#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48619929	48619929	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:48619929T>A	ENST00000435803.1	+	56	14488	c.14464T>A	c.(14464-14466)Tac>Aac	p.Y4822N	ABCA13_ENST00000544596.1_Missense_Mutation_p.Y552N	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4822	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCTCTATTATTACTGTAGCTT	0.542																																					p.Y4822N		.											.	ABCA13	521	0			c.T14464A						.						53.0	53.0	53.0					7																	48619929		1910	4110	6020	SO:0001583	missense	154664	exon56			TATTATTACTGTA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14464T>A	7.37:g.48619929T>A	ENSP00000411096:p.Tyr4822Asn	Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	63.0	25.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	15.31	2.794773	0.50102	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.39406	1.08;1.08;1.08	5.11	5.11	0.69529	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.44902	D	0.000420	T	0.63698	0.2533	M	0.77616	2.38	0.44048	D	0.996785	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.988;1.0;1.0	T	0.68209	-0.5469	10	0.87932	D	0	.	11.3039	0.49323	0.0:0.0:0.0:1.0	.	552;2524;4822	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	N	4822;595;552	ENSP00000411096:Y4822N;ENSP00000391042:Y595N;ENSP00000442634:Y552N	ENSP00000391042:Y595N	Y	+	1	0	ABCA13	48590475	1.000000	0.71417	0.859000	0.33776	0.196000	0.23810	5.387000	0.66243	1.926000	0.55796	0.519000	0.50382	TAC	.		0.542	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCA6	23460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	67080447	67080447	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:67080447T>C	ENST00000284425.2	-	34	4484	c.4310A>G	c.(4309-4311)gAt>gGt	p.D1437G	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1437	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					AGATGGTTCATCCAGGAGCAA	0.517																																					p.D1437G		.											.	ABCA6	159	0			c.A4310G						.						121.0	113.0	116.0					17																	67080447		2203	4300	6503	SO:0001583	missense	23460	exon34			GGTTCATCCAGGA	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4310A>G	17.37:g.67080447T>C	ENSP00000284425:p.Asp1437Gly	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	29.0	NM_080284	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.075929	0.76415	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.99695	-6.43	5.18	5.18	0.71444	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.52532	D	0.000074	D	0.99862	0.9935	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96409	0.9303	10	0.87932	D	0	.	14.3635	0.66789	0.0:0.0:0.0:1.0	.	1437	Q8N139	ABCA6_HUMAN	G	1437;297	ENSP00000284425:D1437G	ENSP00000284425:D1437G	D	-	2	0	ABCA6	64592042	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	7.229000	0.78088	2.171000	0.68590	0.533000	0.62120	GAT	.		0.517	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
AGPAT1	10554	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32138303	32138303	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:32138303G>A	ENST00000395499.1	-	4	988	c.409C>T	c.(409-411)Ctg>Ttg	p.L137L	AGPAT1_ENST00000375104.2_Silent_p.L137L|AGPAT1_ENST00000336984.6_Silent_p.L137L|AGPAT1_ENST00000490711.1_Intron|AGPAT1_ENST00000395496.1_Silent_p.L137L|AGPAT1_ENST00000395497.1_Silent_p.L137L|AGPAT1_ENST00000375107.3_Silent_p.L137L|AGPAT1_ENST00000412465.2_Silent_p.L25L|PPT2-EGFL8_ENST00000422437.1_3'UTR			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	137					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						CAGCAGGCCAGCCCGGCAGAG	0.652																																					p.L137L		.											.	AGPAT1	90	0			c.C409T						.						70.0	77.0	75.0					6																	32138303		1510	2708	4218	SO:0001819	synonymous_variant	10554	exon4			AGGCCAGCCCGGC	U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.409C>T	6.37:g.32138303G>A		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	36.0	NM_006411	A2BFI5|Q5BL03	Silent	SNP	ENST00000395499.1	37	CCDS4744.1																																																																																			.		0.652	AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411	
AKR1E2	83592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	4879675	4879675	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr10:4879675G>A	ENST00000298375.7	+	5	555	c.484G>A	c.(484-486)Ggg>Agg	p.G162R	AKR1E2_ENST00000334019.4_Missense_Mutation_p.G162R|AKR1E2_ENST00000345253.5_Intron|AKR1E2_ENST00000532248.1_Missense_Mutation_p.G162R|AKR1E2_ENST00000525281.1_3'UTR	NM_001040177.2	NP_001035267.1	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	162						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	1,5-anhydro-D-fructose reductase activity (GO:0050571)			NS(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)	15						GGTGATCACCGGGCTGGTGAA	0.507																																					p.G162R	NSCLC(43;343 1097 20371 28813 45509)	.											.	AKR1E2	68	0			c.G484A						.						101.0	95.0	97.0					10																	4879675		2203	4300	6503	SO:0001583	missense	83592	exon5			ATCACCGGGCTGG	AB040820	CCDS31134.1, CCDS59210.1, CCDS59209.1	10p15.2	2009-09-09	2009-09-09	2009-09-09	ENSG00000165568	ENSG00000165568		"""Aldo-keto reductases"""	23437	protein-coding gene	gene with protein product			"""aldo-keto reductase family 1, member C-like 2"""	AKRDC1, AKR1CL2			Standard	NM_001271021		Approved	MGC10612	uc001ihi.4	Q96JD6	OTTHUMG00000017577	ENST00000298375.7:c.484G>A	10.37:g.4879675G>A	ENSP00000298375:p.Gly162Arg	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	41.0	NM_001040177	Q86Z16|Q86Z17|Q86Z18|Q9BU71	Missense_Mutation	SNP	ENST00000298375.7	37	CCDS31134.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.513869	0.44763	.	.	ENSG00000165568	ENST00000462718;ENST00000533295;ENST00000298375;ENST00000532248;ENST00000334019	D;T;T;T	0.87809	-2.3;-0.72;-0.72;-0.72	4.2	3.27	0.37495	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	D	0.94578	0.8253	H	0.94222	3.51	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95052	0.8188	10	0.72032	D	0.01	.	11.5482	0.50706	0.0:0.0:0.8199:0.1801	.	123;162;162;162	B7Z7K2;Q96JD6-2;Q96JD6;Q96JD6-3	.;.;AKCL2_HUMAN;.	R	58;166;162;162;162	ENSP00000435436:G166R;ENSP00000298375:G162R;ENSP00000432947:G162R;ENSP00000335034:G162R	ENSP00000298375:G162R	G	+	1	0	AKR1E2	4869675	1.000000	0.71417	0.557000	0.28306	0.012000	0.07955	6.848000	0.75409	1.314000	0.45095	0.455000	0.32223	GGG	.		0.507	AKR1E2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046520.4	NM_031436	
AOAH	313	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	36571897	36571897	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:36571897G>T	ENST00000258749.5	-	17	1759	c.1360C>A	c.(1360-1362)Ctc>Atc	p.L454I	AOAH_ENST00000431169.1_Missense_Mutation_p.L454I|AOAH_ENST00000491444.1_5'UTR|AOAH_ENST00000538464.1_Missense_Mutation_p.L176I|AOAH_ENST00000535891.1_Missense_Mutation_p.L422I	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	454					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						CTCACCTGGAGGCAGTTCAGG	0.522																																					p.L454I		.											.	AOAH	91	0			c.C1360A						.						158.0	144.0	149.0					7																	36571897		2203	4300	6503	SO:0001583	missense	313	exon17			CCTGGAGGCAGTT	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.1360C>A	7.37:g.36571897G>T	ENSP00000258749:p.Leu454Ile	Somatic	222.0	1.0		WXS	Illumina HiSeq	Phase_I	166.0	53.0	NM_001637	A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	37	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441064	0.83993	.	.	ENSG00000136250	ENST00000538464;ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647	T;T;T;T	0.15256	2.44;2.44;2.44;2.44	5.75	5.75	0.90469	Esterase, SGNH hydrolase-type (1);Lipase, GDSL (1);	0.212080	0.32386	N	0.006165	T	0.43919	0.1269	.	.	.	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.996	D;D;D	0.87578	0.998;0.934;0.953	T	0.10989	-1.0606	9	0.48119	T	0.1	.	17.2454	0.87026	0.0:0.0:1.0:0.0	.	422;454;454	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	I	176;422;454;454;454	ENSP00000439283:L176I;ENSP00000441101:L422I;ENSP00000258749:L454I;ENSP00000405683:L454I	ENSP00000258749:L454I	L	-	1	0	AOAH	36538422	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.740000	0.55082	2.894000	0.99253	0.655000	0.94253	CTC	.		0.522	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637	
ARFIP1	27236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	153750843	153750843	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:153750843G>A	ENST00000451320.2	+	2	222	c.58G>A	c.(58-60)Gaa>Aaa	p.E20K	ARFIP1_ENST00000356064.3_Missense_Mutation_p.E20K|ARFIP1_ENST00000405727.2_Missense_Mutation_p.E20K|ARFIP1_ENST00000429148.2_Missense_Mutation_p.E20K|ARFIP1_ENST00000353617.2_Missense_Mutation_p.E20K			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	20					intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)			ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TAGTAATGGAGAAGTTGATGA	0.358																																					p.E20K		.											.	ARFIP1	91	0			c.G58A						.						138.0	147.0	144.0					4																	153750843		2203	4300	6503	SO:0001583	missense	27236	exon2			AATGGAGAAGTTG	U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.58G>A	4.37:g.153750843G>A	ENSP00000395083:p.Glu20Lys	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	11.0	NM_001025593	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	37	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016254	0.75161	.	.	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	T;T;T;T	0.79653	-1.27;-1.27;-1.29;-1.29	5.65	5.65	0.86999	.	0.101764	0.64402	D	0.000003	D	0.85911	0.5807	L	0.46157	1.445	0.48762	D	0.999702	P;B;B	0.51057	0.941;0.026;0.191	P;B;B	0.60415	0.874;0.04;0.073	D	0.86316	0.1689	10	0.62326	D	0.03	-17.8338	18.4954	0.90863	0.0:0.0:1.0:0.0	.	20;20;20	B4DS69;Q2M2X4;P53367	.;.;ARFP1_HUMAN	K	20	ENSP00000395083:E20K;ENSP00000296557:E20K;ENSP00000384189:E20K;ENSP00000348360:E20K	ENSP00000296557:E20K	E	+	1	0	ARFIP1	153970293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.222000	0.58580	2.654000	0.90174	0.557000	0.71058	GAA	.		0.358	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447	
ARHGAP20	57569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	110477435	110477435	+	Nonsense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:110477435G>A	ENST00000260283.4	-	10	1098	c.814C>T	c.(814-816)Cga>Tga	p.R272*	ARHGAP20_ENST00000528829.1_Nonsense_Mutation_p.R236*|ARHGAP20_ENST00000533353.1_Nonsense_Mutation_p.R246*|ARHGAP20_ENST00000357139.3_Nonsense_Mutation_p.R246*|ARHGAP20_ENST00000524756.1_Nonsense_Mutation_p.R249*|ARHGAP20_ENST00000527598.1_Nonsense_Mutation_p.R236*	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	272	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GCAGAGTCTCGAAGATGGCTC	0.483																																					p.R272X		.											.	ARHGAP20	230	0			c.C814T						.						154.0	156.0	155.0					11																	110477435		2201	4298	6499	SO:0001587	stop_gained	57569	exon10			AGTCTCGAAGATG	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.814C>T	11.37:g.110477435G>A	ENSP00000260283:p.Arg272*	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	12.0	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Nonsense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	G	38	7.177823	0.98114	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	.	.	.	5.41	4.48	0.54585	.	0.058925	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3081	0.82856	0.0:0.1326:0.8673:0.0	.	.	.	.	X	272;246;249;236;246;236	.	ENSP00000260283:R272X	R	-	1	2	ARHGAP20	109982645	1.000000	0.71417	0.997000	0.53966	0.642000	0.38348	4.177000	0.58276	1.367000	0.46095	0.650000	0.86243	CGA	.		0.483	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
BCO2	83875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	112064703	112064703	+	Nonsense_Mutation	SNP	G	G	T	rs556041453		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:112064703G>T	ENST00000357685.5	+	4	754	c.619G>T	c.(619-621)Gaa>Taa	p.E207*	BCO2_ENST00000532593.1_Nonsense_Mutation_p.E102*|BCO2_ENST00000531169.1_Nonsense_Mutation_p.E173*|BCO2_ENST00000438022.1_Nonsense_Mutation_p.E173*|BCO2_ENST00000361053.4_Intron|BCO2_ENST00000526088.1_Nonsense_Mutation_p.E173*|AP002884.3_ENST00000532612.1_Intron|BCO2_ENST00000393032.2_Nonsense_Mutation_p.E173*			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	207					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						TGAAACTCTGGAAAAAACAGA	0.318																																					p.E207X	GBM(177;1916 2099 21049 29541 39946)	.											.	BCO2	68	0			c.G619T						.						74.0	71.0	72.0					11																	112064703		2201	4297	6498	SO:0001587	stop_gained	83875	exon4			ACTCTGGAAAAAA	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.619G>T	11.37:g.112064703G>T	ENSP00000350314:p.Glu207*	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	16.0	NM_031938	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Nonsense_Mutation	SNP	ENST00000357685.5	37	CCDS8358.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.372167|5.372167	0.95923|0.95923	.|.	.|.	ENSG00000197580|ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169|ENST00000530677	.|.	.|.	.|.	5.07|5.07	4.15|4.15	0.48705|0.48705	.|.	0.217660|.	0.46758|.	D|.	0.000269|.	.|T	.|0.66396	.|0.2785	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71873	.|-0.4461	.|3	0.72032|.	D|.	0.01|.	-14.2432|-14.2432	15.3094|15.3094	0.74019|0.74019	0.0:0.1493:0.8507:0.0|0.0:0.1493:0.8507:0.0	.|.	.|.	.|.	.|.	X|V	207;173;173;173;102;173|105	.|.	ENSP00000350314:E207X|.	E|G	+|+	1|2	0|0	BCO2|BCO2	111569913|111569913	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.940000|0.940000	0.58332|0.58332	4.305000|4.305000	0.59110|0.59110	1.106000|1.106000	0.41623|0.41623	0.563000|0.563000	0.77884|0.77884	GAA|GGA	.		0.318	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290	
BCORL1	63035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	129149866	129149866	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:129149866C>G	ENST00000218147.7	+	4	3315	c.3118C>G	c.(3118-3120)Ctt>Gtt	p.L1040V	BCORL1_ENST00000359304.2_Missense_Mutation_p.L1040V|BCORL1_ENST00000540052.1_Missense_Mutation_p.L1040V|BCORL1_ENST00000303743.5_Missense_Mutation_p.L1040V			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1040					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GCGCCCACAGCTTGGAAGCCA	0.582																																					p.L1040V		.											.	BCORL1	294	0			c.C3118G						.						71.0	61.0	65.0					X																	129149866		2203	4300	6503	SO:0001583	missense	63035	exon3			CCACAGCTTGGAA	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3118C>G	X.37:g.129149866C>G	ENSP00000218147:p.Leu1040Val	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	81.0	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.207|9.207	1.029862|1.029862	0.19512|0.19512	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000441294|ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	.|T;T;T;T;T	.|0.41758	.|1.0;1.37;0.99;1.0;1.44	5.05|5.05	4.18|4.18	0.49190|0.49190	.|.	.|0.000000	.|0.32868	.|N	.|0.005546	T|T	0.30070|0.30070	0.0753|0.0753	N|N	0.24115|0.24115	0.695|0.695	0.24437|0.24437	N|N	0.994542|0.994542	.|P;P	.|0.45474	.|0.859;0.801	.|P;B	.|0.47673	.|0.554;0.275	T|T	0.09509|0.09509	-1.0671|-1.0671	5|10	.|0.30854	.|T	.|0.27	-12.9564|-12.9564	4.3872|4.3872	0.11323|0.11323	0.0:0.6334:0.0:0.3666|0.0:0.6334:0.0:0.3666	.|.	.|1040;1040	.|Q5H9F3-2;Q5H9F3	.|.;BCORL_HUMAN	G|V	475|1040;1040;1040;1040;640	.|ENSP00000218147:L1040V;ENSP00000307541:L1040V;ENSP00000352253:L1040V;ENSP00000437775:L1040V;ENSP00000399483:L640V	.|ENSP00000218147:L1040V	A|L	+|+	2|1	0|0	BCORL1|BCORL1	128977547|128977547	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.418000|0.418000	0.31294|0.31294	2.400000|2.400000	0.44504|0.44504	2.097000|2.097000	0.63578|0.63578	0.529000|0.529000	0.55759|0.55759	GCT|CTT	.		0.582	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
BPIFA3	128861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31814775	31814775	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr20:31814775G>A	ENST00000375454.3	+	6	871	c.661G>A	c.(661-663)Gtg>Atg	p.V221M	BPIFA3_ENST00000375452.3_Missense_Mutation_p.V185M|BPIFA3_ENST00000490499.1_3'UTR	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	221						extracellular region (GO:0005576)	lipid binding (GO:0008289)										GCAGCTGGATGTGAAACTGTT	0.537																																					p.V221M		.											C20orf71,arm,malignant_melanoma,-2	.	.	0			c.G661A						.						139.0	132.0	135.0					20																	31814775		2203	4300	6503	SO:0001583	missense	128861	exon6			CTGGATGTGAAAC		CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.661G>A	20.37:g.31814775G>A	ENSP00000364603:p.Val221Met	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	18.0	NM_178466	Q5JWG8|Q6NZ38	Missense_Mutation	SNP	ENST00000375454.3	37	CCDS13216.2	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409226	0.62399	.	.	ENSG00000131059	ENST00000375454;ENST00000375452	T;T	0.04654	3.58;3.58	4.02	4.02	0.46733	.	0.000000	0.41194	D	0.000931	T	0.11537	0.0281	L	0.29908	0.895	0.31907	N	0.615221	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.995	T	0.00870	-1.1533	10	0.72032	D	0.01	-21.3752	11.9596	0.53001	0.0:0.0:1.0:0.0	.	185;221	Q9BQP9-2;Q9BQP9	.;BPIA3_HUMAN	M	221;185	ENSP00000364603:V221M;ENSP00000364601:V185M	ENSP00000364601:V185M	V	+	1	0	BPIFA3	31278436	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.665000	0.54532	2.538000	0.85594	0.462000	0.41574	GTG	.		0.537	BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466	
C1QTNF2	114898	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	159781851	159781851	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:159781851C>T	ENST00000393975.3	-	2	306	c.303G>A	c.(301-303)atG>atA	p.M101I		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	56	Collagen-like.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCGTCCCATCATTCCTGAGG	0.667																																					p.M101I		.											.	C1QTNF2	91	0			c.G303A						.						25.0	22.0	23.0					5																	159781851		2203	4299	6502	SO:0001583	missense	114898	exon2			TCCCATCATTCCT	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.303G>A	5.37:g.159781851C>T	ENSP00000377545:p.Met101Ile	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	29.0	NM_031908		Missense_Mutation	SNP	ENST00000393975.3	37	CCDS4351.2	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719452	0.30503	.	.	ENSG00000145861	ENST00000393975	D	0.91295	-2.82	5.16	4.29	0.51040	.	0.553935	0.20174	N	0.097675	T	0.80924	0.4717	N	0.20881	0.62	0.22127	N	0.999342	B	0.11235	0.004	B	0.15870	0.014	T	0.65372	-0.6184	10	0.25751	T	0.34	.	4.9414	0.13967	0.1702:0.6538:0.0:0.176	.	56	Q9BXJ5	C1QT2_HUMAN	I	101	ENSP00000377545:M101I	ENSP00000377545:M101I	M	-	3	0	C1QTNF2	159714429	0.685000	0.27652	1.000000	0.80357	0.962000	0.63368	-0.038000	0.12144	1.157000	0.42530	0.313000	0.20887	ATG	.		0.667	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
CACNA1E	777	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	181452992	181452992	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:181452992G>T	ENST00000367573.2	+	1	112	c.112G>T	c.(112-114)Gcc>Tcc	p.A38S	CACNA1E_ENST00000357570.5_5'UTR|CACNA1E_ENST00000360108.3_Missense_Mutation_p.A38S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.A38S|CACNA1E_ENST00000526775.1_Missense_Mutation_p.A38S|CACNA1E_ENST00000358338.5_5'UTR|CACNA1E_ENST00000367567.4_5'UTR	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	38					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCAGGCGGCCGCCTACAAGCA	0.652																																					p.A38S		.											.	CACNA1E	95	0			c.G112T						.						51.0	59.0	56.0					1																	181452992		1883	4084	5967	SO:0001583	missense	777	exon1			GCGGCCGCCTACA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.112G>T	1.37:g.181452992G>T	ENSP00000356545:p.Ala38Ser	Somatic	202.0	1.0		WXS	Illumina HiSeq	Phase_I	198.0	79.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687429	0.68157	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000360108;ENST00000367573	D;D;D;D;D	0.97186	-4.28;-3.93;-3.9;-3.9;-3.93	5.67	4.76	0.60689	.	0.000000	0.64402	D	0.000002	D	0.92561	0.7637	N	0.17082	0.46	0.80722	D	1	B	0.15473	0.013	B	0.17098	0.017	D	0.88852	0.3320	10	0.35671	T	0.21	.	12.6171	0.56584	0.0805:0.0:0.9195:0.0	.	38	Q15878-3	.	S	38	ENSP00000432038:A38S;ENSP00000356542:A38S;ENSP00000434814:A38S;ENSP00000353222:A38S;ENSP00000356545:A38S	ENSP00000353222:A38S	A	+	1	0	CACNA1E	179719615	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	3.071000	0.50041	1.393000	0.46605	0.561000	0.74099	GCC	.		0.652	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CACNA2D2	9254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50415488	50415488	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:50415488C>T	ENST00000479441.1	-	15	1429	c.1430G>A	c.(1429-1431)gGc>gAc	p.G477D	CACNA2D2_ENST00000424201.2_Missense_Mutation_p.G477D|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.G477D|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.G477D|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.G408D|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.G477D|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.G477D|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.G477D			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	477					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGCCTCCTTGCCTGCCAGCAC	0.612																																					p.G477D		.											.	CACNA2D2	278	0			c.G1430A						.						106.0	93.0	98.0					3																	50415488		2203	4300	6503	SO:0001583	missense	9254	exon15			TCCTTGCCTGCCA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.1430G>A	3.37:g.50415488C>T	ENSP00000418081:p.Gly477Asp	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	32.0	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	37	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627259	0.66901	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.06687	3.28;3.27;3.27;3.28;3.28;3.27;3.27;3.28	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.12902	0.0313	L	0.36672	1.1	0.52501	D	0.999955	B;B	0.27013	0.051;0.166	B;B	0.37943	0.042;0.261	T	0.13176	-1.0519	10	0.40728	T	0.16	-21.7662	19.0208	0.92915	0.0:1.0:0.0:0.0	.	477;477	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	D	477;477;477;408;477;477;477;477	ENSP00000407393:G477D;ENSP00000404631:G477D;ENSP00000266039:G477D;ENSP00000354228:G408D;ENSP00000390526:G477D;ENSP00000378519:G477D;ENSP00000390329:G477D;ENSP00000418081:G477D	ENSP00000266039:G477D	G	-	2	0	CACNA2D2	50390492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.002000	0.70693	2.492000	0.84095	0.585000	0.79938	GGC	.		0.612	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
CCBE1	147372	broad.mit.edu;bcgsc.ca	37	18	57136703	57136703	+	Splice_Site	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr18:57136703A>T	ENST00000439986.4	-	4	438		c.e4+1		CCBE1_ENST00000398179.2_Splice_Site	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1						lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				TTCCCAACACACCCAGACAGT	0.512																																					.	NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)	.											.	CCBE1	93	0			c.400+2T>A						.						270.0	214.0	233.0					18																	57136703		2203	4300	6503	SO:0001630	splice_region_variant	147372	exon5			CAACACACCCAGA	AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.400+1T>A	18.37:g.57136703A>T		Somatic	180.0	1.0		WXS	Illumina HiSeq	Phase_I	182.0	8.0	NM_133459	Q6MZX5|Q86SS2|Q8TF19	Splice_Site	SNP	ENST00000439986.4	37	CCDS32838.1	.	.	.	.	.	.	.	.	.	.	A	15.76	2.929496	0.52759	.	.	ENSG00000183287	ENST00000439986	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7749	0.69724	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCBE1	55287683	1.000000	0.71417	0.992000	0.48379	0.325000	0.28411	8.923000	0.92808	2.130000	0.65690	0.528000	0.53228	.	.		0.512	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459	Intron
CCDC174	51244	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	14708391	14708391	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:14708391G>A	ENST00000383794.3	+	7	734	c.661G>A	c.(661-663)Gaa>Aaa	p.E221K	CCDC174_ENST00000303688.7_Missense_Mutation_p.E221K	NM_016474.4	NP_057558.3	Q6PII3	CC174_HUMAN	coiled-coil domain containing 174	221	Poly-Glu.					cytoplasm (GO:0005737)|nucleus (GO:0005634)											ATGGGAGGAAGAAGAAAGAGA	0.408																																					p.E221K		.											.	.	.	0			c.G661A						.						83.0	98.0	93.0					3																	14708391		2203	4300	6503	SO:0001583	missense	51244	exon7			GAGGAAGAAGAAA	AF151046	CCDS2620.2	3p25.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000154781	ENSG00000154781			28033	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 19"""	C3orf19		11042152	Standard	NM_016474		Approved	FLJ33839	uc003byw.3	Q6PII3	OTTHUMG00000129837	ENST00000383794.3:c.661G>A	3.37:g.14708391G>A	ENSP00000373304:p.Glu221Lys	Somatic	74.0	1.0		WXS	Illumina HiSeq	Phase_I	53.0	23.0	NM_016474	Q96CS5	Missense_Mutation	SNP	ENST00000383794.3	37	CCDS2620.2	.	.	.	.	.	.	.	.	.	.	G	27.7	4.853955	0.91355	.	.	ENSG00000154781	ENST00000383794;ENST00000303688;ENST00000285042	T;T	0.50277	0.83;0.75	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.56934	0.2019	L	0.39397	1.21	0.39313	D	0.965116	D	0.89917	1.0	D	0.87578	0.998	T	0.48670	-0.9015	10	0.05959	T	0.93	-6.9438	18.0146	0.89235	0.0:0.0:1.0:0.0	.	221	Q6PII3	CC019_HUMAN	K	221;221;124	ENSP00000373304:E221K;ENSP00000302344:E221K	ENSP00000285042:E124K	E	+	1	0	C3orf19	14683395	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	8.563000	0.90723	2.550000	0.86006	0.591000	0.81541	GAA	.		0.408	CCDC174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252077.2	NM_016474	
CCDC180	100499483	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	100105674	100105674	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:100105674C>G	ENST00000357054.1	+	33	3811	c.2876C>G	c.(2875-2877)tCc>tGc	p.S959C	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.S820C|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.S817C|CCDC180_ENST00000375202.2_Missense_Mutation_p.S820C			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	959						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GACATGGAGTCCTTCACAATC	0.423																																					p.S820C		.											.	.	.	0			c.C2459G						.						141.0	124.0	130.0					9																	100105674		2203	4300	6503	SO:0001583	missense	0	exon19			TGGAGTCCTTCAC	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2876C>G	9.37:g.100105674C>G	ENSP00000349562:p.Ser959Cys	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	6.0	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	37		.	.	.	.	.	.	.	.	.	.	C	16.48	3.135348	0.56828	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.13089	2.99;3.0;2.62;3.0	5.49	-0.913	0.10500	.	0.874303	0.09928	N	0.737591	T	0.15696	0.0378	N	0.19112	0.55	0.24518	N	0.994177	D;D;D	0.67145	0.995;0.996;0.995	P;P;P	0.61592	0.847;0.891;0.847	T	0.22836	-1.0205	10	0.56958	D	0.05	-2.8289	5.534	0.17001	0.0:0.3408:0.1489:0.5103	.	843;959;959	Q86Y65;B7ZMG3;Q9P1Z9	.;.;CI174_HUMAN	C	959;820;817;843;820	ENSP00000349562:S959C;ENSP00000364348:S820C;ENSP00000414000:S817C;ENSP00000434727:S820C	ENSP00000349562:S959C	S	+	2	0	C9orf174	99145495	0.797000	0.28877	0.994000	0.49952	0.776000	0.43924	-0.341000	0.07811	-0.129000	0.11620	-0.140000	0.14226	TCC	.		0.423	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
CHD1	1105	hgsc.bcm.edu;broad.mit.edu	37	5	98229286	98229286	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:98229286C>A	ENST00000284049.3	-	13	1974	c.1825G>T	c.(1825-1827)Gca>Tca	p.A609S		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	609	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CCTATAAATGCCCAATTTAGA	0.328																																					p.A609S		.											.	CHD1	274	0			c.G1825T						.						82.0	92.0	88.0					5																	98229286		2203	4300	6503	SO:0001583	missense	1105	exon13			TAAATGCCCAATT	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.1825G>T	5.37:g.98229286C>A	ENSP00000284049:p.Ala609Ser	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025195	0.93518	.	.	ENSG00000153922	ENST00000284049	D	0.92858	-3.12	5.41	5.41	0.78517	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.33346	U	0.005016	D	0.89476	0.6726	N	0.11870	0.19	0.80722	D	1	P	0.42123	0.771	P	0.48488	0.579	D	0.91279	0.5050	10	0.72032	D	0.01	.	19.1964	0.93690	0.0:1.0:0.0:0.0	.	609	O14646	CHD1_HUMAN	S	609	ENSP00000284049:A609S	ENSP00000284049:A609S	A	-	1	0	CHD1	98257186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.792000	0.85828	2.547000	0.85894	0.555000	0.69702	GCA	.		0.328	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
CHRNB2	1141	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	154543798	154543798	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:154543798C>A	ENST00000368476.3	+	5	763	c.499C>A	c.(499-501)Cag>Aag	p.Q167K		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	167					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	ATTTGACCAGCAGAACTGCAC	0.542																																					p.Q167K		.											.	CHRNB2	90	0			c.C499A						.						133.0	109.0	117.0					1																	154543798		2203	4300	6503	SO:0001583	missense	1141	exon5			GACCAGCAGAACT	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.499C>A	1.37:g.154543798C>A	ENSP00000357461:p.Gln167Lys	Somatic	274.0	0.0		WXS	Illumina HiSeq	Phase_I	278.0	16.0	NM_000748	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	37	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631225	0.87660	.	.	ENSG00000160716	ENST00000368476	D	0.84660	-1.88	4.38	4.38	0.52667	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94857	0.8338	H	0.97918	4.105	0.80722	D	1	D	0.65815	0.995	D	0.70227	0.968	D	0.96834	0.9613	10	0.87932	D	0	.	16.7273	0.85426	0.0:1.0:0.0:0.0	.	167	P17787	ACHB2_HUMAN	K	167	ENSP00000357461:Q167K	ENSP00000357461:Q167K	Q	+	1	0	CHRNB2	152810422	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.616000	0.83018	2.238000	0.73509	0.563000	0.77884	CAG	.		0.542	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
CILP2	148113	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19654087	19654087	+	Silent	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:19654087A>G	ENST00000291495.5	+	7	1093	c.1008A>G	c.(1006-1008)cgA>cgG	p.R336R	CILP2_ENST00000586018.1_Silent_p.R342R	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	336	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGGACAGGCGAGCTCATGGGT	0.657																																					p.R336R		.											.	CILP2	91	0			c.A1008G						.						40.0	46.0	44.0					19																	19654087		2203	4300	6503	SO:0001819	synonymous_variant	148113	exon7			CAGGCGAGCTCAT	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1008A>G	19.37:g.19654087A>G		Somatic	229.0	1.0		WXS	Illumina HiSeq	Phase_I	237.0	63.0	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	CCDS12405.1																																																																																			.		0.657	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
CLCN5	1184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49854827	49854827	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:49854827G>T	ENST00000307367.2	+	10	1880	c.1589G>T	c.(1588-1590)gGt>gTt	p.G530V	CLCN5_ENST00000376088.3_Missense_Mutation_p.G600V|CLCN5_ENST00000376091.3_Missense_Mutation_p.G600V|CLCN5_ENST00000376108.3_Missense_Mutation_p.G530V			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	530					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					GAACTGACTGGTGGCTTAGAA	0.498																																					p.G600V		.											.	CLCN5	132	0			c.G1799T						.						181.0	165.0	171.0					X																	49854827		2203	4300	6503	SO:0001583	missense	1184	exon13			TGACTGGTGGCTT	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1589G>T	X.37:g.49854827G>T	ENSP00000304257:p.Gly530Val	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	29.0	NM_001127898	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	37	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455589	0.84209	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.95069	-3.6;-3.6;-3.6;-3.6	5.79	5.79	0.91817	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.98416	0.9473	H	0.97682	4.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99723	1.1010	10	0.87932	D	0	-2.6316	17.6718	0.88220	0.0:0.0:1.0:0.0	.	530;600	P51795;P51795-2	CLCN5_HUMAN;.	V	600;432;600;530;530	ENSP00000365256:G600V;ENSP00000365259:G600V;ENSP00000365276:G530V;ENSP00000304257:G530V	ENSP00000304257:G530V	G	+	2	0	CLCN5	49741567	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.705000	0.98719	2.445000	0.82738	0.600000	0.82982	GGT	.		0.498	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
CNTLN	54875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	17394764	17394764	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:17394764T>C	ENST00000380647.3	+	15	2396	c.2312T>C	c.(2311-2313)gTc>gCc	p.V771A	CNTLN_ENST00000425824.1_Missense_Mutation_p.V771A|CNTLN_ENST00000262360.5_Missense_Mutation_p.V771A			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	771					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GAGACAGAAGTCACTTCCCTG	0.398																																					p.V771A		.											.	CNTLN	91	0			c.T2312C						.						84.0	84.0	84.0					9																	17394764		1933	4150	6083	SO:0001583	missense	54875	exon15			CAGAAGTCACTTC	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2312T>C	9.37:g.17394764T>C	ENSP00000370021:p.Val771Ala	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	33.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	T	8.423	0.846840	0.17034	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.20200	2.09;2.09;2.35	5.77	5.77	0.91146	.	.	.	.	.	T	0.15522	0.0374	L	0.34521	1.04	0.30276	N	0.791744	P;P;P	0.46784	0.607;0.884;0.884	B;B;B	0.39503	0.224;0.301;0.301	T	0.04811	-1.0925	9	0.18710	T	0.47	.	11.1671	0.48550	0.0:0.0734:0.0:0.9266	.	771;771;771	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	A	771	ENSP00000370021:V771A;ENSP00000392798:V771A;ENSP00000262360:V771A	ENSP00000262360:V771A	V	+	2	0	CNTLN	17384764	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	3.291000	0.51764	2.201000	0.70794	0.528000	0.53228	GTC	.		0.398	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
CPB2	1361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	46638821	46638821	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:46638821G>A	ENST00000181383.4	-	8	774	c.758C>T	c.(757-759)aCa>aTa	p.T253I	CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000606243.1_RNA|CPB2-AS1_ENST00000415033.2_RNA|CPB2-AS1_ENST00000606351.1_RNA|CPB2_ENST00000439329.3_Missense_Mutation_p.T216I	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	253					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		ATTCAGGTCTGTTCCGATGCA	0.418																																					p.T253I		.											.	CPB2	92	0			c.C758T						.						187.0	155.0	166.0					13																	46638821		2203	4300	6503	SO:0001583	missense	1361	exon8			AGGTCTGTTCCGA	M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.758C>T	13.37:g.46638821G>A	ENSP00000181383:p.Thr253Ile	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	50.0	NM_001872	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	ENST00000181383.4	37	CCDS9401.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744899	0.69418	.	.	ENSG00000080618	ENST00000181383;ENST00000439329	T;T	0.28454	1.61;2.87	5.66	5.66	0.87406	Peptidase M14, carboxypeptidase A (3);	0.156175	0.64402	D	0.000018	T	0.55386	0.1917	M	0.65498	2.005	0.47778	D	0.99951	D;D	0.71674	0.99;0.998	P;D	0.68483	0.891;0.958	T	0.55598	-0.8116	10	0.66056	D	0.02	.	18.74	0.91770	0.0:0.0:1.0:0.0	.	216;253	Q96IY4-2;Q96IY4	.;CBPB2_HUMAN	I	253;216	ENSP00000181383:T253I;ENSP00000400714:T216I	ENSP00000181383:T253I	T	-	2	0	CPB2	45536822	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	4.447000	0.60020	2.662000	0.90505	0.650000	0.86243	ACA	.		0.418	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	NM_001872	
CTR9	9646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10796824	10796824	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:10796824C>A	ENST00000361367.2	+	23	3382	c.2956C>A	c.(2956-2958)Cca>Aca	p.P986T		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	986	Lys-rich.				cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AAAACGACGTCCACCAAAAGC	0.383																																					p.P986T		.											.	CTR9	92	0			c.C2956A						.						110.0	103.0	106.0					11																	10796824		2201	4294	6495	SO:0001583	missense	9646	exon23			CGACGTCCACCAA	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2956C>A	11.37:g.10796824C>A	ENSP00000355013:p.Pro986Thr	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	20.0	NM_014633	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	C	1.046	-0.677318	0.03378	.	.	ENSG00000198730	ENST00000361367	T	0.40476	1.03	5.55	1.37	0.22104	.	0.267927	0.43747	N	0.000540	T	0.22437	0.0541	N	0.14661	0.345	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.16719	-1.0393	10	0.25751	T	0.34	-0.1623	9.6251	0.39746	0.3591:0.5773:0.0:0.0636	.	986	Q6PD62	CTR9_HUMAN	T	986	ENSP00000355013:P986T	ENSP00000355013:P986T	P	+	1	0	CTR9	10753400	0.027000	0.19231	0.339000	0.25562	0.025000	0.11179	0.815000	0.27253	0.276000	0.22118	-0.244000	0.11960	CCA	.		0.383	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633	
CTSK	1513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	150778408	150778408	+	Nonsense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:150778408C>A	ENST00000271651.3	-	4	438	c.328G>T	c.(328-330)Gaa>Taa	p.E110*	CTSK_ENST00000480670.1_5'UTR	NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K	110					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCTTCCCATTCTGGGATATAA	0.448																																					p.E110X		.											.	CTSK	91	0			c.G328T						.						122.0	117.0	119.0					1																	150778408		2203	4300	6503	SO:0001587	stop_gained	1513	exon4			CCCATTCTGGGAT	BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.328G>T	1.37:g.150778408C>A	ENSP00000271651:p.Glu110*	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	59.0	NM_000396	Q6FHS6	Nonsense_Mutation	SNP	ENST00000271651.3	37	CCDS969.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590290	0.46214	.	.	ENSG00000143387	ENST00000271651;ENST00000443913	.	.	.	5.52	4.59	0.56863	.	0.251846	0.44285	D	0.000478	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	13.7444	0.62865	0.1551:0.8449:0.0:0.0	.	.	.	.	X	110;169	.	ENSP00000271651:E110X	E	-	1	0	CTSK	149045032	0.874000	0.30092	0.980000	0.43619	0.023000	0.10783	1.766000	0.38491	1.440000	0.47531	0.655000	0.94253	GAA	.		0.448	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084732.1	NM_000396	
DNMT1	1786	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10248624	10248624	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:10248624C>T	ENST00000340748.4	-	35	4364	c.4129G>A	c.(4129-4131)Gtg>Atg	p.V1377M	DNMT1_ENST00000540357.1_Missense_Mutation_p.V1377M|DNMT1_ENST00000359526.4_Missense_Mutation_p.V1393M|DNMT1_ENST00000589538.1_5'Flank			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1377	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CCATTCCGCACCTCCGGCAGG	0.627																																					p.V1393M		.											.	DNMT1	660	0			c.G4177A						.						58.0	44.0	49.0					19																	10248624		2203	4300	6503	SO:0001583	missense	1786	exon36			TCCGCACCTCCGG	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.4129G>A	19.37:g.10248624C>T	ENSP00000345739:p.Val1377Met	Somatic	138.0	1.0		WXS	Illumina HiSeq	Phase_I	157.0	56.0	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524852	0.44969	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	D;D;D	0.84223	-1.82;-1.82;-1.82	5.27	-0.627	0.11541	.	0.165025	0.52532	D	0.000074	D	0.87378	0.6162	M	0.72118	2.19	0.29340	N	0.866089	P;P;P	0.44877	0.745;0.845;0.589	P;P;P	0.51615	0.546;0.546;0.675	D	0.84421	0.0571	10	0.87932	D	0	.	13.0757	0.59085	0.0:0.0823:0.0:0.9177	.	1377;1393;1377	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	M	1393;1377;1377;1245	ENSP00000352516:V1393M;ENSP00000440457:V1377M;ENSP00000345739:V1377M	ENSP00000345739:V1377M	V	-	1	0	DNMT1	10109624	1.000000	0.71417	0.961000	0.40146	0.030000	0.12068	1.591000	0.36665	-0.776000	0.04578	-0.140000	0.14226	GTG	.		0.627	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
DVL2	1856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7131298	7131298	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:7131298C>A	ENST00000005340.5	-	10	1382	c.1100G>T	c.(1099-1101)cGa>cTa	p.R367L	DVL2_ENST00000574642.1_5'Flank|DVL2_ENST00000575458.1_Missense_Mutation_p.R361L	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	367					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						TCACTCACTTCGGGGGAGAGT	0.642																																					p.R367L		.											.	DVL2	659	0			c.G1100T						.						37.0	38.0	37.0					17																	7131298		2203	4300	6503	SO:0001583	missense	1856	exon10			TCACTTCGGGGGA	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1100G>T	17.37:g.7131298C>A	ENSP00000005340:p.Arg367Leu	Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	51.0	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	37	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.719943	0.89205	.	.	ENSG00000004975	ENST00000005340	T	0.06371	3.31	4.89	4.89	0.63831	PDZ/DHR/GLGF (1);	0.065725	0.64402	D	0.000007	T	0.30448	0.0765	M	0.91459	3.21	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71870	0.975;0.975	T	0.12760	-1.0535	10	0.59425	D	0.04	-17.7923	13.4054	0.60911	0.0:1.0:0.0:0.0	.	361;367	B4DLQ0;O14641	.;DVL2_HUMAN	L	367	ENSP00000005340:R367L	ENSP00000005340:R367L	R	-	2	0	DVL2	7072022	1.000000	0.71417	0.995000	0.50966	0.679000	0.39708	7.651000	0.83577	2.552000	0.86080	0.655000	0.94253	CGA	.		0.642	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
EPB41L1	2036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34773213	34773213	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr20:34773213C>T	ENST00000338074.2	+	7	902	c.741C>T	c.(739-741)acC>acT	p.T247T	EPB41L1_ENST00000441639.1_Silent_p.T185T|EPB41L1_ENST00000373950.2_Silent_p.T150T|EPB41L1_ENST00000373946.3_Silent_p.T216T|EPB41L1_ENST00000373941.1_Silent_p.T247T|EPB41L1_ENST00000202028.5_Silent_p.T185T	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	247	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CTAACCAGACCCGGGAGCTGG	0.592																																					p.T247T		.											.	EPB41L1	93	0			c.C741T						.						48.0	46.0	47.0					20																	34773213		2203	4300	6503	SO:0001819	synonymous_variant	2036	exon8			CCAGACCCGGGAG	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.741C>T	20.37:g.34773213C>T		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	13.0	NM_001258329	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	37	CCDS13271.1																																																																																			.		0.592	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
EPRS	2058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220193425	220193425	+	Silent	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:220193425T>C	ENST00000366923.3	-	10	1523	c.1254A>G	c.(1252-1254)ccA>ccG	p.P418P		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	418	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CCCAAATATATGGTTTTCTTA	0.388																																					p.P418P		.											.	EPRS	92	0			c.A1254G						.						166.0	160.0	162.0					1																	220193425		2203	4300	6503	SO:0001819	synonymous_variant	2058	exon10			AATATATGGTTTT	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.1254A>G	1.37:g.220193425T>C		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	23.0	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	ENST00000366923.3	37	CCDS31027.1																																																																																			.		0.388	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
ESYT1	23344	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56526103	56526103	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:56526103C>T	ENST00000394048.5	+	8	1235	c.971C>T	c.(970-972)tCc>tTc	p.S324F	RP11-603J24.5_ENST00000550947.1_RNA|ESYT1_ENST00000541590.1_Missense_Mutation_p.S324F|ESYT1_ENST00000267113.4_Missense_Mutation_p.S324F	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	324	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CAGTTGCGTTCCCCTCTGCCC	0.542																																					p.S324F		.											.	ESYT1	95	0			c.C971T						.						234.0	196.0	209.0					12																	56526103		2203	4300	6503	SO:0001583	missense	23344	exon8			TGCGTTCCCCTCT	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.971C>T	12.37:g.56526103C>T	ENSP00000377612:p.Ser324Phe	Somatic	186.0	1.0		WXS	Illumina HiSeq	Phase_I	158.0	48.0	NM_015292	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	37	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825024	0.32237	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.56611	0.45;0.48;0.48	5.52	5.52	0.82312	C2 calcium/lipid-binding domain, CaLB (1);	0.049602	0.85682	D	0.000000	T	0.57770	0.2076	N	0.20881	0.62	0.80722	D	1	D;B	0.89917	1.0;0.264	D;B	0.80764	0.994;0.05	T	0.46898	-0.9158	10	0.09843	T	0.71	-19.1035	18.5815	0.91172	0.0:1.0:0.0:0.0	.	324;324	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	F	324;278;324;324	ENSP00000377612:S324F;ENSP00000267113:S324F;ENSP00000445952:S324F	ENSP00000267113:S324F	S	+	2	0	ESYT1	54812370	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.667000	0.54547	2.769000	0.95229	0.563000	0.77884	TCC	.		0.542	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
EXD3	54932	hgsc.bcm.edu;bcgsc.ca	37	9	140247082	140247082	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:140247082G>T	ENST00000340951.4	-	11	1222	c.1027C>A	c.(1027-1029)Ctc>Atc	p.L343I	EXD3_ENST00000342129.4_Missense_Mutation_p.L23I	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						CTCCCCTGGAGCCTGAACCGG	0.701																																					p.L343I		.											.	EXD3	90	0			c.C1027A						.						4.0	6.0	6.0					9																	140247082		1738	3751	5489	SO:0001583	missense	54932	exon11			CCTGGAGCCTGAA		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.1027C>A	9.37:g.140247082G>T	ENSP00000340474:p.Leu343Ile	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_017820	Q6P1M1|Q8IXT8	Missense_Mutation	SNP	ENST00000340951.4	37	CCDS48066.1	.	.	.	.	.	.	.	.	.	.	G	7.327	0.618228	0.14129	.	.	ENSG00000187609	ENST00000342129;ENST00000340951	T;T	0.66460	-0.21;0.59	3.69	0.263	0.15602	.	0.735839	0.12406	N	0.471684	T	0.51024	0.1650	L	0.53249	1.67	0.09310	N	1	P;B	0.35745	0.518;0.158	B;B	0.32533	0.147;0.018	T	0.37478	-0.9704	10	0.30854	T	0.27	.	1.741	0.02952	0.1129:0.1746:0.3572:0.3554	.	23;343	Q8N9H8-3;Q8N9H8	.;MUT7_HUMAN	I	23;343	ENSP00000343705:L23I;ENSP00000340474:L343I	ENSP00000340474:L343I	L	-	1	0	EXD3	139366903	0.003000	0.15002	0.009000	0.14445	0.001000	0.01503	-0.126000	0.10563	0.163000	0.19507	-0.350000	0.07774	CTC	.		0.701	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	NM_017820	
FAM46D	169966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	79698451	79698451	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:79698451G>A	ENST00000308293.5	+	3	652	c.413G>A	c.(412-414)tGc>tAc	p.C138Y	FAM46D_ENST00000538312.1_Missense_Mutation_p.C138Y	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	138										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						GTCAAGGTTTGCAATGGGCAT	0.378																																					p.C138Y		.											.	FAM46D	130	0			c.G413A						.						119.0	114.0	116.0					X																	79698451		2203	4298	6501	SO:0001583	missense	169966	exon5			AGGTTTGCAATGG	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.413G>A	X.37:g.79698451G>A	ENSP00000308575:p.Cys138Tyr	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	7.0	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	37	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	G	0.250	-1.007247	0.02112	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.24723	1.84;1.84	4.38	3.48	0.39840	Domain of unknown function DUF1693 (1);	0.123552	0.56097	D	0.000027	T	0.19886	0.0478	L	0.58101	1.795	0.33804	D	0.627047	P	0.34864	0.473	B	0.31812	0.136	T	0.12041	-1.0563	10	0.08179	T	0.78	-7.5637	9.7805	0.40645	0.0:0.4204:0.5796:0.0	.	138	Q8NEK8	FA46D_HUMAN	Y	138	ENSP00000443410:C138Y;ENSP00000308575:C138Y	ENSP00000308575:C138Y	C	+	2	0	FAM46D	79585107	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	2.639000	0.46570	2.025000	0.59659	0.538000	0.68166	TGC	.		0.378	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
FBXL3	26224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	77589641	77589641	+	Silent	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:77589641A>T	ENST00000355619.5	-	4	870	c.546T>A	c.(544-546)acT>acA	p.T182T	FBXL3_ENST00000477982.1_5'UTR	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	182					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		CATCTACTGGAGTATCATCTA	0.393																																					p.T182T		.											.	FBXL3	226	0			c.T546A						.						135.0	121.0	125.0					13																	77589641		2203	4300	6503	SO:0001819	synonymous_variant	26224	exon4			TACTGGAGTATCA	AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.546T>A	13.37:g.77589641A>T		Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	38.0	NM_012158	B2RB04|Q9P122	Silent	SNP	ENST00000355619.5	37	CCDS9457.1																																																																																			.		0.393	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045312.3		
FGD2	221472	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	36979514	36979514	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:36979514C>T	ENST00000274963.8	+	4	582	c.411C>T	c.(409-411)cgC>cgT	p.R137R		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	137	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						AGACAGCCCGCAGCAGCAAGG	0.577																																					p.R137R		.											.	FGD2	229	0			c.C411T						.						136.0	111.0	119.0					6																	36979514		2203	4300	6503	SO:0001819	synonymous_variant	221472	exon4			AGCCCGCAGCAGC	AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.411C>T	6.37:g.36979514C>T		Somatic	145.0	1.0		WXS	Illumina HiSeq	Phase_I	147.0	40.0	NM_173558	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Silent	SNP	ENST00000274963.8	37	CCDS4829.1																																																																																			.		0.577	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	
FOXP4	116113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41566660	41566660	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:41566660G>A	ENST00000307972.4	+	16	2041	c.2029G>A	c.(2029-2031)Gaa>Aaa	p.E677K	FOXP4_ENST00000409208.1_Missense_Mutation_p.E665K|MIR4641_ENST00000578353.1_RNA|FOXP4_ENST00000373060.1_Missense_Mutation_p.E677K|FOXP4_ENST00000373057.3_Missense_Mutation_p.E675K|FOXP4_ENST00000373063.3_Missense_Mutation_p.E664K			Q8IVH2	FOXP4_HUMAN	forkhead box P4	677					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GCTGCCGGGAGAAGAACTGTC	0.692																																					p.E677K		.											.	FOXP4	289	0			c.G2029A						.						25.0	30.0	28.0					6																	41566660		2203	4298	6501	SO:0001583	missense	116113	exon17			CCGGGAGAAGAAC	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.2029G>A	6.37:g.41566660G>A	ENSP00000309823:p.Glu677Lys	Somatic	275.0	0.0		WXS	Illumina HiSeq	Phase_I	258.0	89.0	NM_001012426	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	37	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271378	0.80469	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	D;D;D;D;D	0.91945	-2.92;-2.93;-2.94;-2.92;-2.92	4.36	4.36	0.52297	.	0.135315	0.46442	D	0.000292	D	0.93822	0.8024	L	0.60455	1.87	0.58432	D	0.999999	D;D;D	0.63880	0.993;0.993;0.993	D;D;D	0.68192	0.956;0.956;0.956	D	0.94431	0.7649	10	0.87932	D	0	.	15.206	0.73180	0.0:0.0:1.0:0.0	.	664;675;677	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	K	677;664;665;675;677	ENSP00000362151:E677K;ENSP00000362154:E664K;ENSP00000386958:E665K;ENSP00000362148:E675K;ENSP00000309823:E677K	ENSP00000309823:E677K	E	+	1	0	FOXP4	41674638	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.578000	0.74032	2.435000	0.82474	0.462000	0.41574	GAA	.		0.692	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457	
FRMD3	257019	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	85863364	85863364	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:85863364G>A	ENST00000304195.3	-	14	1469	c.1263C>T	c.(1261-1263)gcC>gcT	p.A421A	FRMD3_ENST00000376434.1_Silent_p.A227A|FRMD3_ENST00000465485.1_5'UTR|FRMD3_ENST00000328788.1_Silent_p.A78A|FRMD3_ENST00000376438.1_Silent_p.A421A	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	421						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						CATACTCCCGGGCTGCCTTCA	0.433																																					p.A421A		.											.	FRMD3	91	0			c.C1263T						.						71.0	71.0	71.0					9																	85863364		1845	4102	5947	SO:0001819	synonymous_variant	257019	exon14			CTCCCGGGCTGCC	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1263C>T	9.37:g.85863364G>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	14.0	NM_174938	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Silent	SNP	ENST00000304195.3	37	CCDS43840.1																																																																																			.		0.433	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157355.1	NM_174938	
FZR1	51343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3522996	3522996	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:3522996G>A	ENST00000395095.3	+	1	9	c.9G>A	c.(7-9)caG>caA	p.Q3Q	SNORD38_ENST00000516599.1_RNA|FZR1_ENST00000313639.8_Silent_p.Q3Q|FZR1_ENST00000441788.2_Silent_p.Q3Q	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	3					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCATGGACCAGGACTATGAGC	0.692																																					p.Q3Q		.											.	FZR1	227	0			c.G9A						.						70.0	72.0	72.0					19																	3522996		2203	4297	6500	SO:0001819	synonymous_variant	51343	exon1			GGACCAGGACTAT	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.9G>A	19.37:g.3522996G>A		Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	66.0	NM_001136197	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Silent	SNP	ENST00000395095.3	37	CCDS45916.1																																																																																			.		0.692	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
GAB3	139716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153940659	153940659	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:153940659G>A	ENST00000369575.3	-	4	942	c.911C>T	c.(910-912)tCc>tTc	p.S304F	GAB3_ENST00000424127.2_Missense_Mutation_p.S305F|GAB3_ENST00000496390.1_Intron	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	304					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGGAGTGTTGGACATAATGTC	0.488																																					p.S305F		.											.	GAB3	227	0			c.C914T						.						139.0	127.0	131.0					X																	153940659		2203	4300	6503	SO:0001583	missense	139716	exon4			GTGTTGGACATAA	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.911C>T	X.37:g.153940659G>A	ENSP00000358588:p.Ser304Phe	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	95.0	NM_001081573	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	37	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461877	0.26248	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.21932	1.98;1.98;1.98	5.63	1.8	0.24995	.	0.378282	0.28376	N	0.015571	T	0.22936	0.0554	M	0.72118	2.19	0.09310	N	1	P;P;P	0.46395	0.877;0.877;0.877	P;P;P	0.45037	0.467;0.467;0.467	T	0.16364	-1.0405	10	0.54805	T	0.06	-0.1214	3.4229	0.07400	0.1424:0.1349:0.5809:0.1418	.	305;305;304	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	F	304;305;305	ENSP00000358588:S304F;ENSP00000358581:S305F;ENSP00000399588:S305F	ENSP00000358581:S305F	S	-	2	0	GAB3	153593853	0.022000	0.18835	0.000000	0.03702	0.489000	0.33432	0.867000	0.27968	-0.070000	0.12908	0.506000	0.49869	TCC	.		0.488	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
GRM7	2917	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	7620716	7620716	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:7620716G>T	ENST00000357716.4	+	8	2397	c.2123G>T	c.(2122-2124)aGt>aTt	p.S708I	GRM7_ENST00000486284.1_Missense_Mutation_p.S708I|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000403881.1_Missense_Mutation_p.S708I|GRM7_ENST00000389336.4_Missense_Mutation_p.S708I|GRM7_ENST00000402647.2_Missense_Mutation_p.S708I	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	708					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						ATCACTTCCAGTTTAATATCA	0.418																																					p.S708I		.											.	GRM7	526	0			c.G2123T						.						126.0	110.0	116.0					3																	7620716		2203	4300	6503	SO:0001583	missense	2917	exon8			CTTCCAGTTTAAT	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2123G>T	3.37:g.7620716G>T	ENSP00000350348:p.Ser708Ile	Somatic	360.0	2.0		WXS	Illumina HiSeq	Phase_I	321.0	93.0	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270679	0.23221	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23	6.17	5.3	0.74995	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.86439	0.5933	N	0.19112	0.55	0.58432	D	0.999994	B;D;D;D;B	0.76494	0.071;0.997;0.999;0.996;0.013	B;D;D;D;B	0.87578	0.115;0.994;0.998;0.99;0.02	T	0.81892	-0.0724	10	0.02654	T	1	.	15.7571	0.78043	0.0:0.0:0.8625:0.1375	.	708;708;463;708;708	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	I	708	ENSP00000350348:S708I;ENSP00000417536:S708I;ENSP00000373987:S708I;ENSP00000385664:S708I;ENSP00000384585:S708I	ENSP00000350348:S708I	S	+	2	0	GRM7	7595716	1.000000	0.71417	0.999000	0.59377	0.168000	0.22595	6.636000	0.74299	1.602000	0.50124	0.655000	0.94253	AGT	.		0.418	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
GNAI2	2771	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	50273847	50273847	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:50273847G>T	ENST00000313601.6	+	1	464	c.80G>T	c.(79-81)gGa>gTa	p.G27V	GNAI2_ENST00000422163.1_Intron|GNAI2_ENST00000536647.1_5'UTR|GNAI2_ENST00000491100.1_Intron|GNAI2_ENST00000440628.1_5'Flank	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	27					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		CGGGAGGACGGAGAGAAGGCG	0.667																																					p.G27V		.											.	GNAI2	417	0			c.G80T						.						86.0	87.0	87.0					3																	50273847		2202	4300	6502	SO:0001583	missense	2771	exon1			AGGACGGAGAGAA	X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.80G>T	3.37:g.50273847G>T	ENSP00000312999:p.Gly27Val	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	41.0	NM_002070	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	ENST00000313601.6	37	CCDS2813.1	.	.	.	.	.	.	.	.	.	.	G	35	5.591748	0.96590	.	.	ENSG00000114353	ENST00000313601;ENST00000540560	D	0.88277	-2.36	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.93530	0.7935	M	0.89478	3.035	0.80722	D	1	P	0.43542	0.81	P	0.50825	0.651	D	0.94677	0.7862	10	0.87932	D	0	.	16.2417	0.82411	0.0:0.0:1.0:0.0	.	27	P04899	GNAI2_HUMAN	V	27	ENSP00000312999:G27V	ENSP00000312999:G27V	G	+	2	0	GNAI2	50248851	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.227000	0.95236	2.413000	0.81919	0.650000	0.86243	GGA	.		0.667	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070	
GTF3C1	2975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	27549250	27549250	+	Splice_Site	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:27549250T>A	ENST00000356183.4	-	4	624		c.e4-2		GTF3C1_ENST00000561623.1_Splice_Site	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa						5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCATCAACCCTGGAGGAAAAG	0.448																																					.		.											.	GTF3C1	94	0			c.609-2A>T						.						64.0	63.0	63.0					16																	27549250		2197	4300	6497	SO:0001630	splice_region_variant	2975	exon5			CAACCCTGGAGGA	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.609-2A>T	16.37:g.27549250T>A		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	26.0	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Splice_Site	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.416940	0.62511	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6229	0.76820	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTF3C1	27456751	1.000000	0.71417	0.975000	0.42487	0.517000	0.34286	7.421000	0.80204	2.164000	0.68074	0.460000	0.39030	.	.		0.448	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	Intron
HMGCR	3156	hgsc.bcm.edu;broad.mit.edu	37	5	74651016	74651017	+	In_Frame_Ins	INS	-	-	CAAGAC			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:74651016_74651017insCAAGAC	ENST00000287936.4	+	13	1855_1856	c.1699_1700insCAAGAC	c.(1699-1701)aat>aCAAGACat	p.567_567N>TRH	HMGCR_ENST00000343975.5_Intron|HMGCR_ENST00000511206.1_In_Frame_Ins_p.567_567N>TRH	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	567	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	GGCCAGCACCAATAGAGGCTGC	0.406																																					p.N567delinsTRH		.											.	HMGCR	227	0			c.1699_1700insCAAGAC						.																																			SO:0001652	inframe_insertion	3156	exon13			AGCACCAATAGAG		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	Exception_encountered	5.37:g.74651016_74651017insCAAGAC	ENSP00000287936:p.Asn567delinsThrArgHis	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	21.0	NM_000859	B7Z3Y9|Q8N190	In_Frame_Ins	INS	ENST00000287936.4	37	CCDS4027.1																																																																																			.		0.406	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
HMGCR	3156	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	74651018	74651018	+	Frame_Shift_Del	DEL	T	T	-			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:74651018delT	ENST00000287936.4	+	13	1857	c.1701delT	c.(1699-1701)aatfs	p.N567fs	HMGCR_ENST00000343975.5_Intron|HMGCR_ENST00000511206.1_Frame_Shift_Del_p.N567fs	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	567	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	CCAGCACCAATAGAGGCTGCA	0.413																																					p.N567fs		.											.	HMGCR	227	0			c.1701delT						.						59.0	56.0	57.0					5																	74651018		2203	4300	6503	SO:0001589	frameshift_variant	3156	exon13			CACCAATAGAGGC		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.1701delT	5.37:g.74651018delT	ENSP00000287936:p.Asn567fs	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	21.0	NM_000859	B7Z3Y9|Q8N190	Frame_Shift_Del	DEL	ENST00000287936.4	37	CCDS4027.1																																																																																			.		0.413	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	121431983	121431983	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:121431983A>G	ENST00000257555.6	+	4	956	c.730A>G	c.(730-732)Aga>Gga	p.R244G	HNF1A_ENST00000544413.1_Missense_Mutation_p.R244G|HNF1A_ENST00000543427.1_Missense_Mutation_p.R127G|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000402929.1_Missense_Mutation_p.R244G|HNF1A_ENST00000541395.1_Missense_Mutation_p.R244G|HNF1A_ENST00000400024.2_Missense_Mutation_p.R244G			P20823	HNF1A_HUMAN	HNF1 homeobox A	244			R -> G (in a hepatic adenoma sample; somatic mutation; expected to interfere with DNA binding). {ECO:0000269|PubMed:12355088}.		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R244G(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ATGCATCCAGAGAGGGGTGTC	0.602									Hepatic Adenoma, Familial Clustering of																												p.R244G		.											HNF1A,NS,other,0	HNF1A	1745	2	Substitution - Missense(2)	liver(2)	c.A730G						.						34.0	35.0	35.0					12																	121431983		2203	4300	6503	SO:0001583	missense	6927	exon4	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	ATCCAGAGAGGGG	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.730A>G	12.37:g.121431983A>G	ENSP00000257555:p.Arg244Gly	Somatic	150.0	1.0		WXS	Illumina HiSeq	Phase_I	163.0	46.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	A	35	5.423542	0.96111	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.95622	-3.76;-3.76;-3.76;-3.76	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97151	0.9069	M	0.70595	2.14	0.54753	D	0.999986	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.85130	0.997;0.995;0.994;0.969	D	0.97740	1.0208	10	0.87932	D	0	-35.8616	13.6279	0.62178	1.0:0.0:0.0:0.0	.	244;244;244;244	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	G	244;244;244;244;244;127;244;244;244;244;244	ENSP00000257555:R244G;ENSP00000439721:R127G;ENSP00000443112:R244G;ENSP00000438804:R244G	ENSP00000257555:R244G	R	+	1	2	HNF1A	119916366	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.421000	0.44688	1.820000	0.53075	0.335000	0.21663	AGA	.		0.602	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	121434162	121434162	+	Frame_Shift_Del	DEL	G	G	-			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:121434162delG	ENST00000257555.6	+	5	1279	c.1053delG	c.(1051-1053)gtgfs	p.V351fs	HNF1A_ENST00000544413.1_Frame_Shift_Del_p.V351fs|HNF1A_ENST00000543427.1_Frame_Shift_Del_p.V234fs|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000402929.1_Frame_Shift_Del_p.V351fs|HNF1A_ENST00000541395.1_Frame_Shift_Del_p.V351fs|HNF1A_ENST00000400024.2_Frame_Shift_Del_p.V351fs			P20823	HNF1A_HUMAN	HNF1 homeobox A	351					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCCACCAAGTGTCCCCCACGG	0.582									Hepatic Adenoma, Familial Clustering of																												p.V351fs		.											.	HNF1A	1745	0			c.1053delG	GRCh37	CD064655	HNF1A	D		.						107.0	95.0	99.0					12																	121434162		2203	4300	6503	SO:0001589	frameshift_variant	6927	exon5	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	CCAAGTGTCCCCC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1053delG	12.37:g.121434162delG	ENSP00000257555:p.Val351fs	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	29.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Del	DEL	ENST00000257555.6	37	CCDS9209.1																																																																																			.		0.582	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNF1A	6927	hgsc.bcm.edu;bcgsc.ca	37	12	121434164	121434164	+	Missense_Mutation	SNP	C	C	T	rs151344538		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:121434164C>T	ENST00000257555.6	+	5	1281	c.1055C>T	c.(1054-1056)tCc>tTc	p.S352F	HNF1A_ENST00000544413.1_Missense_Mutation_p.S352F|HNF1A_ENST00000543427.1_Missense_Mutation_p.S235F|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000402929.1_Missense_Mutation_p.S352F|HNF1A_ENST00000541395.1_Missense_Mutation_p.S352F|HNF1A_ENST00000400024.2_Missense_Mutation_p.S352F			P20823	HNF1A_HUMAN	HNF1 homeobox A	352					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACCAAGTGTCCCCCACGGGC	0.587									Hepatic Adenoma, Familial Clustering of																												p.S352F		.											.	HNF1A	1745	0			c.C1055T						.						106.0	95.0	98.0					12																	121434164		2203	4300	6503	SO:0001583	missense	6927	exon5	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	AAGTGTCCCCCAC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1055C>T	12.37:g.121434164C>T	ENSP00000257555:p.Ser352Phe	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	29.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934898	0.73442	.	.	ENSG00000135100	ENST00000257555;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.98862	-5.19;-5.19;-5.19;-5.19	5.06	5.06	0.68205	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.000000	0.64402	D	0.000002	D	0.99017	0.9664	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.965	D;D;D;P	0.97110	1.0;1.0;1.0;0.734	D	0.99873	1.1099	10	0.87932	D	0	-20.899	17.4803	0.87671	0.0:1.0:0.0:0.0	.	352;352;352;352	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	F	352;352;352;352;235;352;352;352;352;352	ENSP00000257555:S352F;ENSP00000439721:S235F;ENSP00000443112:S352F;ENSP00000438804:S352F	ENSP00000257555:S352F	S	+	2	0	HNF1A	119918547	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	2.980000	0.49321	2.373000	0.80994	0.638000	0.83543	TCC	.		0.587	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNRNPA3	220988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	178081416	178081416	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:178081416G>T	ENST00000392524.2	+	6	893	c.656G>T	c.(655-657)gGa>gTa	p.G219V	HNRNPA3_ENST00000435711.1_Missense_Mutation_p.G219V|HNRNPA3_ENST00000411529.2_Missense_Mutation_p.G197V			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	219	Gly-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						CGTGGAGGTGGATCTGGCAAT	0.463																																					p.G219V		.											.	HNRNPA3	70	0			c.G656T						.						140.0	143.0	142.0					2																	178081416		2203	4300	6503	SO:0001583	missense	220988	exon6			GAGGTGGATCTGG	AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.656G>T	2.37:g.178081416G>T	ENSP00000376309:p.Gly219Val	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	31.0	NM_194247	D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	ENST00000392524.2	37	CCDS2273.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257085	0.59321	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711;ENST00000432457	D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72	4.42	4.42	0.53409	.	0.000000	0.46442	D	0.000296	D	0.91818	0.7411	M	0.91249	3.19	0.80722	D	1	B;B	0.34015	0.232;0.435	B;B	0.27170	0.077;0.077	D	0.92471	0.5985	10	0.45353	T	0.12	.	17.3931	0.87437	0.0:0.0:1.0:0.0	.	197;219	B4DDB6;P51991	.;ROA3_HUMAN	V	219;197;197;197;219;27	ENSP00000376309:G219V;ENSP00000408487:G197V;ENSP00000416340:G219V;ENSP00000400688:G27V	ENSP00000376309:G219V	G	+	2	0	HNRNPA3	177789662	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.215000	0.77966	2.197000	0.70478	0.551000	0.68910	GGA	.		0.463	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255729.3	NM_194247	
HYDIN	54768	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	71019100	71019100	+	Missense_Mutation	SNP	G	G	C	rs540834594		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:71019100G>C	ENST00000393567.2	-	28	4470	c.4320C>G	c.(4318-4320)atC>atG	p.I1440M		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1440					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ACACAGGCAGGATTAGTGGCA	0.512																																					p.I1440M		.											.	HYDIN	92	0			c.C4320G						.						26.0	28.0	27.0					16																	71019100		1844	4078	5922	SO:0001583	missense	54768	exon28			AGGCAGGATTAGT	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4320C>G	16.37:g.71019100G>C	ENSP00000377197:p.Ile1440Met	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	26.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171475	0.57584	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01025	5.43	4.75	2.33	0.28932	.	0.294671	0.18485	U	0.139833	T	0.03136	0.0092	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	D	0.65010	0.931	T	0.54827	-0.8235	10	0.45353	T	0.12	.	7.1106	0.25388	0.1259:0.1983:0.6758:0.0	.	1439	F8WD23	.	M	1440;1439	ENSP00000377197:I1440M	ENSP00000313052:I1439M	I	-	3	3	HYDIN	69576601	0.605000	0.26941	0.852000	0.33557	0.213000	0.24496	0.344000	0.19962	0.435000	0.26365	0.609000	0.83330	ATC	.		0.512	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IBSP	3381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88732684	88732684	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:88732684C>T	ENST00000226284.5	+	7	643	c.576C>T	c.(574-576)agC>agT	p.S192S		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	192					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		GCAACGGCAGCAGCGGAGGAG	0.522																																					p.S192S		.											.	IBSP	90	0			c.C576T						.						146.0	133.0	137.0					4																	88732684		2203	4300	6503	SO:0001819	synonymous_variant	3381	exon7			CGGCAGCAGCGGA		CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.576C>T	4.37:g.88732684C>T		Somatic	240.0	0.0		WXS	Illumina HiSeq	Phase_I	238.0	79.0	NM_004967		Silent	SNP	ENST00000226284.5	37	CCDS3624.1																																																																																			.		0.522	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
IGSF1	3547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	130408573	130408573	+	Splice_Site	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:130408573C>T	ENST00000361420.3	-	18	3830	c.3751G>A	c.(3751-3753)Ggg>Agg	p.G1251R	IGSF1_ENST00000370903.3_Splice_Site_p.G1256R|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370910.1_Splice_Site_p.G1242R|IGSF1_ENST00000370904.1_Splice_Site_p.G1242R			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1251					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ATTCTCTTACCTGCTGCCCCC	0.552																																					p.G1256R		.											.	IGSF1	133	0			c.G3766A						.						109.0	100.0	103.0					X																	130408573		2203	4300	6503	SO:0001630	splice_region_variant	3547	exon18			TCTTACCTGCTGC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3751+1G>A	X.37:g.130408573C>T		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	5.0	NM_001170961	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	37	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843851	0.51164	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.00705	5.82;5.82;5.82;5.81	5.42	5.42	0.78866	.	0.000000	0.48767	D	0.000176	T	0.02767	0.0083	L	0.48642	1.525	0.38767	D	0.954455	D;D;D	0.89917	0.958;1.0;1.0	P;D;D	0.87578	0.903;0.997;0.998	T	0.66221	-0.5978	9	.	.	.	.	13.7754	0.63050	0.0:1.0:0.0:0.0	.	1242;695;1251	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	R	1242;1251;1242;1256	ENSP00000359947:G1242R;ENSP00000355010:G1251R;ENSP00000359941:G1242R;ENSP00000359940:G1256R	.	G	-	1	0	IGSF1	130236254	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.509000	0.45459	2.410000	0.81850	0.594000	0.82650	GGG	.		0.552	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		Missense_Mutation
IL12RB2	3595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67833556	67833556	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:67833556A>G	ENST00000262345.1	+	10	1947	c.1307A>G	c.(1306-1308)aAc>aGc	p.N436S	IL12RB2_ENST00000371000.1_Missense_Mutation_p.N436S|IL12RB2_ENST00000544434.1_Missense_Mutation_p.N436S|IL12RB2_ENST00000541374.1_Missense_Mutation_p.N436S	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	436	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						GGCATGGACAACATTCTGGTG	0.517																																					p.N436S		.											.	IL12RB2	92	0			c.A1307G						.						130.0	121.0	124.0					1																	67833556		2203	4300	6503	SO:0001583	missense	3595	exon10			TGGACAACATTCT	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1307A>G	1.37:g.67833556A>G	ENSP00000262345:p.Asn436Ser	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	39.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	A	3.044	-0.196926	0.06259	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.02	-9.72	0.00515	Long hematopoietin receptor, Gp130 family 2, conserved site (1);Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.498590	0.03717	N	0.251221	T	0.06096	0.0158	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.001;0.003;0.003	T	0.17684	-1.0361	10	0.02654	T	1	0.1314	14.3573	0.66745	0.6539:0.0:0.3461:0.0	.	436;436;436;436	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	S	436	ENSP00000262345:N436S;ENSP00000360039:N436S;ENSP00000445276:N436S;ENSP00000442443:N436S	ENSP00000262345:N436S	N	+	2	0	IL12RB2	67606144	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.742000	0.01835	-2.245000	0.00705	-0.798000	0.03219	AAC	.		0.517	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
IPO7	10527	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	9450696	9450696	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:9450696T>A	ENST00000379719.3	+	14	1686	c.1544T>A	c.(1543-1545)gTg>gAg	p.V515E	SNORA23_ENST00000365128.1_RNA|CTD-2371O3.2_ENST00000531111.1_RNA	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	515					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CCTGTGAAAGTGGAAGCTGCC	0.388																																					p.V515E		.											.	IPO7	271	0			c.T1544A						.						85.0	82.0	83.0					11																	9450696		2201	4293	6494	SO:0001583	missense	10527	exon14			TGAAAGTGGAAGC	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1544T>A	11.37:g.9450696T>A	ENSP00000369042:p.Val515Glu	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	31.0	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	37	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.941537	0.92526	.	.	ENSG00000205339	ENST00000379719	T	0.65549	-0.16	5.95	5.95	0.96441	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85406	0.1134	10	0.87932	D	0	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	515	O95373	IPO7_HUMAN	E	515	ENSP00000369042:V515E	ENSP00000369042:V515E	V	+	2	0	IPO7	9407272	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	GTG	.		0.388	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
IRS2	8660	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	110437992	110437992	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:110437992G>A	ENST00000375856.3	-	1	923	c.409C>T	c.(409-411)Cgc>Tgc	p.R137C		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	137	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GTGAGCGCGCGGTACCAGCCC	0.756																																					p.R137C	Melanoma(100;613 2409 40847)	.											.	IRS2	1334	0			c.C409T						.						16.0	13.0	14.0					13																	110437992		2186	4284	6470	SO:0001583	missense	8660	exon1			GCGCGCGGTACCA	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.409C>T	13.37:g.110437992G>A	ENSP00000365016:p.Arg137Cys	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	12.0	NM_003749	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	37	CCDS9510.1	.	.	.	.	.	.	.	.	.	.	g	20.7	4.031136	0.75504	.	.	ENSG00000185950	ENST00000375856	T	0.76316	-1.01	3.39	3.39	0.38822	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.083411	0.49916	U	0.000137	D	0.86289	0.5897	M	0.73598	2.24	0.45366	D	0.998351	D	0.89917	1.0	D	0.74674	0.984	D	0.88089	0.2812	10	0.66056	D	0.02	-11.841	13.7503	0.62904	0.0:0.0:1.0:0.0	.	137	Q9Y4H2	IRS2_HUMAN	C	137	ENSP00000365016:R137C	ENSP00000365016:R137C	R	-	1	0	IRS2	109235993	0.991000	0.36638	1.000000	0.80357	0.992000	0.81027	1.617000	0.36943	1.747000	0.51819	0.487000	0.48397	CGC	.		0.756	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
KCNMB3	27094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	178968887	178968887	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:178968887T>C	ENST00000314235.5	-	1	516	c.5A>G	c.(4-6)gAc>gGc	p.D2G	KCNMB3_ENST00000392685.2_5'UTR|KCNMB3_ENST00000349697.2_Intron|KCNMB3_ENST00000485523.1_Intron|KCNMB3_ENST00000497599.1_Intron	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	2					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	TGGTGAAAAGTCCATCTAAAT	0.398																																					p.D2G		.											.	KCNMB3	90	0			c.A5G						.						117.0	115.0	116.0					3																	178968887		2203	4300	6503	SO:0001583	missense	27094	exon1			GAAAAGTCCATCT	AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.5A>G	3.37:g.178968887T>C	ENSP00000319370:p.Asp2Gly	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	26.0	NM_014407	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	ENST00000314235.5	37	CCDS3226.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.408948	0.62399	.	.	ENSG00000171121	ENST00000314235	T	0.11821	2.74	4.68	-0.481	0.12082	.	3.420860	0.01121	N	0.005798	T	0.07863	0.0197	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.35251	-0.9796	10	0.87932	D	0	.	4.1753	0.10349	0.0:0.2055:0.3848:0.4097	.	2	Q9NPA1	KCMB3_HUMAN	G	2	ENSP00000319370:D2G	ENSP00000319370:D2G	D	-	2	0	KCNMB3	180451581	0.001000	0.12720	0.001000	0.08648	0.058000	0.15608	-0.070000	0.11523	0.050000	0.15949	0.533000	0.62120	GAC	.		0.398	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348484.1		
KIAA0100	9703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26948494	26948494	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:26948494C>A	ENST00000528896.2	-	27	5056	c.4982G>T	c.(4981-4983)cGg>cTg	p.R1661L	KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1518L|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1518L|KIAA0100_ENST00000579924.2_5'Flank	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1661						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					ACTACGCTGCCGGTGCTCCTC	0.562																																					p.R1661L		.											.	KIAA0100	93	0			c.G4982T						.						86.0	79.0	81.0					17																	26948494		2203	4300	6503	SO:0001583	missense	9703	exon27			CGCTGCCGGTGCT	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.4982G>T	17.37:g.26948494C>A	ENSP00000436773:p.Arg1661Leu	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	21.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.719966	0.48728	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.23552	1.9;1.9	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.31358	0.0794	N	0.08118	0	0.80722	D	1	D	0.63880	0.993	D	0.74023	0.982	T	0.21724	-1.0237	10	0.26408	T	0.33	.	18.2554	0.90017	0.0:1.0:0.0:0.0	.	1661	Q14667	K0100_HUMAN	L	1661;1631;1661;1518	ENSP00000436773:R1661L;ENSP00000446443:R1518L	ENSP00000005905:R1661L	R	-	2	0	KIAA0100	23972621	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.277000	0.78572	2.826000	0.97356	0.491000	0.48974	CGG	.		0.562	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KIAA0408	9729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	127768213	127768213	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:127768213C>T	ENST00000483725.3	-	5	1587	c.1251G>A	c.(1249-1251)gaG>gaA	p.E417E	SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	417										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		GGCTACTGCTCTCTGCTACTG	0.413																																					p.E417E		.											.	KIAA0408	90	0			c.G1251A						.						67.0	69.0	68.0					6																	127768213		2202	4300	6502	SO:0001819	synonymous_variant	9729	exon5			ACTGCTCTCTGCT	AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.1251G>A	6.37:g.127768213C>T		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	5.0	NM_014702	B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Silent	SNP	ENST00000483725.3	37	CCDS34531.1																																																																																			.		0.413	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	NM_014702	
KIF25	3834	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	168439388	168439388	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:168439388A>G	ENST00000443060.2	+	6	864	c.473A>G	c.(472-474)gAg>gGg	p.E158G	KIF25_ENST00000351261.3_Missense_Mutation_p.E158G|KIF25_ENST00000354419.2_Missense_Mutation_p.E158G			Q9UIL4	KIF25_HUMAN	kinesin family member 25	158	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGACGGACAGAGGTTGCGCTG	0.582																																					p.E158G		.											.	KIF25	92	0			c.A473G						.						105.0	94.0	98.0					6																	168439388		2203	4300	6503	SO:0001583	missense	3834	exon5			GGACAGAGGTTGC	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.473A>G	6.37:g.168439388A>G	ENSP00000388878:p.Glu158Gly	Somatic	279.0	2.0		WXS	Illumina HiSeq	Phase_I	246.0	71.0	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	A	17.91	3.503412	0.64298	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.72615	-0.67;-0.67;0.96	4.65	3.46	0.39613	Kinesin, motor domain (4);	0.573542	0.16918	N	0.194196	T	0.49389	0.1554	L	0.35341	1.055	0.26387	N	0.976632	D;P	0.54601	0.967;0.653	P;B	0.51657	0.676;0.348	T	0.37619	-0.9698	10	0.30854	T	0.27	-3.132	8.4327	0.32769	0.8257:0.0:0.0:0.1743	.	158;158	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	G	158	ENSP00000388878:E158G;ENSP00000346401:E158G;ENSP00000252688:E158G	ENSP00000252688:E158G	E	+	2	0	KIF25	168182237	1.000000	0.71417	0.108000	0.21378	0.007000	0.05969	2.909000	0.48758	0.606000	0.29965	0.533000	0.62120	GAG	.		0.582	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
KLHL1	57626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	70293586	70293586	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:70293586T>C	ENST00000377844.4	-	9	2689	c.1930A>G	c.(1930-1932)Aca>Gca	p.T644A	KLHL1_ENST00000545028.1_Missense_Mutation_p.T451A	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	644					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CCGTCACATGTGGCCACTCCG	0.453																																					p.T644A		.											.	KLHL1	90	0			c.A1930G						.						135.0	119.0	124.0					13																	70293586		2203	4300	6503	SO:0001583	missense	57626	exon9			CACATGTGGCCAC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1930A>G	13.37:g.70293586T>C	ENSP00000367075:p.Thr644Ala	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	32.0	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	37	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.042209	0.55003	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.77358	-1.09;-1.09	5.68	5.68	0.88126	Galactose oxidase, beta-propeller (1);	0.095038	0.46145	N	0.000305	T	0.60741	0.2292	N	0.01649	-0.78	0.42107	D	0.991367	B;B	0.28128	0.201;0.106	B;B	0.37346	0.247;0.085	T	0.66172	-0.5990	10	0.49607	T	0.09	.	15.9251	0.79609	0.0:0.0:0.0:1.0	.	644;644	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	A	644;451	ENSP00000367075:T644A;ENSP00000439602:T451A	ENSP00000367075:T644A	T	-	1	0	KLHL1	69191587	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.289000	0.72696	2.156000	0.67533	0.459000	0.35465	ACA	.		0.453	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
KLHL2	11275	ucsc.edu;bcgsc.ca	37	4	166220662	166220662	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:166220662G>T	ENST00000226725.6	+	8	1034	c.775G>T	c.(775-777)Gtt>Ttt	p.V259F	KLHL2_ENST00000509028.1_3'UTR|KLHL2_ENST00000538127.1_Missense_Mutation_p.V171F|KLHL2_ENST00000514860.1_Missense_Mutation_p.V263F|KLHL2_ENST00000421009.2_Missense_Mutation_p.V162F|KLHL2_ENST00000506761.1_Missense_Mutation_p.V93F	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2	259					protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GTTACAGAGGGTTGAAGAGGA	0.393																																					p.V263F		.											.	KLHL2	226	0			c.G787T						.						106.0	99.0	101.0					4																	166220662		2203	4300	6503	SO:0001583	missense	11275	exon8			CAGAGGGTTGAAG	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.775G>T	4.37:g.166220662G>T	ENSP00000226725:p.Val259Phe	Somatic	62.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001161521	A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	Missense_Mutation	SNP	ENST00000226725.6	37	CCDS34094.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787917	0.90367	.	.	ENSG00000109466	ENST00000226725;ENST00000514860;ENST00000538127;ENST00000421009;ENST00000506761	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	5.87	5.87	0.94306	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.92123	0.7503	H	0.98111	4.15	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.993	D	0.94297	0.7534	10	0.87932	D	0	.	20.206	0.98277	0.0:0.0:1.0:0.0	.	263;259	B4DFH7;O95198	.;KLHL2_HUMAN	F	259;263;171;162;93	ENSP00000226725:V259F;ENSP00000424198:V263F;ENSP00000437526:V171F;ENSP00000408974:V162F;ENSP00000424108:V93F	ENSP00000226725:V259F	V	+	1	0	KLHL2	166440112	1.000000	0.71417	0.999000	0.59377	0.842000	0.47809	9.869000	0.99810	2.785000	0.95823	0.655000	0.94253	GTT	.		0.393	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1		
LGSN	51557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	63990465	63990465	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:63990465T>C	ENST00000370657.4	-	4	1024	c.991A>G	c.(991-993)Act>Gct	p.T331A	LGSN_ENST00000370658.5_Silent_p.A190A			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	331					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GTTCCAGAAGTGCTGCAGAAC	0.473																																					p.T331A		.											.	LGSN	227	0			c.A991G						.						87.0	88.0	88.0					6																	63990465		2203	4300	6503	SO:0001583	missense	51557	exon4			CAGAAGTGCTGCA	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.991A>G	6.37:g.63990465T>C	ENSP00000359691:p.Thr331Ala	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	25.0	NM_016571	A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	ENST00000370657.4	37	CCDS4964.1	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.487866	0.01018	.	.	ENSG00000146166	ENST00000370657	D	0.85171	-1.95	5.62	-0.412	0.12367	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.452483	0.29616	N	0.011657	T	0.59224	0.2178	.	.	.	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.55661	-0.8106	9	0.38643	T	0.18	-6.7024	10.7564	0.46239	0.0:0.7178:0.0:0.2822	.	331	Q5TDP6	LGSN_HUMAN	A	331	ENSP00000359691:T331A	ENSP00000359691:T331A	T	-	1	0	LGSN	64048424	0.367000	0.25023	0.007000	0.13788	0.001000	0.01503	1.721000	0.38032	-0.030000	0.13804	-0.250000	0.11733	ACT	.		0.473	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	NM_016571	
LMO7	4008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	76429476	76429476	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:76429476G>A	ENST00000321797.8	+	27	4764	c.4043G>A	c.(4042-4044)gGt>gAt	p.G1348D	LMO7_ENST00000377534.3_Intron|LMO7_ENST00000357063.3_Intron|LMO7_ENST00000526202.1_Missense_Mutation_p.G1225D|LMO7_ENST00000341547.4_Missense_Mutation_p.G1299D|LMO7_ENST00000465261.2_Intron			Q8WWI1	LMO7_HUMAN	LIM domain 7	1633					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GAGTCCCTGGGTCTTTGTTAT	0.493																																					p.G1299D		.											.	LMO7	586	0			c.G3896A						.						146.0	121.0	129.0					13																	76429476		2203	4300	6503	SO:0001583	missense	4008	exon28			CCCTGGGTCTTTG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.4043G>A	13.37:g.76429476G>A	ENSP00000317802:p.Gly1348Asp	Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	49.0	NM_005358	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.	.	.	.	.	.	.	.	.	.	G	32	5.117643	0.94385	.	.	ENSG00000136153	ENST00000341547;ENST00000321797;ENST00000526202	D;D;D	0.87256	-2.23;-2.23;-2.23	5.99	5.99	0.97316	.	0.159223	0.56097	D	0.000033	D	0.92811	0.7714	L	0.56396	1.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92382	0.5914	10	0.66056	D	0.02	-23.5131	20.4777	0.99188	0.0:0.0:1.0:0.0	.	1225;1299	E9PMS6;Q8WWI1-3	.;.	D	1299;1348;1225	ENSP00000342112:G1299D;ENSP00000317802:G1348D;ENSP00000431129:G1225D	ENSP00000317802:G1348D	G	+	2	0	LMO7	75327477	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GGT	.		0.493	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
LRP12	29967	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	105544164	105544164	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr8:105544164T>A	ENST00000276654.5	-	2	215	c.107A>T	c.(106-108)gAa>gTa	p.E36V	LRP12_ENST00000424843.2_Intron	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	36					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATGCACATTTTCAGAATGTTC	0.289																																					p.E36V		.											.	LRP12	90	0			c.A107T						.						73.0	79.0	77.0					8																	105544164		2203	4294	6497	SO:0001583	missense	29967	exon2			ACATTTTCAGAAT	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.107A>T	8.37:g.105544164T>A	ENSP00000276654:p.Glu36Val	Somatic	152.0	2.0		WXS	Illumina HiSeq	Phase_I	104.0	42.0	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936988	0.52972	.	.	ENSG00000147650	ENST00000276654;ENST00000523830	D	0.83837	-1.77	5.65	4.5	0.54988	.	0.129885	0.51477	D	0.000087	T	0.68467	0.3004	N	0.14661	0.345	0.80722	D	1	P	0.37466	0.596	B	0.34779	0.189	T	0.69558	-0.5113	10	0.62326	D	0.03	-19.9659	10.0008	0.41927	0.0:0.0761:0.0:0.9239	.	36	Q9Y561	LRP12_HUMAN	V	36	ENSP00000276654:E36V	ENSP00000276654:E36V	E	-	2	0	LRP12	105613340	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.896000	0.63222	0.991000	0.38814	0.460000	0.39030	GAA	.		0.289	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170055351	170055351	+	Silent	SNP	C	C	T	rs80338749		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:170055351C>T	ENST00000263816.3	-	45	8808	c.8523G>A	c.(8521-8523)ttG>ttA	p.L2841L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2841	LDL-receptor class A 19. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTCCGTCACACAAATAAACGC	0.373																																					p.L2841L		.											.	LRP2	175	0			c.G8523A						.						128.0	121.0	123.0					2																	170055351		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon45			GTCACACAAATAA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8523G>A	2.37:g.170055351C>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	27.0	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																			.		0.373	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRP8	7804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	53727742	53727742	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:53727742C>G	ENST00000306052.6	-	12	2013	c.1912G>C	c.(1912-1914)Gag>Cag	p.E638Q	LRP8_ENST00000460214.1_5'UTR|LRP8_ENST00000347547.2_Missense_Mutation_p.E468Q|LRP8_ENST00000354412.3_Missense_Mutation_p.E509Q|LRP8_ENST00000465675.1_Missense_Mutation_p.E191Q|LRP8_ENST00000371454.2_Missense_Mutation_p.E638Q	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	638					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						GGACTCACCTCAAACACAGCT	0.488																																					p.E638Q		.											.	LRP8	90	0			c.G1912C						.						85.0	77.0	80.0					1																	53727742		2203	4300	6503	SO:0001583	missense	7804	exon12			TCACCTCAAACAC	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1912G>C	1.37:g.53727742C>G	ENSP00000303634:p.Glu638Gln	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	76.0	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	C	33	5.239332	0.95240	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91	6.16	6.16	0.99307	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.	.	.	.	D	0.96728	0.8932	M	0.84773	2.715	0.80722	D	1	D;D;D;D;D;D	0.76494	0.995;0.997;0.991;0.999;0.997;0.995	D;D;D;D;D;D	0.80764	0.911;0.987;0.97;0.994;0.973;0.911	D	0.96343	0.9252	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	191;509;468;638;638;191	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	Q	638;638;191;509;468	ENSP00000303634:E638Q;ENSP00000360509:E638Q;ENSP00000437009:E191Q;ENSP00000346391:E509Q;ENSP00000334522:E468Q	ENSP00000303634:E638Q	E	-	1	0	LRP8	53500330	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.745000	0.85046	2.937000	0.99478	0.650000	0.86243	GAG	.		0.488	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	12	85518185	85518185	+	Nonsense_Mutation	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:85518185A>T	ENST00000393217.2	+	17	3956	c.3895A>T	c.(3895-3897)Aga>Tga	p.R1299*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1299										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		ATGTCAGAAGAGAGAAGACAG	0.413																																					p.R1299X		.											.	LRRIQ1	95	0			c.A3895T						.						165.0	178.0	173.0					12																	85518185		2203	4300	6503	SO:0001587	stop_gained	84125	exon17			CAGAAGAGAGAAG	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3895A>T	12.37:g.85518185A>T	ENSP00000376910:p.Arg1299*	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	27.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	38	7.261921	0.98171	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.39	5.39	0.77823	.	1.220000	0.06013	N	0.649856	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5212	0.44920	0.8562:0.0:0.0:0.1438	.	.	.	.	X	1299;1274;1299	.	ENSP00000256007:R1299X	R	+	1	2	LRRIQ1	84042316	0.017000	0.18338	0.002000	0.10522	0.011000	0.07611	1.182000	0.32029	2.043000	0.60533	0.482000	0.46254	AGA	.		0.413	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	85554390	85554390	+	Splice_Site	SNP	G	G	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:85554390G>C	ENST00000393217.2	+	24	4781		c.e24-1		LRRIQ1_ENST00000528777.3_Splice_Site	NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GTTTTGTTTAGATTCCACTGT	0.343																																					.		.											.	LRRIQ1	95	0			c.4721-1G>C						.						113.0	102.0	105.0					12																	85554390		1822	4093	5915	SO:0001630	splice_region_variant	84125	exon24			TGTTTAGATTCCA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4721-1G>C	12.37:g.85554390G>C		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	23.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Splice_Site	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436600	0.25813	.	.	ENSG00000133640	ENST00000393217	.	.	.	4.76	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4921	0.67657	0.0:0.0:0.8517:0.1483	.	.	.	.	.	-1	.	.	.	+	.	.	LRRIQ1	84078521	1.000000	0.71417	0.995000	0.50966	0.417000	0.31264	4.755000	0.62198	1.083000	0.41159	0.650000	0.86243	.	.		0.343	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	Intron
LSP1	4046	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	1888129	1888129	+	Intron	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:1888129A>G	ENST00000311604.3	+	2	228				LSP1_ENST00000405957.2_5'Flank|AC051649.12_ENST00000509204.1_RNA|LSP1_ENST00000381775.1_Missense_Mutation_p.N142S	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1						cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		CCCAGCACCAACTGCAGCCCC	0.697																																					p.N142S		.											.	LSP1	90	0			c.A425G						.																																			SO:0001627	intron_variant	4046	exon2			GCACCAACTGCAG	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.54-13188A>G	11.37:g.1888129A>G		Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	6.0	NM_001242932	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	ENST00000311604.3	37	CCDS31334.1	.	.	.	.	.	.	.	.	.	.	a	4.034	0.003817	0.07866	.	.	ENSG00000130592	ENST00000381775	T	0.24538	1.85	2.09	-4.18	0.03846	.	0.283763	0.17926	U	0.157346	T	0.11750	0.0286	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11792	-1.0573	9	0.39692	T	0.17	0.9007	0.9247	0.01322	0.1687:0.2826:0.3303:0.2183	.	142	E9PFP3	.	S	142	ENSP00000371194:N142S	ENSP00000371194:N142S	N	+	2	0	LSP1	1844705	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	0.380000	0.20602	-1.632000	0.01541	-0.608000	0.04076	AAC	.		0.697	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034045.3	NM_002339	
METTL21A	151194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	208478154	208478154	+	Silent	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:208478154A>T	ENST00000411432.1	-	4	489	c.273T>A	c.(271-273)acT>acA	p.T91T	METTL21A_ENST00000448823.2_3'UTR|METTL21A_ENST00000406927.2_Silent_p.T91T|METTL21A_ENST00000458426.1_Intron|METTL21A_ENST00000425132.1_Intron|METTL21A_ENST00000426075.1_Silent_p.T91T|METTL21A_ENST00000272839.3_Silent_p.T109T|METTL21A_ENST00000477919.1_5'Flank|METTL21A_ENST00000448007.2_Silent_p.T91T|METTL21A_ENST00000442521.1_Silent_p.T91T|METTL21A_ENST00000432416.1_Intron	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	91					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						GATCCGTGATAGTCACATGAG	0.378																																					p.T91T		.											.	METTL21A	69	0			c.T273A						.						68.0	61.0	63.0					2																	208478154		2203	4300	6503	SO:0001819	synonymous_variant	151194	exon4			CGTGATAGTCACA	AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.273T>A	2.37:g.208478154A>T		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_145280	Q53RV0|Q8N1Z9|Q96GH6	Silent	SNP	ENST00000411432.1	37	CCDS2376.1																																																																																			.		0.378	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337044.1	NM_145280	
MGAT3	4248	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	39884425	39884425	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr22:39884425C>T	ENST00000341184.6	+	2	1288	c.1073C>T	c.(1072-1074)aCc>aTc	p.T358I		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	358					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					CAGCCGGGCACCCTGGAGGTG	0.637																																					p.T358I		.											.	MGAT3	90	0			c.C1073T						.						58.0	66.0	64.0					22																	39884425		2202	4299	6501	SO:0001583	missense	4248	exon2			CGGGCACCCTGGA	D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.1073C>T	22.37:g.39884425C>T	ENSP00000345270:p.Thr358Ile	Somatic	85.0	1.0		WXS	Illumina HiSeq	Phase_I	108.0	30.0	NM_002409	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	ENST00000341184.6	37	CCDS13994.2	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960352	0.53400	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.37	4.34	0.51931	.	0.126104	0.52532	D	0.000073	T	0.49592	0.1566	L	0.44542	1.39	0.40482	D	0.980459	P	0.34864	0.473	B	0.31812	0.136	T	0.49184	-0.8966	9	0.33141	T	0.24	.	16.2207	0.82257	0.0:0.867:0.133:0.0	.	358	Q09327	MGAT3_HUMAN	I	358	.	ENSP00000345270:T358I	T	+	2	0	MGAT3	38214371	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.681000	0.54648	1.251000	0.43983	0.561000	0.74099	ACC	.		0.637	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075039.2	NM_002409	
EIF4A2	1974	ucsc.edu;mdanderson.org	37	3	186504557	186504557	+	Intron	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:186504557A>G	ENST00000323963.5	+	7	835				SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA|EIF4A2_ENST00000440191.2_Intron|RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363548.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000356531.5_Intron			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		CAAGAAGAAAAGTAACAGCAC	0.373			T	BCL6	NHL																																.		.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	.	.	0			.						.						90.0	83.0	85.0					3																	186504557		1568	3582	5150	SO:0001627	intron_variant	100302143	.			AAGAAAAGTAACA	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.771+123A>G	3.37:g.186504557A>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	.	36.0	14.0	.	D3DNU9|Q53XJ6|Q96B90|Q96EA8	RNA	SNP	ENST00000323963.5	37	CCDS3282.1																																																																																			.		0.373	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
MRPL53	116540	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	74699251	74699251	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:74699251G>A	ENST00000258105.7	-	3	995	c.334C>T	c.(334-336)Cgc>Tgc	p.R112C	MRPL53_ENST00000409710.1_3'UTR	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	112						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						CGCTGTCAGCGACCAGTATCA	0.552																																					p.R112C		.											.	MRPL53	90	0			c.C334T						.						45.0	51.0	49.0					2																	74699251		2196	4298	6494	SO:0001583	missense	116540	exon3			GTCAGCGACCAGT	BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.334C>T	2.37:g.74699251G>A	ENSP00000258105:p.Arg112Cys	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	10.0	NM_053050		Missense_Mutation	SNP	ENST00000258105.7	37	CCDS1944.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193251	0.58017	.	.	ENSG00000204822	ENST00000258105	T	0.53640	0.61	4.13	-1.01	0.10169	.	0.000000	0.50627	D	0.000115	T	0.26340	0.0643	L	0.29908	0.895	0.09310	N	0.999992	B	0.09022	0.002	B	0.04013	0.001	T	0.13575	-1.0504	10	0.87932	D	0	.	0.8064	0.01084	0.2903:0.1616:0.3822:0.1658	.	112	Q96EL3	RM53_HUMAN	C	112	ENSP00000258105:R112C	ENSP00000258105:R112C	R	-	1	0	MRPL53	74552759	0.510000	0.26171	0.000000	0.03702	0.007000	0.05969	2.273000	0.43381	-0.198000	0.10333	-0.149000	0.13747	CGC	.		0.552	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252225.2	NM_053050	
RNF123	63891	hgsc.bcm.edu;bcgsc.ca	37	3	49724207	49724207	+	5'Flank	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:49724207A>G	ENST00000327697.6	+	0	0				MST1_ENST00000383728.3_Missense_Mutation_p.Y178H|MST1_ENST00000545762.1_3'UTR|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000449682.2_Missense_Mutation_p.Y253H|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'UTR	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TTCCGGCAATAGTTGTCGTCC	0.627																																					p.Y253H		.											.	MST1	278	0			c.T757C						.						9.0	11.0	11.0					3																	49724207		2139	4203	6342	SO:0001631	upstream_gene_variant	4485	exon7			GGCAATAGTTGTC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49724207A>G	Exception_encountered	Somatic	425.0	0.0		WXS	Illumina HiSeq	Phase_I	436.0	73.0	NM_020998	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	A	35	5.430667	0.96150	.	.	ENSG00000173531	ENST00000449682;ENST00000383728	T;T	0.75704	-0.96;-0.96	5.75	5.75	0.90469	Kringle (5);Kringle-like fold (1);Kringle, conserved site (1);	0.478958	0.15547	N	0.256612	D	0.89979	0.6872	M	0.93420	3.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.994	D	0.91709	0.5380	10	0.87932	D	0	.	16.0663	0.80878	1.0:0.0:0.0:0.0	.	239;253	P26927;G3XAK1	HGFL_HUMAN;.	H	253;178	ENSP00000414287:Y253H;ENSP00000373234:Y178H	ENSP00000373234:Y178H	Y	-	1	0	MST1	49699211	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.046000	0.93817	2.201000	0.70794	0.533000	0.62120	TAT	.		0.627	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
MTMR1	8776	ucsc.edu;bcgsc.ca	37	X	149895739	149895739	+	Silent	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:149895739G>T	ENST00000370390.3	+	4	538	c.381G>T	c.(379-381)ctG>ctT	p.L127L	MTMR1_ENST00000451863.2_Silent_p.L127L|MTMR1_ENST00000544228.1_Silent_p.L127L|MTMR1_ENST00000542156.1_Silent_p.L127L|MTMR1_ENST00000445323.2_Silent_p.L135L|MTMR1_ENST00000541925.1_Silent_p.L33L|MTMR1_ENST00000538506.1_Silent_p.L14L	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	127	GRAM.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GTGGAACCCTGACAGTGACGG	0.368																																					p.L127L		.											.	MTMR1	131	0			c.G381T						.						155.0	128.0	137.0					X																	149895739		2203	4300	6503	SO:0001819	synonymous_variant	8776	exon4			AACCCTGACAGTG	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.381G>T	X.37:g.149895739G>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_003828	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Silent	SNP	ENST00000370390.3	37	CCDS14695.1																																																																																			.		0.368	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789	
MUC2	4583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1095258	1095258	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:1095258G>A	ENST00000441003.2	+	32	6105	c.6078G>A	c.(6076-6078)aaG>aaA	p.K2026K	MUC2_ENST00000361558.6_Silent_p.K164K|MUC2_ENST00000333592.6_3'UTR	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4388					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CGCCCTCCAAGTCGACGCCCA	0.612																																					p.K2022K		.											.	MUC2	90	0			c.G6066A						.						77.0	99.0	92.0					11																	1095258		2130	4223	6353	SO:0001819	synonymous_variant	4583	exon33			CTCCAAGTCGACG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6078G>A	11.37:g.1095258G>A		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	18.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.612	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MYO3B	140469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171260757	171260757	+	Splice_Site	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:171260757A>T	ENST00000408978.4	+	20	2421	c.2278A>T	c.(2278-2280)Atg>Ttg	p.M760L	MYO3B_ENST00000409044.3_Splice_Site_p.M760L|MYO3B_ENST00000334231.6_Splice_Site_p.M769L|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	760	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TTCCCTCCAGATGGAATATCA	0.498																																					p.M760L		.											.	MYO3B	530	0			c.A2278T						.						161.0	152.0	155.0					2																	171260757		1903	4118	6021	SO:0001630	splice_region_variant	140469	exon20			CTCCAGATGGAAT		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2278-1A>T	2.37:g.171260757A>T		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	28.0	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.902040	0.33628	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.47	1.64	0.23874	Myosin head, motor domain (2);	0.194685	0.64402	D	0.000003	T	0.45677	0.1354	N	0.08118	0	0.40675	D	0.982253	B;B;B	0.16603	0.007;0.007;0.018	B;B;B	0.19946	0.015;0.016;0.027	T	0.13442	-1.0509	9	.	.	.	.	9.7715	0.40591	0.7998:0.0:0.2002:0.0	.	760;760;760	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	L	760;760;759;769;769	ENSP00000386497:M760L;ENSP00000386213:M760L;ENSP00000446237:M769L;ENSP00000335100:M769L	.	M	+	1	0	MYO3B	170969003	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.201000	0.42734	0.097000	0.17492	0.533000	0.62120	ATG	.		0.498	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		Missense_Mutation
NANOG	79923	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7945627	7945627	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:7945627C>T	ENST00000229307.4	+	2	452	c.233C>T	c.(232-234)aCt>aTt	p.T78I	NANOG_ENST00000526286.1_Missense_Mutation_p.T78I	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	78					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		AAACAACCCACTTCTGCAGAG	0.473																																					p.T78I		.											.	NANOG	90	0			c.C233T						.						83.0	77.0	79.0					12																	7945627		2202	4295	6497	SO:0001583	missense	79923	exon2			AACCCACTTCTGC	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.233C>T	12.37:g.7945627C>T	ENSP00000229307:p.Thr78Ile	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	62.0	NM_024865	D3DUU4|Q2TTG0|Q6JZS5	Missense_Mutation	SNP	ENST00000229307.4	37	CCDS31736.1	.	.	.	.	.	.	.	.	.	.	.	13.57	2.275830	0.40294	.	.	ENSG00000111704	ENST00000541267;ENST00000229307;ENST00000526286	D;D;D	0.91686	-2.88;-2.89;-2.88	4.42	-2.41	0.06562	Homeodomain-related (1);	2.536840	0.01075	N	0.004894	D	0.85566	0.5726	L	0.29908	0.895	0.09310	N	1	P	0.43885	0.82	B	0.42555	0.391	T	0.75566	-0.3273	10	0.39692	T	0.17	5.0072	0.335	0.00325	0.274:0.3064:0.1421:0.2775	.	78	Q9H9S0	NANOG_HUMAN	I	54;78;78	ENSP00000444434:T54I;ENSP00000229307:T78I;ENSP00000435288:T78I	ENSP00000229307:T78I	T	+	2	0	NANOG	7836894	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.390000	0.07332	-0.829000	0.04268	0.456000	0.33151	ACT	.		0.473	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387480.2	NM_024865	
NCKAP5	344148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	133489528	133489528	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:133489528G>T	ENST00000409261.1	-	17	5598	c.5225C>A	c.(5224-5226)cCa>cAa	p.P1742Q	NCKAP5_ENST00000473859.1_5'UTR|NCKAP5_ENST00000405974.3_Missense_Mutation_p.P423Q|NCKAP5_ENST00000317721.6_Missense_Mutation_p.P1742Q|NCKAP5_ENST00000409213.1_Missense_Mutation_p.P423Q	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1742										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGGGGAGTCTGGCTGGCATAG	0.557																																					p.P1742Q		.											.	.	.	0			c.C5225A						.						84.0	93.0	90.0					2																	133489528		2079	4212	6291	SO:0001583	missense	344148	exon17			GAGTCTGGCTGGC	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5225C>A	2.37:g.133489528G>T	ENSP00000387128:p.Pro1742Gln	Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	220.0	72.0	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	4.664	0.123478	0.08931	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.44083	2.98;0.93;2.98;0.93	5.2	3.35	0.38373	.	0.641465	0.11643	N	0.543605	T	0.19644	0.0472	N	0.04880	-0.145	0.20926	N	0.999821	B;B	0.20052	0.006;0.041	B;B	0.20384	0.004;0.029	T	0.29058	-1.0024	10	0.14252	T	0.57	.	6.5747	0.22560	0.0859:0.0:0.5052:0.4089	.	423;1742	O14513-2;O14513	.;NCKP5_HUMAN	Q	1742;423;1742;423;423	ENSP00000387128:P1742Q;ENSP00000386952:P423Q;ENSP00000380603:P1742Q;ENSP00000385692:P423Q	ENSP00000380603:P1742Q	P	-	2	0	NCKAP5	133205998	1.000000	0.71417	0.217000	0.23759	0.340000	0.28889	2.882000	0.48546	0.733000	0.32492	0.655000	0.94253	CCA	.		0.557	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
NDN	4692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	23931535	23931535	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr15:23931535T>C	ENST00000331837.4	-	1	915	c.830A>G	c.(829-831)gAg>gGg	p.E277G		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	277	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GGCCAGGAACTCCATGATTTG	0.592									Prader-Willi syndrome																												p.E277G		.											.	NDN	90	0			c.A830G						.						30.0	33.0	32.0					15																	23931535		2202	4300	6502	SO:0001583	missense	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	AGGAACTCCATGA	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.830A>G	15.37:g.23931535T>C	ENSP00000332643:p.Glu277Gly	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	12.0	NM_002487	B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	37	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.422619	0.43020	.	.	ENSG00000182636	ENST00000331837	T	0.03065	4.06	3.5	3.5	0.40072	.	0.285984	0.32190	N	0.006443	T	0.05456	0.0144	M	0.64567	1.98	0.43494	D	0.995736	B	0.16396	0.017	B	0.14578	0.011	T	0.14035	-1.0487	10	0.87932	D	0	.	8.7038	0.34343	0.0:0.0:0.0:1.0	.	277	Q99608	NECD_HUMAN	G	277	ENSP00000332643:E277G	ENSP00000332643:E277G	E	-	2	0	NDN	21482628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.254000	0.32897	1.832000	0.53329	0.459000	0.35465	GAG	.		0.592	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
NDUFV2	4729	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	9102767	9102767	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr18:9102767C>T	ENST00000318388.6	+	1	140	c.26C>T	c.(25-27)gCc>gTc	p.A9V	NDUFV2_ENST00000400033.1_5'Flank|RP11-21J18.1_ENST00000579126.1_RNA|NDUFV2_ENST00000497577.2_Missense_Mutation_p.A9V	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	9					cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|lung(4)|ovary(1)|stomach(1)	7						GCGCTCCGGGCCCGGGCGGCT	0.706																																					p.A9V		.											.	NDUFV2	91	0			c.C26T						.						6.0	8.0	7.0					18																	9102767		2125	4156	6281	SO:0001583	missense	4729	exon1			TCCGGGCCCGGGC	X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.26C>T	18.37:g.9102767C>T	ENSP00000327268:p.Ala9Val	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	16.0	NM_021074	Q9BV41	Missense_Mutation	SNP	ENST00000318388.6	37	CCDS11842.1	.	.	.	.	.	.	.	.	.	.	C	7.170	0.587450	0.13812	.	.	ENSG00000178127	ENST00000318388	T	0.46819	0.86	4.7	2.89	0.33648	.	.	.	.	.	T	0.30070	0.0753	N	0.22421	0.69	0.26272	N	0.978407	B	0.14438	0.01	B	0.09377	0.004	T	0.17745	-1.0359	9	0.33940	T	0.23	.	5.7902	0.18357	0.1899:0.7112:0.0:0.0988	.	9	P19404	NDUV2_HUMAN	V	9	ENSP00000327268:A9V	ENSP00000327268:A9V	A	+	2	0	NDUFV2	9092767	0.833000	0.29383	0.066000	0.19879	0.005000	0.04900	1.158000	0.31737	0.565000	0.29255	-0.150000	0.13652	GCC	.		0.706	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254475.2	NM_021074	
NR1I2	8856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	119526207	119526207	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:119526207G>T	ENST00000337940.4	+	2	275	c.227G>T	c.(226-228)gGt>gTt	p.G76V	NR1I2_ENST00000466380.1_Missense_Mutation_p.G37V|NR1I2_ENST00000393716.2_Missense_Mutation_p.G37V	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	37					drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	GAAGTCGGAGGTCCCCAAATC	0.502																																					p.G76V		.											.	NR1I2	188	0			c.G227T						.						152.0	141.0	145.0					3																	119526207		2203	4300	6503	SO:0001583	missense	8856	exon2			TCGGAGGTCCCCA	AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	ENST00000337940.4:c.227G>T	3.37:g.119526207G>T	ENSP00000336528:p.Gly76Val	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	50.0	NM_022002	Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Missense_Mutation	SNP	ENST00000337940.4	37	CCDS2995.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834346	0.32421	.	.	ENSG00000144852	ENST00000393716;ENST00000466380;ENST00000337940	D;D;D	0.91843	-2.89;-2.8;-2.92	4.21	3.24	0.37175	.	0.513929	0.17668	N	0.166070	T	0.81950	0.4931	N	0.19112	0.55	0.51233	D	0.999918	B;B	0.19445	0.015;0.036	B;B	0.16289	0.011;0.015	T	0.74856	-0.3522	10	0.25106	T	0.35	.	4.908	0.13807	0.2439:0.0:0.7561:0.0	.	76;60	F1D8P9;O75469-6	.;.	V	37;37;76	ENSP00000377319:G37V;ENSP00000420297:G37V;ENSP00000336528:G76V	ENSP00000336528:G76V	G	+	2	0	NR1I2	121008897	0.699000	0.27786	0.529000	0.27951	0.304000	0.27724	1.042000	0.30303	2.167000	0.68274	0.591000	0.81541	GGT	.		0.502	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355126.1		
NRG1	3084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	32621590	32621590	+	Silent	SNP	C	C	T	rs576124928		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr8:32621590C>T	ENST00000405005.3	+	12	1593	c.1593C>T	c.(1591-1593)taC>taT	p.Y531Y	NRG1_ENST00000338921.4_Silent_p.Y539Y|NRG1_ENST00000287845.5_Silent_p.Y502Y|NRG1_ENST00000356819.4_Silent_p.Y536Y|NRG1_ENST00000287842.3_Silent_p.Y528Y|NRG1_ENST00000539990.1_Silent_p.Y374Y|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000519301.1_Silent_p.Y481Y			Q02297	NRG1_HUMAN	neuregulin 1	531					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCCAAGAGTACGAGCCAGCCC	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16851	0.0		0.0	False		,,,				2504	0.0				p.Y536Y		.											.	NRG1	525	0			c.C1608T						.						59.0	54.0	56.0					8																	32621590		2203	4300	6503	SO:0001819	synonymous_variant	3084	exon13			AGAGTACGAGCCA	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1593C>T	8.37:g.32621590C>T		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	29.0	NM_013956	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	ENST00000405005.3	37	CCDS6085.1																																																																																			.		0.547	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
NUP98	4928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	3707425	3707425	+	Splice_Site	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:3707425C>G	ENST00000324932.7	-	29	4875		c.e29-1		NUP98_ENST00000355260.3_Intron|NUP98_ENST00000359171.4_Intron	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		ATCATAATGTCTGCAAAGAAC	0.483			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																.		.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	703	0			c.4455-1G>C						.						79.0	67.0	71.0					11																	3707425		2201	4298	6499	SO:0001630	splice_region_variant	4928	exon30			TAATGTCTGCAAA	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4455-1G>C	11.37:g.3707425C>G		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	38.0	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Splice_Site	SNP	ENST00000324932.7	37	CCDS7746.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472871	0.84640	.	.	ENSG00000110713	ENST00000324932;ENST00000429801	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9921	0.92796	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUP98	3664001	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.575000	0.82447	2.805000	0.96524	0.650000	0.86243	.	.		0.483	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	Intron
OR9K2	441639	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	55524128	55524128	+	Silent	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:55524128T>C	ENST00000305377.5	+	1	664	c.576T>C	c.(574-576)tcT>tcC	p.S192S		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S192S(1)		NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						TTACTTTATCTTTTTGCGCTT	0.408																																					p.S192S		.											.	OR9K2	69	1	Substitution - coding silent(1)	lung(1)	c.T576C						.						153.0	141.0	145.0					12																	55524128		2203	4300	6503	SO:0001819	synonymous_variant	441639	exon1			TTTATCTTTTTGC	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.576T>C	12.37:g.55524128T>C		Somatic	107.0	1.0		WXS	Illumina HiSeq	Phase_I	96.0	33.0	NM_001005243	B9EH19|Q6IFD6	Silent	SNP	ENST00000305377.5	37	CCDS31814.1																																																																																			.		0.408	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1		
OTX1	5013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	63283430	63283430	+	Silent	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:63283430A>T	ENST00000282549.2	+	5	1320	c.1044A>T	c.(1042-1044)tcA>tcT	p.S348S	OTX1_ENST00000366671.3_Silent_p.S348S	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	348					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					ACCAAGCCTCATGGCGGTTCC	0.582																																					p.S348S		.											.	OTX1	70	0			c.A1044T						.						44.0	46.0	46.0					2																	63283430		2203	4300	6503	SO:0001819	synonymous_variant	5013	exon5			AGCCTCATGGCGG		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.1044A>T	2.37:g.63283430A>T		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	54.0	NM_014562	A6NHA2|B3KTJ4|Q53TG6	Silent	SNP	ENST00000282549.2	37	CCDS1873.1																																																																																			.		0.582	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
OSBPL6	114880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179201097	179201097	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:179201097A>G	ENST00000190611.4	+	9	1103	c.727A>G	c.(727-729)Act>Gct	p.T243A	OSBPL6_ENST00000409045.3_Missense_Mutation_p.T243A|OSBPL6_ENST00000409631.1_Missense_Mutation_p.T243A|OSBPL6_ENST00000359685.3_Missense_Mutation_p.T243A|OSBPL6_ENST00000392505.2_Missense_Mutation_p.T243A|OSBPL6_ENST00000357080.4_Missense_Mutation_p.T243A|OSBPL6_ENST00000315022.2_Missense_Mutation_p.T222A	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	243					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AACGTGCACAACTGGCCAGAG	0.507																																					p.T243A		.											.	OSBPL6	69	0			c.A727G						.						185.0	182.0	183.0					2																	179201097		2203	4300	6503	SO:0001583	missense	114880	exon9			TGCACAACTGGCC	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.727A>G	2.37:g.179201097A>G	ENSP00000190611:p.Thr243Ala	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	39.0	NM_001201482	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	A	10.69	1.421029	0.25639	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000361154;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.11277	2.81;2.81;2.79;2.81;2.8;2.81;2.81	5.57	4.34	0.51931	.	0.161156	0.56097	D	0.000034	T	0.06645	0.0170	N	0.22421	0.69	0.33897	D	0.638003	B;B;B;B;B;B	0.24721	0.0;0.023;0.008;0.11;0.055;0.038	B;B;B;B;B;B	0.22880	0.002;0.042;0.009;0.041;0.012;0.02	T	0.12578	-1.0542	10	0.07175	T	0.84	-13.5516	11.7903	0.52065	0.8686:0.0:0.0:0.1314	.	243;222;243;243;243;243	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	A	243;243;28;243;243;243;243;222	ENSP00000376293:T243A;ENSP00000352713:T243A;ENSP00000349591:T243A;ENSP00000387248:T243A;ENSP00000190611:T243A;ENSP00000386885:T243A;ENSP00000318723:T222A	ENSP00000190611:T243A	T	+	1	0	OSBPL6	178909343	0.998000	0.40836	0.056000	0.19401	0.308000	0.27856	6.532000	0.73825	2.244000	0.73946	0.533000	0.62120	ACT	.		0.507	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
P2RY8	286530	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	1585347	1585347	+	Silent	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:1585347C>A	ENST00000381297.4	-	2	315	c.105G>T	c.(103-105)gcG>gcT	p.A35A	P2RY8_ENST00000460672.1_5'UTR	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	35						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGATGCTGACCGCCGCCACCA	0.677			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.A35A		.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	522	0			c.G105T						.						40.0	42.0	41.0					X																	1585347		2203	4295	6498	SO:0001819	synonymous_variant	286530	exon2			GCTGACCGCCGCC	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.105G>T	X.37:g.1585347C>A		Somatic	132.0	1.0		WXS	Illumina HiSeq	Phase_I	129.0	41.0	NM_178129		Silent	SNP	ENST00000381297.4	37	CCDS14115.1																																																																																			.		0.677	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
PCDHB11	56125	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140579644	140579644	+	Silent	SNP	C	C	T	rs377046428		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:140579644C>T	ENST00000354757.3	+	1	297	c.297C>T	c.(295-297)atC>atT	p.I99I	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	99	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.I99I(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGTTCCATCGAGCCTTGCG	0.453																																					p.I99I		.											.	PCDHB11	96	1	Substitution - coding silent(1)	large_intestine(1)	c.C297T						.	C		0,4406		0,0,2203	120.0	131.0	127.0		297	-5.6	0.0	5		127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PCDHB11	NM_018931.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		99/798	140579644	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56125	exon1			TTCCATCGAGCCT	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.297C>T	5.37:g.140579644C>T		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	5.0	NM_018931	B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	37	CCDS4253.1																																																																																			.		0.453	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
PDZRN3	23024	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	73437175	73437175	+	Missense_Mutation	SNP	G	G	T	rs373968116		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:73437175G>T	ENST00000263666.4	-	8	1576	c.1462C>A	c.(1462-1464)Cta>Ata	p.L488I	PDZRN3_ENST00000479530.1_Missense_Mutation_p.L205I|PDZRN3_ENST00000466780.1_Missense_Mutation_p.L145I|PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000535920.1_Missense_Mutation_p.L210I|PDZRN3_ENST00000462146.2_Missense_Mutation_p.L145I	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	488	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TCACTGGTTAGAAGAGCCACA	0.413																																					p.L488I		.											.	PDZRN3	232	0			c.C1462A						.						117.0	130.0	126.0					3																	73437175		2203	4300	6503	SO:0001583	missense	23024	exon8			TGGTTAGAAGAGC	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1462C>A	3.37:g.73437175G>T	ENSP00000263666:p.Leu488Ile	Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	4.0	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.959463|3.959463	0.74016|0.74016	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000494559|ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	.|T;T;T;T;T;T	.|0.48522	.|0.81;0.81;0.81;0.81;0.81;0.81	4.73|4.73	1.95|1.95	0.26073|0.26073	.|PDZ/DHR/GLGF (4);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.57961|0.57961	0.2089|0.2089	L|L	0.54863|0.54863	1.705|1.705	0.54753|0.54753	D|D	0.999989|0.999989	.|D;P;D;D	.|0.69078	.|0.997;0.903;0.98;0.993	.|D;D;D;D	.|0.91635	.|0.998;0.977;0.994;0.999	T|T	0.50372|0.50372	-0.8836|-0.8836	5|10	.|0.32370	.|T	.|0.25	.|.	9.4908|9.4908	0.38958|0.38958	0.2342:0.0:0.7658:0.0|0.2342:0.0:0.7658:0.0	.|.	.|210;205;205;488	.|F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.|.;.;.;PZRN3_HUMAN	L|I	84|488;210;145;145;205;488;186	.|ENSP00000263666:L488I;ENSP00000442026:L210I;ENSP00000418168:L145I;ENSP00000418484:L145I;ENSP00000418624:L205I;ENSP00000419250:L186I	.|ENSP00000263666:L488I	F|L	-|-	3|1	2|2	PDZRN3|PDZRN3	73519865|73519865	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.999000|0.999000	0.98932|0.98932	3.935000|3.935000	0.56560|0.56560	0.179000|0.179000	0.19938|0.19938	0.655000|0.655000	0.94253|0.94253	TTC|CTA	.		0.413	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
PEX13	5194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61258823	61258823	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:61258823A>C	ENST00000295030.5	+	2	400	c.362A>C	c.(361-363)cAa>cCa	p.Q121P	PEX13_ENST00000472678.1_3'UTR	NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	121					cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			TTTGTTCAGCAAGCTGAAGAA	0.443																																					p.Q121P		.											.	PEX13	91	0			c.A362C						.						142.0	136.0	138.0					2																	61258823		2203	4300	6503	SO:0001583	missense	5194	exon2			TTCAGCAAGCTGA	U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.362A>C	2.37:g.61258823A>C	ENSP00000295030:p.Gln121Pro	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	36.0	NM_002618	B2RCS1	Missense_Mutation	SNP	ENST00000295030.5	37	CCDS1866.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056146	0.76074	.	.	ENSG00000162928	ENST00000295030	T	0.78126	-1.15	5.85	5.85	0.93711	Peroxin 13, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85146	0.5630	L	0.60455	1.87	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	D	0.83751	0.0209	10	0.33940	T	0.23	-10.22	16.2375	0.82384	1.0:0.0:0.0:0.0	.	121	Q92968	PEX13_HUMAN	P	121	ENSP00000295030:Q121P	ENSP00000295030:Q121P	Q	+	2	0	PEX13	61112327	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.865000	0.69583	2.222000	0.72286	0.533000	0.62120	CAA	.		0.443	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251581.3	NM_002618	
PEX5L	51555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	179537706	179537706	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:179537706T>A	ENST00000467460.1	-	9	1211	c.881A>T	c.(880-882)aAc>aTc	p.N294I	PEX5L_ENST00000263962.8_Missense_Mutation_p.N292I|PEX5L_ENST00000392649.3_Missense_Mutation_p.N186I|PEX5L_ENST00000472994.1_Missense_Mutation_p.N235I|PEX5L_ENST00000468741.1_Missense_Mutation_p.N102I|PEX5L_ENST00000464614.1_Missense_Mutation_p.N186I|PEX5L_ENST00000485199.1_Missense_Mutation_p.N259I|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000476138.1_Missense_Mutation_p.N251I|PEX5L_ENST00000465751.1_Missense_Mutation_p.N270I	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	294					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			AGATATCCAGTTCCTCCGAGC	0.428																																					p.N294I		.											.	PEX5L	156	0			c.A881T						.						236.0	207.0	217.0					3																	179537706		2203	4300	6503	SO:0001583	missense	51555	exon9			ATCCAGTTCCTCC	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.881A>T	3.37:g.179537706T>A	ENSP00000419975:p.Asn294Ile	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	57.0	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	ENST00000467460.1	37	CCDS3236.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.642853	0.87859	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	D;D;D;D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.39;-2.35;-2.36;-2.4;-2.4;-2.35;-2.4	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.93106	0.7805	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.998;0.982;1.0;0.999;0.999	D;D;P;D;D;D	0.91635	0.991;0.987;0.776;0.999;0.998;0.997	D	0.93820	0.7118	10	0.87932	D	0	-23.8923	15.2627	0.73637	0.0:0.0:0.0:1.0	.	235;270;186;292;259;294	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	I	294;292;259;292;186;102;251;182;235;186;270	ENSP00000419975:N294I;ENSP00000263962:N292I;ENSP00000418440:N259I;ENSP00000376420:N186I;ENSP00000418665:N102I;ENSP00000420555:N251I;ENSP00000418054:N235I;ENSP00000417270:N186I;ENSP00000419348:N270I	ENSP00000263962:N292I	N	-	2	0	PEX5L	181020400	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.684000	0.68197	2.096000	0.63516	0.533000	0.62120	AAC	.		0.428	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
PGM3	5238	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	83888466	83888466	+	Missense_Mutation	SNP	T	T	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:83888466T>G	ENST00000283977.4	-	7	838	c.712A>C	c.(712-714)Agt>Cgt	p.S238R	PGM3_ENST00000513973.1_Missense_Mutation_p.S319R|PGM3_ENST00000512866.1_Missense_Mutation_p.S319R|PGM3_ENST00000506587.1_Missense_Mutation_p.S347R					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		ATATTCAAACTTTCTCCAATC	0.318																																					p.S347R		.											.	PGM3	90	0			c.A1039C						.						109.0	97.0	101.0					6																	83888466		2203	4299	6502	SO:0001583	missense	5238	exon9			TCAAACTTTCTCC	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.712A>C	6.37:g.83888466T>G	ENSP00000283977:p.Ser238Arg	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	32.0	NM_001199917		Missense_Mutation	SNP	ENST00000283977.4	37		.	.	.	.	.	.	.	.	.	.	T	11.77	1.737001	0.30774	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.87	3.51	0.40186	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.488846	0.26387	N	0.024664	T	0.10594	0.0259	N	0.20357	0.565	0.40017	D	0.975362	B;B;B	0.26935	0.164;0.002;0.072	B;B;B	0.24269	0.052;0.007;0.032	T	0.09100	-1.0690	10	0.16420	T	0.52	-53.103	9.8444	0.41017	0.0:0.139:0.0:0.861	.	347;347;319	E9PF86;B4DX94;O95394	.;.;AGM1_HUMAN	R	319;319;238;347	ENSP00000424874:S319R;ENSP00000421565:S319R;ENSP00000283977:S238R;ENSP00000425809:S347R	ENSP00000283977:S238R	S	-	1	0	PGM3	83945185	0.213000	0.23551	0.510000	0.27712	0.861000	0.49209	0.526000	0.22971	0.492000	0.27815	0.528000	0.53228	AGT	.		0.318	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
PLA2G4C	8605	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48565344	48565344	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:48565344T>C	ENST00000599921.1	-	14	1525	c.1168A>G	c.(1168-1170)Atc>Gtc	p.I390V	PLA2G4C_ENST00000413144.2_Missense_Mutation_p.I390V|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.I390V|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.I400V|CTD-2265M8.2_ENST00000601950.1_RNA|PLA2G4C_ENST00000596510.1_5'UTR|CTD-2265M8.2_ENST00000601548.1_RNA|CTD-2265M8.2_ENST00000596552.1_RNA			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	390	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		GGAGTGTTGATGGCTAAACCA	0.572																																					p.I400V		.											.	PLA2G4C	92	0			c.A1198G						.						88.0	69.0	76.0					19																	48565344		2203	4300	6503	SO:0001583	missense	8605	exon14			TGTTGATGGCTAA	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1168A>G	19.37:g.48565344T>C	ENSP00000469473:p.Ile390Val	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	43.0	NM_001159322	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268688	0.40095	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.17370	2.28;2.28	2.79	2.79	0.32731	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.372534	0.21783	U	0.069161	T	0.13500	0.0327	L	0.44542	1.39	0.22457	N	0.999084	B;B	0.27117	0.104;0.168	B;B	0.26969	0.059;0.075	T	0.15983	-1.0418	10	0.39692	T	0.17	-8.6609	7.4822	0.27411	0.0:0.0:0.0:1.0	.	400;390	B4DI40;Q9UP65	.;PA24C_HUMAN	V	390	ENSP00000346228:I390V;ENSP00000400036:I390V	ENSP00000346228:I390V	I	-	1	0	PLA2G4C	53257156	1.000000	0.71417	0.999000	0.59377	0.281000	0.26958	3.354000	0.52254	1.045000	0.40225	0.333000	0.21579	ATC	.		0.572	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
PLP1	5354	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	103042816	103042816	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:103042816G>T	ENST00000303958.2	+	4	689	c.543G>T	c.(541-543)tgG>tgT	p.W181C	PLP1_ENST00000466486.1_3'UTR|PLP1_ENST00000418604.1_Missense_Mutation_p.W181C|PLP1_ENST00000361621.2_Missense_Mutation_p.W146C	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1	181			W -> C (in HLD1). {ECO:0000269|PubMed:10417279, ECO:0000269|PubMed:11093273}.		astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						TCAACACCTGGACCACCTGCC	0.517																																					p.W181C		.											.	PLP1	555	0			c.G543T	GRCh37	CM002828	PLP1	M		.						208.0	145.0	166.0					X																	103042816		2203	4300	6503	SO:0001583	missense	5354	exon5			CACCTGGACCACC	M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.543G>T	X.37:g.103042816G>T	ENSP00000305152:p.Trp181Cys	Somatic	102.0	1.0		WXS	Illumina HiSeq	Phase_I	115.0	77.0	NM_001128834	P04400|P06905|Q502Y1|Q6FHZ6	Missense_Mutation	SNP	ENST00000303958.2	37	CCDS14513.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874707	0.51695	.	.	ENSG00000123560	ENST00000418604;ENST00000303958;ENST00000361621;ENST00000428755	D;D;D	0.99382	-5.8;-5.8;-5.8	5.58	5.58	0.84498	.	0.337180	0.37012	N	0.002286	D	0.99284	0.9750	M	0.72894	2.215	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.999;0.999;0.999;0.996	D	0.99395	1.0926	10	0.72032	D	0.01	-1.1997	15.8191	0.78626	0.0:0.0:1.0:0.0	.	126;181;181;146	B4DI30;A8K9L3;P60201;P60201-2	.;.;MYPR_HUMAN;.	C	181;181;146;159	ENSP00000405750:W181C;ENSP00000305152:W181C;ENSP00000354860:W146C	ENSP00000305152:W181C	W	+	3	0	PLP1	102929472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.061000	0.64319	2.333000	0.79357	0.600000	0.82982	TGG	.		0.517	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057743.2		
PLXNA4	91584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	131833385	131833385	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:131833385C>T	ENST00000359827.3	-	26	5643	c.4681G>A	c.(4681-4683)Gca>Aca	p.A1561T	PLXNA4_ENST00000321063.4_Missense_Mutation_p.A1561T			Q9HCM2	PLXA4_HUMAN	plexin A4	1561					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ATCATCCTTGCCCCACTTCCT	0.537																																					p.A1561T		.											.	PLXNA4	91	0			c.G4681A						.						133.0	131.0	132.0					7																	131833385		2156	4288	6444	SO:0001583	missense	91584	exon26			TCCTTGCCCCACT	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4681G>A	7.37:g.131833385C>T	ENSP00000352882:p.Ala1561Thr	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	49.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.516951	0.64634	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.11712	2.75;2.75	4.62	4.62	0.57501	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.286062	0.38959	N	0.001516	T	0.11750	0.0286	L	0.33753	1.03	0.41275	D	0.986873	P	0.39665	0.682	B	0.39503	0.301	T	0.08249	-1.0731	10	0.49607	T	0.09	.	17.6545	0.88174	0.0:1.0:0.0:0.0	.	1561	Q9HCM2	PLXA4_HUMAN	T	1561	ENSP00000323194:A1561T;ENSP00000352882:A1561T	ENSP00000323194:A1561T	A	-	1	0	PLXNA4	131483925	0.998000	0.40836	0.963000	0.40424	0.940000	0.58332	3.815000	0.55651	2.401000	0.81631	0.561000	0.74099	GCA	.		0.537	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
PPIP5K2	23262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	102469329	102469329	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:102469329G>T	ENST00000358359.3	+	3	796	c.287G>T	c.(286-288)tGt>tTt	p.C96F	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.C96F|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.C96F	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	96					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTATGTGATTGTCTTATTTCT	0.328																																					p.C96F		.											.	PPIP5K2	92	0			c.G287T						.						90.0	94.0	92.0					5																	102469329		2202	4300	6502	SO:0001583	missense	23262	exon2			GTGATTGTCTTAT	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.287G>T	5.37:g.102469329G>T	ENSP00000351126:p.Cys96Phe	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	14.0	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	G	17.19	3.327354	0.60743	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000507310	T;T;T	0.15139	2.46;2.45;2.46	5.17	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.33876	0.0878	L	0.49350	1.555	0.80722	D	1	P;D	0.89917	0.93;1.0	P;D	0.65987	0.452;0.94	T	0.08391	-1.0724	10	0.87932	D	0	.	13.9491	0.64104	0.0738:0.0:0.9262:0.0	.	96;96	O43314-2;O43314	.;VIP2_HUMAN	F	96;96;96;96;26	ENSP00000313070:C96F;ENSP00000351126:C96F;ENSP00000416016:C96F	ENSP00000313070:C96F	C	+	2	0	PPIP5K2	102497228	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.420000	0.97426	1.322000	0.45245	0.491000	0.48974	TGT	.		0.328	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
PRDM14	63978	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	70981670	70981670	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr8:70981670C>T	ENST00000276594.2	-	2	627	c.426G>A	c.(424-426)ccG>ccA	p.P142P		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	142					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GTCCACAACACGGGCCACTCT	0.592																																					p.P142P	NSCLC(129;99 1813 5906 40656 46114)	.											.	PRDM14	93	0			c.G426A						.						54.0	51.0	52.0					8																	70981670		2203	4300	6503	SO:0001819	synonymous_variant	63978	exon2			ACAACACGGGCCA	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.426G>A	8.37:g.70981670C>T		Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	12.0	NM_024504	Q86UX9	Silent	SNP	ENST00000276594.2	37	CCDS6206.1																																																																																			.		0.592	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
PRPF40A	55660	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	153515808	153515808	+	Missense_Mutation	SNP	A	A	C	rs371901743		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:153515808A>C	ENST00000410080.1	-	22	2926	c.2385T>G	c.(2383-2385)caT>caG	p.H795Q		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	822	FF 6.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						AACGTTTCCTATGATGTTTTT	0.308																																					p.H795Q		.											.	PRPF40A	68	0			c.T2385G						.						117.0	102.0	107.0					2																	153515808		1843	4088	5931	SO:0001583	missense	55660	exon22			TTTCCTATGATGT	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.2385T>G	2.37:g.153515808A>C	ENSP00000386458:p.His795Gln	Somatic	174.0	2.0		WXS	Illumina HiSeq	Phase_I	148.0	57.0	NM_017892	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	ENST00000410080.1	37	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.050200	0.55218	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961	T	0.31510	1.49	5.62	3.2	0.36748	.	0.000000	0.85682	D	0.000000	T	0.45796	0.1360	M	0.72894	2.215	0.80722	D	1	P;P	0.50156	0.932;0.932	D;D	0.63703	0.917;0.917	T	0.33803	-0.9854	10	0.34782	T	0.22	-16.3484	6.2793	0.20999	0.4368:0.0:0.5632:0.0	.	822;795	O75400;E9PFS0	PR40A_HUMAN;.	Q	795;804;691;746	ENSP00000386458:H795Q	ENSP00000348770:H804Q	H	-	3	2	PRPF40A	153224054	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.474000	0.60203	1.212000	0.43366	0.459000	0.35465	CAT	.		0.308	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575	
PYURF	100996939	broad.mit.edu;ucsc.edu	37	4	89443178	89443178	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:89443178T>C	ENST00000273968.4	-	2	318	c.206A>G	c.(205-207)tAt>tGt	p.Y69C	PIGY_ENST00000527353.1_5'Flank|HERC3_ENST00000601319.1_3'UTR	NM_001042616.2|NM_032906.4	NP_001036081.1|NP_116295.1	Q96I23	PREY_HUMAN	PIGY upstream reading frame	69	TRM112.				GPI anchor biosynthetic process (GO:0006506)|positive regulation of metabolic process (GO:0009893)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|mitochondrion (GO:0005739)											TGATGCTTCATATCTGAGGTG	0.353																																					p.Y69C		.											.	.	.	0			c.A206G						.						125.0	91.0	101.0					4																	89443178		692	1591	2283	SO:0001583	missense	100996939	exon2			GCTTCATATCTGA			4q22.1	2012-08-14			ENSG00000145337	ENSG00000145337			44317	protein-coding gene	gene with protein product						16162815	Standard	NM_032906		Approved	PreY	uc003hru.2	Q96I23	OTTHUMG00000130949	ENST00000273968.4:c.206A>G	4.37:g.89443178T>C	ENSP00000273968:p.Tyr69Cys	Somatic	52.0	2.0		WXS	Illumina HiSeq	Phase_I	50.0	17.0	NM_032906	B2R571	Missense_Mutation	SNP	ENST00000273968.4	37	CCDS3631.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.557412	0.45590	.	.	ENSG00000145337	ENST00000273968	.	.	.	4.56	3.35	0.38373	.	0.000000	0.85682	D	0.000000	T	0.81513	0.4838	M	0.92923	3.36	0.46260	D	0.998955	D	0.89917	1.0	D	0.80764	0.994	D	0.87380	0.2356	8	0.87932	D	0	-14.1395	10.5428	0.45043	0.1449:0.0:0.0:0.8551	.	69	Q96I23	PREY_HUMAN	C	69	.	ENSP00000273968:Y69C	Y	-	2	0	PIGY	89662201	1.000000	0.71417	0.999000	0.59377	0.424000	0.31475	5.263000	0.65507	0.858000	0.35431	0.533000	0.62120	TAT	.		0.353	PYURF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253550.1	NM_032906.4	
RFPL2	10739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	32589248	32589248	+	Intron	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr22:32589248G>A	ENST00000400237.1	-	4	1201				RFPL2_ENST00000248983.4_Intron|RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248980.4_Missense_Mutation_p.S5L|RFPL2_ENST00000400236.3_Intron			O75678	RFPL2_HUMAN	ret finger protein-like 2								zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						TGTGACAAGTGACAACCTTTT	0.468																																					p.S5L		.											.	RFPL2	91	0			c.C14T						.						53.0	60.0	58.0					22																	32589248		1323	2305	3628	SO:0001627	intron_variant	10739	exon1			ACAAGTGACAACC	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.266-69C>T	22.37:g.32589248G>A		Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	106.0	NM_006605		Missense_Mutation	SNP	ENST00000400237.1	37	CCDS43009.2	.	.	.	.	.	.	.	.	.	.	G	3.137	-0.177170	0.06380	.	.	ENSG00000128253	ENST00000248980	T	0.54071	0.59	0.628	-1.26	0.09376	.	.	.	.	.	T	0.30070	0.0753	N	0.22421	0.69	0.09310	N	1	B	0.19817	0.039	B	0.18263	0.021	T	0.15896	-1.0421	7	.	.	.	.	.	.	.	.	5	O75678-3	.	L	5	ENSP00000248980:S5L	.	S	-	2	0	RFPL2	30919248	0.033000	0.19621	0.004000	0.12327	0.011000	0.07611	-0.582000	0.05814	-0.961000	0.03609	-0.693000	0.03709	TCA	.		0.468	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
RUSC1	23623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155295430	155295430	+	Missense_Mutation	SNP	G	G	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:155295430G>C	ENST00000368352.5	+	6	1932	c.1781G>C	c.(1780-1782)aGc>aCc	p.S594T	RUSC1_ENST00000368354.3_Missense_Mutation_p.S594T|RUSC1_ENST00000462780.1_3'UTR|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368349.4_Missense_Mutation_p.S125T|RUSC1_ENST00000292254.4_Missense_Mutation_p.S125T|RUSC1_ENST00000368347.4_Missense_Mutation_p.S184T	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	594	Interaction with TRAF6.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			AGCAGCCGTAGCCGCTTCCAT	0.622											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S594T		.											.	RUSC1	92	0			c.G1781C						.						57.0	59.0	58.0					1																	155295430		2203	4300	6503	SO:0001583	missense	23623	exon6			GCCGTAGCCGCTT	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1781G>C	1.37:g.155295430G>C	ENSP00000357336:p.Ser594Thr	Somatic	110.0	0.0	1769	WXS	Illumina HiSeq	Phase_I	118.0	37.0	NM_001105203	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	37	CCDS41410.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991347	0.54041	.	.	ENSG00000160753	ENST00000368354;ENST00000368352;ENST00000368347;ENST00000368349;ENST00000292254	T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77	4.34	4.34	0.51931	RUN (2);	0.218004	0.34435	N	0.003961	T	0.03178	0.0093	N	0.03608	-0.345	0.09310	N	0.999998	P;P;B;P;D;P	0.53885	0.89;0.55;0.369;0.605;0.963;0.823	P;B;B;B;P;P	0.54401	0.707;0.254;0.237;0.37;0.751;0.564	T	0.40308	-0.9570	10	0.26408	T	0.33	-24.7239	9.096	0.36640	0.1409:0.0:0.8591:0.0	.	92;125;125;184;199;594	B4DQB8;Q9BVN2-2;B3KWM9;Q5T9V0;Q9BT86;Q9BVN2	.;.;.;.;.;RUSC1_HUMAN	T	594;594;184;125;125	ENSP00000357338:S594T;ENSP00000357336:S594T;ENSP00000357331:S184T;ENSP00000357333:S125T;ENSP00000292254:S125T	ENSP00000292254:S125T	S	+	2	0	RUSC1	153562054	1.000000	0.71417	0.775000	0.31657	0.774000	0.43823	2.703000	0.47110	2.393000	0.81446	0.655000	0.94253	AGC	.		0.622	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
RYR1	6261	broad.mit.edu;bcgsc.ca	37	19	38964295	38964295	+	Silent	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:38964295A>G	ENST00000359596.3	+	28	4044	c.4044A>G	c.(4042-4044)aaA>aaG	p.K1348K	RYR1_ENST00000360985.3_Silent_p.K1348K|RYR1_ENST00000355481.4_Silent_p.K1348K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1348	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGAACGGCAAAGAAGGGACTG	0.726																																					p.K1348K		.											.	RYR1	100	0			c.A4044G						.						5.0	6.0	6.0					19																	38964295		2044	3957	6001	SO:0001819	synonymous_variant	6261	exon28			CGGCAAAGAAGGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.4044A>G	19.37:g.38964295A>G		Somatic	78.0	2.0		WXS	Illumina HiSeq	Phase_I	93.0	36.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.726	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SAMD9L	219285	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92764969	92764969	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:92764969G>A	ENST00000318238.4	-	5	1532	c.316C>T	c.(316-318)Cac>Tac	p.H106Y	SAMD9L_ENST00000437805.1_Missense_Mutation_p.H106Y|SAMD9L_ENST00000411955.1_Missense_Mutation_p.H106Y	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	106					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTTTTGGTGTGTTTTGGATTT	0.333																																					p.H106Y		.											.	SAMD9L	94	0			c.C316T						.						114.0	131.0	125.0					7																	92764969		2203	4300	6503	SO:0001583	missense	219285	exon5			TGGTGTGTTTTGG	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.316C>T	7.37:g.92764969G>A	ENSP00000326247:p.His106Tyr	Somatic	117.0	1.0		WXS	Illumina HiSeq	Phase_I	86.0	23.0	NM_152703	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348698	0.24426	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472	T;T;T	0.13657	2.57;2.57;2.57	3.7	2.73	0.32206	.	2.102490	0.03401	U	0.203384	T	0.09992	0.0245	N	0.08118	0	0.09310	N	1	B;B	0.18863	0.004;0.031	B;B	0.19946	0.016;0.027	T	0.34527	-0.9825	10	0.72032	D	0.01	0.1904	9.3566	0.38171	0.0:0.0:0.7249:0.2751	.	106;106	Q8IVG5-2;Q8IVG5	.;SAM9L_HUMAN	Y	106	ENSP00000326247:H106Y;ENSP00000405760:H106Y;ENSP00000408796:H106Y	ENSP00000326247:H106Y	H	-	1	0	SAMD9L	92602905	0.000000	0.05858	0.011000	0.14972	0.026000	0.11368	-1.604000	0.02076	0.594000	0.29761	0.460000	0.39030	CAC	.		0.333	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
SCN1B	6324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35523452	35523452	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:35523452T>A	ENST00000262631.5	+	2	198	c.61T>A	c.(61-63)Tgc>Agc	p.C21S	SCN1B_ENST00000596348.1_3'UTR|SCN1B_ENST00000595652.1_Missense_Mutation_p.C21S|SCN1B_ENST00000415950.3_Missense_Mutation_p.C21S	NM_001037.4	NP_001028.1	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta subunit	21					axon guidance (GO:0007411)|cardiac conduction (GO:0061337)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|corticospinal neuron axon guidance (GO:0021966)|locomotion (GO:0040011)|membrane depolarization (GO:0051899)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during Purkinje myocyte cell action potential (GO:0086047)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|intercalated disc (GO:0014704)|node of Ranvier (GO:0033268)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)|voltage-gated sodium channel activity involved in Purkinje myocyte action potential (GO:0086062)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	11	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGCGGGGGCTGCGTGGAGGT	0.597																																					p.C21S		.											.	SCN1B	91	0			c.T61A						.						90.0	90.0	90.0					19																	35523452		2203	4300	6503	SO:0001583	missense	6324	exon2			GGGGGCTGCGTGG		CCDS12441.1, CCDS46047.1	19q13.12	2014-09-17	2012-02-28		ENSG00000105711	ENSG00000105711		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10586	protein-coding gene	gene with protein product		600235	"""sodium channel, voltage-gated, type I, beta polypeptide"", ""sodium channel, voltage-gated, type I, beta"""			8394762	Standard	NM_001037		Approved		uc002nxo.2	Q07699	OTTHUMG00000182472	ENST00000262631.5:c.61T>A	19.37:g.35523452T>A	ENSP00000262631:p.Cys21Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	19.0	NM_001037	Q5TZZ4|Q6TN97	Missense_Mutation	SNP	ENST00000262631.5	37	CCDS12441.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.756207	0.49362	.	.	ENSG00000105711	ENST00000262631;ENST00000415950	D;D	0.98044	-4.68;-2.33	3.72	3.72	0.42706	.	0.000000	0.85682	D	0.000000	D	0.97676	0.9238	L	0.59436	1.845	0.58432	D	0.999997	D;D;D	0.76494	0.981;0.981;0.999	D;D;D	0.83275	0.95;0.95;0.996	D	0.96414	0.9306	10	0.33940	T	0.23	-27.6615	8.7296	0.34491	0.0:0.0:0.0:1.0	.	21;21;21	B4DI92;Q07699;Q07699-2	.;SCN1B_HUMAN;.	S	21	ENSP00000262631:C21S;ENSP00000396915:C21S	ENSP00000262631:C21S	C	+	1	0	SCN1B	40215292	1.000000	0.71417	0.996000	0.52242	0.556000	0.35491	6.970000	0.76099	1.557000	0.49525	0.460000	0.39030	TGC	.		0.597	SCN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461567.1		
SCN5A	6331	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	38620987	38620987	+	Splice_Site	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:38620987C>T	ENST00000333535.4	-	18	3378		c.e18-1		SCN5A_ENST00000450102.2_Intron|SCN5A_ENST00000425664.1_Splice_Site|SCN5A_ENST00000451551.2_Intron|SCN5A_ENST00000423572.2_Intron|SCN5A_ENST00000455624.2_Intron|SCN5A_ENST00000414099.2_Splice_Site|SCN5A_ENST00000443581.1_Intron|SCN5A_ENST00000413689.1_Splice_Site|SCN5A_ENST00000449557.2_Intron			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit						AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GGGATTCCTGCTGAAAAGACC	0.657																																					.		.											.	SCN5A	98	0			c.3229-1G>A						.						14.0	16.0	15.0					3																	38620987		1971	4131	6102	SO:0001630	splice_region_variant	6331	exon19			TTCCTGCTGAAAA	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.3229-1G>A	3.37:g.38620987C>T		Somatic	124.0	1.0		WXS	Illumina HiSeq	Phase_I	127.0	41.0	NM_198056	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Splice_Site	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.396113	0.62177	.	.	ENSG00000183873	ENST00000414099;ENST00000413689;ENST00000425664;ENST00000333535	.	.	.	4.42	3.52	0.40303	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4199	0.44344	0.0:0.8026:0.1974:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCN5A	38595991	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	3.526000	0.53509	1.418000	0.47098	0.655000	0.94253	.	.		0.657	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	Intron
SHANK1	50944	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	51171701	51171701	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:51171701G>A	ENST00000293441.1	-	22	3534	c.3516C>T	c.(3514-3516)agC>agT	p.S1172S	SHANK1_ENST00000391814.1_Silent_p.S1180S|SYT3_ENST00000544769.1_5'Flank|SHANK1_ENST00000359082.3_Silent_p.S1163S|SHANK1_ENST00000391813.1_Silent_p.S559S	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1172					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		TGCTGCCCTGGCTGCTGCGGC	0.761																																					p.S1172S		.											.	SHANK1	153	0			c.C3516T						.						18.0	19.0	19.0					19																	51171701		1537	3337	4874	SO:0001819	synonymous_variant	50944	exon22			GCCCTGGCTGCTG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.3516C>T	19.37:g.51171701G>A		Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	6.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	37	CCDS12799.1																																																																																			.		0.761	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
SHISA6	388336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11166833	11166833	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:11166833G>A	ENST00000409168.3	+	2	789	c.789G>A	c.(787-789)aaG>aaA	p.K263K	SHISA6_ENST00000432116.3_Silent_p.K263K|SHISA6_ENST00000441885.3_Silent_p.K263K	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	263						alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						GTACGGCCAAGCAGACTCCAG	0.522																																					p.K263K		.											.	SHISA6	67	0			c.G789A						.						148.0	123.0	131.0					17																	11166833		692	1591	2283	SO:0001819	synonymous_variant	388336	exon2			GGCCAAGCAGACT	AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.789G>A	17.37:g.11166833G>A		Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	58.0	NM_207386	B3KXV5|Q4PL63	Silent	SNP	ENST00000409168.3	37	CCDS54090.1																																																																																			.		0.522	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000333970.2	NM_207386	
SIGLEC10	89790	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	51920190	51920190	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:51920190G>A	ENST00000339313.5	-	3	552	c.436C>T	c.(436-438)Cct>Tct	p.P146S	CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000432469.2_Splice_Site|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000439889.2_Intron|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.P146S|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.P146S|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.P146S|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000436984.2_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	146	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		TAGACATCAGGCTTCTGAGTC	0.607																																					p.P146S		.											.	SIGLEC10	91	0			c.C436T						.						71.0	82.0	78.0					19																	51920190		2203	4300	6503	SO:0001583	missense	89790	exon3			CATCAGGCTTCTG	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.436C>T	19.37:g.51920190G>A	ENSP00000345243:p.Pro146Ser	Somatic	223.0	1.0		WXS	Illumina HiSeq	Phase_I	179.0	43.0	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|.	12.80|12.80	2.047825|2.047825	0.36085|0.36085	.|.	.|.	ENSG00000142512|ENSG00000142512	ENST00000432469|ENST00000353836;ENST00000356298;ENST00000525998;ENST00000339313;ENST00000530476	.|T;T;T;T;T	.|0.12879	.|2.64;2.64;2.64;2.64;2.64	4.85|4.85	4.85|4.85	0.62838|0.62838	.|Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.108957	.|0.41938	.|N	.|0.000784	.|T	.|0.45054	.|0.1323	M|M	0.91768|0.91768	3.24|3.24	0.34831|0.34831	D|D	0.739719|0.739719	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	.|T	.|0.66224	.|-0.5977	.|10	.|0.62326	.|D	.|0.03	.|.	13.4537|13.4537	0.61187|0.61187	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|146;146;146	.|E9PL79;Q96LC7-2;Q96LC7	.|.;.;SIG10_HUMAN	.|S	-1|146;146;146;146;113	.|ENSP00000342389:P146S;ENSP00000348646:P146S;ENSP00000431444:P146S;ENSP00000345243:P146S;ENSP00000433838:P113S	.|ENSP00000345243:P146S	.|P	-|-	.|1	.|0	SIGLEC10|SIGLEC10	56612002|56612002	0.995000|0.995000	0.38212|0.38212	0.153000|0.153000	0.22517|0.22517	0.520000|0.520000	0.34377|0.34377	4.606000|4.606000	0.61126|0.61126	2.235000|2.235000	0.73313|0.73313	0.313000|0.313000	0.20887|0.20887	.|CCT	.		0.607	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
SLC25A13	10165	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	95838258	95838258	+	Silent	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:95838258T>C	ENST00000265631.5	-	5	496	c.360A>G	c.(358-360)acA>acG	p.T120T	SLC25A13_ENST00000416240.2_Silent_p.T120T|SLC25A13_ENST00000542654.1_Silent_p.T12T			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	120	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	GTTGATGAATTGTGGTCTGTC	0.323																																					p.T120T		.											.	SLC25A13	515	0			c.A360G						.						74.0	78.0	77.0					7																	95838258		2203	4300	6503	SO:0001819	synonymous_variant	10165	exon5			ATGAATTGTGGTC	AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.360A>G	7.37:g.95838258T>C		Somatic	68.0	2.0		WXS	Illumina HiSeq	Phase_I	63.0	36.0	NM_001160210	O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Silent	SNP	ENST00000265631.5	37	CCDS5645.1																																																																																			.		0.323	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059395.2	NM_014251	
SLC25A5	292	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	118603838	118603838	+	Missense_Mutation	SNP	T	T	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:118603838T>G	ENST00000317881.8	+	2	442	c.326T>G	c.(325-327)tTt>tGt	p.F109C	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	109					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	AGAACCCAGTTTTGGCTCTAC	0.517																																					p.F109C		.											.	SLC25A5	131	0			c.T326G						.						105.0	105.0	105.0					X																	118603838		2203	4300	6503	SO:0001583	missense	292	exon2			CCCAGTTTTGGCT	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.326T>G	X.37:g.118603838T>G	ENSP00000360671:p.Phe109Cys	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	11.0	NM_001152	B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	37	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436537	0.62955	.	.	ENSG00000005022	ENST00000317881	T	0.78595	-1.19	4.35	4.35	0.52113	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.87736	0.6252	M	0.85299	2.745	0.58432	D	0.999998	D	0.76494	0.999	D	0.71414	0.973	D	0.89459	0.3735	10	0.87932	D	0	.	12.0671	0.53594	0.0:0.0:0.0:1.0	.	109	P05141	ADT2_HUMAN	C	109	ENSP00000360671:F109C	ENSP00000360671:F109C	F	+	2	0	SLC25A5	118487866	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.635000	0.83286	1.685000	0.51034	0.430000	0.28490	TTT	.		0.517	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2	NM_001152	
SLC26A11	284129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78220002	78220002	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:78220002G>A	ENST00000361193.3	+	12	1427	c.1147G>A	c.(1147-1149)Gtg>Atg	p.V383M	SLC26A11_ENST00000546047.2_Missense_Mutation_p.V383M|SLC26A11_ENST00000411502.3_Missense_Mutation_p.V383M|SLC26A11_ENST00000572725.1_Missense_Mutation_p.V383M	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11											central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGGGGGCCTGGTGACGGGTAA	0.672																																					p.V383M		.											.	SLC26A11	90	0			c.G1147A						.						42.0	51.0	48.0					17																	78220002		2201	4293	6494	SO:0001583	missense	284129	exon12			GGCCTGGTGACGG		CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.1147G>A	17.37:g.78220002G>A	ENSP00000355384:p.Val383Met	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	20.0	NM_173626		Missense_Mutation	SNP	ENST00000361193.3	37	CCDS11771.2	.	.	.	.	.	.	.	.	.	.	G	9.672	1.147078	0.21288	.	.	ENSG00000181045	ENST00000411502;ENST00000546047;ENST00000361193	D;D;D	0.94184	-3.37;-3.37;-3.37	4.12	3.12	0.35913	Sulphate transporter (1);	0.230563	0.45126	N	0.000389	D	0.92341	0.7570	M	0.77820	2.39	0.43852	D	0.996449	B	0.33448	0.412	B	0.39503	0.301	D	0.89902	0.4045	10	0.48119	T	0.1	-29.6563	7.1222	0.25450	0.1045:0.1875:0.7079:0.0	.	383	Q86WA9	S2611_HUMAN	M	383	ENSP00000403998:V383M;ENSP00000440724:V383M;ENSP00000355384:V383M	ENSP00000355384:V383M	V	+	1	0	SLC26A11	75834597	1.000000	0.71417	1.000000	0.80357	0.228000	0.25075	0.773000	0.26661	1.022000	0.39626	0.491000	0.48974	GTG	.		0.672	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1		
SLC3A2	6520	broad.mit.edu;bcgsc.ca	37	11	62648802	62648802	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:62648802A>G	ENST00000377890.2	+	4	778	c.610A>G	c.(610-612)Atc>Gtc	p.I204V	SLC3A2_ENST00000536981.1_5'Flank|SLC3A2_ENST00000338663.7_Missense_Mutation_p.I103V|SLC3A2_ENST00000535296.1_Missense_Mutation_p.I173V|SLC3A2_ENST00000377889.2_Missense_Mutation_p.I142V|SLC3A2_ENST00000377892.1_Missense_Mutation_p.I235V|SLC3A2_ENST00000377891.2_Missense_Mutation_p.I205V	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	204					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						CGTGGTCATAATCGTGCGAGC	0.692											OREG0021031	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I205V		.											.	SLC3A2	90	0			c.A613G						.						11.0	11.0	11.0					11																	62648802		2189	4281	6470	SO:0001583	missense	6520	exon4			GTCATAATCGTGC		CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.610A>G	11.37:g.62648802A>G	ENSP00000367122:p.Ile204Val	Somatic	53.0	2.0	1062	WXS	Illumina HiSeq	Phase_I	59.0	21.0	NM_001012662	Q13543	Missense_Mutation	SNP	ENST00000377890.2	37	CCDS8039.2	.	.	.	.	.	.	.	.	.	.	A	22.3	4.265524	0.80358	.	.	ENSG00000168003	ENST00000377892;ENST00000377891;ENST00000377890;ENST00000542007;ENST00000377889;ENST00000535296;ENST00000544377;ENST00000338663;ENST00000422606	T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.2;-1.2;-1.2	5.04	5.04	0.67666	.	0.050671	0.85682	D	0.000000	D	0.83285	0.5221	M	0.66939	2.045	0.58432	D	0.999993	P;P;P;D;P	0.63880	0.884;0.867;0.925;0.993;0.867	P;P;P;P;P	0.58331	0.54;0.54;0.601;0.778;0.837	T	0.83064	-0.0146	10	0.39692	T	0.17	-25.4642	12.7821	0.57483	1.0:0.0:0.0:0.0	.	142;173;204;103;235	P08195-3;F5GZS6;P08195;P08195-2;P08195-4	.;.;4F2_HUMAN;.;.	V	235;205;204;205;142;173;103;103;85	ENSP00000367124:I235V;ENSP00000367123:I205V;ENSP00000367122:I204V;ENSP00000367121:I142V;ENSP00000444236:I173V;ENSP00000442135:I103V;ENSP00000340815:I103V	ENSP00000340815:I103V	I	+	1	0	SLC3A2	62405378	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	3.755000	0.55197	2.117000	0.64856	0.459000	0.35465	ATC	.		0.692	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157306.1	NM_001012661	
SLC9A6	10479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135106598	135106598	+	Silent	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:135106598A>G	ENST00000370698.3	+	12	1511	c.1476A>G	c.(1474-1476)gtA>gtG	p.V492V	SLC9A6_ENST00000370695.4_Silent_p.V524V|SLC9A6_ENST00000370701.1_Silent_p.V472V	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	492					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CCGTGTGGGTATTTGGTGGTG	0.408																																					p.V524V		.											.	SLC9A6	131	0			c.A1572G						.						286.0	207.0	234.0					X																	135106598		2203	4300	6503	SO:0001819	synonymous_variant	10479	exon12			GTGGGTATTTGGT	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1476A>G	X.37:g.135106598A>G		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	54.0	NM_001042537	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	ENST00000370698.3	37	CCDS14654.1																																																																																			.		0.408	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
SPATA31A6	389730	broad.mit.edu;mdanderson.org	37	9	43625360	43625360	+	Silent	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:43625360A>T	ENST00000332857.6	-	4	3355	c.3327T>A	c.(3325-3327)tcT>tcA	p.S1109S	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1109					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGGGCTTCCTAGACTTCTCAC	0.478																																					p.S1109S		.											.	.	.	0			c.T3327A						.						2.0	2.0	2.0					9																	43625360		476	1150	1626	SO:0001819	synonymous_variant	389730	exon4			CTTCCTAGACTTC		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3327T>A	9.37:g.43625360A>T		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	52.0	NM_001145196		Silent	SNP	ENST00000332857.6	37	CCDS47973.1																																																																																			.		0.478	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196	
SMC5	23137	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	72874055	72874055	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:72874055C>G	ENST00000361138.5	+	1	119	c.61C>G	c.(61-63)Ccg>Gcg	p.P21A	SMC5-AS1_ENST00000594708.1_RNA	NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	21					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						GAGAGCTCTCCCGAGAGACCC	0.622																																					p.P21A		.											.	SMC5	229	0			c.C61G						.						38.0	46.0	43.0					9																	72874055		2203	4299	6502	SO:0001583	missense	23137	exon1			GCTCTCCCGAGAG	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.61C>G	9.37:g.72874055C>G	ENSP00000354957:p.Pro21Ala	Somatic	149.0	1.0		WXS	Illumina HiSeq	Phase_I	127.0	44.0	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	CCDS6632.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410386	0.25465	.	.	ENSG00000198887	ENST00000361138	T	0.16597	2.33	4.53	2.64	0.31445	.	1.023610	0.07744	N	0.947486	T	0.08044	0.0201	N	0.08118	0	0.23841	N	0.996694	B	0.16166	0.016	B	0.12156	0.007	T	0.41270	-0.9518	10	0.09843	T	0.71	-1.9907	6.7154	0.23300	0.1758:0.7294:0.0:0.0948	.	21	Q8IY18	SMC5_HUMAN	A	21	ENSP00000354957:P21A	ENSP00000354957:P21A	P	+	1	0	SMC5	72063875	0.000000	0.05858	0.689000	0.30133	0.664000	0.39144	-0.322000	0.08007	0.443000	0.26582	0.297000	0.19635	CCG	.		0.622	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
ST8SIA3	51046	broad.mit.edu;bcgsc.ca	37	18	55024675	55024675	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr18:55024675G>A	ENST00000324000.3	+	3	2868	c.834G>A	c.(832-834)ccG>ccA	p.P278P		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	278					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		TGGCTTGGCCGGGAAATATAA	0.408																																					p.P278P		.											.	ST8SIA3	136	0			c.G834A						.						63.0	70.0	68.0					18																	55024675		1952	3687	5639	SO:0001819	synonymous_variant	51046	exon3			TTGGCCGGGAAAT	AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.834G>A	18.37:g.55024675G>A		Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	4.0	NM_015879	A8K0F2|Q6B085|Q9NS41	Silent	SNP	ENST00000324000.3	37	CCDS32834.1																																																																																			.		0.408	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879	
TBC1D9	23158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	141543975	141543975	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:141543975G>A	ENST00000442267.2	-	21	3249	c.3175C>T	c.(3175-3177)Ctc>Ttc	p.L1059F		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1059							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TCCAGCAGGAGGCTGGTCACT	0.602																																					p.L1059F		.											.	TBC1D9	23	0			c.C3175T						.						27.0	28.0	27.0					4																	141543975		2047	4197	6244	SO:0001583	missense	23158	exon21			GCAGGAGGCTGGT	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.3175C>T	4.37:g.141543975G>A	ENSP00000411197:p.Leu1059Phe	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	26.0	NM_015130	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	37	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637256	0.67130	.	.	ENSG00000109436	ENST00000442267	T	0.65916	-0.18	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.74846	0.3770	M	0.76574	2.34	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	T	0.77319	-0.2632	10	0.87932	D	0	.	6.8792	0.24163	0.2146:0.0:0.7854:0.0	.	1059	Q6ZT07	TBCD9_HUMAN	F	1059	ENSP00000411197:L1059F	ENSP00000411197:L1059F	L	-	1	0	TBC1D9	141763425	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.690000	0.61731	2.461000	0.83175	0.655000	0.94253	CTC	.		0.602	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
TGFBR1	7046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	101908774	101908774	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:101908774G>A	ENST00000374994.4	+	7	1255	c.1138G>A	c.(1138-1140)Gcc>Acc	p.A380T	RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000374990.2_Missense_Mutation_p.A303T|TGFBR1_ENST00000552516.1_Missense_Mutation_p.A384T|TGFBR1_ENST00000550253.1_Missense_Mutation_p.A311T	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	380	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TAGGTACATGGCCCCTGAAGT	0.363																																					p.A380T		.											.	TGFBR1	954	0			c.G1138A						.						172.0	175.0	174.0					9																	101908774		2203	4300	6503	SO:0001583	missense	7046	exon7			TACATGGCCCCTG		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1138G>A	9.37:g.101908774G>A	ENSP00000364133:p.Ala380Thr	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	9.0	NM_004612	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	37	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	G	34	5.352851	0.95830	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99187	0.9718	H	0.98314	4.2	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.984;0.999	D	0.98883	1.0770	10	0.87932	D	0	.	18.3871	0.90470	0.0:0.0:1.0:0.0	.	303;380	P36897-3;P36897	.;TGFR1_HUMAN	T	380;342;303;384;311	ENSP00000364133:A380T;ENSP00000364129:A303T;ENSP00000447297:A384T;ENSP00000450052:A311T	ENSP00000364129:A303T	A	+	1	0	TGFBR1	100948595	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.810000	0.99221	2.708000	0.92522	0.467000	0.42956	GCC	.		0.363	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
TLR1	7096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	38799346	38799346	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:38799346C>T	ENST00000502213.2	-	3	1336	c.1107G>A	c.(1105-1107)ggG>ggA	p.G369G	TLR1_ENST00000308979.2_Silent_p.G369G			Q15399	TLR1_HUMAN	toll-like receptor 1	369					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						CAGTAAGGTGCCCACAATTTT	0.373																																					p.G369G	GBM(5;216 373 40795 46382)	.											.	TLR1	524	0			c.G1107A						.						44.0	46.0	45.0					4																	38799346		2203	4300	6503	SO:0001819	synonymous_variant	7096	exon4			AAGGTGCCCACAA	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1107G>A	4.37:g.38799346C>T		Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	5.0	NM_003263	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Silent	SNP	ENST00000502213.2	37	CCDS33973.1																																																																																			.		0.373	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
TMBIM4	51643	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	66531753	66531753	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:66531753A>C	ENST00000358230.3	-	7	824	c.704T>G	c.(703-705)gTt>gGt	p.V235G	TMBIM4_ENST00000398033.4_3'UTR|TMBIM4_ENST00000539652.1_3'UTR|TMBIM4_ENST00000556010.1_3'UTR|TMBIM4_ENST00000286424.7_Missense_Mutation_p.V282G|TMBIM4_ENST00000544599.1_Missense_Mutation_p.V58G|TMBIM4_ENST00000542724.1_Missense_Mutation_p.V204G	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	235					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		CTTTTTATTAACTGCTTCCAG	0.333																																					p.V235G		.											TMBIM4,brain,glioma,-1	TMBIM4	515	0			c.T704G						.						94.0	89.0	90.0					12																	66531753		1844	4084	5928	SO:0001583	missense	51643	exon7			TTATTAACTGCTT	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.704T>G	12.37:g.66531753A>C	ENSP00000350965:p.Val235Gly	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	16.0	NM_016056	Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	37	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.758419	0.31137	.	.	ENSG00000155957	ENST00000358230;ENST00000544599;ENST00000286424;ENST00000539427;ENST00000542724	T;T;T	0.48522	1.42;1.4;0.81	5.87	3.53	0.40419	.	0.272984	0.33005	N	0.005381	T	0.21509	0.0518	N	0.02708	-0.52	0.80722	D	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.18263	0.021;0.005;0.002	T	0.04065	-1.0980	9	.	.	.	-10.7337	10.4472	0.44501	0.8687:0.0:0.1313:0.0	.	282;204;235	G3XAA5;G3V1M2;Q9HC24	.;.;TMBI4_HUMAN	G	235;58;282;280;204	ENSP00000350965:V235G;ENSP00000286424:V282G;ENSP00000441291:V204G	.	V	-	2	0	TMBIM4	64818020	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.386000	0.59620	0.571000	0.29365	0.533000	0.62120	GTT	.		0.333	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056	
TMPRSS7	344805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111785275	111785275	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:111785275G>A	ENST00000452346.2	+	13	1595	c.1592G>A	c.(1591-1593)aGg>aAg	p.R531K	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.R405K			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	531	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGCTCCTTCAGGCAGCATGGC	0.512																																					p.R405K		.											.	TMPRSS7	70	0			c.G1214A						.						104.0	104.0	104.0					3																	111785275		1968	4164	6132	SO:0001583	missense	344805	exon11			CCTTCAGGCAGCA	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1592G>A	3.37:g.111785275G>A	ENSP00000398236:p.Arg531Lys	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	36.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	37		.	.	.	.	.	.	.	.	.	.	G	3.696	-0.062452	0.07273	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	T;T	0.58652	0.32;0.32	5.67	3.81	0.43845	.	0.698068	0.14485	N	0.316738	T	0.35885	0.0947	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24977	-1.0145	10	0.06099	T	0.92	.	7.6679	0.28443	0.0868:0.0:0.7474:0.1658	.	531;405	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	K	531;519;505;405	ENSP00000398236:R531K;ENSP00000411645:R405K	ENSP00000411645:R405K	R	+	2	0	TMPRSS7	113267965	0.126000	0.22350	0.809000	0.32408	0.867000	0.49689	0.872000	0.28037	1.484000	0.48361	0.655000	0.94253	AGG	.		0.512	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
TNFRSF8	943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	12175637	12175637	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:12175637A>C	ENST00000263932.2	+	8	1019	c.797A>C	c.(796-798)gAc>gCc	p.D266A	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.D155A	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	266					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CCCTTAGATGACCTTGTGGAG	0.577																																					p.D266A		.											.	TNFRSF8	654	0			c.A797C						.						157.0	134.0	141.0					1																	12175637		2203	4300	6503	SO:0001583	missense	943	exon8			TAGATGACCTTGT	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.797A>C	1.37:g.12175637A>C	ENSP00000263932:p.Asp266Ala	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	34.0	NM_001243	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	ENST00000263932.2	37	CCDS144.1	.	.	.	.	.	.	.	.	.	.	A	8.631	0.893756	0.17613	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	D;D	0.91351	-2.83;-2.83	3.83	1.51	0.23008	TNFR/CD27/30/40/95 cysteine-rich region (3);	4.245900	0.00520	N	0.000187	D	0.92341	0.7570	M	0.63843	1.955	0.25715	N	0.98543	P;P	0.52316	0.916;0.952	P;P	0.56127	0.491;0.792	T	0.76143	-0.3067	10	0.29301	T	0.29	-10.2473	5.0616	0.14560	0.738:0.0:0.262:0.0	.	155;266	D3YTD8;P28908	.;TNR8_HUMAN	A	266;155	ENSP00000263932:D266A;ENSP00000390650:D155A	ENSP00000263932:D266A	D	+	2	0	TNFRSF8	12098224	1.000000	0.71417	0.836000	0.33094	0.025000	0.11179	2.222000	0.42926	0.206000	0.20587	0.383000	0.25322	GAC	.		0.577	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
TOP2B	7155	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	25668275	25668275	+	Missense_Mutation	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:25668275A>T	ENST00000264331.4	-	17	2096	c.2097T>A	c.(2095-2097)caT>caA	p.H699Q	TOP2B_ENST00000435706.2_Missense_Mutation_p.H694Q	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	699					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	CTGGTAAGCCATGTAGCCTAC	0.383																																					p.H694Q		.											.	TOP2B	273	0			c.T2082A						.						69.0	70.0	70.0					3																	25668275		2203	4299	6502	SO:0001583	missense	7155	exon17			TAAGCCATGTAGC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.2097T>A	3.37:g.25668275A>T	ENSP00000264331:p.His699Gln	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	37		.	.	.	.	.	.	.	.	.	.	A	10.34	1.324066	0.24080	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.42131	0.98;0.98	5.4	3.0	0.34707	.	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	N	0.16656	0.425	0.80722	D	1	B	0.21688	0.059	B	0.17433	0.018	T	0.04664	-1.0935	10	0.21014	T	0.42	.	8.7808	0.34789	0.7131:0.0:0.2869:0.0	.	694	Q02880-2	.	Q	694;699;694	ENSP00000396704:H694Q;ENSP00000264331:H699Q	ENSP00000264331:H699Q	H	-	3	2	TOP2B	25643279	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.018000	0.40991	0.433000	0.26313	-0.379000	0.06801	CAT	.		0.383	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
TRAF5	7188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	211545809	211545809	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:211545809A>G	ENST00000261464.5	+	11	1493	c.1439A>G	c.(1438-1440)cAg>cGg	p.Q480R	TRAF5_ENST00000427925.2_Missense_Mutation_p.Q374R|TRAF5_ENST00000336184.2_Missense_Mutation_p.Q480R|TRAF5_ENST00000367004.3_Missense_Mutation_p.Q480R	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	480	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		CCATTCAGGCAGAGGGTGACC	0.517																																					p.Q480R		.											.	TRAF5	661	0			c.A1439G						.						103.0	92.0	95.0					1																	211545809		2203	4300	6503	SO:0001583	missense	7188	exon11			TCAGGCAGAGGGT	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.1439A>G	1.37:g.211545809A>G	ENSP00000261464:p.Gln480Arg	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	25.0	NM_004619	B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	ENST00000261464.5	37	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638128	0.87760	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.51	5.51	0.81932	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.58750	0.2144	L	0.56280	1.765	0.58432	D	0.999992	D;D;D	0.89917	0.994;1.0;0.997	D;D;D	0.91635	0.988;0.999;0.995	T	0.53136	-0.8481	10	0.23891	T	0.37	-23.8815	15.907	0.79439	1.0:0.0:0.0:0.0	.	374;491;480	F5H1P7;B4E0A2;O00463	.;.;TRAF5_HUMAN	R	480;374;480;480	ENSP00000336825:Q480R;ENSP00000389891:Q374R;ENSP00000261464:Q480R;ENSP00000355971:Q480R	ENSP00000261464:Q480R	Q	+	2	0	TRAF5	209612432	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.946000	0.92992	2.210000	0.71456	0.528000	0.53228	CAG	.		0.517	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
TRIM41	90933	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	180651721	180651721	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:180651721A>G	ENST00000315073.5	+	1	1432	c.722A>G	c.(721-723)gAc>gGc	p.D241G	CTC-338M12.7_ENST00000499096.2_RNA|TRIM41_ENST00000351937.5_Missense_Mutation_p.D241G|MIR4638_ENST00000581158.1_RNA	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	241					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCGAGGTAGACGAAGAGGCC	0.582																																					p.D241G		.											.	TRIM41	226	0			c.A722G						.						72.0	63.0	66.0					5																	180651721		2203	4300	6503	SO:0001583	missense	90933	exon1			AGGTAGACGAAGA	AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.722A>G	5.37:g.180651721A>G	ENSP00000320869:p.Asp241Gly	Somatic	234.0	1.0		WXS	Illumina HiSeq	Phase_I	224.0	15.0	NM_201627	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	ENST00000315073.5	37	CCDS4466.1	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471740	0.63737	.	.	ENSG00000146063	ENST00000351937;ENST00000315073;ENST00000421508	T;T	0.50813	0.73;0.73	5.01	5.01	0.66863	Zinc finger, B-box (3);	0.000000	0.56097	D	0.000031	T	0.78755	0.4333	H	0.97564	4.03	0.52099	D	0.999942	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.97110	1.0;0.989;0.989	D	0.85797	0.1371	10	0.87932	D	0	.	12.7002	0.57026	1.0:0.0:0.0:0.0	.	241;241;241	Q8WV44;Q8WV44-2;Q8WV44-4	TRI41_HUMAN;.;.	G	241;241;120	ENSP00000336749:D241G;ENSP00000320869:D241G	ENSP00000320869:D241G	D	+	2	0	TRIM41	180584327	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	8.701000	0.91331	1.873000	0.54277	0.402000	0.26972	GAC	.		0.582	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253574.3	NM_201627	
TRPM8	79054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	234894478	234894478	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:234894478C>T	ENST00000324695.4	+	21	2948	c.2908C>T	c.(2908-2910)Ctg>Ttg	p.L970L	TRPM8_ENST00000433712.2_Silent_p.L548L	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	970					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CACCAACATCCTGCTGGTCAA	0.577																																					p.L970L		.											.	TRPM8	94	0			c.C2908T						.						129.0	87.0	101.0					2																	234894478		2203	4300	6503	SO:0001819	synonymous_variant	79054	exon21			AACATCCTGCTGG	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2908C>T	2.37:g.234894478C>T		Somatic	251.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	84.0	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Silent	SNP	ENST00000324695.4	37	CCDS33407.1																																																																																			.		0.577	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
TTC33	23548	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	40716358	40716358	+	Silent	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:40716358T>A	ENST00000337702.4	-	5	830	c.678A>T	c.(676-678)tcA>tcT	p.S226S	TTC33_ENST00000503936.2_5'UTR	NM_012382.2	NP_036514.1	Q6PID6	TTC33_HUMAN	tetratricopeptide repeat domain 33	226										NS(1)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TTTTATTTGCTGAAACTGTCT	0.403																																					p.S226S		.											.	TTC33	91	0			c.A678T						.						111.0	96.0	101.0					5																	40716358		2203	4300	6503	SO:0001819	synonymous_variant	23548	exon5			ATTTGCTGAAACT	BC015701	CCDS3931.1	5p13.1	2013-01-11			ENSG00000113638	ENSG00000113638		"""Tetratricopeptide (TTC) repeat domain containing"""	29959	protein-coding gene	gene with protein product	"""osmosis responsive factor"""					12477932	Standard	NM_012382		Approved	OSRF	uc003jma.3	Q6PID6	OTTHUMG00000131142	ENST00000337702.4:c.678A>T	5.37:g.40716358T>A		Somatic	87.0	1.0		WXS	Illumina HiSeq	Phase_I	92.0	42.0	NM_012382	B2R6G0|O95105	Silent	SNP	ENST00000337702.4	37	CCDS3931.1																																																																																			.		0.403	TTC33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253831.1	NM_012382	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	179579150	179579150	+	Nonsense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:179579150C>T	ENST00000591111.1	-	89	25624	c.25400G>A	c.(25399-25401)tGg>tAg	p.W8467*	TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.W7540*|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Nonsense_Mutation_p.W8784*			Q8WZ42	TITIN_HUMAN	titin	12635	Ig-like 67.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAAGAAATCCATATGTTGTC	0.408																																					p.W8784X		.											.	TTN	636	0			c.G26351A						.						88.0	83.0	85.0					2																	179579150		1854	4093	5947	SO:0001587	stop_gained	7273	exon91			GAAATCCATATGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25400G>A	2.37:g.179579150C>T	ENSP00000465570:p.Trp8467*	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	11.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	59	36.689866	0.99983	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	X	7540	.	ENSP00000343764:W7540X	W	-	2	0	TTN	179287395	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.253000	0.32886	2.832000	0.97577	0.655000	0.94253	TGG	.		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	54590037	54590037	+	Silent	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr15:54590037T>A	ENST00000260323.11	+	11	4017	c.4017T>A	c.(4015-4017)tcT>tcA	p.S1339S	UNC13C_ENST00000545554.1_Silent_p.S1339S|UNC13C_ENST00000537900.1_Silent_p.S1337S	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1339					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CAGCTGTATCTGGGGCCATAC	0.363																																					p.S1339S		.											.	UNC13C	51	0			c.T4017A						.						64.0	63.0	63.0					15																	54590037		1856	4088	5944	SO:0001819	synonymous_variant	440279	exon10			TGTATCTGGGGCC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4017T>A	15.37:g.54590037T>A		Somatic	291.0	0.0		WXS	Illumina HiSeq	Phase_I	276.0	81.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	CCDS45264.1																																																																																			.		0.363	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
UNKL	64718	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	1417163	1417179	+	Intron	DEL	CCGATGTCCCCACAGCC	CCGATGTCCCCACAGCC	-	rs372155593|rs529314659|rs557591189|rs149887709		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	CCGATGTCCCCACAGCC	CCGATGTCCCCACAGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:1417163_1417179delCCGATGTCCCCACAGCC	ENST00000389221.4	-	14	1887				UNKL_ENST00000402641.2_Frame_Shift_Del_p.GCGDIG153fs|UNKL_ENST00000508903.2_Frame_Shift_Del_p.GCGDIG654fs|UNKL_ENST00000397464.1_Intron|UNKL_ENST00000391893.2_Frame_Shift_Del_p.GCGDIG150fs|UNKL_ENST00000403703.1_Frame_Shift_Del_p.GCGDIG153fs|UNKL_ENST00000248104.7_Frame_Shift_Del_p.GCGDIG150fs	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.I157I(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GGGAATGGTGCCGATGTCCCCACAGCCCCGCAGCCCC	0.691																																					p.153_158del		.											.	UNKL	90	1	Substitution - coding silent(1)	lung(1)	c.457_473del						.																																			SO:0001627	intron_variant	64718	exon5			ATGGTGCCGATGT	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1887+63GGCTGTGGGGACATCGG>-	16.37:g.1417163_1417179delCCGATGTCCCCACAGCC		Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	10.0	NM_023076	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Frame_Shift_Del	DEL	ENST00000389221.4	37	CCDS53981.1																																																																																			.		0.691	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
USP2	9099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	119228275	119228275	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:119228275C>T	ENST00000260187.2	-	11	1821	c.1527G>A	c.(1525-1527)agG>agA	p.R509R	USP2_ENST00000455332.2_Silent_p.R266R|USP2_ENST00000525735.1_Silent_p.R300R	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	509	USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		tggttcggatcctggattctg	0.463																																					p.R509R		.											.	USP2	661	0			c.G1527A						.						79.0	80.0	80.0					11																	119228275		2199	4295	6494	SO:0001819	synonymous_variant	9099	exon11			TCGGATCCTGGAT	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.1527G>A	11.37:g.119228275C>T		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	50.0	NM_004205	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Silent	SNP	ENST00000260187.2	37	CCDS8422.1																																																																																			.		0.463	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
USP34	9736	hgsc.bcm.edu;broad.mit.edu	37	2	61441759	61441760	+	In_Frame_Ins	INS	-	-	GACCTTGTT			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:61441759_61441760insGACCTTGTT	ENST00000398571.2	-	68	8193_8194	c.8117_8118insAACAAGGTC	c.(8116-8118)tct>tcAACAAGGTCt	p.2706_2706S>STRS	USP34_ENST00000472689.1_Intron	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2706					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GGATGTGCAAAGACCTTGTTGA	0.46																																					p.S2706delinsSTRS		.											.	USP34	579	0			c.8118_8119insAACAAGGTC						.																																			SO:0001652	inframe_insertion	9736	exon68			GTGCAAAGACCTT	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8109_8117dupAACAAGGTC	2.37:g.61441760_61441768dupGACCTTGTT	ENSP00000381577:p.ThrArgSer2706dup	Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	21.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	In_Frame_Ins	INS	ENST00000398571.2	37	CCDS42686.1																																																																																			.		0.460	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
VPS35	55737	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	46716005	46716005	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:46716005C>G	ENST00000299138.7	-	3	243	c.185G>C	c.(184-186)aGt>aCt	p.S62T		NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	62					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TTCATAGTAACTCTTTGGTGA	0.333																																					p.S62T		.											.	VPS35	90	0			c.G185C						.						102.0	95.0	97.0					16																	46716005		2203	4299	6502	SO:0001583	missense	55737	exon3			TAGTAACTCTTTG	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.185G>C	16.37:g.46716005C>G	ENSP00000299138:p.Ser62Thr	Somatic	214.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	10.0	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Missense_Mutation	SNP	ENST00000299138.7	37	CCDS10721.1	.	.	.	.	.	.	.	.	.	.	.	13.61	2.288658	0.40494	.	.	ENSG00000069329	ENST00000299138	T	0.42900	0.96	4.88	4.88	0.63580	.	0.084158	0.85682	D	0.000000	T	0.41096	0.1144	L	0.43152	1.355	0.80722	D	1	P	0.35383	0.498	B	0.40506	0.331	T	0.15122	-1.0448	10	0.14252	T	0.57	-5.5078	18.4459	0.90683	0.0:1.0:0.0:0.0	.	62	Q96QK1	VPS35_HUMAN	T	62	ENSP00000299138:S62T	ENSP00000299138:S62T	S	-	2	0	VPS35	45273506	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.405000	0.81733	0.551000	0.68910	AGT	.		0.333	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
WDR43	23160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	29129433	29129433	+	Silent	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:29129433A>G	ENST00000407426.3	+	3	527	c.471A>G	c.(469-471)acA>acG	p.T157T		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	157						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					ACGTACAGACATGCAAAGTAA	0.388																																					p.T157T		.											.	WDR43	69	0			c.A471G						.						94.0	91.0	92.0					2																	29129433		1998	4178	6176	SO:0001819	synonymous_variant	23160	exon3			ACAGACATGCAAA	D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.471A>G	2.37:g.29129433A>G		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	24.0	NM_015131	Q15395|Q92577	Silent	SNP	ENST00000407426.3	37	CCDS46251.1																																																																																			.		0.388	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324865.1	XM_087089	
YIF1B	90522	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	38796134	38796134	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:38796134C>T	ENST00000339413.6	-	8	848	c.803G>A	c.(802-804)cGg>cAg	p.R268Q	YIF1B_ENST00000592694.1_Missense_Mutation_p.R237Q|YIF1B_ENST00000329420.8_Missense_Mutation_p.R253Q|YIF1B_ENST00000337679.8_Missense_Mutation_p.G291S|YIF1B_ENST00000592246.1_Missense_Mutation_p.R202Q|YIF1B_ENST00000392124.3_Missense_Mutation_p.R237Q|YIF1B_ENST00000591784.1_Missense_Mutation_p.R237Q	NM_001039672.2|NM_001039673.2	NP_001034761.1|NP_001034762.1	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B (S. cerevisiae)	268						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)	10	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GATCTTCAGCCGCAGCGTCCG	0.647																																					p.G291S		.											.	YIF1B	68	0			c.G871A						.						13.0	15.0	14.0					19																	38796134		2178	4268	6446	SO:0001583	missense	90522	exon9			TTCAGCCGCAGCG	AL833382	CCDS12512.1, CCDS33010.1, CCDS46066.1, CCDS46067.1	19q13.2	2008-02-05							30511	protein-coding gene	gene with protein product						12975309	Standard	NM_001039672		Approved	FinGER8	uc002ohz.2	Q5BJH7		ENST00000339413.6:c.803G>A	19.37:g.38796134C>T	ENSP00000343435:p.Arg268Gln	Somatic	284.0	2.0		WXS	Illumina HiSeq	Phase_I	254.0	92.0	NM_001145463	H7BXS8|Q5JPC2|Q8WY70|Q96C02|Q96IC4	Missense_Mutation	SNP	ENST00000339413.6	37	CCDS33010.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.25|18.25	3.583307|3.583307	0.65992|0.65992	.|.	.|.	ENSG00000167645|ENSG00000167645	ENST00000337679|ENST00000339413;ENST00000329420;ENST00000392124	T|T;T;T	0.55234|0.47869	0.53|0.83;0.83;0.85	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61937|0.61937	0.2387|0.2387	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	P|D;D;P	0.40931|0.58970	0.733|0.975;0.984;0.943	B|P;P;P	0.37144|0.55303	0.242|0.587;0.773;0.745	T|T	0.67393|0.67393	-0.5682|-0.5682	8|9	0.87932|0.72032	D|D	0|0.01	-25.0087|-25.0087	15.7029|15.7029	0.77555|0.77555	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	291|237;268;265	Q5BJH7-4|Q5BJH7-2;Q5BJH7;Q5BJH7-3	.|.;YIF1B_HUMAN;.	S|Q	291|268;253;237	ENSP00000337411:G291S|ENSP00000343435:R268Q;ENSP00000329559:R253Q;ENSP00000375971:R237Q	ENSP00000337411:G291S|ENSP00000329559:R253Q	G|R	-|-	1|2	0|0	YIF1B|YIF1B	43487974|43487974	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.870000|0.870000	0.49936|0.49936	5.151000|5.151000	0.64875|0.64875	2.304000|2.304000	0.77564|0.77564	0.462000|0.462000	0.41574|0.41574	GGC|CGG	.		0.647	YIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460511.1	NM_033557	
ZDHHC4	55146	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	6621814	6621814	+	Frame_Shift_Del	DEL	T	T	-	rs183719718	byFrequency	TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:6621814delT	ENST00000396706.2	+	5	745	c.302delT	c.(301-303)cttfs	p.L103fs	ZDHHC4_ENST00000396709.1_Frame_Shift_Del_p.L103fs|ZDHHC4_ENST00000335965.6_Frame_Shift_Del_p.L103fs|ZDHHC4_ENST00000396707.2_Frame_Shift_Del_p.L103fs|ZDHHC4_ENST00000396713.2_Frame_Shift_Del_p.L103fs|AC079742.4_ENST00000434951.1_RNA|ZDHHC4_ENST00000405731.3_Frame_Shift_Del_p.L103fs			Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	103						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		TTGCATTACCTTCTTCTGCCC	0.468																																					p.L101fs		.											.	ZDHHC4	154	0			c.302delT						.						328.0	288.0	301.0					7																	6621814		2203	4300	6503	SO:0001589	frameshift_variant	55146	exon5			ATTACCTTCTTCT	AF201931	CCDS5352.1	7p22.1	2011-01-11			ENSG00000136247	ENSG00000136247		"""Zinc fingers, DHHC-type"""	18471	protein-coding gene	gene with protein product							Standard	NM_018106		Approved	FLJ10479, ZNF374	uc003sqj.3	Q9NPG8	OTTHUMG00000023579	ENST00000396706.2:c.302delT	7.37:g.6621814delT	ENSP00000379934:p.Leu103fs	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	61.0	NM_018106	A4D2N9|Q53EV7|Q6FIB5|Q9H0R9	Frame_Shift_Del	DEL	ENST00000396706.2	37	CCDS5352.1																																																																																			.		0.468	ZDHHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207477.3	NM_018106	
ZFHX3	463	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	72829983	72829983	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:72829983C>T	ENST00000268489.5	-	9	7270	c.6598G>A	c.(6598-6600)Gag>Aag	p.E2200K	ZFHX3_ENST00000397992.5_Missense_Mutation_p.E1286K	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2200					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CGCTGCCTCTCTTTGAAGAGA	0.522																																					p.E2200K		.											.	ZFHX3	72	0			c.G6598A						.						106.0	103.0	104.0					16																	72829983		2198	4300	6498	SO:0001583	missense	463	exon9			GCCTCTCTTTGAA	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6598G>A	16.37:g.72829983C>T	ENSP00000268489:p.Glu2200Lys	Somatic	131.0	1.0		WXS	Illumina HiSeq	Phase_I	119.0	46.0	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.937354	0.73557	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	D;D	0.96491	-4.03;-4.03	5.51	5.51	0.81932	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.50627	D	0.000115	D	0.97914	0.9314	M	0.70595	2.14	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	D	0.98302	1.0519	10	0.59425	D	0.04	.	19.4092	0.94662	0.0:1.0:0.0:0.0	.	2200	Q15911	ZFHX3_HUMAN	K	2200;1286	ENSP00000268489:E2200K;ENSP00000438926:E1286K	ENSP00000268489:E2200K	E	-	1	0	ZFHX3	71387484	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.570000	0.86706	0.561000	0.74099	GAG	.		0.522	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZNF558	148156	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8932718	8932718	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:8932718G>A	ENST00000601372.1	-	6	792	c.81C>T	c.(79-81)ggC>ggT	p.G27G	ZNF558_ENST00000301475.1_Silent_p.G27G|ZNF558_ENST00000444186.2_5'Flank|CTD-2529P6.3_ENST00000594006.1_RNA|ZNF558_ENST00000599938.1_5'Flank			Q96NG5	ZN558_HUMAN	zinc finger protein 558	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						CCAGCTCTCCGCCCTGTGTGT	0.512																																					p.G27G		.											.	ZNF558	90	0			c.C81T						.						196.0	174.0	182.0					19																	8932718		2203	4300	6503	SO:0001819	synonymous_variant	148156	exon2			CTCTCCGCCCTGT	AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.81C>T	19.37:g.8932718G>A		Somatic	217.0	1.0		WXS	Illumina HiSeq	Phase_I	191.0	77.0	NM_144693	A8K5F0|B7Z798	Silent	SNP	ENST00000601372.1	37	CCDS12208.1																																																																																			.		0.512	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459955.2	NM_144693	
ZNF480	147657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52817496	52817496	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:52817496G>T	ENST00000595962.1	+	3	229	c.163G>T	c.(163-165)Gtg>Ttg	p.V55L	ZNF480_ENST00000334564.7_Missense_Mutation_p.V55L|ZNF480_ENST00000490272.1_Intron|ZNF480_ENST00000335090.6_Intron|CTD-2525I3.6_ENST00000594379.1_RNA	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	55	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		ATACAAGGATGTGATGTTGGA	0.507																																					p.V55L		.											.	ZNF480	153	0			c.G163T						.						138.0	123.0	128.0					19																	52817496		2203	4300	6503	SO:0001583	missense	147657	exon3			AAGGATGTGATGT	AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.163G>T	19.37:g.52817496G>T	ENSP00000471754:p.Val55Leu	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	18.0	NM_144684	Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	ENST00000595962.1	37	CCDS12850.2	.	.	.	.	.	.	.	.	.	.	G	9.983	1.228670	0.22542	.	.	ENSG00000198464	ENST00000354515;ENST00000468240;ENST00000334564	T;T	0.03801	3.8;3.8	2.04	0.919	0.19392	Krueppel-associated box (4);	.	.	.	.	T	0.29914	0.0748	H	0.97940	4.11	0.20489	N	0.999899	P;D	0.63046	0.842;0.992	B;D	0.77004	0.201;0.989	T	0.07654	-1.0761	9	0.87932	D	0	.	6.3975	0.21620	0.1717:0.0:0.8283:0.0	.	55;55	F8WEZ9;Q8WV37	.;ZN480_HUMAN	L	77;55;55	ENSP00000417424:V55L;ENSP00000334164:V55L	ENSP00000334164:V55L	V	+	1	0	ZNF480	57509308	0.983000	0.35010	0.253000	0.24343	0.046000	0.14306	2.017000	0.40981	0.178000	0.19917	0.508000	0.49915	GTG	.		0.507	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349001.3	NM_144684	
ZSWIM1	90204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44511883	44511883	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr20:44511883A>C	ENST00000372523.1	+	2	747	c.652A>C	c.(652-654)Agc>Cgc	p.S218R	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.S218R	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	218						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				TACACTCCTGAGCAACTGCAT	0.597																																					p.S218R		.											.	ZSWIM1	91	0			c.A652C						.						50.0	48.0	49.0					20																	44511883		2203	4300	6503	SO:0001583	missense	90204	exon2			CTCCTGAGCAACT	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.652A>C	20.37:g.44511883A>C	ENSP00000361601:p.Ser218Arg	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	20.0	NM_080603	Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	ENST00000372523.1	37	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	A	1.243	-0.620919	0.03636	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.24151	1.87;1.87	5.37	4.28	0.50868	.	0.328871	0.25439	U	0.030673	T	0.15089	0.0364	L	0.27053	0.805	0.26265	N	0.978518	B	0.26876	0.162	B	0.24006	0.05	T	0.24012	-1.0172	10	0.09084	T	0.74	-11.2214	9.9652	0.41721	0.924:0.0:0.076:0.0	.	218	Q9BR11	ZSWM1_HUMAN	R	218	ENSP00000361601:S218R;ENSP00000361598:S218R	ENSP00000361598:S218R	S	+	1	0	ZSWIM1	43945290	1.000000	0.71417	0.992000	0.48379	0.122000	0.20287	2.852000	0.48310	1.060000	0.40578	0.528000	0.53228	AGC	.		0.597	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603	
ADAM12	8038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	127760045	127760046	+	Splice_Site	DNP	CC	CC	AA			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr10:127760045_127760046CC>AA	ENST00000368679.4	-	12	1641_1642	c.1332_1333GG>TT	c.(1330-1335)gaGGaa>gaTTaa	p.444_445EE>D*	ADAM12_ENST00000368676.4_Splice_Site_p.444_445EE>D*|ADAM12_ENST00000467145.1_5'Flank	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	444	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		ATGGTTCTTACCTCTGGCTCCC	0.5																																					.		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	8038	.			TTCTTACCTCTGG	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1332_1333delinsAA	10.37:g.127760045_127760046delinsAA		Somatic	210.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	47.0	.	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	DNP	ENST00000368679.4	37	CCDS7653.1																																																																																			.		0.500	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		Nonsense_Mutation
