	0.996;0.996;0.996	D	0.88419	0.3027	10	0.51188	T	0.08	-18.1341	7.7623	0.28959	0.6622:0.0:0.0:0.3377	.	765;827;710	Q9UBS5-3;Q9UBS5;Q5SUJ9	.;GABR1_HUMAN;.	P	710;765;710;827	ENSP00000348248:S710P;ENSP00000366215:S765P;ENSP00000366211:S710P;ENSP00000366233:S827P	ENSP00000348248:S710P	S	-	1	0	GABBR1	29680705	0.985000	0.35326	0.998000	0.56505	0.999000	0.98932	2.509000	0.45459	0.954000	0.37851	0.533000	0.62120	TCC	.		0.507	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
GABRR3	200959	broad.mit.edu;bcgsc.ca	37	3	97736568	97736568	+	RNA	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:97736568T>A	ENST00000472788.1	-	0	240					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	CTGGAGACCCTTAAGAAAGAA	0.348																																					.		.											.	GABRR3	68	0			c.239-2A>T						.						64.0	57.0	59.0					3																	97736568		1828	4096	5924			200959	exon5			AGACCCTTAAGAA	Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97736568T>A		Somatic	48.0	1.0		WXS	Illumina HiSeq	Phase_I	42.0	13.0	NM_001105580	Q9UIV9	Splice_Site	SNP	ENST00000472788.1	37																																																																																				.		0.348	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000353445.2		
GLI2	2736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	121747847	121747847	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:121747847A>T	ENST00000452319.1	+	14	4417	c.4357A>T	c.(4357-4359)Atg>Ttg	p.M1453L	GLI2_ENST00000314490.11_Intron|GLI2_ENST00000361492.4_Missense_Mutation_p.M1453L					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CCAGATCCACATGTACGAACA	0.657																																					p.M1453L		.											.	GLI2	954	0			c.A4357T						.						59.0	63.0	62.0					2																	121747847		2203	4300	6503	SO:0001583	missense	2736	exon13			ATCCACATGTACG		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4357A>T	2.37:g.121747847A>T	ENSP00000390436:p.Met1453Leu	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	38.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.835069	0.71373	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.16897	2.31;2.31	4.89	4.89	0.63831	.	0.042036	0.85682	D	0.000000	T	0.28962	0.0719	M	0.77820	2.39	0.80722	D	1	P;P	0.50528	0.675;0.936	B;P	0.46585	0.202;0.521	T	0.10314	-1.0635	9	.	.	.	.	14.6681	0.68924	1.0:0.0:0.0:0.0	.	1453;1108	P10070;P10070-2	GLI2_HUMAN;.	L	1453	ENSP00000390436:M1453L;ENSP00000354586:M1453L	.	M	+	1	0	GLI2	121464317	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.771000	0.68881	2.050000	0.60909	0.454000	0.30748	ATG	.		0.657	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
GLS2	27165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56868406	56868406	+	Silent	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:56868406A>G	ENST00000311966.4	-	12	1424	c.1146T>C	c.(1144-1146)agT>agC	p.S382S	GLS2_ENST00000476991.1_5'UTR	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	382					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	CTGCTTCAGCACTCAGCACAC	0.567																																					p.S382S		.											.	GLS2	91	0			c.T1146C						.						139.0	124.0	129.0					12																	56868406		2203	4300	6503	SO:0001819	synonymous_variant	27165	exon12			TTCAGCACTCAGC		CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.1146T>C	12.37:g.56868406A>G		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	10.0	NM_013267	B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Silent	SNP	ENST00000311966.4	37	CCDS8921.1																																																																																			.		0.567	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267	
GPR62	118442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	51990739	51990739	+	Silent	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:51990739C>A	ENST00000322241.4	+	1	1410	c.1071C>A	c.(1069-1071)ccC>ccA	p.P357P		NM_080865.3	NP_543141.3	Q9BZJ7	GPR62_HUMAN	G protein-coupled receptor 62	357						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCGGAGCCCCGCATACCAGG	0.647																																					p.P357P		.											.	GPR62	91	0			c.C1071A						.						16.0	21.0	19.0					3																	51990739		2181	4277	6458	SO:0001819	synonymous_variant	118442	exon1			GAGCCCCGCATAC	AF317653	CCDS2838.1	3p21.1	2012-08-21			ENSG00000180929	ENSG00000180929		"""GPCR / Class A : Orphans"""	13301	protein-coding gene	gene with protein product		606917				11165367	Standard	NM_080865		Approved		uc003dca.4	Q9BZJ7	OTTHUMG00000157367	ENST00000322241.4:c.1071C>A	3.37:g.51990739C>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	44.0	NM_080865	F1DAM4|Q5KU27	Silent	SNP	ENST00000322241.4	37	CCDS2838.1																																																																																			.		0.647	GPR62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348611.1		
GPR156	165829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	119885965	119885965	+	Missense_Mutation	SNP	C	C	A	rs375340933		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:119885965C>A	ENST00000464295.1	-	10	2804	c.2359G>T	c.(2359-2361)Ggg>Tgg	p.G787W	GPR156_ENST00000315843.3_Missense_Mutation_p.G787W|GPR156_ENST00000461057.1_Missense_Mutation_p.G783W			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	787						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		GCCAGCCCCCCAGTAGGCTCA	0.547																																					p.G787W		.											.	GPR156	92	0			c.G2359T						.	C	TRP/GLY,TRP/GLY	0,4406		0,0,2203	140.0	158.0	152.0		2347,2359	-3.7	0.0	3		152	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GPR156	NM_001168271.1,NM_153002.2	184,184	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	benign,benign	783/811,787/815	119885965	1,13005	2203	4300	6503	SO:0001583	missense	165829	exon9			GCCCCCCAGTAGG	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.2359G>T	3.37:g.119885965C>A	ENSP00000417261:p.Gly787Trp	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	31.0	NM_153002	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	37	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	C	7.348	0.622294	0.14193	0.0	1.16E-4	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.24723	1.84;1.84;1.84	4.95	-3.71	0.04424	.	1.884040	0.02330	N	0.073800	T	0.12987	0.0315	N	0.19112	0.55	0.09310	N	1	P;P	0.47106	0.89;0.89	B;B	0.39185	0.293;0.293	T	0.13737	-1.0498	9	.	.	.	6.8521	1.6275	0.02726	0.1158:0.2889:0.2166:0.3787	.	783;787	E9PFZ4;Q8NFN8	.;GP156_HUMAN	W	787;787;783	ENSP00000417261:G787W;ENSP00000324553:G787W;ENSP00000418758:G783W	.	G	-	1	0	GPR156	121368655	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.279000	0.08479	-0.481000	0.06792	-0.345000	0.07892	GGG	.		0.547	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
GRIA2	2891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	158281153	158281153	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:158281153T>C	ENST00000264426.9	+	13	2428	c.2149T>C	c.(2149-2151)Tcc>Ccc	p.S717P	GRIA2_ENST00000393815.2_Missense_Mutation_p.S670P|AC079233.1_ENST00000578227.1_RNA|GRIA2_ENST00000296526.7_Missense_Mutation_p.S717P|GRIA2_ENST00000507898.1_Missense_Mutation_p.S670P|GRIA2_ENST00000449365.1_Missense_Mutation_p.S670P	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	717					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AGTGCGGAAGTCCAAAGGGAA	0.493																																					p.S717P		.											.	GRIA2	515	0			c.T2149C						.						139.0	132.0	134.0					4																	158281153		2203	4300	6503	SO:0001583	missense	2891	exon13			CGGAAGTCCAAAG		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.2149T>C	4.37:g.158281153T>C	ENSP00000264426:p.Ser717Pro	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	24.0	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	37	CCDS43274.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.04|19.04	3.750399|3.750399	0.69533|0.69533	.|.	.|.	ENSG00000120251|ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365|ENST00000510854	T;T;T;T;T|.	0.38887|.	1.11;1.11;1.11;1.11;1.11|.	5.69|5.69	5.69|5.69	0.88448|0.88448	Ionotropic glutamate receptor (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79941|0.79941	0.4533|0.4533	M|M	0.86343|0.86343	2.81|2.81	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;0.98;0.998;0.992;0.963|.	D;P;D;P;P|.	0.81914|.	0.995;0.732;0.966;0.854;0.773|.	T|T	0.82739|0.82739	-0.0308|-0.0308	10|5	0.87932|.	D|.	0|.	.|.	15.9526|15.9526	0.79855|0.79855	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	745;717;717;717;670|.	Q59F93;P42262-3;P42262;P42262-2;A8MT92|.	.;.;GRIA2_HUMAN;.;.|.	P|A	670;670;717;717;670|47	ENSP00000426845:S670P;ENSP00000377403:S670P;ENSP00000296526:S717P;ENSP00000264426:S717P;ENSP00000389837:S670P|.	ENSP00000264426:S717P|.	S|V	+|+	1|2	0|0	GRIA2|GRIA2	158500603|158500603	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	8.040000|8.040000	0.89188|0.89188	2.168000|2.168000	0.68352|0.68352	0.533000|0.533000	0.62120|0.62120	TCC|GTC	.		0.493	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
GRIA4	2893	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	105797567	105797567	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:105797567C>G	ENST00000530497.1	+	12	1948	c.1948C>G	c.(1948-1950)Cga>Gga	p.R650G	GRIA4_ENST00000282499.5_Missense_Mutation_p.R650G|GRIA4_ENST00000393127.2_Missense_Mutation_p.R650G|GRIA4_ENST00000525187.1_Missense_Mutation_p.R650G			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	650					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GACGGTTGAGCGAATGGTCTC	0.433																																					p.R650G		.											.	GRIA4	230	0			c.C1948G						.						113.0	109.0	111.0					11																	105797567		2202	4298	6500	SO:0001583	missense	2893	exon13			GTTGAGCGAATGG	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1948C>G	11.37:g.105797567C>G	ENSP00000435775:p.Arg650Gly	Somatic	129.0	1.0		WXS	Illumina HiSeq	Phase_I	144.0	54.0	NM_001077243	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962286	0.74016	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.87	-3.41	0.04839	Ionotropic glutamate receptor (2);	0.000000	0.64402	D	0.000015	T	0.80934	0.4719	H	0.97315	3.98	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.88088	0.2811	10	0.87932	D	0	.	20.5381	0.99246	0.8063:0.1937:0.0:0.0	.	650;650	P48058;G3V164	GRIA4_HUMAN;.	G	650	ENSP00000282499:R650G;ENSP00000376835:R650G;ENSP00000435775:R650G;ENSP00000432180:R650G	ENSP00000282499:R650G	R	+	1	2	GRIA4	105302777	0.914000	0.31030	0.953000	0.39169	0.988000	0.76386	0.018000	0.13422	-0.400000	0.07656	0.655000	0.94253	CGA	.		0.433	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
H2AFZ	3015	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100870052	100870052	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:100870052G>A	ENST00000296417.5	-	4	458	c.241C>T	c.(241-243)Cgt>Tgt	p.R81C	DNAJB14_ENST00000442697.2_5'Flank|DNAJB14_ENST00000471738.1_5'Flank|RP11-15B17.1_ENST00000514624.1_RNA|RP11-15B17.1_ENST00000501976.2_RNA|H2AFZ_ENST00000529158.1_5'UTR|RP11-15B17.1_ENST00000507494.1_RNA	NM_002106.3	NP_002097.1	P0C0S5	H2AZ_HUMAN	H2A histone family, member Z	81					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular vesicular exosome (GO:0070062)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|endometrium(3)|lung(1)	5				OV - Ovarian serous cystadenocarcinoma(123;2.32e-08)		GGGGTAATACGCTTTACCTTT	0.418											OREG0016271	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R81C		.											.	H2AFZ	90	0			c.C241T						.						93.0	88.0	90.0					4																	100870052		2203	4300	6503	SO:0001583	missense	3015	exon4			TAATACGCTTTAC	X52317	CCDS3654.1	4q23	2011-01-27			ENSG00000164032	ENSG00000164032		"""Histones / Replication-independent"""	4741	protein-coding gene	gene with protein product		142763		H2AZ		1697587	Standard	XM_005262971		Approved	H2A.Z	uc003hvo.1	P0C0S5	OTTHUMG00000131048	ENST00000296417.5:c.241C>T	4.37:g.100870052G>A	ENSP00000296417:p.Arg81Cys	Somatic	173.0	1.0	1354	WXS	Illumina HiSeq	Phase_I	167.0	50.0	NM_002106	B2RD56|P17317|Q6I9U0	Missense_Mutation	SNP	ENST00000296417.5	37	CCDS3654.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329373	0.60743	.	.	ENSG00000164032	ENST00000296417	T	0.69561	-0.41	4.74	4.74	0.60224	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	H	0.97315	3.98	0.80722	D	1	B	0.25312	0.123	B	0.16722	0.016	T	0.82824	-0.0266	10	0.62326	D	0.03	-12.0973	17.7576	0.88453	0.0:0.0:1.0:0.0	.	81	P0C0S5	H2AZ_HUMAN	C	81	ENSP00000296417:R81C	ENSP00000296417:R81C	R	-	1	0	H2AFZ	101089075	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.910000	0.92685	2.187000	0.69744	0.655000	0.94253	CGT	.		0.418	H2AFZ-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000253695.1	NM_002106	
GUCY1B3	2983	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	156724875	156724875	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:156724875G>T	ENST00000264424.8	+	11	1595	c.1513G>T	c.(1513-1515)Gaa>Taa	p.E505*	GUCY1B3_ENST00000502959.1_Nonsense_Mutation_p.E527*|GUCY1B3_ENST00000513437.1_Nonsense_Mutation_p.E437*|GUCY1B3_ENST00000503520.1_Nonsense_Mutation_p.E472*|GUCY1B3_ENST00000505764.1_Nonsense_Mutation_p.E485*|GUCY1B3_ENST00000505154.1_Nonsense_Mutation_p.E437*|GUCY1B3_ENST00000507146.1_Nonsense_Mutation_p.E480*	NM_000857.2	NP_000848.1	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	505	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)	cytoplasm (GO:0005737)|guanylate cyclase complex, soluble (GO:0008074)|intracellular membrane-bounded organelle (GO:0043231)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)		GGACATGATGGAAATTGCTGG	0.423																																					p.E505X		.											.	.	.	0			c.G1513T						.						76.0	78.0	78.0					4																	156724875		1950	4158	6108	SO:0001587	stop_gained	2983	exon11			ATGATGGAAATTG	AF020340	CCDS47154.1, CCDS75203.1	4q31.3-q33	2008-03-18			ENSG00000061918	ENSG00000061918	4.6.1.2		4687	protein-coding gene	gene with protein product		139397		GUC1B3		1352257	Standard	XM_005262959		Approved	GC-SB3, GC-S-beta-1	uc003ipc.3	Q02153	OTTHUMG00000161698	ENST00000264424.8:c.1513G>T	4.37:g.156724875G>T	ENSP00000264424:p.Glu505*	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	22.0	NM_000857	B7Z426|Q86WY5	Nonsense_Mutation	SNP	ENST00000264424.8	37	CCDS47154.1	.	.	.	.	.	.	.	.	.	.	G	38	6.988580	0.97983	.	.	ENSG00000061918	ENST00000505154;ENST00000502959;ENST00000505764;ENST00000507146;ENST00000264424;ENST00000503520;ENST00000513437	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	20.0018	0.97417	0.0:0.0:1.0:0.0	.	.	.	.	X	437;527;485;480;505;472;437	.	ENSP00000264424:E505X	E	+	1	0	GUCY1B3	156944325	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.805000	0.99149	2.793000	0.96121	0.655000	0.94253	GAA	.		0.423	GUCY1B3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365770.2		
HEPACAM2	253012	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92848433	92848433	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:92848433C>A	ENST00000394468.2	-	2	488	c.411G>T	c.(409-411)aaG>aaT	p.K137N	HEPACAM2_ENST00000440868.1_Missense_Mutation_p.K125N|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.K125N|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.K160N	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	137					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TGACTTGTATCTTCTGACTGG	0.478																																					p.K137N		.											.	HEPACAM2	157	0			c.G411T						.						123.0	96.0	105.0					7																	92848433		2203	4300	6503	SO:0001583	missense	253012	exon2			TTGTATCTTCTGA	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.411G>T	7.37:g.92848433C>A	ENSP00000377980:p.Lys137Asn	Somatic	67.0	1.0		WXS	Illumina HiSeq	Phase_I	75.0	31.0	NM_001039372	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	37	CCDS43616.1	.	.	.	.	.	.	.	.	.	.	C	8.668	0.902209	0.17760	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16	5.72	5.72	0.89469	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.141565	0.64402	D	0.000007	T	0.45013	0.1321	N	0.19112	0.55	0.32434	N	0.547589	B;B;B;B	0.32128	0.357;0.288;0.082;0.066	B;B;B;B	0.34242	0.178;0.1;0.045;0.018	T	0.51379	-0.8713	10	0.15499	T	0.54	-13.5397	11.0157	0.47687	0.1303:0.8009:0.0:0.0688	.	160;125;137;125	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	N	137;125;125;160	ENSP00000377980:K137N;ENSP00000340532:K125N;ENSP00000389592:K125N;ENSP00000390204:K160N	ENSP00000340532:K125N	K	-	3	2	HEPACAM2	92686369	0.993000	0.37304	1.000000	0.80357	0.104000	0.19210	0.935000	0.28924	2.878000	0.98634	0.650000	0.86243	AAG	.		0.478	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151	
HERC2P3	283755	broad.mit.edu;mdanderson.org	37	15	20658890	20658890	+	RNA	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr15:20658890A>T	ENST00000428453.1	-	0	1976							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CGATTCCCTCAGGAATAAGTC	0.358																																					.		.											.	HERC2P3	92	0			.						.						50.0	56.0	54.0					15																	20658890		2149	4227	6376			283755	.			TCCCTCAGGAATA	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20658890A>T		Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	20.0	.		RNA	SNP	ENST00000428453.1	37																																																																																				.		0.358	HERC2P3-014	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347772.2	NG_008269	
HOXB7	3217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	46685380	46685380	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:46685380G>A	ENST00000239165.7	-	2	576	c.478C>T	c.(478-480)Cgc>Tgc	p.R160C	HOXB7_ENST00000567101.2_5'UTR|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000494420.1_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000491264.1_RNA	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7	160					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R160C(1)		NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						GTCAGGTAGCGATTGTAGTGA	0.557																																					p.R160C		.											.	HOXB7	90	1	Substitution - Missense(1)	large_intestine(1)	c.C478T						.						92.0	92.0	92.0					17																	46685380		2203	4300	6503	SO:0001583	missense	3217	exon2			GGTAGCGATTGTA		CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.478C>T	17.37:g.46685380G>A	ENSP00000239165:p.Arg160Cys	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	24.0	NM_004502	A8K3N8|Q15957|Q53FN3|Q96BQ6	Missense_Mutation	SNP	ENST00000239165.7	37	CCDS11532.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137468	0.77775	.	.	ENSG00000120087	ENST00000239165	D	0.96745	-4.11	4.58	4.58	0.56647	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98425	0.9476	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.99671	1.0996	10	0.87932	D	0	.	17.1969	0.86895	0.0:0.0:1.0:0.0	.	160	P09629	HXB7_HUMAN	C	160	ENSP00000239165:R160C	ENSP00000239165:R160C	R	-	1	0	HOXB7	44040379	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.496000	0.60360	2.357000	0.79964	0.563000	0.77884	CGC	.		0.557	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358097.3		
HOXC8	3224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54403335	54403335	+	Silent	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:54403335T>C	ENST00000040584.4	+	1	504	c.267T>C	c.(265-267)taT>taC	p.Y89Y	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	89					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						CCAAATTCTATGGCTACGAGG	0.567																																					p.Y89Y	GBM(197;701 2226 7002 18822 41696)	.											.	HOXC8	91	0			c.T267C						.						121.0	130.0	127.0					12																	54403335		2203	4300	6503	SO:0001819	synonymous_variant	3224	exon1			ATTCTATGGCTAC	X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.267T>C	12.37:g.54403335T>C		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	22.0	NM_022658	A8K4J4|O15221|O15362	Silent	SNP	ENST00000040584.4	37	CCDS8870.1																																																																																			.		0.567	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358957.2		
IFT88	8100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	21175874	21175874	+	Silent	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr13:21175874A>G	ENST00000319980.6	+	14	1197	c.870A>G	c.(868-870)acA>acG	p.T290T	IFT88_ENST00000537103.1_Silent_p.T262T|IFT88_ENST00000382778.4_Silent_p.T290T|IFT88_ENST00000351808.5_Silent_p.T281T	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	290					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		TTGGAGTTACATTTATTCAGG	0.338																																					p.T290T		.											.	IFT88	91	0			c.A870G						.						71.0	71.0	71.0					13																	21175874		2203	4300	6503	SO:0001819	synonymous_variant	8100	exon14			AGTTACATTTATT	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.870A>G	13.37:g.21175874A>G		Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	53.0	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Silent	SNP	ENST00000319980.6	37	CCDS31944.1																																																																																			.		0.338	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
IGSF11	152404	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	118647489	118647489	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:118647489G>A	ENST00000393775.2	-	3	596	c.291C>T	c.(289-291)acC>acT	p.T97T	IGSF11_ENST00000354673.2_Silent_p.T96T|IGSF11_ENST00000441144.2_Silent_p.T96T|IGSF11_ENST00000459718.1_5'UTR|IGSF11_ENST00000491903.1_Silent_p.T97T|IGSF11_ENST00000425327.2_Silent_p.T96T|IGSF11_ENST00000489689.1_Silent_p.T97T	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	97	Ig-like V-type.				cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TAGCTGGCATGGTGCCTGTAA	0.473																																					p.T97T		.											.	IGSF11	90	0			c.C291T						.						94.0	85.0	88.0					3																	118647489		2203	4300	6503	SO:0001819	synonymous_variant	152404	exon3			TGGCATGGTGCCT	AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.291C>T	3.37:g.118647489G>A		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	21.0	NM_001015887	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Silent	SNP	ENST00000393775.2	37	CCDS46891.1																																																																																			.		0.473	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2		
INADL	10207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62341008	62341008	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:62341008A>C	ENST00000371158.2	+	21	3043	c.2929A>C	c.(2929-2931)Aat>Cat	p.N977H	INADL_ENST00000316485.6_Missense_Mutation_p.N977H	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	977					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GGAAAATCTTAATTCATTAGC	0.333																																					p.N977H		.											.	INADL	94	0			c.A2929C						.						99.0	100.0	100.0					1																	62341008		2203	4300	6503	SO:0001583	missense	10207	exon21			AATCTTAATTCAT	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.2929A>C	1.37:g.62341008A>C	ENSP00000360200:p.Asn977His	Somatic	406.0	0.0		WXS	Illumina HiSeq	Phase_I	392.0	144.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	8.259	0.810814	0.16537	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.12361	2.81;2.69	5.16	-3.31	0.04988	.	0.781774	0.11837	N	0.524613	T	0.05593	0.0147	N	0.13043	0.29	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.002	T	0.43766	-0.9371	10	0.13470	T	0.59	.	6.009	0.19565	0.2557:0.4629:0.2814:0.0	.	977;977;977	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	H	977	ENSP00000360200:N977H;ENSP00000326199:N977H	ENSP00000255202:N977H	N	+	1	0	INADL	62113596	0.026000	0.19158	0.686000	0.30086	0.979000	0.70002	-0.009000	0.12765	-0.439000	0.07222	-0.262000	0.10625	AAT	.		0.333	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
IPO9	55705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201817700	201817700	+	Silent	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:201817700T>C	ENST00000361565.4	+	4	561	c.492T>C	c.(490-492)caT>caC	p.H164H	IPO9_ENST00000464348.1_3'UTR	NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	164					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						ATGCCGTCCATGGAGCCATGC	0.517																																					p.H164H		.											.	IPO9	228	0			c.T492C						.						133.0	107.0	116.0					1																	201817700		2203	4300	6503	SO:0001819	synonymous_variant	55705	exon4			CGTCCATGGAGCC	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.492T>C	1.37:g.201817700T>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	26.0	NM_018085	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Silent	SNP	ENST00000361565.4	37	CCDS1415.1																																																																																			.		0.517	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
IQCG	84223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	197670818	197670818	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:197670818G>A	ENST00000265239.6	-	4	537	c.113C>T	c.(112-114)cCt>cTt	p.P38L	IQCG_ENST00000480302.1_5'UTR|IQCG_ENST00000455191.1_Missense_Mutation_p.P38L|IQCG_ENST00000453254.1_Missense_Mutation_p.P38L	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	38						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TGTTTCTTTAGGTATTCCTTC	0.488																																					p.P38L		.											.	IQCG	90	0			c.C113T						.						152.0	145.0	148.0					3																	197670818		2203	4300	6503	SO:0001583	missense	84223	exon4			TCTTTAGGTATTC	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.113C>T	3.37:g.197670818G>A	ENSP00000265239:p.Pro38Leu	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	33.0	NM_032263	Q9BST2|Q9HAG8	Missense_Mutation	SNP	ENST00000265239.6	37	CCDS3331.1	.	.	.	.	.	.	.	.	.	.	G	8.892	0.954337	0.18431	.	.	ENSG00000114473	ENST00000265239;ENST00000455191;ENST00000453254;ENST00000416896;ENST00000452735	T;T;T;T	0.44881	0.91;0.91;0.91;0.94	3.79	-1.73	0.08081	.	2.329850	0.01678	N	0.025997	T	0.25344	0.0616	L	0.36672	1.1	0.09310	N	1	B;B	0.30406	0.278;0.016	B;B	0.25759	0.063;0.007	T	0.03193	-1.1062	10	0.09843	T	0.71	6.5902	0.7161	0.00932	0.1996:0.1538:0.333:0.3136	.	38;38	C9JKX8;Q9H095	.;IQCG_HUMAN	L	38;38;38;19;38	ENSP00000265239:P38L;ENSP00000407736:P38L;ENSP00000389897:P38L;ENSP00000406411:P19L	ENSP00000265239:P38L	P	-	2	0	IQCG	199155215	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.160000	0.03147	-0.284000	0.09102	-0.331000	0.08364	CCT	.		0.488	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339730.1	NM_032263	
JARID2	3720	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	15496837	15496837	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:15496837A>G	ENST00000341776.2	+	7	1625	c.1381A>G	c.(1381-1383)Aaa>Gaa	p.K461E	JARID2_ENST00000541660.1_Missense_Mutation_p.K423E|JARID2_ENST00000397311.3_Missense_Mutation_p.K289E	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	461					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CAAGAAGATGAAAGGGGCGGC	0.677																																					p.K461E		.											.	JARID2	228	0			c.A1381G						.						9.0	13.0	12.0					6																	15496837		2140	4204	6344	SO:0001583	missense	3720	exon7			AAGATGAAAGGGG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.1381A>G	6.37:g.15496837A>G	ENSP00000341280:p.Lys461Glu	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	15.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.124946	0.77436	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	D;D;D	0.89552	-1.88;-1.88;-2.53	5.54	5.54	0.83059	.	0.046492	0.85682	D	0.000000	D	0.83631	0.5296	L	0.34521	1.04	0.44937	D	0.997954	D;D;B	0.62365	0.972;0.991;0.39	P;P;B	0.51550	0.673;0.556;0.108	T	0.83218	-0.0070	10	0.29301	T	0.29	-13.3442	15.6626	0.77199	1.0:0.0:0.0:0.0	.	423;325;461	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	E	325;461;289;423	ENSP00000341280:K461E;ENSP00000380478:K289E;ENSP00000444623:K423E	ENSP00000341280:K461E	K	+	1	0	JARID2	15604816	1.000000	0.71417	0.999000	0.59377	0.676000	0.39594	4.011000	0.57124	2.095000	0.63458	0.533000	0.62120	AAA	.		0.677	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
KCNG3	170850	hgsc.bcm.edu;mdanderson.org	37	2	42720469	42720469	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:42720469C>A	ENST00000306078.1	-	1	768	c.173G>T	c.(172-174)cGc>cTc	p.R58L	MTA3_ENST00000405592.1_5'Flank|KCNG3_ENST00000394973.4_Missense_Mutation_p.R58L	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	58					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						GTACTCGTTGCGCTCGCGGTC	0.692																																					p.R58L		.											.	KCNG3	90	0			c.G173T						.						33.0	30.0	31.0					2																	42720469		2196	4297	6493	SO:0001583	missense	170850	exon1			TCGTTGCGCTCGC	AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.173G>T	2.37:g.42720469C>A	ENSP00000304127:p.Arg58Leu	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	8.0	NM_172344	Q53SC1	Missense_Mutation	SNP	ENST00000306078.1	37	CCDS1809.1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832483	0.71258	.	.	ENSG00000171126	ENST00000306078;ENST00000394973	T;T	0.76968	-1.06;-1.06	3.31	3.31	0.37934	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.83473	0.5262	L	0.52011	1.625	0.49389	D	0.999784	D;D	0.69078	0.997;0.996	D;D	0.81914	0.995;0.992	T	0.83064	-0.0146	10	0.37606	T	0.19	.	14.7779	0.69743	0.0:1.0:0.0:0.0	.	58;58	Q8TAE7;Q8TAE7-2	KCNG3_HUMAN;.	L	58	ENSP00000304127:R58L;ENSP00000378424:R58L	ENSP00000304127:R58L	R	-	2	0	KCNG3	42573973	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.875000	0.48491	1.666000	0.50821	0.462000	0.41574	CGC	.		0.692	KCNG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250464.2	NM_172344	
KCNK2	3776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	215259976	215259976	+	Silent	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:215259976C>G	ENST00000444842.2	+	2	462	c.312C>G	c.(310-312)tcC>tcG	p.S104S	KCNK2_ENST00000391895.2_Silent_p.S100S|KCNK2_ENST00000391894.2_Silent_p.S89S	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	104					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CATTCATATCCCAACATTCCT	0.458																																					p.S104S		.											.	KCNK2	90	0			c.C312G						.						169.0	156.0	160.0					1																	215259976		2203	4300	6503	SO:0001819	synonymous_variant	3776	exon2			CATATCCCAACAT	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.312C>G	1.37:g.215259976C>G		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	24.0	NM_001017425	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Silent	SNP	ENST00000444842.2	37	CCDS41467.1																																																																																			.		0.458	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
KDM6A	7403	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	44870266	44870266	+	Splice_Site	SNP	T	T	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:44870266T>G	ENST00000377967.4	+	5	484		c.e5+2		KDM6A_ENST00000536777.1_Splice_Site|KDM6A_ENST00000382899.4_Splice_Site|KDM6A_ENST00000543216.1_Splice_Site	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A						canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0(12)|p.0?(6)|p.?(1)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						ATTTCAGTGGTAAGTTGACAT	0.318			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																.	Colon(129;1273 1667 15230 27352 52914)	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	2748	19	No detectable mRNA/protein(12)|Whole gene deletion(6)|Unknown(1)	haematopoietic_and_lymphoid_tissue(11)|oesophagus(4)|breast(2)|pancreas(2)	c.443+2T>G						.						119.0	99.0	105.0					X																	44870266		2203	4293	6496	SO:0001630	splice_region_variant	7403	exon5			CAGTGGTAAGTTG	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.443+2T>G	X.37:g.44870266T>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	26.0	NM_021140	Q52LL9|Q5JVQ7	Splice_Site	SNP	ENST00000377967.4	37	CCDS14265.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431190	0.83776	.	.	ENSG00000147050	ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216;ENST00000542299	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7731	0.69693	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KDM6A	44755210	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.501000	0.81600	1.870000	0.54199	0.412000	0.27726	.	.		0.318	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	Intron
KDR	3791	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55963911	55963911	+	Silent	SNP	G	G	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:55963911G>C	ENST00000263923.4	-	18	2827	c.2532C>G	c.(2530-2532)gcC>gcG	p.A844A		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	844	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTGGCCAAAGGCACCACGGC	0.418			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.A844A		.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	2298	0			c.C2532G						.						113.0	102.0	106.0					4																	55963911		2203	4300	6503	SO:0001819	synonymous_variant	3791	exon18			GCCAAAGGCACCA	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2532C>G	4.37:g.55963911G>C		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	20.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	37	CCDS3497.1																																																																																			.		0.418	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
KIAA0125	9834	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	106388399	106388399	+	Splice_Site	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr14:106388399G>T	ENST00000449410.1	+	4	407		c.e4-1		KIAA0125_ENST00000429431.1_Splice_Site|KIAA0125_ENST00000482999.1_Splice_Site			Q9NZY2	K0125_HUMAN	KIAA0125																		tgatgacacagcaagaaggtc	0.537																																					.		.											.	.	.	0			c.1095-1G>T						.																																			SO:0001630	splice_region_variant	9834	exon4			GACACAGCAAGAA	AB019441		14q32.33	2014-04-01			ENSG00000226777	ENSG00000226777			19955	other	unknown			"""family with sequence similarity 30, member A"", ""chromosome 14 open reading frame 110"""	FAM30A, C14orf110		8590280	Standard	NR_026800		Approved	HSPC053	uc001ysq.3	Q9NZY2	OTTHUMG00000152318	ENST00000449410.1:c.299-1G>T	14.37:g.106388399G>T		Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	333.0	136.0	NR_026800	C9J8W9	RNA	SNP	ENST00000449410.1	37																																																																																				.		0.537	KIAA0125-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000325876.1	NM_014792	Intron
KIF1C	10749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4905414	4905414	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:4905414G>A	ENST00000320785.5	+	6	781	c.424G>A	c.(424-426)Gtg>Atg	p.V142M		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	142	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						ATCCTACTCTGTGGAGGTAAG	0.577																																					p.V142M	Melanoma(96;1023 1447 10250 19259 33730)	.											.	KIF1C	92	0			c.G424A						.						98.0	86.0	90.0					17																	4905414		2203	4300	6503	SO:0001583	missense	10749	exon6			TACTCTGTGGAGG	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.424G>A	17.37:g.4905414G>A	ENSP00000320821:p.Val142Met	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	20.0	NM_006612	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	ENST00000320785.5	37	CCDS11065.1	.	.	.	.	.	.	.	.	.	.	G	32	5.161251	0.94727	.	.	ENSG00000129250	ENST00000320785	T	0.78364	-1.17	5.45	5.45	0.79879	Kinesin, motor domain (4);	.	.	.	.	D	0.89280	0.6670	M	0.84683	2.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.90129	0.4205	9	0.62326	D	0.03	.	17.1494	0.86774	0.0:0.0:1.0:0.0	.	142	O43896	KIF1C_HUMAN	M	142	ENSP00000320821:V142M	ENSP00000320821:V142M	V	+	1	0	KIF1C	4846138	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.625000	0.98406	2.740000	0.93945	0.561000	0.74099	GTG	.		0.577	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216916.1		
KIF4A	24137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	69595074	69595074	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:69595074A>G	ENST00000374403.3	+	17	1881	c.1799A>G	c.(1798-1800)aAa>aGa	p.K600R	KIF4A_ENST00000374388.3_Missense_Mutation_p.K600R	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	600				K -> E (in Ref. 3; CAB75427). {ECO:0000305}.	anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CGCCGCCGCAAACGTCTCCAG	0.473																																					p.K600R		.											.	KIF4A	134	0			c.A1799G						.						70.0	61.0	64.0					X																	69595074		2203	4300	6503	SO:0001583	missense	24137	exon17			GCCGCAAACGTCT	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1799A>G	X.37:g.69595074A>G	ENSP00000363524:p.Lys600Arg	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	54.0	NM_012310	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	ENST00000374403.3	37	CCDS14401.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.107412	0.56291	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.70749	1.86;-0.51	5.53	4.38	0.52667	.	0.000000	0.64402	D	0.000009	T	0.69788	0.3150	L	0.61387	1.9	0.58432	D	0.999998	B;B	0.28291	0.049;0.206	B;B	0.36989	0.024;0.238	T	0.67654	-0.5615	10	0.54805	T	0.06	.	9.5477	0.39291	0.9181:0.0:0.0819:0.0	.	600;600	O95239;O95239-2	KIF4A_HUMAN;.	R	600	ENSP00000363509:K600R;ENSP00000363524:K600R	ENSP00000363509:K600R	K	+	2	0	KIF4A	69511799	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.624000	0.61254	0.900000	0.36469	0.486000	0.48141	AAA	.		0.473	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057068.1	NM_012310	
KIR3DL1	3811	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	55284949	55284949	+	Intron	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:55284949G>A	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.G79R|KIR2DL3_ENST00000434419.2_Intron|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.G79R			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		ACACCATGATGGGGTCTCCAA	0.517																																					p.G79R		.											.	KIR2DL1	90	0			c.G235A						.						155.0	140.0	145.0					19																	55284949		2176	4207	6383	SO:0001627	intron_variant	3802	exon3			CATGATGGGGTCT	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-44040G>A	19.37:g.55284949G>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	21.0	NM_014218	O43473|Q14946|Q16541	Missense_Mutation	SNP	ENST00000538269.1	37		.	.	.	.	.	.	.	.	.	.	G	5.498	0.276940	0.10403	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.19938	2.11;2.11	1.24	0.151	0.14888	.	.	.	.	.	T	0.24044	0.0582	M	0.78801	2.425	0.09310	N	1	B;B	0.30068	0.015;0.267	B;B	0.34242	0.018;0.178	T	0.36890	-0.9729	9	0.87932	D	0	.	3.2536	0.06823	0.2988:0.0:0.7012:0.0	.	79;79	Q6IST4;Q6H2H3	.;.	R	79	ENSP00000336769:G79R;ENSP00000291633:G79R	ENSP00000291633:G79R	G	+	1	0	KIR2DL1	59976761	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.203000	0.09438	0.098000	0.17522	0.398000	0.26397	GGG	.		0.517	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
KRTAP5-2	440021	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	11	1619366	1619366	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:1619366C>T	ENST00000412090.1	-	1	158	c.115G>A	c.(115-117)Ggc>Agc	p.G39S	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	39						keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CAGCCAGAGCCACAGCCCCCA	0.687																																					p.G39S		.											.	KRTAP5-2	44	0			c.G115A						.						31.0	39.0	37.0					11																	1619366		2168	4223	6391	SO:0001583	missense	440021	exon1			CAGAGCCACAGCC	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.115G>A	11.37:g.1619366C>T	ENSP00000400041:p.Gly39Ser	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	13.0	NM_001004325	A9JTZ1	Missense_Mutation	SNP	ENST00000412090.1	37	CCDS31331.1	.	.	.	.	.	.	.	.	.	.	-	11.16	1.555745	0.27827	.	.	ENSG00000205867	ENST00000412090	T	0.00995	5.46	.	.	.	.	.	.	.	.	T	0.00998	0.0033	L	0.42245	1.32	0.20873	N	0.999838	.	.	.	.	.	.	T	0.46373	-0.9196	5	0.12103	T	0.63	.	.	.	.	.	39	Q701N4	KRA52_HUMAN	S	39	ENSP00000400041:G39S	ENSP00000400041:G39S	G	-	1	0	KRTAP5-2	1575942	0.003000	0.15002	0.677000	0.29947	0.648000	0.38561	-0.350000	0.07721	0.000000	0.14550	0.000000	0.15137	GGC	.		0.687	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	7033066	7033066	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr18:7033066T>A	ENST00000389658.3	-	15	2173	c.2080A>T	c.(2080-2082)Agc>Tgc	p.S694C		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	694	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCATTAGAGCTGGCTATGTCC	0.517																																					p.S694C		.											.	LAMA1	149	0			c.A2080T						.						101.0	75.0	84.0					18																	7033066		2203	4300	6503	SO:0001583	missense	284217	exon15			TAGAGCTGGCTAT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2080A>T	18.37:g.7033066T>A	ENSP00000374309:p.Ser694Cys	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	11.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	13.22	2.170955	0.38315	.	.	ENSG00000101680	ENST00000389658	T	0.37915	1.17	6.07	4.85	0.62838	Laminin B type IV (2);Laminin B, subgroup (1);	0.410765	0.26907	N	0.021900	T	0.50154	0.1599	M	0.64404	1.975	0.24761	N	0.992922	D	0.71674	0.998	P	0.62813	0.907	T	0.44667	-0.9313	10	0.56958	D	0.05	.	8.3534	0.32316	0.1308:0.0:0.1367:0.7325	.	694	P25391	LAMA1_HUMAN	C	694	ENSP00000374309:S694C	ENSP00000374309:S694C	S	-	1	0	LAMA1	7023066	0.027000	0.19231	0.300000	0.25030	0.085000	0.17905	1.467000	0.35321	2.326000	0.78906	0.533000	0.62120	AGC	.		0.517	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
LHX8	431707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	75608866	75608866	+	Silent	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:75608866A>G	ENST00000294638.5	+	6	1117	c.453A>G	c.(451-453)agA>agG	p.R151R	LHX8_ENST00000356261.3_Silent_p.R141R	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	151	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						GGGTCCGGAGAGCCAAGGGGA	0.463																																					p.R151R		.											.	LHX8	93	0			c.A453G						.						123.0	116.0	118.0					1																	75608866		2203	4299	6502	SO:0001819	synonymous_variant	431707	exon6			CCGGAGAGCCAAG	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.453A>G	1.37:g.75608866A>G		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	27.0	NM_001001933	E9PGE3	Silent	SNP	ENST00000294638.5	37	CCDS30756.1																																																																																			.		0.463	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
LHX9	56956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197887089	197887089	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:197887089C>T	ENST00000367387.4	+	1	561	c.136C>T	c.(136-138)Cgt>Tgt	p.R46C	LHX9_ENST00000606127.1_3'UTR|LHX9_ENST00000367391.1_Missense_Mutation_p.R37C|LHX9_ENST00000367390.3_Missense_Mutation_p.R37C|LHX9_ENST00000337020.2_Missense_Mutation_p.R46C|LHX9_ENST00000561173.1_Missense_Mutation_p.R52C	NM_020204.2	NP_064589.2	Q9NQ69	LHX9_HUMAN	LIM homeobox 9	46					cell proliferation (GO:0008283)|female gonad development (GO:0008585)|gonad morphogenesis (GO:0035262)|male gonad development (GO:0008584)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(8)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|skin(1)|stomach(1)	35						GACTGAGGCCCGTCTGGCCAA	0.662																																					p.R46C		.											.	LHX9	91	0			c.C136T						.						70.0	73.0	72.0					1																	197887089		2203	4300	6503	SO:0001583	missense	56956	exon1			GAGGCCCGTCTGG	AJ277915	CCDS1393.1, CCDS30962.1	1q31.1	2011-06-20			ENSG00000143355	ENSG00000143355		"""Homeoboxes / LIM class"""	14222	protein-coding gene	gene with protein product		606066					Standard	NM_020204		Approved		uc001guk.1	Q9NQ69	OTTHUMG00000035656	ENST00000367387.4:c.136C>T	1.37:g.197887089C>T	ENSP00000356357:p.Arg46Cys	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	29.0	NM_020204	Q5VUE2|Q5VUE3|Q5VUE6|Q86UH2|Q9BYU6|Q9NQ70	Missense_Mutation	SNP	ENST00000367387.4	37	CCDS1393.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.915957	0.92178	.	.	ENSG00000143355	ENST00000367391;ENST00000367390;ENST00000367388;ENST00000337020;ENST00000367387	T;D;T;D	0.88431	0.59;-2.37;0.5;-2.38	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.91506	0.7318	L	0.44542	1.39	0.80722	D	1	D;D;D	0.63880	0.989;0.989;0.993	P;P;P	0.61275	0.676;0.781;0.886	D	0.92281	0.5833	10	0.66056	D	0.02	.	17.7666	0.88480	0.0:1.0:0.0:0.0	.	46;37;37	Q9NQ69;Q9NQ69-3;Q9NQ69-2	LHX9_HUMAN;.;.	C	37;37;89;46;46	ENSP00000356361:R37C;ENSP00000356360:R37C;ENSP00000337969:R46C;ENSP00000356357:R46C	ENSP00000337969:R46C	R	+	1	0	LHX9	196153712	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.215000	0.77966	2.506000	0.84524	0.655000	0.94253	CGT	.		0.662	LHX9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086547.2	NM_020204	
LPIN1	23175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	11922631	11922631	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:11922631G>C	ENST00000256720.2	+	7	1247	c.1154G>C	c.(1153-1155)aGa>aCa	p.R385T	LPIN1_ENST00000396097.1_Missense_Mutation_p.R115T|LPIN1_ENST00000449576.2_Missense_Mutation_p.R470T|LPIN1_ENST00000425416.2_Missense_Mutation_p.R391T|LPIN1_ENST00000396098.1_Missense_Mutation_p.R427T|LPIN1_ENST00000396099.1_Missense_Mutation_p.R427T	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	385					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		TCCAGGAAAAGAGGTACCAAG	0.522																																					p.R470T		.											.	LPIN1	156	0			c.G1409C						.						50.0	54.0	53.0					2																	11922631		2203	4300	6503	SO:0001583	missense	23175	exon9			GGAAAAGAGGTAC	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.1154G>C	2.37:g.11922631G>C	ENSP00000256720:p.Arg385Thr	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	21.0	NM_001261428	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	g	12.36	1.914167	0.33815	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097	T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.28	2.86	0.33363	.	0.091406	0.85682	D	0.000000	T	0.49440	0.1557	N	0.17723	0.515	0.80722	D	1	B;B;B	0.17038	0.015;0.02;0.006	B;B;B	0.22753	0.041;0.024;0.024	T	0.42032	-0.9475	10	0.38643	T	0.18	-14.5035	10.48	0.44687	0.8592:0.0:0.1408:0.0	.	470;385;427	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	T	470;427;427;391;385;115	ENSP00000397908:R470T;ENSP00000379405:R427T;ENSP00000379406:R427T;ENSP00000401522:R391T;ENSP00000256720:R385T;ENSP00000379404:R115T	ENSP00000256720:R385T	R	+	2	0	LPIN1	11840082	1.000000	0.71417	0.992000	0.48379	0.448000	0.32197	3.092000	0.50207	0.949000	0.37715	-0.285000	0.09966	AGA	.		0.522	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
PLEKHH2	130271	ucsc.edu;mdanderson.org	37	2	43902537	43902537	+	Intron	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:43902537G>A	ENST00000282406.4	+	3	233					NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2						negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GAACCAACTGGAGGCAAGAAA	0.453																																					p.P309S		.											.	.	.	0			c.C925T						.						50.0	47.0	48.0					2																	43902537		1934	4134	6068	SO:0001627	intron_variant	0	exon1			CAACTGGAGGCAA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.124-3465G>A	2.37:g.43902537G>A		Somatic	98.0	1.0		WXS	Illumina HiSeq	.	76.0	32.0	NM_001101330	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1																																																																																			.		0.453	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
LRFN5	145581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	42356423	42356423	+	Silent	SNP	C	C	A	rs140770648		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr14:42356423C>A	ENST00000298119.4	+	3	1784	c.595C>A	c.(595-597)Cgg>Agg	p.R199R	LRFN5_ENST00000554120.1_Silent_p.R199R|LRFN5_ENST00000554171.1_Silent_p.R199R	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	199						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CAAGATGACTCGGTTAGATGT	0.438										HNSCC(30;0.082)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		20394	0.0		0.0	False		,,,				2504	0.0				p.R199R		.											.	LRFN5	97	0			c.C595A						.						71.0	64.0	66.0					14																	42356423		2203	4300	6503	SO:0001819	synonymous_variant	145581	exon3			ATGACTCGGTTAG	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.595C>A	14.37:g.42356423C>A		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	17.0	NM_152447	B3KU78|Q86XL2	Silent	SNP	ENST00000298119.4	37	CCDS9678.1																																																																																			C|0.999;A|0.001		0.438	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57603645	57603645	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:57603645C>T	ENST00000243077.3	+	80	12899	c.12433C>T	c.(12433-12435)Ccc>Tcc	p.P4145S		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4145					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GCACAAGCAGCCCGAAGGTGG	0.627																																					p.P4145S		.											.	LRP1	596	0			c.C12433T						.						39.0	41.0	40.0					12																	57603645		2203	4300	6503	SO:0001583	missense	4035	exon80			AAGCAGCCCGAAG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.12433C>T	12.37:g.57603645C>T	ENSP00000243077:p.Pro4145Ser	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	10.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.196055	0.38806	.	.	ENSG00000123384	ENST00000243077	T	0.32753	1.44	4.45	4.45	0.53987	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	D	0.000002	T	0.51466	0.1676	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.41875	-0.9484	10	0.27785	T	0.31	.	16.3785	0.83418	0.0:1.0:0.0:0.0	.	4145	Q07954	LRP1_HUMAN	S	4145	ENSP00000243077:P4145S	ENSP00000243077:P4145S	P	+	1	0	LRP1	55889912	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.332000	0.79203	2.486000	0.83907	0.557000	0.71058	CCC	.		0.627	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170003385	170003385	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:170003385G>T	ENST00000263816.3	-	69	12960	c.12675C>A	c.(12673-12675)ttC>ttA	p.F4225L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4225					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.F4225F(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CAAGGTCCTCGAAAACCAGGA	0.438																																					p.F4225L		.											.	LRP2	175	1	Substitution - coding silent(1)	large_intestine(1)	c.C12675A						.						105.0	86.0	93.0					2																	170003385		2203	4300	6503	SO:0001583	missense	4036	exon69			GTCCTCGAAAACC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12675C>A	2.37:g.170003385G>T	ENSP00000263816:p.Phe4225Leu	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	49.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	4.926	0.172110	0.09391	.	.	ENSG00000081479	ENST00000263816	D	0.95821	-3.82	5.38	-10.8	0.00216	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.665589	0.16485	N	0.212355	D	0.85526	0.5717	N	0.24115	0.695	0.09310	N	0.999998	B	0.21905	0.062	B	0.29077	0.098	T	0.71948	-0.4438	10	0.31617	T	0.26	.	2.8995	0.05701	0.5481:0.1319:0.1151:0.2049	.	4225	P98164	LRP2_HUMAN	L	4225	ENSP00000263816:F4225L	ENSP00000263816:F4225L	F	-	3	2	LRP2	169711631	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.136000	0.00288	-3.144000	0.00232	-1.069000	0.02264	TTC	.		0.438	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRRC37B	114659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	30348372	30348372	+	Silent	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:30348372G>T	ENST00000341671.7	+	1	212	c.207G>T	c.(205-207)ccG>ccT	p.P69P	LRRC37B_ENST00000394713.3_Silent_p.P69P|LRRC37B_ENST00000584368.1_Silent_p.P81P|LRRC37B_ENST00000543378.2_Intron|LRRC37B_ENST00000327564.7_Silent_p.P96P	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	69						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.P69P(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				CAGCAGCCCCGGGGGACTTTG	0.592																																					p.P69P		.											.	LRRC37B	92	1	Substitution - coding silent(1)	lung(1)	c.G207T						.						51.0	62.0	58.0					17																	30348372		2203	4298	6501	SO:0001819	synonymous_variant	114659	exon1			AGCCCCGGGGGAC	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.207G>T	17.37:g.30348372G>T		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	6.0	NM_052888	Q17RC9|Q5YKG6	Silent	SNP	ENST00000341671.7	37	CCDS32609.1																																																																																			.		0.592	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888	
LRRCC1	85444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	86048194	86048194	+	Silent	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:86048194A>G	ENST00000360375.3	+	14	2474	c.2325A>G	c.(2323-2325)caA>caG	p.Q775Q	LRRCC1_ENST00000414626.2_Silent_p.Q755Q	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	775					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						AGCTGGCACAACAAGGTAAAA	0.373																																					p.Q775Q		.											.	LRRCC1	90	0			c.A2325G						.						83.0	82.0	82.0					8																	86048194		1832	4091	5923	SO:0001819	synonymous_variant	85444	exon14			GGCACAACAAGGT	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.2325A>G	8.37:g.86048194A>G		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	235.0	39.0	NM_033402	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Silent	SNP	ENST00000360375.3	37	CCDS43750.1																																																																																			.		0.373	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	
LSP1	4046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1887904	1887904	+	Intron	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:1887904T>C	ENST00000311604.3	+	2	228				LSP1_ENST00000381775.1_Missense_Mutation_p.V67A|AC051649.12_ENST00000509204.1_RNA|LSP1_ENST00000405957.2_5'Flank	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		CGGGAATGTGTTTTCCCAGGG	0.622																																					p.V67A		.											.	LSP1	90	0			c.T200C						.																																			SO:0001627	intron_variant	4046	exon2			AATGTGTTTTCCC	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.54-13413T>C	11.37:g.1887904T>C		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	20.0	NM_001242932	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	ENST00000311604.3	37	CCDS31334.1	.	.	.	.	.	.	.	.	.	.	t	11.18	1.561452	0.27915	.	.	ENSG00000130592	ENST00000381775	T	0.28069	1.63	2.36	-3.06	0.05379	.	.	.	.	.	T	0.18593	0.0446	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.27739	-1.0065	8	0.87932	D	0	.	3.6997	0.08378	0.0:0.2498:0.4411:0.3091	.	67	E9PFP3	.	A	67	ENSP00000371194:V67A	ENSP00000371194:V67A	V	+	2	0	LSP1	1844480	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-2.587000	0.00902	-0.671000	0.05274	0.358000	0.22013	GTT	.		0.622	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034045.3	NM_002339	
MAG	4099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35786342	35786342	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:35786342T>C	ENST00000392213.3	+	3	190	c.31T>C	c.(31-33)Tgg>Cgg	p.W11R	MAG_ENST00000597035.1_Missense_Mutation_p.W11R|MAG_ENST00000537831.2_Intron|MAG_ENST00000361922.4_Missense_Mutation_p.W11R	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	11					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GCCTCTGTTCTGGATTATGAT	0.577																																					p.W11R		.											.	MAG	947	0			c.T31C						.						222.0	218.0	219.0					19																	35786342		2203	4300	6503	SO:0001583	missense	4099	exon3			CTGTTCTGGATTA	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.31T>C	19.37:g.35786342T>C	ENSP00000376048:p.Trp11Arg	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	21.0	NM_080600	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	ENST00000392213.3	37	CCDS12455.1	.	.	.	.	.	.	.	.	.	.	T	18.98	3.737928	0.69304	.	.	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213	T;T	0.66460	-0.05;-0.21	5.7	5.7	0.88788	.	0.161847	0.40908	D	0.000989	T	0.77831	0.4189	M	0.61703	1.905	0.80722	D	1	D;D;D	0.71674	0.99;0.99;0.998	D;D;D	0.81914	0.969;0.969;0.995	T	0.76865	-0.2801	10	0.37606	T	0.19	.	12.3464	0.55124	0.0:0.0:0.0:1.0	.	48;11;11	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	R	48;11;11	ENSP00000355234:W11R;ENSP00000376048:W11R	ENSP00000262624:W48R	W	+	1	0	MAG	40478182	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.640000	0.54350	2.176000	0.68965	0.374000	0.22700	TGG	.		0.577	MAG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466071.1	NM_080600	
MAGEB4	4115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	30260451	30260451	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:30260451C>A	ENST00000378982.2	+	1	395	c.199C>A	c.(199-201)Ccc>Acc	p.P67T	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	67										breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GAGAGAGCCACCCACCACCTC	0.527																																					p.P67T		.											.	MAGEB4	131	0			c.C199A						.						54.0	50.0	51.0					X																	30260451		2202	4300	6502	SO:0001583	missense	4115	exon1			GAGCCACCCACCA		CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.199C>A	X.37:g.30260451C>A	ENSP00000368266:p.Pro67Thr	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	45.0	NM_002367	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	ENST00000378982.2	37	CCDS14221.1	.	.	.	.	.	.	.	.	.	.	C	2.143	-0.396447	0.04899	.	.	ENSG00000120289	ENST00000378982	T	0.03831	3.79	3.37	0.0494	0.14289	Melanoma associated antigen, MAGE, N-terminal (1);	.	.	.	.	T	0.02767	0.0083	N	0.16862	0.45	0.09310	N	1	B	0.21381	0.055	B	0.21360	0.034	T	0.47328	-0.9126	9	0.27082	T	0.32	.	3.7193	0.08450	0.0:0.485:0.2789:0.2361	.	67	O15481	MAGB4_HUMAN	T	67	ENSP00000368266:P67T	ENSP00000368266:P67T	P	+	1	0	MAGEB4	30170372	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.960000	0.03849	-0.111000	0.12001	0.544000	0.68410	CCC	.		0.527	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056159.1	NM_002367	
MAGI2	9863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	79082460	79082460	+	Missense_Mutation	SNP	T	T	G	rs373785355		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:79082460T>G	ENST00000354212.4	-	1	430	c.177A>C	c.(175-177)aaA>aaC	p.K59N	MAGI2-AS3_ENST00000422093.1_RNA|MAGI2-AS3_ENST00000448195.1_RNA|MAGI2-AS3_ENST00000426835.1_RNA|MAGI2-AS3_ENST00000446159.1_RNA|MAGI2_ENST00000522391.1_Missense_Mutation_p.K59N|MAGI2-AS3_ENST00000414797.1_RNA|MAGI2-AS3_ENST00000451809.1_RNA|MAGI2-AS3_ENST00000424477.1_RNA|MAGI2-AS3_ENST00000429408.1_RNA|MAGI2_ENST00000419488.1_Missense_Mutation_p.K59N	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	59	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CCGACACCAATTTGCTGCCGC	0.642																																					p.K59N		.											.	MAGI2	461	0			c.A177C						.						57.0	62.0	60.0					7																	79082460		2203	4300	6503	SO:0001583	missense	9863	exon1			CACCAATTTGCTG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.177A>C	7.37:g.79082460T>G	ENSP00000346151:p.Lys59Asn	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	22.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613838	0.66672	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.11712	2.86;2.86;2.75	5.39	5.39	0.77823	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.26919	0.0659	L	0.58101	1.795	0.80722	D	1	D;P	0.67145	0.996;0.896	D;P	0.65010	0.931;0.673	T	0.00643	-1.1630	9	0.46703	T	0.11	.	13.4339	0.61073	0.0:0.9241:0.0:0.0759	.	59;59	Q86UL8-2;Q86UL8	.;MAGI2_HUMAN	N	59	ENSP00000405766:K59N;ENSP00000346151:K59N;ENSP00000428389:K59N	ENSP00000346151:K59N	K	-	3	2	MAGI2	78920396	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.976000	0.40579	1.279000	0.44446	-0.320000	0.08662	AAA	.		0.642	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
MAT2A	4144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	85770059	85770059	+	Silent	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:85770059T>C	ENST00000306434.3	+	8	1110	c.987T>C	c.(985-987)tcT>tcC	p.S329S	MAT2A_ENST00000409017.1_Silent_p.S266S	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	329					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	ATCCATTATCTATCTCCATTT	0.388																																					p.S329S		.											.	MAT2A	90	0			c.T987C						.						192.0	195.0	194.0					2																	85770059		2203	4300	6503	SO:0001819	synonymous_variant	4144	exon8			ATTATCTATCTCC		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.987T>C	2.37:g.85770059T>C		Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	57.0	NM_005911	A8K511|B4DN45|D6W5L1|Q53SP5	Silent	SNP	ENST00000306434.3	37	CCDS1977.1																																																																																			.		0.388	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	
MDM1	56890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	68715374	68715374	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:68715374G>A	ENST00000303145.7	-	6	922	c.836C>T	c.(835-837)gCa>gTa	p.A279V	MDM1_ENST00000540418.1_5'UTR|MDM1_ENST00000411698.2_Missense_Mutation_p.A234V	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	279					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TTCCATCTCTGCTTCCAATTT	0.313																																					p.A279V		.											.	MDM1	95	0			c.C836T						.						138.0	138.0	138.0					12																	68715374		2203	4300	6503	SO:0001583	missense	56890	exon6			ATCTCTGCTTCCA	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.836C>T	12.37:g.68715374G>A	ENSP00000302537:p.Ala279Val	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	20.0	NM_017440	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Missense_Mutation	SNP	ENST00000303145.7	37	CCDS8983.1	.	.	.	.	.	.	.	.	.	.	G	9.452	1.090738	0.20471	.	.	ENSG00000111554	ENST00000303145;ENST00000411698;ENST00000541686	T;T;T	0.20598	2.06;2.06;2.06	4.49	1.48	0.22813	.	0.814921	0.11178	N	0.591255	T	0.11281	0.0275	N	0.22421	0.69	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.14578	0.011;0.01	T	0.20806	-1.0264	9	.	.	.	-0.5526	2.964	0.05902	0.1044:0.1786:0.5329:0.1841	.	234;279	E7EPQ3;Q8TC05	.;MDM1_HUMAN	V	279;234;274	ENSP00000302537:A279V;ENSP00000391006:A234V;ENSP00000446000:A274V	.	A	-	2	0	MDM1	67001641	0.997000	0.39634	0.999000	0.59377	0.830000	0.47004	0.268000	0.18571	0.187000	0.20147	-0.314000	0.08810	GCA	.		0.313	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128	
MEF2C	4208	hgsc.bcm.edu;broad.mit.edu	37	5	88057132	88057132	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:88057132T>C	ENST00000437473.2	-	4	689	c.272A>G	c.(271-273)aAg>aGg	p.K91R	MEF2C_ENST00000504921.2_Missense_Mutation_p.K91R|MEF2C_ENST00000539796.1_Intron|MEF2C_ENST00000508569.1_Missense_Mutation_p.K91R|MEF2C_ENST00000340208.5_Missense_Mutation_p.K91R|MEF2C_ENST00000424173.2_Intron|MEF2C_ENST00000510942.1_Missense_Mutation_p.K91R|MEF2C_ENST00000506554.1_Missense_Mutation_p.K91R|MEF2C_ENST00000503554.1_5'UTR|MEF2C_ENST00000514028.1_Missense_Mutation_p.K91R|MEF2C_ENST00000514015.1_Missense_Mutation_p.K91R	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	91					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		ATTAAGGCCCTTCTTTCTCAA	0.448										HNSCC(66;0.2)																											p.K91R		.											.	MEF2C	704	0			c.A272G						.						95.0	94.0	94.0					5																	88057132		1867	4100	5967	SO:0001583	missense	4208	exon4			AGGCCCTTCTTTC	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.272A>G	5.37:g.88057132T>C	ENSP00000396219:p.Lys91Arg	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	5.0	NM_001193350	C9JMZ0|D7F7N5|F8W7V7	Missense_Mutation	SNP	ENST00000437473.2	37	CCDS47245.1	.	.	.	.	.	.	.	.	.	.	T	33	5.194313	0.94960	.	.	ENSG00000081189	ENST00000340208;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000506554;ENST00000508569;ENST00000514015;ENST00000502983;ENST00000508610;ENST00000502831	T;T;T;T;T;T;T;T;D;D;D	0.87334	0.02;-0.16;-0.16;-0.16;-0.17;-0.5;-0.49;-0.45;-2.24;-2.2;-1.81	5.93	5.93	0.95920	Transcription factor, MADS-box (1);	0.000000	0.85682	D	0.000000	D	0.93831	0.8027	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	0.974;0.995;1.0	D;D;D	0.80764	0.953;0.994;0.982	D	0.94541	0.7745	10	0.87932	D	0	-6.944	16.3756	0.83387	0.0:0.0:0.0:1.0	.	91;91;91	F8W7V7;Q06413;Q06413-2	.;MEF2C_HUMAN;.	R	91	ENSP00000340874:K91R;ENSP00000421925:K91R;ENSP00000426665:K91R;ENSP00000396219:K91R;ENSP00000422390:K91R;ENSP00000425636:K91R;ENSP00000423597:K91R;ENSP00000424606:K91R;ENSP00000427163:K91R;ENSP00000426442:K91R;ENSP00000427286:K91R	ENSP00000340874:K91R	K	-	2	0	MEF2C	88092888	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	2.270000	0.75569	0.460000	0.39030	AAG	.		0.448	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000369817.1	NM_002397	
MMP16	4325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	89053953	89053953	+	Silent	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:89053953T>A	ENST00000286614.6	-	10	1841	c.1560A>T	c.(1558-1560)ggA>ggT	p.G520G		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	520					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	ATCTTGGATATCCAGGTTCTA	0.423																																					p.G520G		.											.	MMP16	231	0			c.A1560T						.						233.0	196.0	209.0					8																	89053953		2203	4300	6503	SO:0001819	synonymous_variant	4325	exon10			TGGATATCCAGGT	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1560A>T	8.37:g.89053953T>A		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	65.0	NM_005941	B2RAN7|Q14824|Q52H48	Silent	SNP	ENST00000286614.6	37	CCDS6246.1																																																																																			.		0.423	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
MPO	4353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56348028	56348028	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:56348028C>G	ENST00000225275.3	-	12	2403	c.2227G>C	c.(2227-2229)Gaa>Caa	p.E743Q	MPO_ENST00000340482.3_Missense_Mutation_p.E775Q	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	743					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	TAGGAGGCTTCCCTCCAGGAA	0.552																																					p.E743Q		.											.	MPO	156	0			c.G2227C						.						82.0	72.0	75.0					17																	56348028		2203	4300	6503	SO:0001583	missense	4353	exon12			AGGCTTCCCTCCA		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.2227G>C	17.37:g.56348028C>G	ENSP00000225275:p.Glu743Gln	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	23.0	NM_000250	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289674	0.40494	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.76448	-1.02;-1.02	5.46	-4.67	0.03319	.	0.942914	0.08962	N	0.868576	T	0.72003	0.3407	M	0.75777	2.31	0.21256	N	0.999746	B	0.02656	0.0	B	0.01281	0.0	T	0.63120	-0.6708	10	0.62326	D	0.03	-0.4993	7.4074	0.26998	0.0:0.244:0.4089:0.3471	.	743	P05164	PERM_HUMAN	Q	775;743	ENSP00000344419:E775Q;ENSP00000225275:E743Q	ENSP00000225275:E743Q	E	-	1	0	MPO	53703027	0.002000	0.14202	0.011000	0.14972	0.063000	0.16089	-0.074000	0.11450	-0.708000	0.05015	-0.150000	0.13652	GAA	.		0.552	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1		
MROH5	389690	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142451260	142451260	+	RNA	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:142451260T>A	ENST00000430863.1	-	0	3141					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		AGGATGAGGATGGCCACCTTC	0.627																																					.		.											.	.	.	0			.						.						37.0	41.0	40.0					8																	142451260		2156	4257	6413			389690	.			TGAGGATGGCCAC			8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142451260T>A		Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	12.0	.		RNA	SNP	ENST00000430863.1	37																																																																																				.		0.627	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414	
MROH5	389690	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	142489405	142489405	+	RNA	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:142489405G>A	ENST00000430863.1	-	0	1077					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GTGGCCGCCAGCCCCAAGGTC	0.662																																					.		.											.	.	.	0			.						.						12.0	17.0	15.0					8																	142489405		1942	4109	6051			389690	.			CCGCCAGCCCCAA			8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142489405G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	32.0	.		RNA	SNP	ENST00000430863.1	37																																																																																				.		0.662	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000342412.4	NM_207414	
MRPL47	57129	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	179310438	179310438	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:179310438A>C	ENST00000476781.1	-	6	652	c.623T>G	c.(622-624)tTt>tGt	p.F208C	MRPL47_ENST00000259038.2_Missense_Mutation_p.F188C|MRPL47_ENST00000392659.2_Missense_Mutation_p.F98C	NM_020409.2	NP_065142.2	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47	208					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|stomach(1)	11	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			TCACCTGAGAAAATGGTCCAC	0.363																																					p.F208C		.											.	MRPL47	90	0			c.T623G						.						103.0	91.0	95.0					3																	179310438		2203	4300	6503	SO:0001583	missense	57129	exon6			CTGAGAAAATGGT	AF285120	CCDS3232.1, CCDS3233.1	3q26.33	2012-11-14			ENSG00000136522	ENSG00000136522		"""Mitochondrial ribosomal proteins / large subunits"""	16652	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma metastasis-related 1"""	611852				11551941	Standard	NM_177988		Approved	CGI-204, NCM1	uc003fjz.3	Q9HD33	OTTHUMG00000157784	ENST00000476781.1:c.623T>G	3.37:g.179310438A>C	ENSP00000417602:p.Phe208Cys	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	27.0	NM_020409	Q6XRG1|Q8N5D1	Missense_Mutation	SNP	ENST00000476781.1	37	CCDS3232.1	.	.	.	.	.	.	.	.	.	.	A	18.08	3.544265	0.65198	.	.	ENSG00000136522	ENST00000476781;ENST00000259038;ENST00000392659	T;T;T	0.57436	0.93;1.04;0.4	5.96	5.96	0.96718	.	0.190645	0.49916	D	0.000126	T	0.70579	0.3240	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.70487	0.969;0.931	T	0.73978	-0.3812	10	0.87932	D	0	-24.3422	13.9716	0.64245	1.0:0.0:0.0:0.0	.	188;208	Q9HD33-2;Q9HD33	.;RM47_HUMAN	C	208;188;98	ENSP00000417602:F208C;ENSP00000259038:F188C;ENSP00000376427:F98C	ENSP00000259038:F188C	F	-	2	0	MRPL47	180793132	1.000000	0.71417	0.121000	0.21740	0.384000	0.30261	5.148000	0.64857	2.285000	0.76669	0.533000	0.62120	TTT	.		0.363	MRPL47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349623.1	NM_020409	
MTA1	9112	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	105931048	105931048	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr14:105931048C>G	ENST00000331320.7	+	15	1596	c.1382C>G	c.(1381-1383)cCc>cGc	p.P461R	MTA1_ENST00000406191.1_Missense_Mutation_p.P461R|MTA1_ENST00000405646.1_Missense_Mutation_p.P444R|MTA1_ENST00000435036.2_5'UTR	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	461					circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		AGCGGGAGCCCCAAGTTTGCC	0.701																																					p.P461R		.											.	MTA1	135	0			c.C1382G						.						28.0	23.0	25.0					14																	105931048		2196	4297	6493	SO:0001583	missense	9112	exon15			GGAGCCCCAAGTT	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.1382C>G	14.37:g.105931048C>G	ENSP00000333633:p.Pro461Arg	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	24.0	NM_004689	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	ENST00000331320.7	37	CCDS32169.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829771	0.91036	.	.	ENSG00000182979	ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000434050	T;T;T;T	0.35048	1.35;1.33;1.35;1.36	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.60818	0.2298	M	0.77486	2.375	0.80722	D	1	D;B	0.67145	0.996;0.378	D;B	0.68621	0.959;0.127	T	0.63607	-0.6599	10	0.48119	T	0.1	-31.1175	16.8714	0.86041	0.0:1.0:0.0:0.0	.	253;461	Q59FW1;Q13330	.;MTA1_HUMAN	R	370;461;461;444;253	ENSP00000333633:P461R;ENSP00000385702:P461R;ENSP00000384180:P444R;ENSP00000394106:P253R	ENSP00000333633:P461R	P	+	2	0	MTA1	105002093	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	4.790000	0.62453	2.332000	0.79248	0.462000	0.41574	CCC	.		0.701	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15		
MTTP	4547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100532577	100532577	+	Silent	SNP	G	G	A	rs369415595		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr4:100532577G>A	ENST00000265517.5	+	14	2159	c.1956G>A	c.(1954-1956)caG>caA	p.Q652Q	MTTP_ENST00000511045.1_Silent_p.Q679Q|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Silent_p.Q652Q			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	652	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	ACATCTTTCAGTACATTGGGA	0.438																																					p.Q652Q		.											.	MTTP	93	0			c.G1956A						.	G		1,4405	2.1+/-5.4	0,1,2202	174.0	159.0	164.0		1956	5.6	1.0	4		164	0,8600		0,0,4300	no	coding-synonymous	MTTP	NM_000253.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		652/895	100532577	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4547	exon15			CTTTCAGTACATT		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1956G>A	4.37:g.100532577G>A		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	57.0	NM_000253	A8K428|Q08AM4|Q6P5T3	Silent	SNP	ENST00000265517.5	37	CCDS3651.1																																																																																			.		0.438	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100683826	100683826	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:100683826A>T	ENST00000306151.4	+	3	9193	c.9129A>T	c.(9127-9129)gaA>gaT	p.E3043D		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3043	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTCCTAGTGAAGGAAGTACTC	0.512																																					p.E3043D		.											.	MUC17	95	0			c.A9129T						.						268.0	280.0	276.0					7																	100683826		2203	4300	6503	SO:0001583	missense	140453	exon3			TAGTGAAGGAAGT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9129A>T	7.37:g.100683826A>T	ENSP00000302716:p.Glu3043Asp	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	21.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	a	7.902	0.734560	0.15574	.	.	ENSG00000169876	ENST00000306151	T	0.01821	4.62	0.664	-0.833	0.10782	.	.	.	.	.	T	0.01730	0.0055	N	0.19112	0.55	0.09310	N	1	P	0.46578	0.88	P	0.50270	0.636	T	0.44452	-0.9327	9	0.13108	T	0.6	.	4.2429	0.10658	0.7458:0.0:0.2542:0.0	.	3043	Q685J3	MUC17_HUMAN	D	3043	ENSP00000302716:E3043D	ENSP00000302716:E3043D	E	+	3	2	MUC17	100470546	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-2.974000	0.00666	-0.294000	0.08973	0.102000	0.15555	GAA	.		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MYO18A	399687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27420004	27420004	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:27420004A>C	ENST00000527372.1	-	33	5122	c.4942T>G	c.(4942-4944)Ttt>Gtt	p.F1648V	MYO18A_ENST00000354329.4_Missense_Mutation_p.F1648V|MYO18A_ENST00000531253.1_Missense_Mutation_p.F1648V|TIAF1_ENST00000408971.2_5'Flank|MYO18A_ENST00000529578.1_5'Flank|MYO18A_ENST00000533112.1_Missense_Mutation_p.F1611V	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1648					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TCTGACTCAAAGTCCCGCCGG	0.627																																					p.F1648V	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A	22	0			c.T4942G						.						37.0	46.0	43.0					17																	27420004		2066	4201	6267	SO:0001583	missense	399687	exon33			ACTCAAAGTCCCG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4942T>G	17.37:g.27420004A>C	ENSP00000437073:p.Phe1648Val	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	9.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	37	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	a	10.11	1.261465	0.23051	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	T;D;T;T	0.87729	-1.06;-2.29;-1.06;-1.06	4.57	2.27	0.28462	Myosin tail (1);	0.443166	0.26432	N	0.024411	T	0.69566	0.3125	N	0.10645	0.015	0.31133	N	0.707455	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.59075	-0.7522	10	0.19147	T	0.46	.	7.2518	0.26154	0.777:0.1456:0.0775:0.0	.	1251;1611;1648;1648	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	V	1648;1611;1611;1648;1648;544;544;1251	ENSP00000346291:F1648V;ENSP00000435932:F1611V;ENSP00000434228:F1648V;ENSP00000437073:F1648V	ENSP00000346291:F1648V	F	-	1	0	MYO18A	24444130	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.356000	0.34079	0.245000	0.21373	0.378000	0.23410	TTT	.		0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
NCAPD3	23310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134076627	134076627	+	Splice_Site	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:134076627C>A	ENST00000534548.2	-	8	947	c.883G>T	c.(883-885)Gtc>Ttc	p.V295F		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	295					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CAACTGATGACCTAGAAGAGA	0.408																																					p.V295F		.											.	NCAPD3	229	0			c.G883T						.						96.0	93.0	94.0					11																	134076627		2201	4297	6498	SO:0001630	splice_region_variant	23310	exon8			TGATGACCTAGAA	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.883-1G>T	11.37:g.134076627C>A		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	43.0	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540500	0.27563	.	.	ENSG00000151503	ENST00000534548	T	0.04706	3.57	5.68	2.81	0.32909	Armadillo-type fold (1);	0.269957	0.39909	N	0.001235	T	0.05181	0.0138	L	0.60455	1.87	0.80722	D	1	P	0.35383	0.498	B	0.29716	0.106	T	0.33574	-0.9863	10	0.59425	D	0.04	-20.1388	6.2882	0.21045	0.0:0.5599:0.0:0.4401	.	295	P42695	CNDD3_HUMAN	F	295	ENSP00000433681:V295F	ENSP00000431612:V295F	V	-	1	0	NCAPD3	133581837	0.991000	0.36638	0.998000	0.56505	0.182000	0.23217	0.627000	0.24506	0.885000	0.36088	-0.216000	0.12614	GTC	.		0.408	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	Missense_Mutation
NECAP1	25977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8242584	8242584	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:8242584A>T	ENST00000339754.5	+	2	226	c.148A>T	c.(148-150)Act>Tct	p.T50S		NM_015509.3	NP_056324.2	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	50					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|plasma membrane (GO:0005886)				cervix(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				Kidney(36;0.0915)		CCTCCGAATCACTTCAAAAGG	0.438																																					p.T50S		.											.	NECAP1	91	0			c.A148T						.						109.0	115.0	113.0					12																	8242584		2203	4300	6503	SO:0001583	missense	25977	exon2			CGAATCACTTCAA	AK074923	CCDS8589.1	12p13.31	2012-05-02			ENSG00000089818	ENSG00000089818			24539	protein-coding gene	gene with protein product		611623				14555962, 15494011	Standard	NM_015509		Approved	DKFZP566B183	uc001qtx.2	Q8NC96	OTTHUMG00000168568	ENST00000339754.5:c.148A>T	12.37:g.8242584A>T	ENSP00000341737:p.Thr50Ser	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	22.0	NM_015509	Q2NL73|Q5XG95|Q6NWY6|Q8N153|Q8NCB0|Q9BU52|Q9Y407	Missense_Mutation	SNP	ENST00000339754.5	37	CCDS8589.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.568954	0.86439	.	.	ENSG00000089818	ENST00000545179;ENST00000339754	T	0.43688	0.94	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.53578	0.1805	M	0.77616	2.38	0.80722	D	1	B	0.30021	0.265	B	0.42555	0.391	T	0.58515	-0.7623	10	0.54805	T	0.06	.	12.312	0.54933	1.0:0.0:0.0:0.0	.	50	Q8NC96	NECP1_HUMAN	S	50	ENSP00000341737:T50S	ENSP00000341737:T50S	T	+	1	0	NECAP1	8133851	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.521000	0.90569	2.067000	0.61834	0.533000	0.62120	ACT	.		0.438	NECAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400244.1	NM_015509	
NLGN4Y	22829	hgsc.bcm.edu;bcgsc.ca	37	Y	16941900	16941900	+	3'UTR	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrY:16941900A>G	ENST00000476359.1	+	0	1647							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						CTACGACATCATGCTGGGCGT	0.582																																					p.M368V		.											.	.	.	0			c.A1102G						.																																			SO:0001624	3_prime_UTR_variant	22829	exon5			GACATCATGCTGG		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*1644A>G	Y.37:g.16941900A>G		Somatic	188.0	1.0		WXS	Illumina HiSeq	Phase_I	199.0	106.0	NM_014893	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Missense_Mutation	SNP	ENST00000476359.1	37																																																																																				.		0.582	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000089064.2	NM_014893	
NTM	50863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	132205003	132205003	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:132205003T>A	ENST00000374786.1	+	7	1477	c.998T>A	c.(997-999)cTg>cAg	p.L333Q	NTM_ENST00000425719.2_Missense_Mutation_p.L344Q|NTM_ENST00000374791.3_Missense_Mutation_p.L333Q|NTM_ENST00000427481.2_Missense_Mutation_p.L335Q|NTM_ENST00000539799.1_Missense_Mutation_p.L344Q|NTM_ENST00000474900.1_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	333					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GTCTGGCTGCTGCCTCTTCTG	0.612																																					p.L344Q		.											.	NTM	95	0			c.T1031A						.						100.0	98.0	99.0					11																	132205003		2201	4297	6498	SO:0001583	missense	50863	exon8			GGCTGCTGCCTCT	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.998T>A	11.37:g.132205003T>A	ENSP00000363918:p.Leu333Gln	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	20.0	NM_001144058	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	37	CCDS8491.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.77|15.77	2.932567|2.932567	0.52866|0.52866	.|.	.|.	ENSG00000182667|ENSG00000182667	ENST00000457381|ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719	.|T;T;T;T;T	.|0.62639	.|0.05;0.07;0.01;0.08;0.06	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|0.350658	.|0.26963	.|N	.|0.021608	T|T	0.64800|0.64800	0.2631|0.2631	L|L	0.46157|0.46157	1.445|1.445	0.35227|0.35227	D|D	0.776546|0.776546	.|P;P;P;D;P;D	.|0.59357	.|0.835;0.944;0.725;0.967;0.944;0.985	.|P;P;B;P;B;P	.|0.51385	.|0.514;0.462;0.26;0.587;0.383;0.668	T|T	0.76052|0.76052	-0.3100|-0.3100	5|10	.|0.66056	.|D	.|0.02	-5.9966|-5.9966	13.2101|13.2101	0.59819|0.59819	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|344;335;292;344;333;333	.|B7Z1Z5;B7Z1I4;B7Z1H3;Q9P121-4;Q9P121;Q9P121-2	.|.;.;.;.;NTRI_HUMAN;.	S|Q	108|333;344;335;333;344	.|ENSP00000363923:L333Q;ENSP00000437668:L344Q;ENSP00000416320:L335Q;ENSP00000363918:L333Q;ENSP00000396722:L344Q	.|ENSP00000363918:L333Q	C|L	+|+	1|2	0|0	NTM|NTM	131710213|131710213	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.734000|0.734000	0.41952|0.41952	4.711000|4.711000	0.61881|0.61881	1.940000|1.940000	0.56252|0.56252	0.528000|0.528000	0.53228|0.53228	TGC|CTG	.		0.612	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
OPCML	4978	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	132526997	132526997	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:132526997delG	ENST00000331898.7	-	2	963	c.385delC	c.(385-387)cacfs	p.H129fs	OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000541867.1_Frame_Shift_Del_p.H129fs|OPCML_ENST00000524381.1_Frame_Shift_Del_p.H122fs|OPCML_ENST00000374778.4_Frame_Shift_Del_p.H88fs	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	129					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		ACTATTAGGTGAACCCGGGAC	0.507																																					p.H129fs		.											.	OPCML	93	0			c.385delC						.						162.0	142.0	149.0					11																	132526997		2201	4297	6498	SO:0001589	frameshift_variant	4978	exon2			TTAGGTGAACCCG	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.385delC	11.37:g.132526997delG	ENSP00000330862:p.His129fs	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	45.0	NM_002545	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Frame_Shift_Del	DEL	ENST00000331898.7	37	CCDS8492.1																																																																																			.		0.507	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
OR2S2	56656	broad.mit.edu;bcgsc.ca	37	9	35957695	35957695	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr9:35957695G>A	ENST00000341959.2	-	1	456	c.401C>T	c.(400-402)tCc>tTc	p.S134F		NM_019897.2	NP_063950.2	Q9NQN1	OR2S1_HUMAN	olfactory receptor, family 2, subfamily S, member 2	134					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(32;0.00613)|STAD - Stomach adenocarcinoma(86;0.194)			CATGATCACGGAGTACCTAAG	0.552																																					p.S134F	Pancreas(172;293 2036 17878 24427 30946)	.											.	OR2S2	68	0			c.C401T						.						94.0	82.0	86.0					9																	35957695		2203	4300	6503	SO:0001583	missense	56656	exon1			ATCACGGAGTACC	AL135841	CCDS6596.2	9p13.3	2012-08-09			ENSG00000122718	ENSG00000122718		"""GPCR / Class A : Olfactory receptors"""	8276	protein-coding gene	gene with protein product							Standard	NM_019897		Approved		uc011lpi.2	Q9NQN1	OTTHUMG00000019891	ENST00000341959.2:c.401C>T	9.37:g.35957695G>A	ENSP00000344040:p.Ser134Phe	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	4.0	NM_019897	Q2M3L0|Q6IF19|Q96R42	Missense_Mutation	SNP	ENST00000341959.2	37	CCDS6596.2	.	.	.	.	.	.	.	.	.	.	G	9.668	1.145934	0.21288	.	.	ENSG00000122718	ENST00000341959	T	0.01379	4.96	4.21	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.263827	0.27060	N	0.021128	T	0.02494	0.0076	L	0.53249	1.67	0.22819	N	0.998699	P	0.37594	0.601	B	0.40940	0.344	T	0.31888	-0.9927	10	0.72032	D	0.01	.	10.851	0.46769	0.0958:0.0:0.9042:0.0	.	134	Q9NQN1	OR2S1_HUMAN	F	134	ENSP00000344040:S134F	ENSP00000344040:S134F	S	-	2	0	OR2S2	35947695	0.000000	0.05858	0.051000	0.19133	0.120000	0.20174	0.811000	0.27198	1.325000	0.45301	0.655000	0.94253	TCC	.		0.552	OR2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052400.2	NM_019897	
OR8K3	219473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56085886	56085886	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:56085886A>G	ENST00000312711.1	+	1	104	c.104A>G	c.(103-105)tAt>tGt	p.Y35C		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					CTCATGATCTATGTGATCTCA	0.433																																					p.Y35C		.											.	OR8K3	70	0			c.A104G						.						210.0	191.0	198.0					11																	56085886		2201	4296	6497	SO:0001583	missense	219473	exon1			TGATCTATGTGAT	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.104A>G	11.37:g.56085886A>G	ENSP00000323555:p.Tyr35Cys	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	36.0	NM_001005202	Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	37	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	A	11.13	1.546716	0.27652	.	.	ENSG00000181689	ENST00000312711	T	0.04706	3.57	4.65	3.5	0.40072	.	0.000000	0.56097	D	0.000039	T	0.11793	0.0287	M	0.86864	2.845	0.39941	D	0.974415	P	0.45531	0.86	B	0.43360	0.417	T	0.03325	-1.1048	10	0.87932	D	0	.	10.6838	0.45830	0.839:0.161:0.0:0.0	.	35	Q8NH51	OR8K3_HUMAN	C	35	ENSP00000323555:Y35C	ENSP00000323555:Y35C	Y	+	2	0	OR8K3	55842462	1.000000	0.71417	0.681000	0.30009	0.007000	0.05969	6.008000	0.70739	0.890000	0.36211	-0.337000	0.08149	TAT	.		0.433	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
OVCH1	341350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu	37	12	29628110	29628111	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:29628110_29628111CC>AA	ENST00000318184.5	-	14	1482_1483	c.1483_1484GG>TT	c.(1483-1485)GGa>TTa	p.G495L	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	495	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GGTCAACATTCCACAAAGTTTA	0.287																																					p.G495V|p.G495X		.											.	OVCH1	210	0			c.G1484T|c.G1483T						.																																			SO:0001583	missense	341350	exon14			AACATTCCACAAA|ACATTCCACAAAG	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1483_1484delinsAA	12.37:g.29628110_29628111delinsAA	ENSP00000326708:p.Gly495Leu	Somatic	135.0|133.0	0.0|1.0		WXS	Illumina HiSeq	Phase_I	143.0|142.0	42.0|43.0	NM_183378		Missense_Mutation|Nonsense_Mutation	SNP	ENST00000318184.5	37																																																																																				.		0.287	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
PADI4	23569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17690059	17690059	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:17690059C>A	ENST00000375448.4	+	16	1827	c.1801C>A	c.(1801-1803)Ccc>Acc	p.P601T		NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	601					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CATCCCCAAGCCCTTCGGGCC	0.622																																					p.P601T		.											.	PADI4	70	0			c.C1801A						.						41.0	39.0	40.0					1																	17690059		2203	4300	6503	SO:0001583	missense	23569	exon16			CCCAAGCCCTTCG	AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.1801C>A	1.37:g.17690059C>A	ENSP00000364597:p.Pro601Thr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	50.0	NM_012387	A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	ENST00000375448.4	37	CCDS180.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189475	0.78789	.	.	ENSG00000159339	ENST00000375448	T	0.58060	0.36	5.03	4.12	0.48240	Protein-arginine deiminase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79936	0.4532	H	0.96365	3.81	0.42729	D	0.9937	D	0.89917	1.0	D	0.83275	0.996	D	0.85769	0.1354	10	0.87932	D	0	-30.2633	12.5475	0.56208	0.0:0.918:0.0:0.082	.	601	Q9UM07	PADI4_HUMAN	T	601	ENSP00000364597:P601T	ENSP00000364597:P601T	P	+	1	0	PADI4	17562646	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.588000	0.82629	1.258000	0.44101	0.561000	0.74099	CCC	.		0.622	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006799.1	NM_012387	
PAK7	57144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	9546703	9546703	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr20:9546703A>G	ENST00000378429.3	-	6	1865	c.1319T>C	c.(1318-1320)gTc>gCc	p.V440A	PAK7_ENST00000378423.1_Missense_Mutation_p.V440A|PAK7_ENST00000353224.5_Missense_Mutation_p.V440A	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	440	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			TCCTGGGCTGACCACCAGCTG	0.612																																					p.V440A		.											.	PAK7	1434	0			c.T1319C						.						108.0	105.0	106.0					20																	9546703		2203	4300	6503	SO:0001583	missense	57144	exon5			GGGCTGACCACCA	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1319T>C	20.37:g.9546703A>G	ENSP00000367686:p.Val440Ala	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	18.0	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	A	27.0	4.790751	0.90367	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.74947	-0.89;-0.89;-0.89	5.66	5.66	0.87406	Protein kinase-like domain (1);	0.109198	0.64402	D	0.000008	D	0.85423	0.5693	M	0.78049	2.395	0.80722	D	1	D;D	0.57257	0.979;0.979	D;D	0.66497	0.944;0.944	D	0.86088	0.1548	9	.	.	.	.	15.9044	0.79412	1.0:0.0:0.0:0.0	.	440;440	B0AZM9;Q9P286	.;PAK7_HUMAN	A	440;440;440;388	ENSP00000367686:V440A;ENSP00000322957:V440A;ENSP00000367679:V440A	.	V	-	2	0	PAK7	9494703	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	2.144000	0.66660	0.477000	0.44152	GTC	.		0.612	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
PCDHA7	56141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140215935	140215935	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:140215935A>T	ENST00000525929.1	+	1	1967	c.1967A>T	c.(1966-1968)gAg>gTg	p.E656V	PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.E656V|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	656	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCACGGGGAGCCCTCGCTG	0.662																																					p.E656V	NSCLC(160;258 2013 5070 22440 28951)	.											.	PCDHA7	94	0			c.A1967T						.						59.0	63.0	62.0					5																	140215935		2203	4298	6501	SO:0001583	missense	56141	exon1			ACGGGGAGCCCTC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1967A>T	5.37:g.140215935A>T	ENSP00000436426:p.Glu656Val	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	39.0	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.791206	0.50102	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.53206	0.63;0.63	3.57	3.57	0.40892	Cadherin (4);Cadherin-like (1);	0.000000	0.31936	U	0.006824	T	0.57110	0.2031	L	0.53249	1.67	0.23572	N	0.997388	P;P	0.52316	0.93;0.952	P;P	0.57244	0.816;0.772	T	0.51872	-0.8650	10	0.87932	D	0	.	12.5944	0.56461	1.0:0.0:0.0:0.0	.	656;656	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	656	ENSP00000436426:E656V;ENSP00000367365:E656V	ENSP00000367365:E656V	E	+	2	0	PCDHA7	140196119	0.011000	0.17503	0.929000	0.37066	0.374000	0.29953	2.440000	0.44855	1.603000	0.50134	0.379000	0.24179	GAG	.		0.662	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PDZD7	79955	bcgsc.ca;mdanderson.org	37	10	102783278	102783278	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:102783278G>A	ENST00000370215.3	-	4	682	c.457C>T	c.(457-459)Ctg>Ttg	p.L153L	PDZD7_ENST00000470414.1_Silent_p.L153L	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	153	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CTGCTGGTCAGCACCTTTACG	0.632																																					p.L153L		.											.	PDZD7	136	0			c.C457T						.						73.0	61.0	65.0					10																	102783278		2203	4300	6503	SO:0001819	synonymous_variant	79955	exon4			TGGTCAGCACCTT	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.457C>T	10.37:g.102783278G>A		Somatic	30.0	1.0		WXS	Illumina HiSeq	Phase_1	33.0	16.0	NM_001195263	D5FJ77|Q8N321	Silent	SNP	ENST00000370215.3	37	CCDS31269.1																																																																																			.		0.632	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
PKN1	5585	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14581098	14581098	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:14581098A>T	ENST00000242783.6	+	19	2582	c.2417A>T	c.(2416-2418)tAc>tTc	p.Y806F	PKN1_ENST00000342216.4_Missense_Mutation_p.Y812F	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	806	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GTGCTGCTCTACGAGATGCTG	0.632																																					p.Y812F	NSCLC(185;2539 2965 10733 52867)	.											.	PKN1	1481	0			c.A2435T						.						115.0	127.0	123.0					19																	14581098		2203	4300	6503	SO:0001583	missense	5585	exon19			TGCTCTACGAGAT	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2417A>T	19.37:g.14581098A>T	ENSP00000242783:p.Tyr806Phe	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_213560	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	37	CCDS42513.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.460836	0.26248	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.27720	1.65;1.65	3.91	3.91	0.45181	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000008	T	0.22475	0.0542	L	0.38692	1.165	0.32900	D	0.513041	B;B	0.18610	0.023;0.029	B;B	0.21708	0.021;0.036	T	0.21280	-1.0250	10	0.15952	T	0.53	-4.756	10.9799	0.47488	1.0:0.0:0.0:0.0	.	812;806	Q16512-2;Q16512	.;PKN1_HUMAN	F	806;812	ENSP00000242783:Y806F;ENSP00000343325:Y812F	ENSP00000242783:Y806F	Y	+	2	0	PKN1	14442098	1.000000	0.71417	0.960000	0.40013	0.968000	0.65278	4.689000	0.61723	1.760000	0.52011	0.397000	0.26171	TAC	.		0.632	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	
PKNOX2	63876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	125267956	125267956	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:125267956C>G	ENST00000298282.9	+	7	857	c.586C>G	c.(586-588)Cag>Gag	p.Q196E	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Missense_Mutation_p.Q132E	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	196					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CCTTCACTCACAGGTAACACC	0.587																																					p.Q196E		.											.	PKNOX2	93	0			c.C586G						.						60.0	65.0	63.0					11																	125267956		1919	4121	6040	SO:0001583	missense	63876	exon7			CACTCACAGGTAA	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.586C>G	11.37:g.125267956C>G	ENSP00000298282:p.Gln196Glu	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	30.0	NM_022062	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.997762	0.54147	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175;ENST00000535518	D;D;D;D	0.84298	-1.83;-1.83;-1.82;-1.8	5.52	5.52	0.82312	.	0.120567	0.56097	D	0.000025	T	0.73481	0.3592	N	0.14661	0.345	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.13407	0.009;0.001	T	0.68622	-0.5360	10	0.02654	T	1	-10.6274	19.8721	0.96854	0.0:1.0:0.0:0.0	.	132;196	F5GZ15;Q96KN3	.;PKNX2_HUMAN	E	167;167;196;132;184	ENSP00000434732:Q167E;ENSP00000433971:Q167E;ENSP00000298282:Q196E;ENSP00000441470:Q132E	ENSP00000298282:Q196E	Q	+	1	0	PKNOX2	124773166	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.250000	0.78287	2.772000	0.95346	0.644000	0.83932	CAG	.		0.587	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
PLA2G7	7941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46682256	46682256	+	Silent	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:46682256A>T	ENST00000274793.7	-	5	607	c.411T>A	c.(409-411)ccT>ccA	p.P137P	PLA2G7_ENST00000538237.1_Silent_p.P92P|PLA2G7_ENST00000541026.1_Silent_p.P10P|PLA2G7_ENST00000537365.1_Silent_p.P137P	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	137					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			CAGGCCTCAGAGGGGAATTCC	0.388																																					p.P137P		.											.	PLA2G7	90	0			c.T411A						.						104.0	102.0	103.0					6																	46682256		2203	4300	6503	SO:0001819	synonymous_variant	7941	exon5			CCTCAGAGGGGAA	U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.411T>A	6.37:g.46682256A>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	23.0	NM_005084	A5HTT5|Q15692|Q5VTT1|Q8IVA2	Silent	SNP	ENST00000274793.7	37	CCDS4917.1																																																																																			.		0.388	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040802.1		
PLEKHA6	22874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204210871	204210871	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:204210871G>A	ENST00000272203.3	-	16	2560	c.2244C>T	c.(2242-2244)atC>atT	p.I748I	PLEKHA6_ENST00000414478.1_Silent_p.I768I	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	748								p.I748I(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GCACAAGGCTGATGTCTCTGG	0.532																																					p.I748I		.											.	PLEKHA6	654	1	Substitution - coding silent(1)	lung(1)	c.C2244T						.						128.0	121.0	124.0					1																	204210871		2203	4300	6503	SO:0001819	synonymous_variant	22874	exon16			AAGGCTGATGTCT	AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2244C>T	1.37:g.204210871G>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	33.0	NM_014935	A7MD51|Q5VTI6	Silent	SNP	ENST00000272203.3	37	CCDS1444.1																																																																																			.		0.532	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087889.3	NM_014935	
PLXNA3	55558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153698841	153698841	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:153698841C>A	ENST00000369682.3	+	30	5218	c.5043C>A	c.(5041-5043)caC>caA	p.H1681Q	PLXNA3_ENST00000493546.1_3'UTR	NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	1681					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCACAGCCCACCGGGGCTCGG	0.622																																					p.H1681Q		.											.	PLXNA3	132	0			c.C5043A						.						77.0	71.0	73.0					X																	153698841		2202	4300	6502	SO:0001583	missense	55558	exon30			AGCCCACCGGGGC	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.5043C>A	X.37:g.153698841C>A	ENSP00000358696:p.His1681Gln	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	68.0	NM_017514	Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401486	0.83120	.	.	ENSG00000130827	ENST00000369682	T	0.17691	2.26	5.0	4.14	0.48551	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.32496	0.0831	M	0.62088	1.915	0.58432	D	0.999999	P	0.40144	0.704	P	0.53760	0.734	T	0.03043	-1.1079	10	0.72032	D	0.01	.	11.5616	0.50780	0.0:0.9089:0.0:0.0911	.	1681	P51805	PLXA3_HUMAN	Q	1681	ENSP00000358696:H1681Q	ENSP00000358696:H1681Q	H	+	3	2	PLXNA3	153352035	1.000000	0.71417	0.993000	0.49108	0.901000	0.52897	1.229000	0.32600	0.898000	0.36418	0.529000	0.55759	CAC	.		0.622	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
PNPLA7	375775	bcgsc.ca;mdanderson.org	37	9	140391674	140391674	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr9:140391674C>A	ENST00000277531.4	-	17	2089	c.1903G>T	c.(1903-1905)Gcc>Tcc	p.A635S	PNPLA7_ENST00000406427.1_Missense_Mutation_p.A660S|PNPLA7_ENST00000371457.1_Missense_Mutation_p.A241S	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	635					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TACTCCCCGGCCAGGCGCTTC	0.657																																					p.A660S		.											.	PNPLA7	91	0			c.G1978T						.						30.0	30.0	30.0					9																	140391674		2191	4292	6483	SO:0001583	missense	375775	exon18			CCCCGGCCAGGCG	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.1903G>T	9.37:g.140391674C>A	ENSP00000277531:p.Ala635Ser	Somatic	34.0	1.0		WXS	Illumina HiSeq	Phase_1	35.0	20.0	NM_001098537	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	37	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563129	0.45694	.	.	ENSG00000130653	ENST00000371457;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06	4.53	4.53	0.55603	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.337636	0.31847	N	0.006970	D	0.86936	0.6053	L	0.29908	0.895	0.80722	D	1	P;P	0.41232	0.743;0.635	B;B	0.43155	0.392;0.41	D	0.86731	0.1948	10	0.87932	D	0	-16.06	6.9542	0.24562	0.0:0.797:0.0:0.203	.	660;635	Q6ZV29-5;Q6ZV29	.;PLPL7_HUMAN	S	241;635;660;635;626	ENSP00000360512:A241S;ENSP00000277531:A635S;ENSP00000384610:A660S;ENSP00000400582:A626S	ENSP00000277531:A635S	A	-	1	0	PNPLA7	139511495	0.481000	0.25941	0.967000	0.41034	0.401000	0.30781	1.053000	0.30442	2.238000	0.73509	0.462000	0.41574	GCC	.		0.657	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
POMC	5443	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	25384341	25384341	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:25384341G>A	ENST00000405623.1	-	3	868	c.413C>T	c.(412-414)tCc>tTc	p.S138F	POMC_ENST00000264708.3_Missense_Mutation_p.S138F|POMC_ENST00000380794.1_Missense_Mutation_p.S138F|RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000395826.2_Missense_Mutation_p.S138F			P01189	COLI_HUMAN	proopiomelanocortin	138					cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	CATGGAGTAGGAGCGCTTGCC	0.726																																					p.S138F	Colon(110;1515 1566 8452 10082 43216)	.											.	POMC	91	0			c.C413T						.						9.0	11.0	10.0					2																	25384341		2169	4251	6420	SO:0001583	missense	5443	exon4			GAGTAGGAGCGCT		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.413C>T	2.37:g.25384341G>A	ENSP00000384092:p.Ser138Phe	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	16.0	NM_001035256	P78442|Q53T23|Q9UD39|Q9UD40	Missense_Mutation	SNP	ENST00000405623.1	37	CCDS1717.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944546	0.92593	.	.	ENSG00000115138	ENST00000380794;ENST00000405623;ENST00000264708;ENST00000395826;ENST00000449220	D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09	5.16	5.16	0.70880	Pro-opiomelanocortin/corticotropin, ACTH, central region (1);	0.055164	0.85682	D	0.000000	D	0.93874	0.8040	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94692	0.7875	10	0.87932	D	0	-17.1067	17.2372	0.87002	0.0:0.0:1.0:0.0	.	138	P01189	COLI_HUMAN	F	138	ENSP00000370171:S138F;ENSP00000384092:S138F;ENSP00000264708:S138F;ENSP00000379170:S138F;ENSP00000387993:S138F	ENSP00000264708:S138F	S	-	2	0	POMC	25237845	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.343000	0.97047	2.409000	0.81822	0.462000	0.41574	TCC	.		0.726	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211573.3	NM_001035256	
PRDM1	639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106536266	106536266	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:106536266A>T	ENST00000369096.4	+	2	467	c.233A>T	c.(232-234)cAg>cTg	p.Q78L	PRDM1_ENST00000369091.2_Missense_Mutation_p.Q42L	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	78					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q42fs*23(2)|p.?(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		ACTTCGGTTCAGGCGGAGGCA	0.493			"""D, N, Mis, F, S"""		DLBCL																																p.Q78L		.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	862	3	Deletion - Frameshift(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	c.A233T						.						201.0	178.0	186.0					6																	106536266		2203	4300	6503	SO:0001583	missense	639	exon2			CGGTTCAGGCGGA		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.233A>T	6.37:g.106536266A>T	ENSP00000358092:p.Gln78Leu	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	33.0	NM_001198	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924727	0.52653	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000424894	T;T;T	0.50001	3.24;3.23;0.76	5.8	5.8	0.92144	.	0.060966	0.64402	D	0.000004	T	0.39462	0.1079	M	0.62723	1.935	0.80722	D	1	D	0.53462	0.96	B	0.43082	0.407	T	0.49194	-0.8965	10	0.72032	D	0.01	-29.8017	16.1606	0.81704	1.0:0.0:0.0:0.0	.	78	O75626	PRDM1_HUMAN	L	42;78;42;42	ENSP00000358087:Q42L;ENSP00000358092:Q78L;ENSP00000395566:Q42L	ENSP00000358087:Q42L	Q	+	2	0	PRDM1	106642959	1.000000	0.71417	0.997000	0.53966	0.584000	0.36387	6.919000	0.75793	2.227000	0.72691	0.460000	0.39030	CAG	.		0.493	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
PREX1	57580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47267445	47267445	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr20:47267445G>A	ENST00000371941.3	-	23	2826	c.2804C>T	c.(2803-2805)gCc>gTc	p.A935V	PREX1_ENST00000396220.1_Missense_Mutation_p.A935V	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	935					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CTGGTAGCAGGCAATCCTCTG	0.577																																					p.A935V		.											.	PREX1	231	0			c.C2804T						.						94.0	72.0	80.0					20																	47267445		2203	4300	6503	SO:0001583	missense	57580	exon23			TAGCAGGCAATCC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2804C>T	20.37:g.47267445G>A	ENSP00000361009:p.Ala935Val	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	14.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520809	0.44866	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.38887	1.11;1.11	5.11	-2.99	0.05497	.	0.415430	0.19788	U	0.106048	T	0.27798	0.0684	L	0.36672	1.1	0.09310	N	1	B;B	0.33940	0.077;0.433	B;B	0.36244	0.066;0.22	T	0.32640	-0.9899	10	0.15066	T	0.55	.	11.5706	0.50832	0.0:0.4454:0.326:0.2287	.	935;232	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	V	935	ENSP00000361009:A935V;ENSP00000379522:A935V	ENSP00000361009:A935V	A	-	2	0	PREX1	46700852	0.000000	0.05858	0.017000	0.16124	0.908000	0.53690	0.130000	0.15850	-0.433000	0.07286	0.462000	0.41574	GCC	.		0.577	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48715984	48715984	+	Silent	SNP	T	T	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:48715984T>G	ENST00000314191.2	-	71	9858	c.9802A>C	c.(9802-9804)Aga>Cga	p.R3268R	Y_RNA_ENST00000384719.1_RNA|PRKDC_ENST00000338368.3_Silent_p.R3268R|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3269	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CAATCGTCTCTGGTTTTTGAC	0.498								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						111.0	116.0	114.0					8																	48715984		1957	4162	6119	SO:0001819	synonymous_variant	5591	.			CGTCTCTGGTTTT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.9802A>C	8.37:g.48715984T>G		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	13.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	ENST00000314191.2	37																																																																																				.		0.498	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PRTG	283659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	55912922	55912922	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr15:55912922T>C	ENST00000389286.4	-	19	3184	c.3137A>G	c.(3136-3138)aAa>aGa	p.K1046R		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGAGTTGTTTTTAATTATAGG	0.333																																					p.K1046R		.											.	PRTG	92	0			c.A3137G						.						57.0	57.0	57.0					15																	55912922		1785	4048	5833	SO:0001583	missense	283659	exon19			TTGTTTTTAATTA	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.3137A>G	15.37:g.55912922T>C	ENSP00000373937:p.Lys1046Arg	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	42.0	NM_173814		Missense_Mutation	SNP	ENST00000389286.4	37	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.345095	0.61073	.	.	ENSG00000166450	ENST00000389286	T	0.51817	0.69	5.91	5.91	0.95273	.	0.366829	0.32204	N	0.006434	T	0.41971	0.1182	L	0.57536	1.79	0.80722	D	1	P	0.35328	0.495	B	0.27170	0.077	T	0.31081	-0.9956	10	0.20519	T	0.43	-24.7769	15.5264	0.75910	0.0:0.0:0.0:1.0	.	1046	Q2VWP7	PRTG_HUMAN	R	1046	ENSP00000373937:K1046R	ENSP00000373937:K1046R	K	-	2	0	PRTG	53700214	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.463000	0.53050	2.261000	0.74972	0.533000	0.62120	AAA	.		0.333	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	
PTCHD2	57540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	11574466	11574466	+	Missense_Mutation	SNP	G	G	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:11574466G>T	ENST00000294484.6	+	4	1474	c.1336G>T	c.(1336-1338)Ggg>Tgg	p.G446W	PTCHD2_ENST00000389575.3_Missense_Mutation_p.G446W	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	446					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGTTCTCTATGGGGGGACAGA	0.512																																					p.G446W		.											.	PTCHD2	209	0			c.G1336T						.						130.0	128.0	129.0					1																	11574466		1981	4166	6147	SO:0001583	missense	57540	exon4			CTCTATGGGGGGA	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1336G>T	1.37:g.11574466G>T	ENSP00000294484:p.Gly446Trp	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	13.0	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031930	0.75504	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.96459	-4.02;-4.02	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.97318	0.9123	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97697	1.0182	10	0.54805	T	0.06	-33.4867	17.7404	0.88405	0.0:0.0:1.0:0.0	.	446	Q9P2K9	PTHD2_HUMAN	W	446	ENSP00000294484:G446W;ENSP00000374226:G446W	ENSP00000294484:G446W	G	+	1	0	PTCHD2	11497053	1.000000	0.71417	0.761000	0.31378	0.743000	0.42351	9.391000	0.97249	2.490000	0.84030	0.655000	0.94253	GGG	.		0.512	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
PTCH2	8643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	45292375	45292375	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:45292375C>T	ENST00000372192.3	-	18	2891	c.2761G>A	c.(2761-2763)Gca>Aca	p.A921T	PTCH2_ENST00000447098.2_Missense_Mutation_p.A921T	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	921					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					ACAAAGTCTGCAGTCTTCTGG	0.677									Basal Cell Nevus syndrome																												p.A921T		.											.	PTCH2	851	0			c.G2761A						.						16.0	20.0	19.0					1																	45292375		2199	4286	6485	SO:0001583	missense	8643	exon18	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AGTCTGCAGTCTT	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.2761G>A	1.37:g.45292375C>T	ENSP00000361266:p.Ala921Thr	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	8.0	NM_001166292	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	37	CCDS516.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078411	0.36662	.	.	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.85013	-1.93;-1.93	3.89	3.89	0.44902	.	0.281434	0.25720	N	0.028757	T	0.75649	0.3878	N	0.17723	0.515	0.33295	D	0.564053	B;B	0.27166	0.024;0.17	B;B	0.32211	0.025;0.142	T	0.78858	-0.2038	10	0.39692	T	0.17	-8.7297	11.8824	0.52583	0.2929:0.7071:0.0:0.0	.	921;921	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	T	921	ENSP00000389703:A921T;ENSP00000361266:A921T	ENSP00000361266:A921T	A	-	1	0	PTCH2	45064962	0.850000	0.29656	0.999000	0.59377	0.998000	0.95712	1.531000	0.36018	2.462000	0.83206	0.563000	0.77884	GCA	.		0.677	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
RABGAP1L	9910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	174957891	174957891	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:174957891C>A	ENST00000367688.3	+	6	704	c.525C>A	c.(523-525)gaC>gaA	p.D175E	RABGAP1L_ENST00000367687.1_Missense_Mutation_p.D299E|RABGAP1L_ENST00000367686.3_3'UTR|RABGAP1L_ENST00000347255.2_Missense_Mutation_p.D300E|RABGAP1L_ENST00000392064.2_Missense_Mutation_p.D230E|RABGAP1L_ENST00000325589.5_Missense_Mutation_p.D280E|RABGAP1L_ENST00000489615.1_Missense_Mutation_p.D292E	NM_001243764.1	NP_001230693.1	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	175										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						ATGAGAAGGACTCACTTAAGA	0.463																																					p.D292E		.											.	RABGAP1L	540	0			c.C876A						.																																			SO:0001583	missense	9910	exon8			GAAGGACTCACTT	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000367688.3:c.525C>A	1.37:g.174957891C>A	ENSP00000356661:p.Asp175Glu	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	36.0	NM_001243765	B7ZAA4	Missense_Mutation	SNP	ENST00000367688.3	37	CCDS55662.1	.	.	.	.	.	.	.	.	.	.	C	5.353	0.250449	0.10130	.	.	ENSG00000152061	ENST00000325589;ENST00000367687;ENST00000347255;ENST00000489615;ENST00000392064;ENST00000367688	T;T;T	0.12361	2.69;2.92;2.92	5.88	4.02	0.46733	.	.	.	.	.	T	0.10852	0.0265	N	0.05351	-0.065	0.32794	N	0.500793	P;D;B;B;B;B	0.67145	0.884;0.996;0.007;0.001;0.001;0.007	B;P;B;B;B;B	0.58928	0.292;0.848;0.023;0.003;0.008;0.016	T	0.03112	-1.1071	9	0.02654	T	1	.	8.7912	0.34852	0.0:0.7192:0.0:0.2808	.	175;230;292;299;300;178	B7ZAP0;F5H8L0;Q5R372-8;Q5R372-6;Q5R372-5;Q9Y6Y7	.;.;.;.;.;.	E	280;299;300;292;230;175	ENSP00000318603:D280E;ENSP00000356660:D299E;ENSP00000281844:D300E	ENSP00000318603:D280E	D	+	3	2	RABGAP1L	173224514	0.976000	0.34144	0.998000	0.56505	0.994000	0.84299	0.206000	0.17375	0.830000	0.34757	0.561000	0.74099	GAC	.		0.463	RABGAP1L-015	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000084573.2	NM_001243765	
RADIL	55698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4854972	4854972	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:4854972G>C	ENST00000399583.3	-	9	2263	c.2076C>G	c.(2074-2076)caC>caG	p.H692Q	RADIL_ENST00000536091.1_3'UTR|RADIL_ENST00000538469.1_Missense_Mutation_p.H452Q	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	692	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		TCTGGAAGAAGTGCTCTCCAG	0.687																																					p.H692Q		.											.	RADIL	994	0			c.C2076G						.						7.0	9.0	9.0					7																	4854972		1850	4031	5881	SO:0001583	missense	55698	exon9			GAAGAAGTGCTCT	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.2076C>G	7.37:g.4854972G>C	ENSP00000382492:p.His692Gln	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	17.0	NM_018059	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	ENST00000399583.3	37	CCDS43544.1	.	.	.	.	.	.	.	.	.	.	G	6.428	0.447035	0.12223	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000544486;ENST00000538469	T;T	0.05855	3.46;3.38	5.74	1.74	0.24563	Dilute (1);Dil domain (1);	0.727630	0.13634	N	0.373482	T	0.02083	0.0065	N	0.01482	-0.84	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.45469	-0.9259	10	0.13470	T	0.59	-12.5832	7.1312	0.25502	0.0:0.3576:0.3083:0.3341	.	692	Q96JH8	RADIL_HUMAN	Q	692;663;426;452	ENSP00000382492:H692Q;ENSP00000442966:H452Q	ENSP00000320946:H663Q	H	-	3	2	RADIL	4821498	0.226000	0.23696	0.938000	0.37757	0.484000	0.33280	0.289000	0.18957	0.734000	0.32515	0.655000	0.94253	CAC	.		0.687	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323769.2	NM_018059	
RASGRF1	5923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79327481	79327481	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr15:79327481A>T	ENST00000419573.3	-	6	1224	c.950T>A	c.(949-951)cTg>cAg	p.L317Q	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.L317Q	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	317	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ACCCAGGACCAGCGTGGGCCA	0.567																																					p.L317Q		.											.	RASGRF1	662	0			c.T950A						.						26.0	27.0	27.0					15																	79327481		2196	4293	6489	SO:0001583	missense	5923	exon6			AGGACCAGCGTGG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.950T>A	15.37:g.79327481A>T	ENSP00000405963:p.Leu317Gln	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	21.0	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	A	19.39	3.817900	0.71028	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.67523	-0.27	4.95	4.95	0.65309	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000018	T	0.74703	0.3751	L	0.49699	1.58	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.998	T	0.70835	-0.4764	10	0.22109	T	0.4	.	12.6038	0.56511	1.0:0.0:0.0:0.0	.	317;317;317;317	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	Q	317	ENSP00000405963:L317Q	ENSP00000378224:L317Q	L	-	2	0	RASGRF1	77114536	0.984000	0.35163	0.995000	0.50966	0.585000	0.36419	8.941000	0.92964	2.069000	0.61940	0.397000	0.26171	CTG	.		0.567	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
RASGRF1	5923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79339166	79339166	+	Missense_Mutation	SNP	A	A	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr15:79339166A>C	ENST00000419573.3	-	5	1074	c.800T>G	c.(799-801)cTg>cGg	p.L267R	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.L267R	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	267	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CAGCGGGCGCAGGAAATTGTT	0.587																																					p.L267R		.											.	RASGRF1	662	0			c.T800G						.						135.0	108.0	117.0					15																	79339166		2196	4293	6489	SO:0001583	missense	5923	exon5			GGGCGCAGGAAAT	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.800T>G	15.37:g.79339166A>C	ENSP00000405963:p.Leu267Arg	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	20.0	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	37	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.020733	0.75275	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.64991	-0.13	4.03	4.03	0.46877	Dbl homology (DH) domain (5);	0.000000	0.56097	D	0.000022	T	0.75722	0.3888	M	0.77820	2.39	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.74118	-0.3768	10	0.26408	T	0.33	.	10.9558	0.47356	1.0:0.0:0.0:0.0	.	267;267;267;267	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	R	267	ENSP00000405963:L267R	ENSP00000378224:L267R	L	-	2	0	RASGRF1	77126221	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	8.873000	0.92357	1.684000	0.51022	0.533000	0.62120	CTG	.		0.587	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
RECK	8434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	36122844	36122844	+	Silent	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr9:36122844A>G	ENST00000377966.3	+	21	3284	c.2718A>G	c.(2716-2718)gcA>gcG	p.A906A		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	906					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			ATAAAGAAGCAGAGAAGATTG	0.463																																					p.A906A		.											.	RECK	93	0			c.A2718G						.						125.0	124.0	124.0					9																	36122844		2203	4300	6503	SO:0001819	synonymous_variant	8434	exon21			AGAAGCAGAGAAG	E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.2718A>G	9.37:g.36122844A>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	23.0	NM_021111	B2RNS1|Q5W0K6|Q8WX37	Silent	SNP	ENST00000377966.3	37	CCDS6597.1																																																																																			.		0.463	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052409.1		
RGAG1	57529	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	109695556	109695556	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:109695556A>G	ENST00000465301.2	+	3	1957	c.1711A>G	c.(1711-1713)Act>Gct	p.T571A	RGAG1_ENST00000540313.1_Missense_Mutation_p.T571A	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	571										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GAAAGCCATGACTTCTGGAGC	0.507																																					p.T571A		.											.	RGAG1	132	0			c.A1711G						.						120.0	103.0	109.0					X																	109695556		2203	4300	6503	SO:0001583	missense	57529	exon3			GCCATGACTTCTG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1711A>G	X.37:g.109695556A>G	ENSP00000419786:p.Thr571Ala	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	6.0	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.374027	0.00015	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.39056	1.1;1.1	3.47	0.536	0.17138	.	1.004580	0.08028	N	0.993029	T	0.11965	0.0291	N	0.00859	-1.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26189	-1.0110	9	.	.	.	-3.9872	2.627	0.04932	0.4001:0.0:0.3834:0.2164	.	571	Q8NET4	RGAG1_HUMAN	A	571	ENSP00000419786:T571A;ENSP00000441452:T571A	.	T	+	1	0	RGAG1	109582212	0.001000	0.12720	0.001000	0.08648	0.014000	0.08584	0.212000	0.17497	-0.009000	0.14296	-1.386000	0.01163	ACT	.		0.507	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
RHOA	387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49400013	49400013	+	Silent	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:49400013G>A	ENST00000418115.1	-	4	708	c.324C>T	c.(322-324)ccC>ccT	p.P108P	RHOA-IT1_ENST00000428083.1_RNA|RHOA_ENST00000454011.2_Missense_Mutation_p.P68L|RHOA_ENST00000422781.1_Silent_p.P108P	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	108					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGGGCACGTTGGGACAGAAAT	0.458																																					p.P108P		.											.	RHOA	1273	0			c.C324T						.						122.0	110.0	114.0					3																	49400013		2203	4300	6503	SO:0001819	synonymous_variant	387	exon4			CACGTTGGGACAG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.324C>T	3.37:g.49400013G>A		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	39.0	NM_001664	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Silent	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353734	0.41700	.	.	ENSG00000067560	ENST00000454011	T	0.22336	1.96	6.07	1.83	0.25207	.	0.235349	0.44688	N	0.000427	T	0.28665	0.0710	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03840	-1.0999	7	0.87932	D	0	.	5.738	0.18077	0.0692:0.1168:0.5609:0.2532	.	.	.	.	L	68	ENSP00000394483:P68L	ENSP00000394483:P68L	P	-	2	0	RHOA	49375017	1.000000	0.71417	0.990000	0.47175	0.971000	0.66376	1.788000	0.38714	0.814000	0.34374	0.655000	0.94253	CCA	.		0.458	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
RP1	6101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	55534100	55534100	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:55534100C>A	ENST00000220676.1	+	2	722	c.574C>A	c.(574-576)Cag>Aag	p.Q192K		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	192	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGAGGTCATGCAGCGCCCTGT	0.582																																					p.Q192K	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.C574A						.						121.0	124.0	123.0					8																	55534100		2203	4300	6503	SO:0001583	missense	6101	exon2			GTCATGCAGCGCC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.574C>A	8.37:g.55534100C>A	ENSP00000220676:p.Gln192Lys	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	44.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071221	0.76301	.	.	ENSG00000104237	ENST00000427058;ENST00000220676	D	0.91351	-2.83	5.14	4.25	0.50352	Doublecortin domain (5);	0.606668	0.14844	N	0.295121	D	0.91523	0.7323	M	0.76002	2.32	0.47659	D	0.999482	B;P	0.37061	0.006;0.58	B;B	0.41723	0.013;0.365	D	0.90186	0.4246	10	0.51188	T	0.08	2.4733	14.9386	0.70975	0.1441:0.8559:0.0:0.0	.	2;192	E7EVW9;P56715	.;RP1_HUMAN	K	2;192	ENSP00000220676:Q192K	ENSP00000220676:Q192K	Q	+	1	0	RP1	55696653	1.000000	0.71417	0.735000	0.30896	0.563000	0.35712	3.944000	0.56629	1.145000	0.42336	0.650000	0.86243	CAG	.		0.582	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
SF3B1	23451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	198266711	198266711	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:198266711T>G	ENST00000335508.6	-	15	2312	c.2221A>C	c.(2221-2223)Aag>Cag	p.K741Q	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	741					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGATTTACCTTTCCTCTGTGT	0.353			Mis		myelodysplastic syndrome																																p.K741Q		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	140	0			c.A2221C						.						89.0	84.0	86.0					2																	198266711		2203	4300	6503	SO:0001583	missense	23451	exon15			TTACCTTTCCTCT	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2221A>C	2.37:g.198266711T>G	ENSP00000335321:p.Lys741Gln	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	60.0	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.789531	0.90367	.	.	ENSG00000115524	ENST00000335508	T	0.65732	-0.17	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85678	0.5752	H	0.96175	3.78	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.90320	0.4344	10	0.87932	D	0	.	15.9781	0.80086	0.0:0.0:0.0:1.0	.	741	O75533	SF3B1_HUMAN	Q	741	ENSP00000335321:K741Q	ENSP00000335321:K741Q	K	-	1	0	SF3B1	197974956	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.566000	0.82347	2.171000	0.68590	0.533000	0.62120	AAG	.		0.353	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SLC45A4	57210	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	142229096	142229096	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr8:142229096C>A	ENST00000024061.3	-	4	797	c.490G>T	c.(490-492)Ggg>Tgg	p.G164W	SLC45A4_ENST00000433583.2_Missense_Mutation_p.G157W|SLC45A4_ENST00000517878.1_Missense_Mutation_p.G215W|SLC45A4_ENST00000519067.1_Missense_Mutation_p.G164W	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			CAGTCCAGCCCACCCAGCACG	0.672																																					p.G164W		.											.	SLC45A4	70	0			c.G490T						.						55.0	60.0	58.0					8																	142229096		2203	4300	6503	SO:0001583	missense	57210	exon4			CCAGCCCACCCAG	AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.490G>T	8.37:g.142229096C>A	ENSP00000024061:p.Gly164Trp	Somatic	107.0	1.0		WXS	Illumina HiSeq	Phase_I	182.0	30.0	NM_001080431	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	ENST00000024061.3	37	CCDS34948.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535056	0.85812	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061;ENST00000520137	D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-1.84	5.45	5.45	0.79879	.	0.092556	0.85682	D	0.000000	D	0.94601	0.8260	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95133	0.8257	10	0.87932	D	0	-48.5029	19.3415	0.94344	0.0:1.0:0.0:0.0	.	215;164;164	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	W	164;215;157;164;22	ENSP00000429059:G164W;ENSP00000428137:G215W;ENSP00000400799:G157W;ENSP00000024061:G164W;ENSP00000429033:G22W	ENSP00000024061:G164W	G	-	1	0	SLC45A4	142298278	1.000000	0.71417	0.954000	0.39281	0.964000	0.63967	7.272000	0.78516	2.560000	0.86352	0.555000	0.69702	GGG	.		0.672	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378571.3	XM_050325	
SLC6A2	6530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	55725901	55725901	+	Silent	SNP	C	C	T	rs180935423	byFrequency	TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr16:55725901C>T	ENST00000379906.2	+	5	1110	c.855C>T	c.(853-855)ccC>ccT	p.P285P	SLC6A2_ENST00000567238.1_Silent_p.P180P|SLC6A2_ENST00000566163.1_Intron|SLC6A2_ENST00000561820.1_Silent_p.P285P|SLC6A2_ENST00000414754.3_Silent_p.P285P|SLC6A2_ENST00000219833.8_Silent_p.P285P|SLC6A2_ENST00000568943.1_Silent_p.P285P	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	285					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TCACGCTGCCCGGAGCCTCCA	0.587													C|||	2	0.000399361	0.0	0.0	5008	,	,		21576	0.002		0.0	False		,,,				2504	0.0				p.P285P		.											.	SLC6A2	526	0			c.C855T						.						138.0	93.0	108.0					16																	55725901		2198	4300	6498	SO:0001819	synonymous_variant	6530	exon6			GCTGCCCGGAGCC		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.855C>T	16.37:g.55725901C>T		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	18.0	NM_001172501	B2R707|B4DX48|Q96KH8	Silent	SNP	ENST00000379906.2	37	CCDS10754.1																																																																																			C|0.999;T|0.001		0.587	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2		
SPAG6	9576	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	22678098	22678098	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:22678098delC	ENST00000376624.3	+	7	1004	c.862delC	c.(862-864)ctgfs	p.L288fs	RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000538630.1_Frame_Shift_Del_p.L263fs|SPAG6_ENST00000376601.1_Intron|SPAG6_ENST00000376603.2_Frame_Shift_Del_p.L364fs|SPAG6_ENST00000313311.6_Frame_Shift_Del_p.L288fs	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	288					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						GCTTTCACAGCTGGTAGTTAA	0.463																																					p.L288fs		.											.	SPAG6	153	0			c.862delC						.						148.0	126.0	133.0					10																	22678098		2203	4300	6503	SO:0001589	frameshift_variant	9576	exon7			TCACAGCTGGTAG	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.862delC	10.37:g.22678098delC	ENSP00000365811:p.Leu288fs	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	37.0	NM_172242	A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Frame_Shift_Del	DEL	ENST00000376624.3	37	CCDS7139.1																																																																																			.		0.463	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1		
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220336992	220336992	+	Silent	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:220336992T>C	ENST00000312358.7	+	15	4011	c.3879T>C	c.(3877-3879)gcT>gcC	p.A1293A	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1293	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGGTGGTGGCTGTGACGGGGA	0.652																																					p.A1293A		.											.	SPEG	383	0			c.T3879C						.						51.0	56.0	54.0					2																	220336992		1984	4150	6134	SO:0001819	synonymous_variant	10290	exon15			GGTGGCTGTGACG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3879T>C	2.37:g.220336992T>C		Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	11.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	CCDS42824.1																																																																																			.		0.652	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
SRP54	6729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	35492189	35492189	+	Silent	SNP	G	G	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr14:35492189G>C	ENST00000556994.1	+	15	1627	c.1230G>C	c.(1228-1230)tcG>tcC	p.S410S	SRP54_ENST00000546080.1_Silent_p.S361S|SRP54_ENST00000555557.1_Silent_p.S346S|SRP54_ENST00000216774.6_Silent_p.S410S			P61011	SRP54_HUMAN	signal recognition particle 54kDa	410	M-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)	p.S410S(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		CAAGAGGATCGGGTGTATCAA	0.393																																					p.S410S		.											.	SRP54	227	1	Substitution - coding silent(1)	large_intestine(1)	c.G1230C						.						106.0	98.0	101.0					14																	35492189		2203	4300	6503	SO:0001819	synonymous_variant	6729	exon14			AGGATCGGGTGTA	X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.1230G>C	14.37:g.35492189G>C		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	24.0	NM_003136	B2R759|B4DUW6|P13624	Silent	SNP	ENST00000556994.1	37	CCDS9652.1																																																																																			.		0.393	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276643.2	NM_003136	
SSX2IP	117178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	85121516	85121516	+	Splice_Site	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:85121516T>A	ENST00000342203.3	-	11	1651	c.1388A>T	c.(1387-1389)gAg>gTg	p.E463V	SSX2IP_ENST00000437941.2_Splice_Site_p.E436V|SSX2IP_ENST00000605755.1_Splice_Site_p.E436V|SSX2IP_ENST00000370612.4_Splice_Site_p.E463V|SSX2IP_ENST00000603677.1_Intron	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	463					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTAAAATACCTCCAATCCCAG	0.403																																					p.E463V		.											.	SSX2IP	92	0			c.A1388T						.						69.0	70.0	69.0					1																	85121516		2203	4300	6503	SO:0001630	splice_region_variant	117178	exon12			AATACCTCCAATC		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.1389+1A>T	1.37:g.85121516T>A		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	25.0	NM_001166417	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	37	CCDS699.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.883401	0.91740	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612	T;T	0.68181	-0.3;-0.31	5.6	5.6	0.85130	.	0.047070	0.85682	D	0.000000	T	0.74245	0.3691	L	0.57536	1.79	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.72625	0.978;0.952;0.952	T	0.78231	-0.2284	10	0.87932	D	0	-0.6233	15.774	0.78193	0.0:0.0:0.0:1.0	.	459;463;436	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	V	463;436;459;463	ENSP00000340279:E463V;ENSP00000412781:E436V	ENSP00000340279:E463V	E	-	2	0	SSX2IP	84894104	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.407000	0.80029	2.139000	0.66308	0.482000	0.46254	GAG	.		0.403	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	Missense_Mutation
STK31	56164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	23825118	23825118	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:23825118A>G	ENST00000355870.3	+	18	2289	c.2170A>G	c.(2170-2172)Atg>Gtg	p.M724V	STK31_ENST00000428484.1_Missense_Mutation_p.M701V|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000433467.2_Missense_Mutation_p.M724V|STK31_ENST00000354639.3_Missense_Mutation_p.M701V	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	724	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TCTCCTTACAATGAGCTTGGA	0.403																																					p.M724V		.											.	STK31	338	0			c.A2170G						.						193.0	184.0	187.0					7																	23825118		2203	4300	6503	SO:0001583	missense	56164	exon18			CTTACAATGAGCT	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.2170A>G	7.37:g.23825118A>G	ENSP00000348132:p.Met724Val	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	21.0	NM_031414	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	A	0.890	-0.725800	0.03158	.	.	ENSG00000196335	ENST00000355870;ENST00000433467;ENST00000354639;ENST00000428484	T;T;T;T	0.68331	-0.32;1.41;-0.32;-0.32	5.24	-0.0559	0.13807	Protein kinase, catalytic domain (1);	0.596299	0.18382	N	0.142927	T	0.39572	0.1083	L	0.31294	0.92	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.19418	-1.0306	10	0.02654	T	1	-4.5115	1.7963	0.03062	0.2572:0.3743:0.2397:0.1288	.	724;724	B4DZ06;Q9BXU1	.;STK31_HUMAN	V	724;724;701;701	ENSP00000348132:M724V;ENSP00000411852:M724V;ENSP00000346660:M701V;ENSP00000406146:M701V	ENSP00000346660:M701V	M	+	1	0	STK31	23791643	0.052000	0.20516	0.995000	0.50966	0.982000	0.71751	0.116000	0.15561	0.371000	0.24564	0.528000	0.53228	ATG	.		0.403	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
STMN1	3925	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	26227524	26227524	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:26227524C>A	ENST00000399728.1	-	5	796	c.433G>T	c.(433-435)Gag>Tag	p.E145*	STMN1_ENST00000357865.2_Nonsense_Mutation_p.E145*|STMN1_ENST00000426559.2_Intron|STMN1_ENST00000465604.1_5'UTR|STMN1_ENST00000374291.1_Nonsense_Mutation_p.E145*|STMN1_ENST00000455785.2_Nonsense_Mutation_p.E145*	NM_203401.1	NP_981946.1	P16949	STMN1_HUMAN	stathmin 1	145	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				axonogenesis (GO:0007409)|intracellular signal transduction (GO:0035556)|microtubule depolymerization (GO:0007019)|mitotic spindle organization (GO:0007052)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of cellular component movement (GO:0051272)|response to virus (GO:0009615)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|microtubule (GO:0005874)	signal transducer activity (GO:0004871)|tubulin binding (GO:0015631)			breast(2)|large_intestine(2)|skin(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000163)|all_lung(284;0.000234)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.013)|READ - Rectum adenocarcinoma(331;0.0649)		GCTTCAGTCTCGTCAGCAGGG	0.398																																					p.E145X		.											.	STMN1	90	0			c.G433T						.						214.0	200.0	205.0					1																	26227524		2203	4300	6503	SO:0001587	stop_gained	3925	exon5			CAGTCTCGTCAGC	J04991	CCDS269.1, CCDS44090.1	1p36.11	2011-02-09	2009-04-28	2001-07-13	ENSG00000117632	ENSG00000117632			6510	protein-coding gene	gene with protein product	"""oncoprotein 18"""	151442	"""chromosome 1 open reading frame 215"", ""stathmin 1/oncoprotein 18"""	LAP18, C1orf215		2917975	Standard	NM_005563		Approved	SMN, OP18, PR22, PP19, PP17, Lag, FLJ32206	uc010oev.2	P16949	OTTHUMG00000007389	ENST00000399728.1:c.433G>T	1.37:g.26227524C>A	ENSP00000382633:p.Glu145*	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	44.0	NM_005563	A2A2D1|B2R4E7|B7Z8N4|D3DPJ5	Nonsense_Mutation	SNP	ENST00000399728.1	37	CCDS269.1	.	.	.	.	.	.	.	.	.	.	C	38	6.766145	0.97821	.	.	ENSG00000117632	ENST00000455785;ENST00000399728;ENST00000357865;ENST00000374291	.	.	.	5.76	5.76	0.90799	.	0.147587	0.64402	D	0.000017	.	.	.	.	.	.	0.38055	D	0.935904	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	17.7562	0.88450	0.0:1.0:0.0:0.0	.	.	.	.	X	145	.	ENSP00000350531:E145X	E	-	1	0	STMN1	26100111	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	1.274000	0.33132	2.710000	0.92621	0.655000	0.94253	GAG	.		0.398	STMN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019359.1	NM_005563	
TBCD	6904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80851463	80851463	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:80851463A>T	ENST00000355528.4	+	17	1734	c.1604A>T	c.(1603-1605)gAc>gTc	p.D535V	TBCD_ENST00000539345.2_Missense_Mutation_p.D535V|TBCD_ENST00000397466.2_Missense_Mutation_p.D149V	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	535					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			ACCACAGCTGACTATTTTGCC	0.358																																					p.D535V		.											.	TBCD	22	0			c.A1604T						.						118.0	102.0	107.0					17																	80851463		1852	4091	5943	SO:0001583	missense	6904	exon17			CAGCTGACTATTT	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1604A>T	17.37:g.80851463A>T	ENSP00000347719:p.Asp535Val	Somatic	312.0	0.0		WXS	Illumina HiSeq	Phase_I	430.0	231.0	NM_005993	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	ENST00000355528.4	37	CCDS45818.1	.	.	.	.	.	.	.	.	.	.	A	11.04	1.522378	0.27211	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.66280	-0.2;-0.2	4.64	4.64	0.57946	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81221	0.4777	M	0.90870	3.155	0.80722	D	1	P;P;P	0.48230	0.576;0.701;0.907	B;B;P	0.62491	0.194;0.356;0.903	D	0.84864	0.0821	9	.	.	.	.	13.2094	0.59815	1.0:0.0:0.0:0.0	.	535;535;535	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	V	535;286;149;535	ENSP00000347719:D535V;ENSP00000380608:D149V	.	D	+	2	0	TBCD	78444752	1.000000	0.71417	0.984000	0.44739	0.062000	0.15995	7.034000	0.76511	1.710000	0.51325	0.421000	0.28195	GAC	.		0.358	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439415.1	NM_005993	
TBR1	10716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	162273138	162273138	+	Missense_Mutation	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:162273138G>A	ENST00000389554.3	+	1	534	c.217G>A	c.(217-219)Gac>Aac	p.D73N	TBR1_ENST00000410035.1_5'Flank	NM_006593.2	NP_006584.1	Q16650	TBR1_HUMAN	T-box, brain, 1	73					axon guidance (GO:0007411)|brain development (GO:0007420)|hindbrain development (GO:0030902)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of neuron projection development (GO:0010975)|specification of organ identity (GO:0010092)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(3)	30						TGACTCCAAGGACTCACCAGG	0.493																																					p.D73N		.											.	TBR1	91	0			c.G217A						.						89.0	97.0	94.0					2																	162273138		2203	4300	6503	SO:0001583	missense	10716	exon1			TCCAAGGACTCAC	U49250	CCDS33310.1	2q24.2	2011-06-13			ENSG00000136535	ENSG00000136535		"""T-boxes"""	11590	protein-coding gene	gene with protein product		604616				7619531	Standard	NM_006593		Approved		uc002ubw.1	Q16650	OTTHUMG00000153888	ENST00000389554.3:c.217G>A	2.37:g.162273138G>A	ENSP00000374205:p.Asp73Asn	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	28.0	NM_006593	B0AZS4|B2R6G5|Q14DC5|Q53TH0|Q56A81	Missense_Mutation	SNP	ENST00000389554.3	37	CCDS33310.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.753740	0.49362	.	.	ENSG00000136535	ENST00000389554	D	0.87412	-2.25	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.90532	0.7033	L	0.44542	1.39	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	D	0.87829	0.2643	10	0.27082	T	0.32	.	17.8745	0.88821	0.0:0.0:1.0:0.0	.	73	Q16650	TBR1_HUMAN	N	73	ENSP00000374205:D73N	ENSP00000374205:D73N	D	+	1	0	TBR1	161981384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.161000	0.71868	2.803000	0.96430	0.655000	0.94253	GAC	.		0.493	TBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332845.1	NM_006593	
TBX22	50945	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	79283541	79283541	+	Silent	SNP	T	T	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chrX:79283541T>G	ENST00000373294.5	+	7	943	c.915T>G	c.(913-915)acT>acG	p.T305T	TBX22_ENST00000442340.1_Silent_p.T185T|TBX22_ENST00000373296.3_Silent_p.T305T|TBX22_ENST00000373291.1_Silent_p.T185T	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	305					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTTCTTTCACTCTCGATTTTA	0.383																																					p.T305T		.											.	TBX22	628	0			c.T915G						.						92.0	84.0	87.0					X																	79283541		2203	4300	6503	SO:0001819	synonymous_variant	50945	exon7			TTTCACTCTCGAT	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.915T>G	X.37:g.79283541T>G		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	9.0	NM_016954	Q5JZ06|Q96LC0|Q9HBF1	Silent	SNP	ENST00000373294.5	37	CCDS14445.1																																																																																			.		0.383	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	
TBX2	6909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59485645	59485645	+	Silent	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:59485645C>T	ENST00000240328.3	+	7	2198	c.1917C>T	c.(1915-1917)acC>acT	p.T639T	RP11-332H18.4_ENST00000592009.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2	639					aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						TCCTCACCACCGGGCTGGCCT	0.697																																					p.T639T	GBM(3;187 253 11467 14965 23079)	.											.	TBX2	226	0			c.C1917T						.						23.0	20.0	21.0					17																	59485645		2193	4296	6489	SO:0001819	synonymous_variant	6909	exon7			CACCACCGGGCTG	AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.1917C>T	17.37:g.59485645C>T		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	187.0	54.0	NM_005994	Q16424|Q7Z647	Silent	SNP	ENST00000240328.3	37	CCDS11627.2																																																																																			.		0.697	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346977.2	NM_005994	
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167645700	167645700	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:167645700C>G	ENST00000518659.1	+	23	4843	c.4804C>G	c.(4804-4806)Cac>Gac	p.H1602D	TENM2_ENST00000519204.1_Missense_Mutation_p.H1481D|TENM2_ENST00000403607.2_Missense_Mutation_p.H1426D|TENM2_ENST00000545108.1_Missense_Mutation_p.H1601D|TENM2_ENST00000520394.1_Missense_Mutation_p.H1363D	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1602					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TGATGGCATCCACCAATACAC	0.453																																					p.H1593D		.											.	.	.	0			c.C4777G						.						118.0	115.0	116.0					5																	167645700		2013	4190	6203	SO:0001583	missense	57451	exon23			GGCATCCACCAAT	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4804C>G	5.37:g.167645700C>G	ENSP00000429430:p.His1602Asp	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	36.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	C	21.2	4.115501	0.77323	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.56444	1.63;0.46;1.63;1.63;1.63	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.78168	0.4241	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.984	D;D;D	0.75484	0.986;0.968;0.964	T	0.80821	-0.1211	10	0.87932	D	0	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	1601;1602;1363	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	D	1602;1601;1481;1363;1426	ENSP00000429430:H1602D;ENSP00000438635:H1601D;ENSP00000428964:H1481D;ENSP00000427874:H1363D;ENSP00000384905:H1426D	ENSP00000384905:H1426D	H	+	1	0	ODZ2	167578278	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.767000	0.95098	0.655000	0.94253	CAC	.		0.453	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TENM4	26011	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	78369307	78369307	+	Silent	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr11:78369307C>G	ENST00000278550.7	-	34	8568	c.8106G>C	c.(8104-8106)gcG>gcC	p.A2702A		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2702					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.A2702A(2)									CGCGGGCCCACGCTTGGCGCA	0.672																																					p.A2702A		.											.	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G8106C						.						40.0	45.0	44.0					11																	78369307		2031	4185	6216	SO:0001819	synonymous_variant	26011	exon34			GGCCCACGCTTGG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.8106G>C	11.37:g.78369307C>G		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	28.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																			.		0.672	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
TGFB2	7042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	218607497	218607497	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:218607497A>T	ENST00000366930.4	+	3	1051	c.584A>T	c.(583-585)gAa>gTa	p.E195V	TGFB2_ENST00000366929.4_Missense_Mutation_p.E223V|TGFB2_ENST00000479322.1_3'UTR	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	195					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		ACAAGAGCAGAAGGCGAATGG	0.438																																					p.E223V		.											.	TGFB2	710	0			c.A668T						.						180.0	165.0	170.0					1																	218607497		2203	4300	6503	SO:0001583	missense	7042	exon4			GAGCAGAAGGCGA	M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.584A>T	1.37:g.218607497A>T	ENSP00000355897:p.Glu195Val	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	72.0	NM_001135599	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	37	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.712924	0.89112	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.76578	-0.88;-1.03	5.91	5.91	0.95273	Transforming growth factor-beta, N-terminal (1);	0.044771	0.85682	D	0.000000	T	0.72471	0.3464	L	0.49350	1.555	0.80722	D	1	B;P	0.37731	0.337;0.607	B;B	0.33121	0.133;0.158	T	0.73626	-0.3923	10	0.44086	T	0.13	.	16.3512	0.83208	1.0:0.0:0.0:0.0	.	223;195	P61812-2;P61812	.;TGFB2_HUMAN	V	195;223	ENSP00000355897:E195V;ENSP00000355896:E223V	ENSP00000355896:E223V	E	+	2	0	TGFB2	216674120	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	8.904000	0.92590	2.266000	0.75297	0.533000	0.62120	GAA	.		0.438	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
TJP1	7082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	30010589	30010589	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr15:30010589C>A	ENST00000346128.6	-	21	4231	c.3757G>T	c.(3757-3759)Gaa>Taa	p.E1253*	TJP1_ENST00000356107.6_Nonsense_Mutation_p.E1253*|TJP1_ENST00000400011.2_Nonsense_Mutation_p.E1177*|TJP1_ENST00000545208.2_Nonsense_Mutation_p.E1173*	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1253					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCTTCCTCTTCTTCGGTTTGA	0.473																																					p.E1253X	Melanoma(77;681 1843 6309 6570)	.											.	TJP1	95	0			c.G3757T						.						111.0	108.0	109.0					15																	30010589		1998	4188	6186	SO:0001587	stop_gained	7082	exon21			CCTCTTCTTCGGT		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.3757G>T	15.37:g.30010589C>A	ENSP00000281537:p.Glu1253*	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	29.0	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Nonsense_Mutation	SNP	ENST00000346128.6	37	CCDS42007.1	.	.	.	.	.	.	.	.	.	.	C	41	9.080969	0.99059	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	.	.	.	5.91	5.91	0.95273	.	0.411863	0.29106	N	0.013135	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.3057	0.98631	0.0:1.0:0.0:0.0	.	.	.	.	X	1253;1177;1253;1173;1173	.	ENSP00000281537:E1253X	E	-	1	0	TJP1	27797881	0.995000	0.38212	0.202000	0.23494	0.875000	0.50365	4.832000	0.62759	2.791000	0.96007	0.655000	0.94253	GAA	.		0.473	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
TM6SF1	53346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	83795555	83795555	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr15:83795555C>T	ENST00000322019.9	+	8	1031	c.757C>T	c.(757-759)Caa>Taa	p.Q253*	TM6SF1_ENST00000379390.6_Intron|TM6SF1_ENST00000565774.1_Intron|TM6SF1_ENST00000379386.4_Nonsense_Mutation_p.Q256*			Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1	253						integral component of membrane (GO:0016021)				endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						TACGCAATTTCAAGAGCCCTA	0.318																																					p.Q253X		.											.	TM6SF1	91	0			c.C757T						.						152.0	161.0	158.0					15																	83795555		2203	4300	6503	SO:0001587	stop_gained	53346	exon8			CAATTTCAAGAGC	AF255922	CCDS10323.1, CCDS45338.1	15q24-q26	2003-04-04			ENSG00000136404	ENSG00000136404			11860	protein-coding gene	gene with protein product		606562				11124529	Standard	NM_001144903		Approved		uc002bjp.3	Q9BZW5	OTTHUMG00000147365	ENST00000322019.9:c.757C>T	15.37:g.83795555C>T	ENSP00000317000:p.Gln253*	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	40.0	NM_023003	A8K7T5|H3BU56|Q4U0U5	Nonsense_Mutation	SNP	ENST00000322019.9	37	CCDS10323.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936493	0.73442	.	.	ENSG00000136404	ENST00000322019;ENST00000379386	.	.	.	6.02	5.09	0.68999	.	0.244039	0.43579	D	0.000549	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-2.1509	17.1485	0.86772	0.0:0.8736:0.1264:0.0	.	.	.	.	X	253;256	.	ENSP00000317000:Q253X	Q	+	1	0	TM6SF1	81586559	1.000000	0.71417	0.963000	0.40424	0.477000	0.33069	3.733000	0.55029	1.522000	0.49001	0.655000	0.94253	CAA	.		0.318	TM6SF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000304009.1	NM_023003	
TNK2	10188	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	195596397	195596397	+	Intron	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:195596397C>T	ENST00000333602.6	-	11	2161				TNK2_ENST00000428187.1_Intron|TNK2_ENST00000381916.2_Missense_Mutation_p.R583H|TNK2_ENST00000392400.1_Intron	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2						cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CTGAGGTGGGCGAGGTGGAGG	0.652																																					p.R583H		.											.	TNK2	957	0			c.G1748A						.						30.0	23.0	26.0					3																	195596397		1875	3683	5558	SO:0001627	intron_variant	10188	exon12			GGTGGGCGAGGTG	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1543+587G>A	3.37:g.195596397C>T		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	7.0	NM_001010938	Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	ENST00000333602.6	37	CCDS33928.1	.	.	.	.	.	.	.	.	.	.	C	33	5.236193	0.95240	.	.	ENSG00000061938	ENST00000381916;ENST00000416152	T;T	0.76448	-1.02;2.7	4.76	4.76	0.60689	.	0.271824	0.34223	N	0.004150	T	0.76169	0.3950	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.85130	0.997;0.745	T	0.76801	-0.2825	10	0.26408	T	0.33	.	16.4175	0.83746	0.0:1.0:0.0:0.0	.	583;30	Q07912-3;B3KXJ4	.;.	H	583;72	ENSP00000371341:R583H;ENSP00000398614:R72H	ENSP00000371341:R583H	R	-	2	0	TNK2	197080794	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.634000	0.74290	2.210000	0.71456	0.558000	0.71614	CGC	.		0.652	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	C	T	rs587782144		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr17:7578457C>T	ENST00000269305.4	-	5	662	c.473G>A	c.(472-474)cGc>cAc	p.R158H	TP53_ENST00000413465.2_Missense_Mutation_p.R158H|TP53_ENST00000420246.2_Missense_Mutation_p.R158H|TP53_ENST00000455263.2_Missense_Mutation_p.R158H|TP53_ENST00000445888.2_Missense_Mutation_p.R158H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R158H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	158	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R158L(77)|p.R158H(74)|p.R158P(9)|p.R65L(8)|p.0?(8)|p.R26L(8)|p.R158fs(6)|p.R158fs*11(6)|p.R65H(5)|p.R26H(5)|p.R158_A159insX(4)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R26fs(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R65fs*11(1)|p.R156fs*20(1)|p.R158C(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCATGGCGCGGACGCGGGT	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R158H	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,0	TP53	70225	244	Substitution - Missense(188)|Deletion - Frameshift(19)|Deletion - In frame(13)|Complex(10)|Whole gene deletion(8)|Insertion - In frame(4)|Complex - frameshift(2)	lung(78)|central_nervous_system(33)|oesophagus(20)|haematopoietic_and_lymphoid_tissue(19)|large_intestine(18)|upper_aerodigestive_tract(12)|stomach(12)|urinary_tract(9)|prostate(7)|kidney(6)|liver(6)|breast(5)|bone(4)|soft_tissue(3)|ovary(3)|pancreas(3)|thyroid(2)|biliary_tract(2)|vulva(1)|thymus(1)	c.G473A	GRCh37	CM994513	TP53	M		.						49.0	51.0	50.0					17																	7578457		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATGGCGCGGACGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.473G>A	17.37:g.7578457C>T	ENSP00000269305:p.Arg158His	Somatic	60.0	1.0		WXS	Illumina HiSeq	Phase_I	41.0	18.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.306299	0.40795	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110116	0.64402	D	0.000010	D	0.99809	0.9917	M	0.77486	2.375	0.58432	D	0.999999	D;P;D;D;P;P;D	0.89917	0.998;0.631;0.984;0.982;0.831;0.48;1.0	P;B;P;P;P;B;D	0.97110	0.907;0.274;0.76;0.751;0.516;0.242;1.0	D	0.96738	0.9544	10	0.87932	D	0	-10.4795	12.6491	0.56751	0.0:0.9196:0.0:0.0804	.	119;158;158;65;158;158;158	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	158;158;158;158;158;158;147;65;26;65;26;158	ENSP00000410739:R158H;ENSP00000352610:R158H;ENSP00000269305:R158H;ENSP00000398846:R158H;ENSP00000391127:R158H;ENSP00000391478:R158H;ENSP00000425104:R26H;ENSP00000423862:R65H;ENSP00000424104:R158H	ENSP00000269305:R158H	R	-	2	0	TP53	7519182	1.000000	0.71417	0.034000	0.17996	0.175000	0.22909	7.775000	0.85489	1.514000	0.48869	-0.140000	0.14226	CGC	.		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRIM36	55521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	114506870	114506870	+	Intron	SNP	G	G	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr5:114506870G>A	ENST00000282369.3	-	2	185				TRIM36_ENST00000514154.1_Intron|TRIM36_ENST00000513154.1_5'Flank|TRIM36_ENST00000515104.1_5'Flank|TRIM36_ENST00000379618.2_Missense_Mutation_p.T38M	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36						acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		AAGTTCCGTCGTCTTCCCACA	0.463																																					p.T38M		.											.	TRIM36	725	0			c.C113T						.						145.0	155.0	152.0					5																	114506870		2202	4300	6502	SO:0001627	intron_variant	55521	exon2			TCCGTCGTCTTCC	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.64-7421C>T	5.37:g.114506870G>A		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	56.0	NM_001017397	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Missense_Mutation	SNP	ENST00000282369.3	37	CCDS4115.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109292	0.37242	.	.	ENSG00000152503	ENST00000379618	.	.	.	2.81	-0.166	0.13351	.	.	.	.	.	T	0.26304	0.0642	.	.	.	0.09310	N	1	B	0.28584	0.216	B	0.13407	0.009	T	0.17531	-1.0366	7	0.87932	D	0	.	5.2455	0.15494	0.4427:0.0:0.5573:0.0	.	38	Q0P5Z9	.	M	38	.	ENSP00000368938:T38M	T	-	2	0	TRIM36	114534769	0.001000	0.12720	0.000000	0.03702	0.865000	0.49528	1.031000	0.30165	-0.053000	0.13289	0.650000	0.86243	ACG	.		0.463	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	
TRPM6	140803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	77397736	77397736	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr9:77397736C>G	ENST00000360774.1	-	22	3190	c.2953G>C	c.(2953-2955)Gcc>Ccc	p.A985P	TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.A980P|TRPM6_ENST00000449912.2_Missense_Mutation_p.A980P|TRPM6_ENST00000451710.3_Missense_Mutation_p.A985P|TRPM6_ENST00000376864.4_Missense_Mutation_p.A985P|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	985					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AGGACTATGGCCATGATGATC	0.428																																					p.A985P		.											.	TRPM6	335	0			c.G2953C						.						110.0	96.0	101.0					9																	77397736		2203	4300	6503	SO:0001583	missense	140803	exon22			CTATGGCCATGAT	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.2953G>C	9.37:g.77397736C>G	ENSP00000354006:p.Ala985Pro	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	38.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.844254	0.91197	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81	5.71	5.71	0.89125	Ion transport (1);	0.000000	0.85682	D	0.000000	T	0.42268	0.1195	M	0.88377	2.95	0.80722	D	1	P;P;D	0.76494	0.648;0.91;0.999	P;P;D	0.75484	0.482;0.737;0.986	T	0.37126	-0.9719	10	0.46703	T	0.11	.	19.8632	0.96793	0.0:1.0:0.0:0.0	.	648;985;980	F5H7D1;Q9BX84;Q9BX84-3	.;TRPM6_HUMAN;.	P	985;985;980;980;985;648;648	ENSP00000354006:A985P;ENSP00000407341:A985P;ENSP00000396672:A980P;ENSP00000354962:A980P;ENSP00000366060:A985P	ENSP00000309693:A648P	A	-	1	0	TRPM6	76587556	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.867000	0.56047	2.704000	0.92352	0.561000	0.74099	GCC	.		0.428	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
TSC2	7249	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	2122984	2122984	+	Splice_Site	DEL	G	G	-	rs137854116|rs137854250		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr16:2122984delG	ENST00000219476.3	+	21	2985	c.2355delG	c.(2353-2355)cag>ca	p.Q785fs	TSC2_ENST00000350773.4_Splice_Site_p.Q785fs|TSC2_ENST00000439673.2_Splice_Site_p.Q748fs|TSC2_ENST00000382538.6_Splice_Site_p.Q736fs|TSC2_ENST00000353929.4_Splice_Site_p.Q785fs|TSC2_ENST00000401874.2_Splice_Site_p.Q785fs|TSC2_ENST00000568454.1_Splice_Site_p.Q796fs	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	785					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				AAACCAAACAGGTAGGAGGTC	0.547			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.Q785fs		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	1908	0			c.2355delG						.						46.0	44.0	45.0					16																	2122984		2198	4300	6498	SO:0001630	splice_region_variant	7249	exon21	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CAAACAGGTAGGA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2355+1G>-	16.37:g.2122984delG		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	15.0	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Del	DEL	ENST00000219476.3	37	CCDS10458.1																																																																																			.		0.547	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	Frame_Shift_Del
TTBK1	84630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43214466	43214466	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:43214466T>C	ENST00000259750.4	+	2	151	c.68T>C	c.(67-69)aTc>aCc	p.I23T	TTBK1_ENST00000304139.5_5'Flank	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	23					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CAGGCCGACATCCTGCCGGCC	0.677																																					p.I23T		.											.	TTBK1	353	0			c.T68C						.						44.0	40.0	41.0					6																	43214466		2203	4300	6503	SO:0001583	missense	84630	exon2			CCGACATCCTGCC	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.68T>C	6.37:g.43214466T>C	ENSP00000259750:p.Ile23Thr	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	24.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.967280	0.92855	.	.	ENSG00000146216	ENST00000259750	T	0.56275	0.47	4.62	4.62	0.57501	.	0.000000	0.64402	D	0.000001	T	0.47303	0.1438	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	P	0.61477	0.889	T	0.55945	-0.8060	10	0.87932	D	0	.	13.0392	0.58889	0.0:0.0:0.0:1.0	.	23	Q5TCY1	TTBK1_HUMAN	T	23	ENSP00000259750:I23T	ENSP00000259750:I23T	I	+	2	0	TTBK1	43322444	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.593000	0.82686	1.709000	0.51313	0.533000	0.62120	ATC	.		0.677	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179479034	179479034	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:179479034T>C	ENST00000591111.1	-	212	44391	c.44167A>G	c.(44167-44169)Acc>Gcc	p.T14723A	TTN_ENST00000342175.6_Missense_Mutation_p.T7491A|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T16364A|TTN_ENST00000342992.6_Missense_Mutation_p.T13796A|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000359218.5_Missense_Mutation_p.T7424A|TTN_ENST00000460472.2_Missense_Mutation_p.T7299A|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14723	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTCATTGGTTACATCTGTG	0.398																																					p.T16364A		.											.	TTN	636	0			c.A49090G						.						92.0	85.0	88.0					2																	179479034		1969	4163	6132	SO:0001583	missense	7273	exon262			CATTGGTTACATC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.44167A>G	2.37:g.179479034T>C	ENSP00000465570:p.Thr14723Ala	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	46.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	14.28	2.487645	0.44249	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60299	0.2;0.2;0.2;0.2	5.55	5.55	0.83447	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76898	0.4052	M	0.79123	2.44	0.58432	D	0.999996	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.80216	-0.1474	9	0.87932	D	0	.	15.9963	0.80250	0.0:0.0:0.0:1.0	.	7299;7424;7491;14723	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	13796;7299;7491;7424;7299	ENSP00000343764:T13796A;ENSP00000434586:T7299A;ENSP00000340554:T7491A;ENSP00000352154:T7424A	ENSP00000340554:T7491A	T	-	1	0	TTN	179187279	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	6.206000	0.72154	2.234000	0.73211	0.533000	0.62120	ACC	.		0.398	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179489420	179489420	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr2:179489420T>C	ENST00000591111.1	-	192	39888	c.39664A>G	c.(39664-39666)Acg>Gcg	p.T13222A	TTN_ENST00000342175.6_Missense_Mutation_p.T5990A|TTN_ENST00000589042.1_Missense_Mutation_p.T14863A|TTN_ENST00000342992.6_Missense_Mutation_p.T12295A|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T5923A|TTN_ENST00000460472.2_Missense_Mutation_p.T5798A|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13222	Ig-like 88.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTCGACCGTCTGGTCCTCA	0.453																																					p.T14863A		.											.	TTN	636	0			c.A44587G						.						58.0	58.0	58.0					2																	179489420		1830	4087	5917	SO:0001583	missense	7273	exon242			CGACCGTCTGGTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.39664A>G	2.37:g.179489420T>C	ENSP00000465570:p.Thr13222Ala	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	33.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	14.75	2.629254	0.46944	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.82	4.65	0.58169	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67211	0.2869	L	0.58101	1.795	0.45762	D	0.998659	D;D;D;P	0.53151	0.958;0.958;0.958;0.919	P;P;P;P	0.46172	0.506;0.506;0.506;0.506	T	0.70651	-0.4813	9	0.87932	D	0	.	13.1241	0.59344	0.0:0.0:0.1338:0.8662	.	5798;5923;5990;13222	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	12295;5798;5990;5923;5798	ENSP00000343764:T12295A;ENSP00000434586:T5798A;ENSP00000340554:T5990A;ENSP00000352154:T5923A	ENSP00000340554:T5990A	T	-	1	0	TTN	179197665	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.991000	0.88244	1.016000	0.39470	0.528000	0.53228	ACG	.		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TUBB8	347688	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	93331	93331	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:93331T>C	ENST00000309812.4	-	4	1063	c.1001A>G	c.(1000-1002)cAa>cGa	p.Q334R	TUBB8_ENST00000447903.2_Missense_Mutation_p.Q262R|TUBB8_ENST00000413237.3_5'Flank	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	334					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GTTCTTATCTTGAATGTTGAA	0.547																																					p.Q334R	Pancreas(192;2041 3010 9013 18103)	.											.	TUBB8	69	0			c.A1001G						.						81.0	90.0	87.0					10																	93331		2203	4298	6501	SO:0001583	missense	347688	exon4			TTATCTTGAATGT	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.1001A>G	10.37:g.93331T>C	ENSP00000311042:p.Gln334Arg	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	7.0	NM_177987	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	T	6.433	0.448038	0.12223	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	D	0.82619	-1.63	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.56097	U	0.000029	D	0.89259	0.6664	M	0.93197	3.39	0.31442	N	0.67189	B;B	0.23990	0.002;0.095	B;P	0.46237	0.003;0.508	D	0.86973	0.2099	9	0.87932	D	0	.	4.5487	0.12098	0.0:6.0E-4:0.0:0.9994	.	297;334	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	R	262;300;297;334	ENSP00000403895:Q262R	ENSP00000272035:Q300R	Q	-	2	0	RP11-631M21.2	83331	1.000000	0.71417	0.144000	0.22314	0.145000	0.21501	5.418000	0.66429	0.103000	0.17682	0.102000	0.15555	CAA	.		0.547	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
TXNDC2	84203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	9886946	9886946	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr18:9886946T>C	ENST00000306084.6	+	2	669	c.470T>C	c.(469-471)aTc>aCc	p.I157T	TXNDC2_ENST00000357775.5_Missense_Mutation_p.I90T|TXNDC2_ENST00000536353.2_Missense_Mutation_p.I90T	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	157	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						GCAAAACCCATCCAGCCCAAG	0.542																																					p.I157T		.											.	TXNDC2	92	0			c.T470C						.						128.0	135.0	133.0					18																	9886946		2203	4300	6503	SO:0001583	missense	84203	exon2			AACCCATCCAGCC	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.470T>C	18.37:g.9886946T>C	ENSP00000304908:p.Ile157Thr	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	55.0	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	t	2.155	-0.393672	0.04899	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T;T	0.55234	1.58;0.53;0.53	2.72	-5.45	0.02616	.	0.692875	0.11934	N	0.515413	T	0.37210	0.0995	L	0.33245	0.995	0.09310	N	1	P	0.51791	0.948	P	0.48063	0.565	T	0.23868	-1.0176	9	.	.	.	.	3.7672	0.08627	0.4109:0.3183:0.0:0.2708	.	157	Q86VQ3	TXND2_HUMAN	T	90;90;157;157	ENSP00000437393:I90T;ENSP00000350419:I90T;ENSP00000304908:I157T	.	I	+	2	0	TXNDC2	9876946	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.998000	0.01469	-1.801000	0.01245	-0.680000	0.03767	ATC	.		0.542	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
USP19	10869	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49153162	49153162	+	Missense_Mutation	SNP	C	C	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr3:49153162C>A	ENST00000398888.2	-	10	1696	c.1378G>T	c.(1378-1380)Gcc>Tcc	p.A460S	USP19_ENST00000398892.3_Missense_Mutation_p.A500S|USP19_ENST00000453664.1_Missense_Mutation_p.A551S|USP19_ENST00000417901.1_Missense_Mutation_p.A563S|USP19_ENST00000398898.2_Missense_Mutation_p.A500S|USP19_ENST00000434032.2_Missense_Mutation_p.A561S|USP19_ENST00000398896.1_Missense_Mutation_p.A268S|USP19_ENST00000488993.1_5'Flank	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	460					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTCACCGAGGCCAGGTGTGTC	0.562																																					p.A563S		.											.	USP19	663	0			c.G1687T						.						66.0	70.0	69.0					3																	49153162		2086	4215	6301	SO:0001583	missense	10869	exon11			CCGAGGCCAGGTG	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.1378G>T	3.37:g.49153162C>A	ENSP00000381863:p.Ala460Ser	Somatic	116.0	2.0		WXS	Illumina HiSeq	Phase_I	135.0	43.0	NM_001199161	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	C	6.853	0.526692	0.13066	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032;ENST00000306026	T;T;T;T;T;T;T;T	0.32515	2.14;2.13;2.24;2.24;2.12;2.23;2.22;1.45	6.17	3.36	0.38483	Domain of unknown function DUF1872 (1);	1.158280	0.05853	N	0.621494	T	0.25680	0.0625	L	0.29908	0.895	0.38340	D	0.944042	B;P;B;B;P;B;B	0.38617	0.304;0.482;0.304;0.167;0.64;0.36;0.03	B;B;B;B;B;B;B	0.42386	0.101;0.134;0.101;0.045;0.386;0.041;0.025	T	0.26815	-1.0092	10	0.36615	T	0.2	-15.5023	2.5309	0.04703	0.2276:0.4759:0.1548:0.1416	.	626;561;551;460;500;546;268	A5PKX8;E9PEG8;E7EN22;O94966;B5MEG5;O94966-2;E7ESU0	.;.;.;UBP19_HUMAN;.;.;.	S	268;500;563;551;500;460;561;548	ENSP00000381870:A268S;ENSP00000381872:A500S;ENSP00000395260:A563S;ENSP00000400090:A551S;ENSP00000381867:A500S;ENSP00000381863:A460S;ENSP00000401197:A561S;ENSP00000303503:A548S	ENSP00000303503:A548S	A	-	1	0	USP19	49128166	0.955000	0.32602	0.996000	0.52242	0.613000	0.37349	1.014000	0.29950	0.895000	0.36342	0.655000	0.94253	GCC	.		0.562	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
USP21	27005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161132173	161132173	+	Silent	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr1:161132173C>T	ENST00000289865.8	+	4	995	c.774C>T	c.(772-774)ctC>ctT	p.L258L	USP21_ENST00000368001.1_Silent_p.L258L|USP21_ENST00000368002.3_Silent_p.L258L	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	258	USP.				histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCCAAGAGCTCACTGAAGGTG	0.592																																					p.L258L		.											.	USP21	660	0			c.C774T						.						53.0	56.0	55.0					1																	161132173		2203	4300	6503	SO:0001819	synonymous_variant	27005	exon4			AGAGCTCACTGAA	AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.774C>T	1.37:g.161132173C>T		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	51.0	NM_012475	Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Silent	SNP	ENST00000289865.8	37	CCDS30920.1																																																																																			.		0.592	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080801.1		
USP25	29761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	17250204	17250204	+	Silent	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr21:17250204C>T	ENST00000285679.6	+	23	3258	c.2889C>T	c.(2887-2889)gtC>gtT	p.V963V	USP25_ENST00000351097.5_Silent_p.V358V|USP25_ENST00000285681.2_Silent_p.V995V|USP25_ENST00000400183.2_Silent_p.V1033V	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	963					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		AGTTTATTGTCCCATTTTTGC	0.363																																					p.V963V		.											.	USP25	663	0			c.C2889T						.						121.0	121.0	121.0					21																	17250204		2203	4300	6503	SO:0001819	synonymous_variant	29761	exon23			TATTGTCCCATTT	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2889C>T	21.37:g.17250204C>T		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	59.0	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	ENST00000285679.6	37	CCDS33515.1																																																																																			.		0.363	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
WSCD2	9671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	108589818	108589818	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr12:108589818T>C	ENST00000332082.4	+	3	1027	c.209T>C	c.(208-210)aTg>aCg	p.M70T	WSCD2_ENST00000261400.3_Missense_Mutation_p.M70T|WSCD2_ENST00000549903.1_Missense_Mutation_p.M70T|WSCD2_ENST00000547525.1_Missense_Mutation_p.M70T			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	70						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TTGGGTGACATGCATCTGGGC	0.617																																					p.M70T		.											.	WSCD2	136	0			c.T209C						.						145.0	146.0	146.0					12																	108589818		2068	4218	6286	SO:0001583	missense	9671	exon2			GTGACATGCATCT		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.209T>C	12.37:g.108589818T>C	ENSP00000331933:p.Met70Thr	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	17.0	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	ENST00000332082.4	37	CCDS41828.1	.	.	.	.	.	.	.	.	.	.	T	2.380	-0.342269	0.05243	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.28666	1.61;1.6;1.61;1.6	5.74	3.38	0.38709	.	1.460410	0.03933	N	0.285650	T	0.12220	0.0297	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30707	-0.9969	10	0.11794	T	0.64	-4.6756	4.7924	0.13256	0.0:0.1995:0.1587:0.6419	.	70	Q2TBF2	WSCD2_HUMAN	T	70	ENSP00000448047:M70T;ENSP00000261400:M70T;ENSP00000331933:M70T;ENSP00000447272:M70T	ENSP00000261400:M70T	M	+	2	0	WSCD2	107113948	0.988000	0.35896	0.930000	0.37139	0.465000	0.32709	2.021000	0.41020	0.968000	0.38212	0.533000	0.62120	ATG	.		0.617	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
WTAP	9589	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160163131	160163131	+	Missense_Mutation	SNP	A	A	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr6:160163131A>G	ENST00000358372.4	+	4	1855	c.98A>G	c.(97-99)tAt>tGt	p.Y33C	WTAP_ENST00000337387.4_Missense_Mutation_p.Y33C|SOD2_ENST00000546087.1_Intron	NM_001270531.1|NM_004906.4	NP_001257460.1|NP_004897.2	Q15007	FL2D_HUMAN	Wilms tumor 1 associated protein	33					cell cycle (GO:0007049)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	MIS complex (GO:0036396)|nuclear membrane (GO:0031965)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	18		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		TGGAAACAATATGAAGCATAT	0.279																																					p.Y33C		.											.	WTAP	90	0			c.A98G						.						78.0	83.0	81.0					6																	160163131		2203	4300	6503	SO:0001583	missense	9589	exon4			AACAATATGAAGC	AJ276706	CCDS5266.1, CCDS5267.1, CCDS75542.1	6q25-q27	2008-02-05			ENSG00000146457	ENSG00000146457			16846	protein-coding gene	gene with protein product		605442				7788527, 11001926	Standard	NM_004906		Approved	KIAA0105, MGC3925	uc003qsl.4	Q15007	OTTHUMG00000015933	ENST00000358372.4:c.98A>G	6.37:g.160163131A>G	ENSP00000351141:p.Tyr33Cys	Somatic	240.0	1.0		WXS	Illumina HiSeq	Phase_I	158.0	64.0	NM_001270533	Q5TCL8|Q5TCL9|Q96T28|Q9BYJ7|Q9H4E2	Missense_Mutation	SNP	ENST00000358372.4	37	CCDS5266.1	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909937	0.72983	.	.	ENSG00000146457	ENST00000358372;ENST00000337387	T;T	0.46063	0.88;0.92	5.46	5.46	0.80206	.	0.164448	0.56097	D	0.000034	T	0.31358	0.0794	L	0.36672	1.1	0.42420	D	0.992637	D;P	0.55800	0.973;0.933	P;P	0.53360	0.724;0.513	T	0.11179	-1.0598	10	0.39692	T	0.17	-11.0154	10.7319	0.46102	0.858:0.0:0.0:0.142	.	33;33	Q15007;Q5TCL9	FL2D_HUMAN;.	C	33	ENSP00000351141:Y33C;ENSP00000336911:Y33C	ENSP00000336911:Y33C	Y	+	2	0	WTAP	160083121	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.210000	0.77924	2.071000	0.62044	0.477000	0.44152	TAT	.		0.279	WTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042905.1	NM_152857	
ZKSCAN2	342357	broad.mit.edu;bcgsc.ca	37	16	25258229	25258229	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr16:25258229C>T	ENST00000328086.7	-	5	2091	c.1288G>A	c.(1288-1290)Gcc>Acc	p.A430T		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	430					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		GGAGCACGGGCTGCAGGGTTC	0.493																																					p.A430T		.											.	ZKSCAN2	138	0			c.G1288A						.						178.0	142.0	154.0					16																	25258229		2197	4300	6497	SO:0001583	missense	342357	exon5			CACGGGCTGCAGG	AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1288G>A	16.37:g.25258229C>T	ENSP00000331626:p.Ala430Thr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	5.0	NM_001012981	A1L3B4|Q6ZN77	Missense_Mutation	SNP	ENST00000328086.7	37	CCDS32410.1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814111	0.50527	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.07567	3.18	5.57	4.57	0.56435	.	0.298969	0.29383	N	0.012303	T	0.14830	0.0358	L	0.43923	1.385	0.36083	D	0.842919	D;D;D	0.64830	0.994;0.986;0.994	P;P;P	0.58721	0.81;0.844;0.81	T	0.08452	-1.0721	10	0.14656	T	0.56	-16.6507	13.0068	0.58710	0.0:0.8375:0.1625:0.0	.	226;430;430	B4DYF0;Q63HK3-2;Q63HK3	.;.;ZKSC2_HUMAN	T	430	ENSP00000331626:A430T	ENSP00000331626:A430T	A	-	1	0	ZKSCAN2	25165730	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	1.364000	0.34171	2.780000	0.95670	0.655000	0.94253	GCC	.		0.493	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435739.1	NM_001012981	
ZNF189	7743	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	104171388	104171388	+	Missense_Mutation	SNP	G	G	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr9:104171388G>C	ENST00000339664.2	+	3	1467	c.1338G>C	c.(1336-1338)caG>caC	p.Q446H	ZNF189_ENST00000374861.3_Missense_Mutation_p.Q432H|ZNF189_ENST00000259395.4_Missense_Mutation_p.Q404H	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	446					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TTGTTATACAGCAGGAAGTCT	0.373																																					p.Q446H		.											.	ZNF189	229	0			c.G1338C						.						81.0	82.0	82.0					9																	104171388		2203	4300	6503	SO:0001583	missense	7743	exon3			TATACAGCAGGAA	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.1338G>C	9.37:g.104171388G>C	ENSP00000342019:p.Gln446His	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	4.0	NM_003452	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	ENST00000339664.2	37	CCDS6754.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.272813	0.00257	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.05786	3.47;3.47;3.39	4.43	-2.9	0.05648	.	0.000000	0.44483	D	0.000448	T	0.00815	0.0027	N	0.00090	-2.18	0.33195	D	0.551386	B;B;B	0.14805	0.011;0.011;0.002	B;B;B	0.09377	0.004;0.004;0.001	T	0.41070	-0.9529	10	0.02654	T	1	.	4.5141	0.11926	0.4791:0.0:0.2624:0.2585	.	431;432;446	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	H	432;446;404	ENSP00000363995:Q432H;ENSP00000342019:Q446H;ENSP00000259395:Q404H	ENSP00000259395:Q404H	Q	+	3	2	ZNF189	103211209	0.000000	0.05858	0.953000	0.39169	0.954000	0.61252	-1.046000	0.03525	-0.618000	0.05656	-0.878000	0.02970	CAG	.		0.373	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452	
ZNF266	10781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9525003	9525003	+	Missense_Mutation	SNP	C	C	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:9525003C>T	ENST00000592904.1	-	5	2674	c.598G>A	c.(598-600)Gct>Act	p.A200T	ZNF266_ENST00000590306.1_Missense_Mutation_p.A200T|ZNF266_ENST00000592292.1_Missense_Mutation_p.A200T|ZNF266_ENST00000361451.2_Missense_Mutation_p.A200T|ZNF266_ENST00000361151.1_Missense_Mutation_p.A200T|ZNF266_ENST00000588933.1_Missense_Mutation_p.A200T|ZNF266_ENST00000588221.1_Missense_Mutation_p.A200T			Q14584	ZN266_HUMAN	zinc finger protein 266	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						ATACGCACAGCAAGGTCTGTG	0.398																																					p.A200T		.											.	ZNF266	91	0			c.G598A						.						89.0	83.0	85.0					19																	9525003		2203	4300	6503	SO:0001583	missense	10781	exon11			GCACAGCAAGGTC	X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.598G>A	19.37:g.9525003C>T	ENSP00000466714:p.Ala200Thr	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	25.0	NM_001271314	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	ENST00000592904.1	37	CCDS12213.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.623003	0.28889	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.14516	2.5;2.5	2.91	-5.82	0.02333	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03136	0.0092	N	0.03304	-0.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24512	-1.0158	9	0.02654	T	1	.	0.9292	0.01331	0.2737:0.1037:0.2726:0.3501	.	200	Q14584	ZN266_HUMAN	T	200	ENSP00000354680:A200T;ENSP00000355047:A200T	ENSP00000355047:A200T	A	-	1	0	ZNF266	9386003	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-1.207000	0.03008	-4.054000	0.00078	-0.226000	0.12346	GCT	.		0.398	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1		
ZNF274	10782	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58718123	58718123	+	Missense_Mutation	SNP	C	C	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:58718123C>G	ENST00000326804.4	+	5	752	c.293C>G	c.(292-294)cCt>cGt	p.P98R	ZNF274_ENST00000345813.3_Missense_Mutation_p.P66R|ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000424679.2_5'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		AAATTGGATCCTCTTCCTGCT	0.502																																					.		.											.	ZNF274	91	0			.						.						21.0	23.0	22.0					19																	58718123		1936	4160	6096	SO:0001583	missense	10782	.			TGGATCCTCTTCC	AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.293C>G	19.37:g.58718123C>G	ENSP00000321209:p.Pro98Arg	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	44.0	.	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Missense_Mutation	SNP	ENST00000326804.4	37		.	.	.	.	.	.	.	.	.	.	C	18.30	3.594304	0.66219	.	.	ENSG00000171606	ENST00000326804;ENST00000345813	T;T	0.06849	3.34;3.25	3.74	-1.53	0.08611	.	2.005690	0.02790	N	0.121975	T	0.08626	0.0214	L	0.51422	1.61	0.09310	N	0.999999	P;P	0.39157	0.662;0.531	B;B	0.36092	0.217;0.108	T	0.28713	-1.0035	10	0.59425	D	0.04	0.6649	2.9432	0.05837	0.2219:0.3489:0.0:0.4292	.	66;98	Q96GC6-2;Q96GC6	.;ZN274_HUMAN	R	98;66	ENSP00000321209:P98R;ENSP00000321187:P66R	ENSP00000321209:P98R	P	+	2	0	ZNF274	63409935	0.000000	0.05858	0.002000	0.10522	0.826000	0.46750	0.117000	0.15583	-0.190000	0.10465	0.462000	0.41574	CCT	.		0.502	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_133502	
ZNF398	57541	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	148876417	148876417	+	Missense_Mutation	SNP	T	T	C			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr7:148876417T>C	ENST00000475153.1	+	6	1720	c.1453T>C	c.(1453-1455)Tgc>Cgc	p.C485R	ZNF398_ENST00000540950.1_Missense_Mutation_p.C490R|ZNF398_ENST00000420008.2_Missense_Mutation_p.C314R|ZNF398_ENST00000426851.2_Missense_Mutation_p.C314R|ZNF398_ENST00000335901.4_Missense_Mutation_p.C314R|ZNF398_ENST00000483892.1_Missense_Mutation_p.C314R|ZNF398_ENST00000491174.1_Missense_Mutation_p.C314R			Q8TD17	ZN398_HUMAN	zinc finger protein 398	485					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			CCCTTTCTCCTGCCCTCAGTG	0.607																																					p.C485R		.											.	ZNF398	91	0			c.T1453C						.						59.0	52.0	54.0					7																	148876417		2203	4300	6503	SO:0001583	missense	57541	exon6			TTCTCCTGCCCTC	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.1453T>C	7.37:g.148876417T>C	ENSP00000420418:p.Cys485Arg	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	12.0	NM_170686	A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Missense_Mutation	SNP	ENST00000475153.1	37	CCDS5894.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094345	0.76870	.	.	ENSG00000197024	ENST00000426851;ENST00000420008;ENST00000475153;ENST00000483892;ENST00000491174;ENST00000540950;ENST00000335901	T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000033	T	0.74366	0.3707	H	0.96398	3.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82760	-0.0298	10	0.87932	D	0	-22.0993	12.9978	0.58657	0.0:0.0:0.0:1.0	.	490;485	B4DXA9;Q8TD17	.;ZN398_HUMAN	R	314;314;485;314;314;490;314	ENSP00000389972:C314R;ENSP00000416751:C314R;ENSP00000420418:C485R;ENSP00000418564:C314R;ENSP00000419391:C314R;ENSP00000439340:C490R;ENSP00000338984:C314R	ENSP00000338984:C314R	C	+	1	0	ZNF398	148507350	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.823000	0.86660	1.958000	0.56883	0.528000	0.53228	TGC	.		0.607	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352722.2		
ZNF653	115950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11598499	11598499	+	Missense_Mutation	SNP	G	G	A	rs377200586		TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:11598499G>A	ENST00000293771.5	-	4	915	c.779C>T	c.(778-780)cCg>cTg	p.P260L	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GGAGCACAGCGGGGTACCCTG	0.672																																					p.P260L	Pancreas(83;980 1446 4542 6441 43352)	.											.	ZNF653	90	0			c.C779T						.	G	LEU/PRO	0,4406		0,0,2203	45.0	45.0	45.0		779	3.4	0.1	19		45	1,8595		0,1,4297	no	missense	ZNF653	NM_138783.3	98	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	260/616	11598499	1,13001	2203	4298	6501	SO:0001583	missense	115950	exon4			CACAGCGGGGTAC	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.779C>T	19.37:g.11598499G>A	ENSP00000293771:p.Pro260Leu	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	55.0	NM_138783	Q96AS7	Missense_Mutation	SNP	ENST00000293771.5	37	CCDS12261.1	.	.	.	.	.	.	.	.	.	.	G	6.224	0.409514	0.11812	0.0	1.16E-4	ENSG00000161914	ENST00000293771	T	0.10668	2.85	4.49	3.44	0.39384	.	0.850722	0.10371	N	0.682878	T	0.05364	0.0142	N	0.14661	0.345	0.09310	N	0.999992	P	0.43352	0.804	B	0.25614	0.062	T	0.29671	-1.0004	10	0.87932	D	0	-11.0558	9.5582	0.39353	0.0:0.1548:0.6852:0.16	.	260	Q96CK0	ZN653_HUMAN	L	260	ENSP00000293771:P260L	ENSP00000293771:P260L	P	-	2	0	ZNF653	11459499	0.098000	0.21812	0.079000	0.20413	0.227000	0.25037	1.649000	0.37281	1.002000	0.39104	-0.304000	0.09214	CCG	.		0.672	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458836.2	NM_138783	
ZNF571	51276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38056846	38056846	+	Missense_Mutation	SNP	T	T	A			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:38056846T>A	ENST00000328550.2	-	4	583	c.484A>T	c.(484-486)Aat>Tat	p.N162Y	ZNF571-AS1_ENST00000589750.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF540_ENST00000592533.1_Intron|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571_ENST00000358744.3_Missense_Mutation_p.N162Y|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571_ENST00000451802.2_Missense_Mutation_p.N162Y|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571_ENST00000590751.1_Intron|ZNF571_ENST00000593133.1_Missense_Mutation_p.N162Y			Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	25			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTCTATATTATGATTTTCC	0.353																																					p.N162Y		.											.	ZNF571	90	0			c.A484T						.						85.0	86.0	86.0					19																	38056846		2203	4300	6503	SO:0001583	missense	51276	exon4			CTATATTATGATT	AF161544	CCDS12505.1	19q13.12	2013-09-20			ENSG00000180479	ENSG00000180479		"""Zinc fingers, C2H2-type"", ""-"""	25000	protein-coding gene	gene with protein product						11042152	Standard	XM_005258977		Approved	HSPC059	uc002ogt.3	Q7Z3V5	OTTHUMG00000182016	ENST00000328550.2:c.484A>T	19.37:g.38056846T>A	ENSP00000333660:p.Asn162Tyr	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	29.0	NM_016536	Q2HIY0|Q3ZCU3|Q9NZX7	Missense_Mutation	SNP	ENST00000328550.2	37	CCDS12505.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.017389	0.54576	.	.	ENSG00000180479	ENST00000328550;ENST00000451802;ENST00000358744	T;T;T	0.35605	1.3;1.3;1.3	3.45	1.02	0.19986	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43545	0.1252	L	0.52126	1.63	0.21499	N	0.999667	P	0.51537	0.946	P	0.56163	0.793	T	0.28586	-1.0039	9	0.87932	D	0	.	7.3936	0.26923	0.4228:0.0:0.0:0.5772	.	162	Q7Z3V5	ZN571_HUMAN	Y	162	ENSP00000333660:N162Y;ENSP00000392638:N162Y;ENSP00000351594:N162Y	ENSP00000333660:N162Y	N	-	1	0	ZNF571	42748686	0.001000	0.12720	0.004000	0.12327	0.405000	0.30901	-0.115000	0.10741	-0.120000	0.11809	0.260000	0.18958	AAT	.		0.353	ZNF571-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458669.1	NM_016536	
ZNF468	90333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	53352366	53352366	+	Missense_Mutation	SNP	T	T	G			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr19:53352366T>G	ENST00000595646.1	-	3	236	c.116A>C	c.(115-117)gAg>gCg	p.E39A	ZNF468_ENST00000390651.4_5'UTR|ZNF468_ENST00000243639.4_Missense_Mutation_p.E39A|ZNF468_ENST00000396409.4_5'UTR|ZNF28_ENST00000594602.1_Intron			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	39	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		CCTATAATTCTCCAGCATCAC	0.488																																					p.E39A		.											.	ZNF468	92	0			c.A116C						.						143.0	144.0	144.0					19																	53352366		2203	4300	6503	SO:0001583	missense	90333	exon3			TAATTCTCCAGCA	AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.116A>C	19.37:g.53352366T>G	ENSP00000470381:p.Glu39Ala	Somatic	13.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	7.0	NM_001008801	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Missense_Mutation	SNP	ENST00000595646.1	37	CCDS33094.1	.	.	.	.	.	.	.	.	.	.	-	15.60	2.881197	0.51801	.	.	ENSG00000204604	ENST00000243639	T	0.04317	3.65	1.99	1.99	0.26369	Krueppel-associated box (4);	.	.	.	.	T	0.31606	0.0802	H	0.98487	4.245	0.80722	D	1	D	0.62365	0.991	D	0.77004	0.989	T	0.37572	-0.9700	9	0.87932	D	0	.	8.7623	0.34683	0.0:0.0:0.0:1.0	.	39	Q5VIY5	ZN468_HUMAN	A	39	ENSP00000243639:E39A	ENSP00000243639:E39A	E	-	2	0	ZNF468	58044178	0.997000	0.39634	0.981000	0.43875	0.755000	0.42902	1.160000	0.31761	0.915000	0.36847	0.409000	0.27619	GAG	.		0.488	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801	
ZRANB1	54764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	126631850	126631850	+	Missense_Mutation	SNP	A	A	T			TCGA-MI-A75I-01A-11D-A32G-10	TCGA-MI-A75I-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c9dad44d-b8c3-40f4-83ee-da8c82890611	dc087f7d-68c4-44c3-aa12-a62a8bf3c9a3	g.chr10:126631850A>T	ENST00000359653.4	+	1	1159	c.788A>T	c.(787-789)gAt>gTt	p.D263V	RP11-298J20.3_ENST00000449984.1_RNA|RP11-298J20.4_ENST00000508096.1_RNA	NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	263					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		AAAAAGACTGATTGGCTCTTC	0.388																																					p.D263V		.											.	ZRANB1	660	0			c.A788T						.						39.0	43.0	42.0					10																	126631850		2202	4300	6502	SO:0001583	missense	54764	exon1			AGACTGATTGGCT	AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.788A>T	10.37:g.126631850A>T	ENSP00000352676:p.Asp263Val	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	15.0	NM_017580	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	37	CCDS7642.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.961583	0.74016	.	.	ENSG00000019995	ENST00000359653	T	0.23950	1.88	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57106	-0.7868	10	0.87932	D	0	-25.7875	15.1999	0.73126	1.0:0.0:0.0:0.0	.	263	Q9UGI0	ZRAN1_HUMAN	V	263	ENSP00000352676:D263V	ENSP00000352676:D263V	D	+	2	0	ZRANB1	126621840	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	8.962000	0.93254	1.986000	0.57962	0.460000	0.39030	GAT	.		0.388	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1	NM_017580	
