#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB1	5243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	87168617	87168617	+	Silent	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr7:87168617G>T	ENST00000265724.3	-	20	2781	c.2364C>A	c.(2362-2364)ctC>ctA	p.L788L	ABCB1_ENST00000543898.1_Silent_p.L724L	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	788	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CCATGTATCGGAGCCGCTTGG	0.527																																					p.L788L		.											.	ABCB1	582	0			c.C2364A						.						129.0	107.0	114.0					7																	87168617		2203	4300	6503	SO:0001819	synonymous_variant	5243	exon20			GTATCGGAGCCGC	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2364C>A	7.37:g.87168617G>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	10.0	NM_000927	A8K294|B5AK60|Q12755|Q14812	Silent	SNP	ENST00000265724.3	37	CCDS5608.1																																																																																			.		0.527	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
AKAP11	11215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	42876851	42876851	+	Silent	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr13:42876851A>T	ENST00000025301.2	+	8	4144	c.3969A>T	c.(3967-3969)ccA>ccT	p.P1323P		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1323					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TTTCATTACCACCAAGTTCTT	0.398																																					p.P1323P		.											.	AKAP11	227	0			c.A3969T						.						102.0	99.0	100.0					13																	42876851		2203	4300	6503	SO:0001819	synonymous_variant	11215	exon8			ATTACCACCAAGT	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3969A>T	13.37:g.42876851A>T		Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	24.0	NM_016248	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	37	CCDS9383.1																																																																																			.		0.398	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
AKAP3	10566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	4737115	4737115	+	Missense_Mutation	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:4737115A>T	ENST00000545990.2	-	5	1477	c.953T>A	c.(952-954)cTg>cAg	p.L318Q	AKAP3_ENST00000228850.1_Missense_Mutation_p.L318Q|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	318					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						AACCTTCTTCAGTAGGATGGT	0.473																																					p.L318Q		.											.	AKAP3	292	0			c.T953A						.						153.0	134.0	140.0					12																	4737115		2203	4300	6503	SO:0001583	missense	10566	exon4			TTCTTCAGTAGGA	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.953T>A	12.37:g.4737115A>T	ENSP00000440994:p.Leu318Gln	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	35.0	NM_006422	O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	ENST00000545990.2	37	CCDS8531.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.235330	0.58886	.	.	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.15834	2.39;2.39	5.67	5.67	0.87782	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.49305	D	0.000144	T	0.43478	0.1249	M	0.78801	2.425	0.36697	D	0.879915	D	0.89917	1.0	D	0.91635	0.999	T	0.55256	-0.8169	10	0.87932	D	0	-12.8942	13.7212	0.62728	1.0:0.0:0.0:0.0	.	318	O75969	AKAP3_HUMAN	Q	318	ENSP00000228850:L318Q;ENSP00000440994:L318Q	ENSP00000228850:L318Q	L	-	2	0	AKAP3	4607376	0.770000	0.28543	0.982000	0.44146	0.683000	0.39861	3.704000	0.54815	2.281000	0.76405	0.533000	0.62120	CTG	.		0.473	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422	
ALS2CL	259173	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	46727834	46727834	+	Silent	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr3:46727834T>C	ENST00000318962.4	-	6	713	c.630A>G	c.(628-630)acA>acG	p.T210T	ALS2CL_ENST00000415953.1_Silent_p.T210T	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	210					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		AGAGAGCCTGTGTGGCCACAG	0.617																																					p.T210T		.											.	ALS2CL	155	0			c.A630G						.						50.0	47.0	48.0					3																	46727834		2203	4300	6503	SO:0001819	synonymous_variant	259173	exon6			AGCCTGTGTGGCC	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.630A>G	3.37:g.46727834T>C		Somatic	131.0	1.0		WXS	Illumina HiSeq	Phase_I	115.0	29.0	NM_001190707	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Silent	SNP	ENST00000318962.4	37	CCDS2743.1																																																																																			.		0.617	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	
ANKLE1	126549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17397348	17397348	+	Missense_Mutation	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr19:17397348A>T	ENST00000394458.3	+	9	2111	c.1835A>T	c.(1834-1836)cAg>cTg	p.Q612L	ANKLE1_ENST00000404085.1_Missense_Mutation_p.Q608L|ANKLE1_ENST00000594072.1_Missense_Mutation_p.Q575L|ANKLE1_ENST00000598347.1_Missense_Mutation_p.R540W	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	612										large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						CAGGACATCCAGGCCCGGGGC	0.637																																					p.Q612L		.											.	.	.	0			c.A1835T						.						17.0	15.0	16.0					19																	17397348		2203	4293	6496	SO:0001583	missense	126549	exon9			ACATCCAGGCCCG	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1835A>T	19.37:g.17397348A>T	ENSP00000377971:p.Gln612Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	25.0	NM_152363	A8VU82|Q8N8J8	Missense_Mutation	SNP	ENST00000394458.3	37	CCDS12354.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.40|18.40	3.616075|3.616075	0.66672|0.66672	.|.	.|.	ENSG00000160117|ENSG00000160117	ENST00000404261;ENST00000404085;ENST00000394458|ENST00000438921	T|.	0.72942|.	-0.7|.	5.48|5.48	3.29|3.29	0.37713|0.37713	.|.	0.153243|.	0.40385|.	N|.	0.001104|.	T|T	0.54095|0.54095	0.1837|0.1837	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;P;P|D	0.57571|0.71674	0.98;0.948;0.948|0.998	P;P;P|D	0.53102|0.72625	0.718;0.666;0.666|0.978	T|T	0.55711|0.55711	-0.8098|-0.8098	10|8	0.66056|0.62326	D|D	0.02|0.03	-0.2046|-0.2046	5.0826|5.0826	0.14664|0.14664	0.7205:0.1851:0.0944:0.0|0.7205:0.1851:0.0944:0.0	.|.	572;612;575|540	Q8NAG6-1;Q8NAG6;A0JLW0|E7ETZ9	.;ANKL1_HUMAN;.|.	L|W	612;608;575|540	ENSP00000384008:Q608L|.	ENSP00000377971:Q575L|ENSP00000415429:R540W	Q|R	+|+	2|1	0|2	ANKLE1|ANKLE1	17258348|17258348	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.476000|0.476000	0.33039|0.33039	0.881000|0.881000	0.28173|0.28173	2.081000|2.081000	0.62600|0.62600	0.402000|0.402000	0.26972|0.26972	CAG|AGG	.		0.637	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
ANKRD30B	374860	broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	14851875	14851875	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr18:14851875G>A	ENST00000358984.4	+	36	3755	c.3575G>A	c.(3574-3576)aGt>aAt	p.S1192N		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1192										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CATGATCAAAGTGTCACATCA	0.363																																					p.S1192N		.											.	ANKRD30B	24	0			c.G3575A						.						8.0	8.0	8.0					18																	14851875		668	1559	2227	SO:0001583	missense	374860	exon36			ATCAAAGTGTCAC	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3575G>A	18.37:g.14851875G>A	ENSP00000351875:p.Ser1192Asn	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	23.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.299906	0.01364	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.17054	2.3	1.39	1.39	0.22231	.	.	.	.	.	T	0.11452	0.0279	L	0.41492	1.28	0.31176	N	0.702687	B;B	0.26845	0.053;0.161	B;B	0.22753	0.005;0.041	T	0.14559	-1.0468	9	0.35671	T	0.21	.	3.7575	0.08591	0.2396:0.0:0.7604:0.0	.	1277;1192	Q9BXX2;F8WAG3	AN30B_HUMAN;.	N	1192;586;612	ENSP00000351875:S1192N	ENSP00000277669:S612N	S	+	2	0	ANKRD30B	14841875	0.377000	0.25106	0.393000	0.26258	0.027000	0.11550	0.963000	0.29293	1.076000	0.40961	0.173000	0.16961	AGT	.		0.363	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
ARHGEF18	23370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7528840	7528840	+	Splice_Site	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr19:7528840G>A	ENST00000359920.6	+	12	2461	c.2208G>A	c.(2206-2208)aaG>aaA	p.K736K	CTD-2207O23.3_ENST00000593531.1_Splice_Site_p.R694K|ARHGEF18_ENST00000319670.9_Splice_Site_p.K578K	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	736					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GCCCCACCAAGAGTAAGAGCG	0.612																																					p.K736K		.											.	ARHGEF18	228	0			c.G2208A						.						20.0	22.0	21.0					19																	7528840		2190	4290	6480	SO:0001630	splice_region_variant	23370	exon12			CACCAAGAGTAAG	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.2209+1G>A	19.37:g.7528840G>A		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	22.0	NM_001130955	A8MV62|B5ME81|O60274|Q6DD92	Silent	SNP	ENST00000359920.6	37	CCDS45946.1																																																																																			.		0.612	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	Silent
AP1M1	8907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16319967	16319967	+	Silent	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr19:16319967C>A	ENST00000291439.3	+	5	974	c.525C>A	c.(523-525)gtC>gtA	p.V175V	AP1M1_ENST00000429941.2_Silent_p.V175V|AP1M1_ENST00000541844.1_Silent_p.V103V|AP1M1_ENST00000590756.1_Silent_p.V103V|AP1M1_ENST00000444449.2_Silent_p.V175V	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	175	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						TCTTGGACGTCATCGAGTCTG	0.512																																					p.V175V		.											.	AP1M1	156	0			c.C525A						.						216.0	194.0	201.0					19																	16319967		2203	4300	6503	SO:0001819	synonymous_variant	8907	exon5			GGACGTCATCGAG		CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.525C>A	19.37:g.16319967C>A		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	25.0	NM_001130524	Q4TTY5	Silent	SNP	ENST00000291439.3	37	CCDS12342.1																																																																																			.		0.512	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
ATP6V0A4	50617	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	138394373	138394373	+	Missense_Mutation	SNP	G	G	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr7:138394373G>C	ENST00000310018.2	-	21	2707	c.2425C>G	c.(2425-2427)Cac>Gac	p.H809D	ATP6V0A4_ENST00000393054.1_Missense_Mutation_p.H809D|ATP6V0A4_ENST00000353492.4_Missense_Mutation_p.H809D	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	809					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						CCTTACCAGTGCAGTCGCAGG	0.547																																					p.H809D		.											.	ATP6V0A4	91	0			c.C2425G						.						167.0	166.0	166.0					7																	138394373		2203	4300	6503	SO:0001583	missense	50617	exon20			ACCAGTGCAGTCG	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.2425C>G	7.37:g.138394373G>C	ENSP00000308122:p.His809Asp	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	13.0	NM_130841	A4D1R4|A8KA80|Q32M47	Missense_Mutation	SNP	ENST00000310018.2	37	CCDS5849.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857080	0.91433	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	D;D;D	0.89270	-2.49;-2.49;-2.49	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.96784	0.8950	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97559	1.0097	10	0.72032	D	0.01	.	19.8636	0.96797	0.0:0.0:1.0:0.0	.	809	Q9HBG4	VPP4_HUMAN	D	809	ENSP00000308122:H809D;ENSP00000376774:H809D;ENSP00000253856:H809D	ENSP00000308122:H809D	H	-	1	0	ATP6V0A4	138044913	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.869000	0.99810	2.694000	0.91930	0.655000	0.94253	CAC	.		0.547	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347514.1	NM_020632	
AVIL	10677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	58207158	58207158	+	Missense_Mutation	SNP	C	C	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:58207158C>G	ENST00000257861.3	-	3	620	c.190G>C	c.(190-192)Ggg>Cgg	p.G64R	AVIL_ENST00000537081.1_Missense_Mutation_p.G57R|RP11-571M6.18_ENST00000602327.1_lincRNA	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	64	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)	p.G64W(2)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GAGTCCTTCCCGATCCAGAAG	0.597																																					p.G64R		.											.	AVIL	514	2	Substitution - Missense(2)	lung(2)	c.G190C						.						100.0	90.0	94.0					12																	58207158		2203	4300	6503	SO:0001583	missense	10677	exon3			CCTTCCCGATCCA	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.190G>C	12.37:g.58207158C>G	ENSP00000257861:p.Gly64Arg	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	10.0	NM_006576	B2RAU7|Q2NKM9	Missense_Mutation	SNP	ENST00000257861.3	37	CCDS8959.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818955	0.90873	.	.	ENSG00000135407	ENST00000537081;ENST00000257861;ENST00000549994	D;D;D	0.83335	-1.71;-1.71;-1.71	4.73	4.73	0.59995	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	D	0.94991	0.8379	H	0.98738	4.315	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.96959	0.9700	10	0.87932	D	0	-25.3166	16.9725	0.86304	0.0:1.0:0.0:0.0	.	57;64;64	O75366-2;F8VVU1;O75366	.;.;AVIL_HUMAN	R	57;64;64	ENSP00000443207:G57R;ENSP00000257861:G64R;ENSP00000449239:G64R	ENSP00000257861:G64R	G	-	1	0	AVIL	56493425	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.504000	0.81646	2.610000	0.88304	0.655000	0.94253	GGG	.		0.597	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409276.1	NM_006576	
BRMS1	25855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	66109566	66109566	+	Splice_Site	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr11:66109566C>A	ENST00000359957.3	-	2	300		c.e2+1		BRMS1_ENST00000425825.2_Splice_Site|RP11-867G23.12_ENST00000526655.1_RNA	NM_015399.3	NP_056214.1	Q9HCU9	BRMS1_HUMAN	breast cancer metastasis suppressor 1						apoptotic process (GO:0006915)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of anoikis (GO:2000210)|positive regulation of protein deacetylation (GO:0090312)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)			large_intestine(1)|liver(1)|lung(1)|prostate(1)|skin(1)	5						tAGGGGCTCACCGGAGCTCTC	0.572																																					.	GBM(7;55 307 2662 20856 28942)	.											.	BRMS1	90	0			c.139+1G>T						.						116.0	85.0	95.0					11																	66109566		2200	4295	6495	SO:0001630	splice_region_variant	25855	exon3			GGCTCACCGGAGC	AF147350	CCDS8135.1, CCDS44654.1	11q13-q13.2	2008-02-05				ENSG00000174744			17262	protein-coding gene	gene with protein product		606259				10850410	Standard	XM_005273883		Approved	DKFZP564A063	uc001oho.1	Q9HCU9		ENST00000359957.3:c.139+1G>T	11.37:g.66109566C>A		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	12.0	NM_015399	Q6IAI2	Splice_Site	SNP	ENST00000359957.3	37	CCDS8135.1	.	.	.	.	.	.	.	.	.	.	C	12.79	2.044642	0.36085	.	.	ENSG00000174744	ENST00000425825;ENST00000524699;ENST00000359957;ENST00000530756	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0486	0.71846	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRMS1	65866142	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	2.406000	0.44557	2.234000	0.73211	0.591000	0.81541	.	.		0.572	BRMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392958.2	NM_015399	Intron
C2orf71	388939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	29294547	29294547	+	Nonsense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr2:29294547C>A	ENST00000331664.5	-	1	2580	c.2581G>T	c.(2581-2583)Gaa>Taa	p.E861*		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	861					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TCCTGGGTTTCCTTGGGGGAG	0.612																																					p.E861X		.											.	C2orf71	91	0			c.G2581T						.						54.0	56.0	55.0					2																	29294547		1853	4105	5958	SO:0001587	stop_gained	388939	exon1			GGGTTTCCTTGGG		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2581G>T	2.37:g.29294547C>A	ENSP00000332809:p.Glu861*	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	35.0	NM_001029883		Nonsense_Mutation	SNP	ENST00000331664.5	37	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	C	37	6.401860	0.97537	.	.	ENSG00000179270	ENST00000331664	.	.	.	5.54	2.61	0.31194	.	1.065440	0.07224	N	0.861344	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-4.5644	7.1416	0.25558	0.0:0.6003:0.2553:0.1443	.	.	.	.	X	861	.	ENSP00000332809:E861X	E	-	1	0	C2orf71	29148051	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	1.638000	0.37165	0.698000	0.31739	0.585000	0.79938	GAA	.		0.612	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
C7orf72	100130988	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	50135733	50135733	+	Missense_Mutation	SNP	T	T	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr7:50135733T>A	ENST00000297001.6	+	1	102	c.52T>A	c.(52-54)Tcc>Acc	p.S18T	ZPBP_ENST00000419417.1_5'Flank|ZPBP_ENST00000046087.2_5'Flank	NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	18										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						CTCTAAAAGGTCCATCCTTTC	0.333																																					p.S18T		.											.	C7orf72	23	0			c.T52A						.						81.0	75.0	77.0					7																	50135733		692	1591	2283	SO:0001583	missense	100130988	exon1			AAAAGGTCCATCC		CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.52T>A	7.37:g.50135733T>A	ENSP00000297001:p.Ser18Thr	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	30.0	NM_001161834	A6NDX9	Missense_Mutation	SNP	ENST00000297001.6	37	CCDS47585.1	.	.	.	.	.	.	.	.	.	.	T	5.002	0.186136	0.09495	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.68	1.53	0.23141	.	.	.	.	.	T	0.17916	0.0430	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.25502	-1.0130	7	.	.	.	.	5.0179	0.14347	0.1413:0.1743:0.0:0.6844	.	18	A4D263	CG072_HUMAN	T	18	.	.	S	+	1	0	C7orf72	50106279	0.003000	0.15002	0.001000	0.08648	0.830000	0.47004	0.921000	0.28718	0.407000	0.25591	-0.415000	0.06103	TCC	.		0.333	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342124.1	NM_001161834	
CCDC96	257236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	7043534	7043534	+	Missense_Mutation	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr4:7043534C>T	ENST00000310085.4	-	1	1194	c.1132G>A	c.(1132-1134)Gag>Aag	p.E378K	RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank|TADA2B_ENST00000512388.1_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	378										endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						TGAATGTTCTCCAGCCGCACG	0.572																																					p.E378K		.											.	CCDC96	90	0			c.G1132A						.						76.0	82.0	80.0					4																	7043534		2203	4300	6503	SO:0001583	missense	257236	exon1			TGTTCTCCAGCCG	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.1132G>A	4.37:g.7043534C>T	ENSP00000309285:p.Glu378Lys	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	18.0	NM_153376	Q8N2I7	Missense_Mutation	SNP	ENST00000310085.4	37	CCDS3395.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.942752	0.53079	.	.	ENSG00000173013	ENST00000310085	T	0.41758	0.99	3.98	3.98	0.46160	.	0.182364	0.35096	N	0.003448	T	0.48943	0.1528	L	0.28344	0.845	0.32848	D	0.506269	D	0.76494	0.999	D	0.74674	0.984	T	0.55023	-0.8205	10	0.23891	T	0.37	-23.9438	15.8476	0.78903	0.0:1.0:0.0:0.0	.	378	Q2M329	CCD96_HUMAN	K	378	ENSP00000309285:E378K	ENSP00000309285:E378K	E	-	1	0	CCDC96	7094435	0.999000	0.42202	0.999000	0.59377	0.634000	0.38068	4.307000	0.59123	2.068000	0.61886	0.462000	0.41574	GAG	.		0.572	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
CEP89	84902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	33370231	33370231	+	Missense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr19:33370231C>A	ENST00000305768.5	-	19	2277	c.2189G>T	c.(2188-2190)cGa>cTa	p.R730L	CTD-2085J24.4_ENST00000586628.2_lincRNA	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	730					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						TCGGATTCTTCGGTTTTCCCT	0.458																																					p.R730L		.											.	CEP89	94	0			c.G2189T						.						158.0	157.0	157.0					19																	33370231		2203	4300	6503	SO:0001583	missense	84902	exon19			ATTCTTCGGTTTT	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.2189G>T	19.37:g.33370231C>A	ENSP00000306105:p.Arg730Leu	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	15.0	NM_032816	B9EGA6|Q8N5J8	Missense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603169	0.66445	.	.	ENSG00000121289	ENST00000305768	T	0.34072	1.38	5.12	-6.09	0.02145	.	0.727465	0.12015	N	0.507501	T	0.38852	0.1056	L	0.59436	1.845	0.09310	N	0.999999	P	0.51537	0.946	P	0.49683	0.619	T	0.45041	-0.9288	10	0.44086	T	0.13	-7.0E-4	14.2988	0.66331	0.0:0.3211:0.0:0.6789	.	730	Q96ST8	CEP89_HUMAN	L	730	ENSP00000306105:R730L	ENSP00000306105:R730L	R	-	2	0	CEP89	38062071	0.271000	0.24162	0.001000	0.08648	0.231000	0.25187	-0.222000	0.09190	-0.994000	0.03463	-0.258000	0.10820	CGA	.		0.458	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816	
CLTB	1212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	175819809	175819809	+	Missense_Mutation	SNP	A	A	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:175819809A>G	ENST00000310418.4	-	6	861	c.656T>C	c.(655-657)cTc>cCc	p.L219P	CLTB_ENST00000345807.2_Missense_Mutation_p.L201P	NM_007097.3	NP_009028.1	P09497	CLCB_HUMAN	clathrin, light chain B	219					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	ciliary membrane (GO:0060170)|clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|trans-Golgi network (GO:0005802)	peptide binding (GO:0042277)|structural molecule activity (GO:0005198)			lung(1)	1	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		CAGGGACATGAGCACCGAGCG	0.622																																					p.L219P		.											.	CLTB	90	0			c.T656C						.						205.0	174.0	184.0					5																	175819809		2203	4300	6503	SO:0001583	missense	1212	exon6			GACATGAGCACCG	M20470	CCDS4402.1, CCDS4403.1	5q35.2	2010-05-11	2010-05-11		ENSG00000175416	ENSG00000175416			2091	protein-coding gene	gene with protein product		118970	"""clathrin, light polypeptide (Lcb)"""			7713494	Standard	NM_007097		Approved	Lcb	uc003meh.4	P09497	OTTHUMG00000130662	ENST00000310418.4:c.656T>C	5.37:g.175819809A>G	ENSP00000309415:p.Leu219Pro	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	27.0	NM_007097	Q53Y37|Q6FHW1	Missense_Mutation	SNP	ENST00000310418.4	37	CCDS4403.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.482485	0.84747	.	.	ENSG00000175416	ENST00000310418;ENST00000345807;ENST00000502877	.	.	.	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.85146	0.5630	M	0.91249	3.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.88794	0.3280	9	0.87932	D	0	.	15.0249	0.71663	1.0:0.0:0.0:0.0	.	201;219	P09497-2;P09497	.;CLCB_HUMAN	P	219;201;121	.	ENSP00000309415:L219P	L	-	2	0	CLTB	175752415	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.307000	0.96226	1.949000	0.56562	0.454000	0.30748	CTC	.		0.622	CLTB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253153.1		
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238253847	238253847	+	Missense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr2:238253847C>A	ENST00000295550.4	-	33	7554	c.7102G>T	c.(7102-7104)Ggc>Tgc	p.G2368C	COL6A3_ENST00000346358.4_Missense_Mutation_p.G2168C|COL6A3_ENST00000472056.1_Missense_Mutation_p.G1761C|COL6A3_ENST00000347401.3_Missense_Mutation_p.G2167C|COL6A3_ENST00000409809.1_Missense_Mutation_p.G2162C|COL6A3_ENST00000353578.4_Missense_Mutation_p.G2162C	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2368	Collagen-like 5.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCCCTGTTGCCCTTGGGACCC	0.453																																					p.G2368C		.											.	COL6A3	526	0			c.G7102T						.						67.0	71.0	70.0					2																	238253847		2203	4300	6503	SO:0001583	missense	1293	exon33			TGTTGCCCTTGGG	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7102G>T	2.37:g.238253847C>A	ENSP00000295550:p.Gly2368Cys	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	13.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.585032	0.28268	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29;-6.29	5.03	5.03	0.67393	.	0.000000	0.51477	D	0.000100	D	0.99792	0.9912	H	0.96861	3.895	0.80722	D	1	D;D;D;D	0.89917	0.993;0.993;0.991;1.0	D;P;P;D	0.97110	0.93;0.889;0.823;1.0	D	0.96833	0.9612	10	0.87932	D	0	.	18.381	0.90451	0.0:1.0:0.0:0.0	.	1761;1761;2162;2368	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	C	2368;2167;2162;1761;2162;2168	ENSP00000295550:G2368C;ENSP00000315609:G2167C;ENSP00000315873:G2162C;ENSP00000418285:G1761C;ENSP00000386844:G2162C;ENSP00000295546:G2168C	ENSP00000295550:G2368C	G	-	1	0	COL6A3	237918586	1.000000	0.71417	0.991000	0.47740	0.392000	0.30506	4.266000	0.58871	2.315000	0.78130	0.655000	0.94253	GGC	.		0.453	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CRAMP1L	57585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1676129	1676129	+	Missense_Mutation	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr16:1676129A>T	ENST00000397412.3	+	3	601	c.502A>T	c.(502-504)Aca>Tca	p.T168S	CRAMP1L_ENST00000436138.3_Missense_Mutation_p.T165S|CRAMP1L_ENST00000293925.5_Missense_Mutation_p.T168S|LA16c-395F10.1_ENST00000415176.1_RNA			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	168	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						GTCGTGGAGCACAGAGGACAA	0.647																																					p.T168S		.											.	.	.	0			c.A502T						.						67.0	72.0	70.0					16																	1676129		692	1591	2283	SO:0001583	missense	57585	exon2			TGGAGCACAGAGG	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.502A>T	16.37:g.1676129A>T	ENSP00000380559:p.Thr168Ser	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	16.0	NM_020825	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	ENST00000397412.3	37	CCDS10440.2	.	.	.	.	.	.	.	.	.	.	A	24.5	4.533192	0.85812	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138	T;T	0.28666	1.6;1.6	5.81	5.81	0.92471	SANT domain, DNA binding (1);SANT, eukarya (1);	0.121235	0.56097	D	0.000040	T	0.23370	0.0565	N	0.01352	-0.895	0.80722	D	1	D	0.65815	0.995	P	0.57152	0.814	T	0.51116	-0.8746	10	0.39692	T	0.17	-15.3045	16.1612	0.81712	1.0:0.0:0.0:0.0	.	168	Q96RY5	CRML_HUMAN	S	168;168;165	ENSP00000380559:T168S;ENSP00000293925:T168S	ENSP00000293925:T168S	T	+	1	0	CRAMP1L	1616130	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	3.782000	0.55401	2.216000	0.71823	0.533000	0.62120	ACA	.		0.647	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0	CTNNB1	24361	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	3.37:g.41266136T>C	ENSP00000344456:p.Ser45Pro	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	48.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CXCL2	2920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74964377	74964377	+	Silent	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr4:74964377T>C	ENST00000508487.2	-	3	421	c.249A>G	c.(247-249)aaA>aaG	p.K83K	CXCL2_ENST00000296031.4_5'UTR	NM_002089.3	NP_002080.1	P19875	CXCL2_HUMAN	chemokine (C-X-C motif) ligand 2	83					cell chemotaxis (GO:0060326)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|response to molecule of bacterial origin (GO:0002237)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			lung(1)	1	Breast(15;0.00612)		all cancers(17;0.00317)|Lung(101;0.196)			TGAGACAAGCTTTCTGCCCAT	0.512																																					p.K83K		.											.	CXCL2	90	0			c.A249G						.						129.0	125.0	127.0					4																	74964377		2203	4300	6503	SO:0001819	synonymous_variant	2920	exon3			ACAAGCTTTCTGC	M36820	CCDS34008.1	4q13.3	2013-02-25	2002-08-22	2002-08-23		ENSG00000081041		"""Endogenous ligands"""	4603	protein-coding gene	gene with protein product		139110	"""GRO2 oncogene"""	GRO2		2217207	Standard	NM_002089		Approved	SCYB2, GROb, MIP-2a, MGSA-b, CINC-2a	uc003hhm.4	P19875		ENST00000508487.2:c.249A>G	4.37:g.74964377T>C		Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	44.0	NM_002089	Q6FGD6|Q9UPB8	Silent	SNP	ENST00000508487.2	37	CCDS34008.1																																																																																			.		0.512	CXCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362731.2	NM_002089	
CYP7B1	9420	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	65537039	65537039	+	Silent	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr8:65537039C>A	ENST00000310193.3	-	2	353	c.180G>T	c.(178-180)ctG>ctT	p.L60L		NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	60					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TTCGTAAGTTCAGGACCACTC	0.378																																					p.L60L		.											.	CYP7B1	93	0			c.G180T						.						137.0	135.0	136.0					8																	65537039		2203	4300	6503	SO:0001819	synonymous_variant	9420	exon2			TAAGTTCAGGACC	AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.180G>T	8.37:g.65537039C>A		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	157.0	NM_004820	B2RN07|Q9UNF5	Silent	SNP	ENST00000310193.3	37	CCDS6180.1																																																																																			.		0.378	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		
DEK	7913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	18258580	18258580	+	Missense_Mutation	SNP	T	T	C	rs147997771		TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:18258580T>C	ENST00000397239.3	-	3	649	c.202A>G	c.(202-204)Atg>Gtg	p.M68V	DEK_ENST00000244776.7_Intron	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	68					chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			GAGACTTGCATTGTCAACCTC	0.338			T	NUP214	AML																																p.M68V		.		Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	.	DEK	658	0			c.A202G						.	T	,VAL/MET	0,4406		0,0,2203	160.0	152.0	155.0		,202	5.8	1.0	6	dbSNP_134	155	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	DEK	NM_001134709.1,NM_003472.3	,21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,benign	,68/376	18258580	1,13005	2203	4300	6503	SO:0001583	missense	7913	exon3			CTTGCATTGTCAA	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.202A>G	6.37:g.18258580T>C	ENSP00000380414:p.Met68Val	Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	281.0	89.0	NM_003472	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	.	.	.	.	.	.	.	.	.	.	T	15.60	2.880527	0.51801	0.0	1.16E-4	ENSG00000124795	ENST00000397239;ENST00000503715;ENST00000515742	T;T;T	0.43688	1.14;0.94;1.07	5.84	5.84	0.93424	.	0.173402	0.64402	D	0.000009	T	0.31451	0.0797	N	0.16790	0.44	0.80722	D	1	P	0.40332	0.713	P	0.54815	0.761	T	0.21930	-1.0231	10	0.30854	T	0.27	-13.125	14.7839	0.69787	0.0:0.0:0.0:1.0	.	68	P35659	DEK_HUMAN	V	68;1;73	ENSP00000380414:M68V;ENSP00000425399:M1V;ENSP00000423553:M73V	ENSP00000380414:M68V	M	-	1	0	DEK	18366559	1.000000	0.71417	0.992000	0.48379	0.971000	0.66376	4.834000	0.62774	2.220000	0.72140	0.482000	0.46254	ATG	T|1.000;C|0.000		0.338	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039962.4		
DHX8	1659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41590858	41590858	+	Silent	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr17:41590858G>T	ENST00000262415.3	+	17	2703	c.2631G>T	c.(2629-2631)acG>acT	p.T877T	DHX8_ENST00000540306.1_Silent_p.T877T	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	877	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		TCGTGGTGACGCCTATTTCTC	0.403																																					p.T877T	NSCLC(56;1548 1661 49258 49987)	.											.	DHX8	229	0			c.G2631T						.						154.0	124.0	134.0					17																	41590858		2203	4300	6503	SO:0001819	synonymous_variant	1659	exon17			GGTGACGCCTATT	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.2631G>T	17.37:g.41590858G>T		Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	26.0	NM_004941		Silent	SNP	ENST00000262415.3	37	CCDS11464.1																																																																																			.		0.403	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124419244	124419244	+	Silent	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:124419244C>T	ENST00000409039.3	+	77	13225	c.13200C>T	c.(13198-13200)ccC>ccT	p.P4400P	RP11-380L11.3_ENST00000602292.1_RNA|CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_5'UTR	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4400					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGAGCAAACCCAAGGTGCTGG	0.537																																					p.P4400P		.											.	DNAH10	95	0			c.C13200T						.						65.0	71.0	69.0					12																	124419244		2019	4187	6206	SO:0001819	synonymous_variant	196385	exon77			CAAACCCAAGGTG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.13200C>T	12.37:g.124419244C>T		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	30.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	37	CCDS9255.2																																																																																			.		0.537	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH6	1768	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84784866	84784866	+	Missense_Mutation	SNP	T	T	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr2:84784866T>G	ENST00000237449.6	+	10	1618	c.1610T>G	c.(1609-1611)aTt>aGt	p.I537S	DNAH6_ENST00000398278.2_Missense_Mutation_p.I537S|DNAH6_ENST00000389394.3_Missense_Mutation_p.I537S			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	537	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CAGGATGGTATTTTGGGTGCA	0.313																																					p.I537S		.											.	DNAH6	69	0			c.T1610G						.						134.0	127.0	129.0					2																	84784866		2203	4300	6503	SO:0001583	missense	1768	exon11			ATGGTATTTTGGG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1610T>G	2.37:g.84784866T>G	ENSP00000237449:p.Ile537Ser	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	35.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	T	10.39	1.337324	0.24253	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.28069	1.63;1.75;1.63	5.22	5.22	0.72569	.	0.123056	0.36034	N	0.002826	T	0.37732	0.1014	L	0.57536	1.79	0.39225	D	0.963578	B;P	0.41265	0.415;0.744	B;B	0.44044	0.239;0.439	T	0.41980	-0.9478	10	0.87932	D	0	.	14.0916	0.64995	0.0:0.0:0.0:1.0	.	537;116	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	S	537	ENSP00000374045:I537S;ENSP00000381326:I537S;ENSP00000237449:I537S	ENSP00000237449:I537S	I	+	2	0	DNAH6	84638377	1.000000	0.71417	0.996000	0.52242	0.041000	0.13682	3.504000	0.53347	1.969000	0.57287	0.533000	0.62120	ATT	.		0.313	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DSE	29940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	116720771	116720771	+	Missense_Mutation	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:116720771A>T	ENST00000331677.3	+	3	802	c.358A>T	c.(358-360)Att>Ttt	p.I120F	DSE_ENST00000537543.1_Missense_Mutation_p.I139F|DSE_ENST00000452085.3_Missense_Mutation_p.I120F|DSE_ENST00000359564.2_Missense_Mutation_p.I120F|DSE_ENST00000540275.1_3'UTR			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	120					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TCCTGAGAACATTGAAGCCCG	0.488																																					p.I120F		.											.	DSE	91	0			c.A358T						.						78.0	79.0	79.0					6																	116720771		2203	4300	6503	SO:0001583	missense	29940	exon2			GAGAACATTGAAG	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.358A>T	6.37:g.116720771A>T	ENSP00000332151:p.Ile120Phe	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	25.0	NM_001080976	Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.453416	0.43531	.	.	ENSG00000111817	ENST00000430252;ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T;T	0.42900	1.83;0.96;0.96;0.96;0.96	5.45	1.6	0.23607	.	0.532258	0.21368	N	0.075689	T	0.11495	0.0280	N	0.22421	0.69	0.28156	N	0.929203	B;B	0.14012	0.009;0.009	B;B	0.20767	0.031;0.009	T	0.23119	-1.0197	10	0.56958	D	0.05	-3.7785	7.777	0.29043	0.6693:0.2628:0.0679:0.0	.	139;120	B7Z765;Q9UL01	.;DSE_HUMAN	F	120;120;139;120;120	ENSP00000397597:I120F;ENSP00000404049:I120F;ENSP00000441152:I139F;ENSP00000332151:I120F;ENSP00000352567:I120F	ENSP00000332151:I120F	I	+	1	0	DSE	116827464	0.997000	0.39634	0.933000	0.37362	0.992000	0.81027	1.663000	0.37429	0.125000	0.18397	0.528000	0.53228	ATT	.		0.488	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352	
ENOX2	10495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	129813673	129813673	+	Silent	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chrX:129813673T>C	ENST00000370927.1	-	4	411	c.390A>G	c.(388-390)gtA>gtG	p.V130V	ENOX2_ENST00000338144.3_Silent_p.V130V|ENOX2_ENST00000394363.1_Silent_p.V101V|ENOX2_ENST00000492263.1_5'UTR|ENOX2_ENST00000370935.1_Silent_p.V101V			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	130	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						CACCCACAAATACTGTTTTGC	0.443																																					p.V130V	Ovarian(101;828 1506 2951 9500 35258)	.											.	ENOX2	131	0			c.A390G						.						120.0	103.0	109.0					X																	129813673		2203	4300	6503	SO:0001819	synonymous_variant	10495	exon7			CACAAATACTGTT	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.390A>G	X.37:g.129813673T>C		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	65.0	NM_182314	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Silent	SNP	ENST00000370927.1	37	CCDS14626.1																																																																																			.		0.443	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314	
FAM19A2	338811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	62148740	62148740	+	Missense_Mutation	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:62148740T>C	ENST00000416284.3	-	3	1756	c.172A>G	c.(172-174)Ata>Gta	p.I58V	FAM19A2_ENST00000551619.1_Missense_Mutation_p.I58V|FAM19A2_ENST00000550003.1_5'UTR|FAM19A2_ENST00000551449.1_Intron	NM_178539.4	NP_848634.1	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A2	58						cytoplasm (GO:0005737)				endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	15			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		CGTTCTTCTATCTTGTTCTTA	0.483																																					p.I58V		.											.	FAM19A2	515	0			c.A172G						.						206.0	143.0	164.0					12																	62148740		2203	4300	6503	SO:0001583	missense	338811	exon3			CTTCTATCTTGTT	AY325115	CCDS8962.1	12q14.1	2012-10-03			ENSG00000198673	ENSG00000198673			21589	protein-coding gene	gene with protein product						15028294	Standard	NM_178539		Approved	TAFA-2	uc001sqw.3	Q8N3H0	OTTHUMG00000170207	ENST00000416284.3:c.172A>G	12.37:g.62148740T>C	ENSP00000393987:p.Ile58Val	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	37.0	NM_178539	B3KVV4|Q4G0R9|Q68DK0|Q6GTX6	Missense_Mutation	SNP	ENST00000416284.3	37	CCDS8962.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360113	0.82353	.	.	ENSG00000198673	ENST00000416284;ENST00000551619;ENST00000552075;ENST00000549958;ENST00000548780	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.77665	0.4164	M	0.70903	2.155	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.78324	-0.2248	8	.	.	.	.	15.511	0.75782	0.0:0.0:0.0:1.0	.	58	Q8N3H0	F19A2_HUMAN	V	58;58;59;65;59	.	.	I	-	1	0	FAM19A2	60435007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.969000	0.87988	2.067000	0.61834	0.456000	0.33151	ATA	.		0.483	FAM19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407967.2	NM_178539	
FAM83H	286077	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	144810754	144810754	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr8:144810754G>A	ENST00000388913.3	-	5	1002	c.877C>T	c.(877-879)Cgc>Tgc	p.R293C		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	293					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCGTCCATGCGGGCCAGGGCC	0.697																																					p.R293C		.											.	FAM83H	92	0			c.C877T						.						10.0	12.0	11.0					8																	144810754		1934	4099	6033	SO:0001583	missense	286077	exon5			CCATGCGGGCCAG	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.877C>T	8.37:g.144810754G>A	ENSP00000373565:p.Arg293Cys	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	34.0	NM_198488	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	g	15.62	2.887816	0.52014	.	.	ENSG00000180921	ENST00000388913	T	0.15603	2.41	4.75	3.8	0.43715	.	0.840786	0.09676	U	0.770482	T	0.21387	0.0515	N	0.24115	0.695	0.37036	D	0.896905	D	0.76494	0.999	P	0.54706	0.759	T	0.10064	-1.0646	10	0.62326	D	0.03	.	10.466	0.44607	0.0:0.0:0.6459:0.3541	.	293	Q6ZRV2	FA83H_HUMAN	C	293	ENSP00000373565:R293C	ENSP00000373565:R293C	R	-	1	0	FAM83H	144882742	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	2.684000	0.46951	2.326000	0.78906	0.561000	0.74099	CGC	.		0.697	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
FANCD2	2177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10076196	10076196	+	Silent	SNP	G	G	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr3:10076196G>C	ENST00000419585.1	+	4	410	c.249G>C	c.(247-249)ctG>ctC	p.L83L	FANCD2_ENST00000383807.1_Silent_p.L83L|FANCD2_ENST00000431693.1_Silent_p.L83L|FANCD2_ENST00000287647.3_Silent_p.L83L|FANCD2_ENST00000383806.1_Silent_p.L83L			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	83	Interaction with FANCE.				DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TTCAGACCCTGAGGAGACACC	0.403			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L83L		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	229	0			c.G249C						.						151.0	157.0	155.0					3																	10076196		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon4	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GACCCTGAGGAGA	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.249G>C	3.37:g.10076196G>C		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	27.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			.		0.403	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	45650881	45650882	+	Frame_Shift_Ins	INS	-	-	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr14:45650881_45650882insA	ENST00000267430.5	+	16	4444_4445	c.4359_4360insA	c.(4360-4362)aaafs	p.K1454fs	FANCM_ENST00000555013.1_3'UTR|FANCM_ENST00000542564.2_Frame_Shift_Ins_p.K1428fs	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1454					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TTCATGCTGTCAAAAAGCGCAG	0.317								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V1453fs		.											.	FANCM	569	0			c.4359_4360insA						.																																			SO:0001589	frameshift_variant	57697	exon16	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TGCTGTCAAAAAG	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4364dupA	14.37:g.45650886_45650886dupA	ENSP00000267430:p.Lys1454fs	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	32.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Frame_Shift_Ins	INS	ENST00000267430.5	37	CCDS32070.1																																																																																			.		0.317	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
FAT1	2195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	187539094	187539094	+	Silent	SNP	A	A	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr4:187539094A>G	ENST00000441802.2	-	10	8855	c.8646T>C	c.(8644-8646)aaT>aaC	p.N2882N		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2882	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TAATCTGGTAATTGTCTCTCT	0.418										HNSCC(5;0.00058)																											p.N2882N	Colon(197;1040 2055 4143 4984 49344)	.											.	FAT1	34	0			c.T8646C						.						184.0	165.0	171.0					4																	187539094		1964	4158	6122	SO:0001819	synonymous_variant	2195	exon10			CTGGTAATTGTCT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8646T>C	4.37:g.187539094A>G		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	28.0	NM_005245		Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																			.		0.418	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
FGD6	55785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	95603889	95603889	+	Missense_Mutation	SNP	T	T	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:95603889T>G	ENST00000343958.4	-	2	1394	c.1171A>C	c.(1171-1173)Aac>Cac	p.N391H	FGD6_ENST00000546711.1_Missense_Mutation_p.N391H|FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000549499.1_Missense_Mutation_p.N391H	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	391					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						GCATCACTGTTGGATTCCATA	0.338																																					p.N391H		.											.	FGD6	137	0			c.A1171C						.						155.0	154.0	154.0					12																	95603889		2203	4300	6503	SO:0001583	missense	55785	exon2			CACTGTTGGATTC	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1171A>C	12.37:g.95603889T>G	ENSP00000344446:p.Asn391His	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	22.0	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	.	.	.	.	.	.	.	.	.	.	T	2.479	-0.320147	0.05386	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.68025	-0.19;-0.3;-0.21	5.71	1.97	0.26223	.	0.821389	0.10634	N	0.651848	T	0.50735	0.1633	L	0.44542	1.39	0.09310	N	1	P	0.35600	0.511	B	0.31751	0.135	T	0.47142	-0.9140	10	0.49607	T	0.09	-1.4466	1.5446	0.02562	0.1644:0.1649:0.1156:0.5551	.	391	Q6ZV73	FGD6_HUMAN	H	391	ENSP00000344446:N391H;ENSP00000450342:N391H;ENSP00000449005:N391H	ENSP00000344446:N391H	N	-	1	0	FGD6	94128020	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.067000	0.11579	0.412000	0.25729	0.459000	0.35465	AAC	.		0.338	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152277443	152277443	+	Missense_Mutation	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:152277443G>T	ENST00000368799.1	-	3	9954	c.9919C>A	c.(9919-9921)Cag>Aag	p.Q3307K	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3307	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGACTGCTGGTGGCGGGAT	0.572									Ichthyosis																												p.Q3307K		.											.	FLG	106	0			c.C9919A						.						391.0	384.0	386.0					1																	152277443		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACTGCTGGTGGCG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9919C>A	1.37:g.152277443G>T	ENSP00000357789:p.Gln3307Lys	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	101.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	9.636	1.137653	0.21123	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.00724	5.78	3.18	-4.02	0.04034	.	.	.	.	.	T	0.00998	0.0033	L	0.57536	1.79	0.09310	N	1	P	0.50617	0.937	P	0.62089	0.898	T	0.09292	-1.0681	9	0.37606	T	0.19	.	14.928	0.70893	0.0:0.7461:0.2539:0.0	.	3307	P20930	FILA_HUMAN	K	3307;245	ENSP00000357789:Q3307K	ENSP00000357786:Q245K	Q	-	1	0	FLG	150544067	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.090000	0.03372	-0.701000	0.05063	-0.876000	0.02978	CAG	.		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	152287879	152287879	+	Nonsense_Mutation	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:152287879A>T	ENST00000368799.1	-	2	89	c.54T>A	c.(52-54)taT>taA	p.Y18*	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	18	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTTTTTTGAATATTGCTTGA	0.338									Ichthyosis																												p.Y18X		.											.	FLG	106	0			c.T54A						.						118.0	117.0	118.0					1																	152287879		2202	4300	6502	SO:0001587	stop_gained	2312	exon2	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TTTTGAATATTGC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.54T>A	1.37:g.152287879A>T	ENSP00000357789:p.Tyr18*	Somatic	327.0	0.0		WXS	Illumina HiSeq	Phase_I	437.0	87.0	NM_002016	Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.435657	0.62955	.	.	ENSG00000143631	ENST00000368799	.	.	.	5.2	1.68	0.24146	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.5857	6.4054	0.21662	0.7042:0.0:0.2958:0.0	.	.	.	.	X	18	.	ENSP00000357789:Y18X	Y	-	3	2	FLG	150554503	0.556000	0.26538	0.501000	0.27601	0.032000	0.12392	0.173000	0.16724	0.131000	0.18576	0.456000	0.33151	TAT	.		0.338	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
GABRG2	2566	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	161569259	161569259	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:161569259G>A	ENST00000361925.4	+	7	1079	c.859G>A	c.(859-861)Gtc>Atc	p.V287I	GABRG2_ENST00000356592.3_Missense_Mutation_p.V287I|GABRG2_ENST00000414552.2_Missense_Mutation_p.V327I|GABRG2_ENST00000393933.4_Missense_Mutation_p.V192I			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	287					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CACACTCATTGTCGTCCTATC	0.438																																					p.V327I		.											.	GABRG2	95	0			c.G979A						.						273.0	230.0	245.0					5																	161569259		2203	4300	6503	SO:0001583	missense	2566	exon8			CTCATTGTCGTCC		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.859G>A	5.37:g.161569259G>A	ENSP00000354651:p.Val287Ile	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	39.0	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	37	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	G	35	5.492648	0.96339	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31	5.75	5.75	0.90469	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.92724	0.7687	M	0.69185	2.1	0.80722	D	1	D;P;P	0.60160	0.987;0.944;0.931	D;P;P	0.64410	0.925;0.877;0.805	D	0.92858	0.6303	10	0.87932	D	0	.	19.9447	0.97177	0.0:0.0:1.0:0.0	.	327;287;287	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	I	287;327;287;192;192	ENSP00000349000:V287I;ENSP00000410732:V327I;ENSP00000354651:V287I;ENSP00000377510:V192I;ENSP00000430182:V192I	ENSP00000349000:V287I	V	+	1	0	GABRG2	161501837	1.000000	0.71417	0.156000	0.22583	0.992000	0.81027	9.751000	0.98889	2.719000	0.93026	0.655000	0.94253	GTC	.		0.438	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
GAPVD1	26130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	128094293	128094293	+	Missense_Mutation	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr9:128094293G>T	ENST00000495955.1	+	14	2552	c.2262G>T	c.(2260-2262)agG>agT	p.R754S	GAPVD1_ENST00000297933.6_Missense_Mutation_p.R754S|GAPVD1_ENST00000312123.9_Missense_Mutation_p.R733S|GAPVD1_ENST00000394083.2_Missense_Mutation_p.R733S|GAPVD1_ENST00000265956.4_Missense_Mutation_p.R754S|GAPVD1_ENST00000394104.2_Missense_Mutation_p.R754S|GAPVD1_ENST00000470056.1_Missense_Mutation_p.R754S|GAPVD1_ENST00000394105.2_Missense_Mutation_p.R754S			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	754					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CGGATGTCAGGGAGGTCAGTT	0.532																																					p.R754S		.											.	GAPVD1	93	0			c.G2262T						.						113.0	90.0	98.0					9																	128094293		2203	4300	6503	SO:0001583	missense	26130	exon12			TGTCAGGGAGGTC		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.2262G>T	9.37:g.128094293G>T	ENSP00000419063:p.Arg754Ser	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	22.0	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	ENST00000495955.1	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	22.4|22.4|22.4	4.280191|4.280191|4.280191	0.80692|0.80692|0.80692	.|.|.	.|.|.	ENSG00000165219|ENSG00000165219|ENSG00000165219	ENST00000431329|ENST00000436712|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|.|T;T;T;T;T;T;T;T;T	.|.|0.13657	.|.|2.57;2.57;2.57;2.57;2.57;2.57;2.57;2.57;2.57	6.01|6.01|6.01	6.01|6.01|6.01	0.97437|0.97437|0.97437	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|.|T	0.17831|.|0.17831	0.0428|.|0.0428	N|N|N	0.14661|0.14661|0.14661	0.345|0.345|0.345	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D;D;D	.|.|0.63046	.|.|0.981;0.967;0.981;0.981;0.981;0.992	.|.|D;D;D;D;D;D	.|.|0.71656	.|.|0.962;0.916;0.962;0.962;0.962;0.974	T|.|T	0.13791|.|0.13791	-1.0496|.|-1.0496	5|.|10	.|.|0.12430	.|.|T	.|.|0.62	.|.|.	12.7684|12.7684|12.7684	0.57405|0.57405|0.57405	0.0742:0.0:0.9258:0.0|0.0742:0.0:0.9258:0.0|0.0742:0.0:0.9258:0.0	.|.|.	.|.|754;754;754;733;754;754	.|.|Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6	.|.|.;GAPD1_HUMAN;.;.;.;.	V|X|S	617|591|754;754;754;754;733;754;754;754;733	.|.|ENSP00000419767:R754S;ENSP00000377665:R754S;ENSP00000377664:R754S;ENSP00000265956:R754S;ENSP00000377645:R733S;ENSP00000419063:R754S;ENSP00000418747:R754S;ENSP00000297933:R754S;ENSP00000309582:R733S	.|.|ENSP00000265956:R754S	G|G|R	+|+|+	2|1|3	0|0|2	GAPVD1|GAPVD1|GAPVD1	127134114|127134114|127134114	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	6.419000|6.419000|6.419000	0.73345|0.73345|0.73345	2.850000|2.850000|2.850000	0.98022|0.98022|0.98022	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GGG|GGA|AGG	.		0.532	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
GPATCH8	23131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42552196	42552196	+	Splice_Site	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr17:42552196C>A	ENST00000591680.1	-	2	151		c.e2+1		GPATCH8_ENST00000434000.1_Splice_Site|GPATCH8_ENST00000588554.1_Missense_Mutation_p.V41L|GPATCH8_ENST00000592154.1_Splice_Site	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8								metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GATTATCTTACCGATTCTATA	0.358																																					.		.											.	GPATCH8	94	0			c.120+1G>T						.						108.0	85.0	93.0					17																	42552196		2202	4299	6501	SO:0001630	splice_region_variant	23131	exon3			ATCTTACCGATTC	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.120+1G>T	17.37:g.42552196C>A		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	27.0	NM_001002909	B9EGP9|O60300|Q8TB99	Splice_Site	SNP	ENST00000591680.1	37	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	C	31	5.088341	0.94100	.	.	ENSG00000186566	ENST00000335500;ENST00000541307	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9771	0.97313	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPATCH8	39907722	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.980000	0.70516	2.894000	0.99253	0.655000	0.94253	.	.		0.358	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	Intron
HIF3A	64344	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46815884	46815884	+	Silent	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr19:46815884T>C	ENST00000377670.4	+	8	1030	c.999T>C	c.(997-999)agT>agC	p.S333S	HIF3A_ENST00000600383.1_Silent_p.S264S|HIF3A_ENST00000472815.1_Silent_p.S264S|HIF3A_ENST00000244303.6_Silent_p.S264S|HIF3A_ENST00000339613.2_Silent_p.S277S|HIF3A_ENST00000420102.2_Silent_p.S282S|HIF3A_ENST00000300862.3_Silent_p.S331S	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	333					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		AGTCGGAGAGTATCGTCTGTG	0.602																																					p.S333S		.											.	HIF3A	228	0			c.T999C						.						79.0	77.0	77.0					19																	46815884		2203	4300	6503	SO:0001819	synonymous_variant	64344	exon8			GGAGAGTATCGTC	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.999T>C	19.37:g.46815884T>C		Somatic	120.0	1.0		WXS	Illumina HiSeq	Phase_I	97.0	26.0	NM_152795	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Silent	SNP	ENST00000377670.4	37	CCDS12681.2	.	.	.	.	.	.	.	.	.	.	T	10.98	1.503303	0.26949	.	.	ENSG00000124440	ENST00000472815	.	.	.	4.75	-1.64	0.08318	.	.	.	.	.	T	0.55862	0.1947	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52403	-0.8580	4	.	.	.	.	10.7554	0.46234	0.0:0.6672:0.0:0.3328	.	.	.	.	H	306	.	.	Y	+	1	0	HIF3A	51507724	0.144000	0.22641	0.992000	0.48379	0.982000	0.71751	-0.577000	0.05847	-0.230000	0.09840	0.482000	0.46254	TAT	.		0.602	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3		
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	12122422	12122422	+	Silent	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:12122422A>T	ENST00000379388.2	+	4	2726	c.2394A>T	c.(2392-2394)ccA>ccT	p.P798P		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	798					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATTTAAAACCAGTGGGACGGA	0.418																																					p.P798P		.											.	HIVEP1	139	0			c.A2394T						.						112.0	105.0	107.0					6																	12122422		1884	4103	5987	SO:0001819	synonymous_variant	3096	exon4			AAAACCAGTGGGA	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.2394A>T	6.37:g.12122422A>T		Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	75.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	ENST00000379388.2	37	CCDS43426.1																																																																																			.		0.418	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
HLCS	3141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	38128887	38128887	+	Silent	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr21:38128887C>A	ENST00000399120.1	-	11	3195	c.1965G>T	c.(1963-1965)ggG>ggT	p.G655G	HLCS_ENST00000336648.4_Silent_p.G655G	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	655					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CGCTGTTGGGCCCTTTGTCCT	0.458																																					p.G655G		.											.	HLCS	157	0			c.G1965T						.						193.0	157.0	169.0					21																	38128887		2203	4300	6503	SO:0001819	synonymous_variant	3141	exon11			GTTGGGCCCTTTG		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1965G>T	21.37:g.38128887C>A		Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	44.0	NM_000411	B2RAH1|D3DSG6|Q99451	Silent	SNP	ENST00000399120.1	37	CCDS13647.1																																																																																			.		0.458	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		
HMGCLL1	54511	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	55378944	55378944	+	Silent	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:55378944G>A	ENST00000398661.2	-	6	665	c.534C>T	c.(532-534)tcC>tcT	p.S178S	HMGCLL1_ENST00000508459.1_Intron|HMGCLL1_ENST00000308161.4_Silent_p.S116S|HMGCLL1_ENST00000274901.4_Silent_p.S148S|HMGCLL1_ENST00000428842.1_Silent_p.S116S|HMGCLL1_ENST00000370850.2_Intron	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	178					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			TCTTGCTAAAGGATTCAGATG	0.353																																					p.S178S	Ovarian(35;840 893 7837 15538 42887)	.											.	HMGCLL1	94	0			c.C534T						.						73.0	68.0	70.0					6																	55378944		1817	4070	5887	SO:0001819	synonymous_variant	54511	exon6			GCTAAAGGATTCA	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.534C>T	6.37:g.55378944G>A		Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	92.0	49.0	NM_019036	B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Silent	SNP	ENST00000398661.2	37	CCDS43475.1																																																																																			.		0.353	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383	
IGF2R	3482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160494446	160494446	+	Missense_Mutation	SNP	A	A	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:160494446A>G	ENST00000356956.1	+	34	5040	c.4892A>G	c.(4891-4893)aAg>aGg	p.K1631R		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1631					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TCCCTGGACAAGCAGACATGC	0.577																																					p.K1631R		.											.	IGF2R	118	0			c.A4892G						.						135.0	111.0	119.0					6																	160494446		2203	4300	6503	SO:0001583	missense	3482	exon34			TGGACAAGCAGAC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.4892A>G	6.37:g.160494446A>G	ENSP00000349437:p.Lys1631Arg	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	25.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.105052	0.56291	.	.	ENSG00000197081	ENST00000356956	T	0.02121	4.44	5.3	5.3	0.74995	Mannose-6-phosphate receptor, binding (1);	0.384799	0.29260	N	0.012676	T	0.01558	0.0050	L	0.43152	1.355	0.31838	N	0.623782	B	0.34226	0.443	B	0.42555	0.391	T	0.50110	-0.8866	10	0.36615	T	0.2	-5.7255	9.9754	0.41779	0.9238:0.0:0.0762:0.0	.	1631	P11717	MPRI_HUMAN	R	1631	ENSP00000349437:K1631R	ENSP00000349437:K1631R	K	+	2	0	IGF2R	160414436	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.448000	0.66612	2.132000	0.65825	0.459000	0.35465	AAG	.		0.577	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
IGF2R	3482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160523558	160523558	+	Missense_Mutation	SNP	T	T	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:160523558T>G	ENST00000356956.1	+	46	6998	c.6850T>G	c.(6850-6852)Ttt>Gtt	p.F2284V	IGF2R_ENST00000475584.1_3'UTR	NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	2284					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CAGGGTGGGCTTTGACAGCGA	0.642																																					p.F2284V		.											.	IGF2R	118	0			c.T6850G						.						60.0	53.0	56.0					6																	160523558		2202	4300	6502	SO:0001583	missense	3482	exon46			GTGGGCTTTGACA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.6850T>G	6.37:g.160523558T>G	ENSP00000349437:p.Phe2284Val	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	31.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	T	8.583	0.882728	0.17467	.	.	ENSG00000197081	ENST00000356956	T	0.08102	3.13	5.34	-0.16	0.13375	.	0.727958	0.13098	N	0.414034	T	0.02193	0.0068	M	0.63428	1.95	0.09310	N	1	B	0.10296	0.003	B	0.14023	0.01	T	0.45483	-0.9258	10	0.15952	T	0.53	-7.7614	4.0838	0.09939	0.1878:0.4092:0.0:0.403	.	2284	P11717	MPRI_HUMAN	V	2284	ENSP00000349437:F2284V	ENSP00000349437:F2284V	F	+	1	0	IGF2R	160443548	0.001000	0.12720	0.010000	0.14722	0.023000	0.10783	0.087000	0.14958	0.342000	0.23796	0.482000	0.46254	TTT	.		0.642	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	133790932	133790932	+	Silent	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr11:133790932G>A	ENST00000321016.8	-	18	2918	c.2688C>T	c.(2686-2688)aaC>aaT	p.N896N	IGSF9B_ENST00000533871.2_Silent_p.N896N			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	896					homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GTGGGTCCTCGTTCTCCTCGT	0.647																																					p.N896N		.											.	IGSF9B	68	0			c.C2688T						.						75.0	91.0	86.0					11																	133790932		2123	4205	6328	SO:0001819	synonymous_variant	22997	exon18			GTCCTCGTTCTCC	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.2688C>T	11.37:g.133790932G>A		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	10.0	NM_014987	G5EA26	Silent	SNP	ENST00000321016.8	37																																																																																				.		0.647	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
INSRR	3645	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156815580	156815580	+	Missense_Mutation	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:156815580C>T	ENST00000368195.3	-	10	2401	c.2005G>A	c.(2005-2007)Gat>Aat	p.D669N	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	669	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AAGCGCGGATCGTTGTTGCTG	0.682																																					p.D669N		.											.	INSRR	1403	0			c.G2005A						.						26.0	23.0	24.0					1																	156815580		2203	4298	6501	SO:0001583	missense	3645	exon10			GCGGATCGTTGTT	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2005G>A	1.37:g.156815580C>T	ENSP00000357178:p.Asp669Asn	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	70.0	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270751	0.40194	.	.	ENSG00000027644	ENST00000368195	T	0.71817	-0.6	4.69	4.69	0.59074	Fibronectin, type III (3);	0.000000	0.51477	D	0.000099	T	0.41858	0.1177	.	.	.	0.35068	D	0.762207	B	0.20052	0.041	B	0.08055	0.003	T	0.27088	-1.0084	9	0.21014	T	0.42	.	15.4999	0.75691	0.0:1.0:0.0:0.0	.	669	P14616	INSRR_HUMAN	N	669	ENSP00000357178:D669N	ENSP00000357178:D669N	D	-	1	0	INSRR	155082204	0.988000	0.35896	1.000000	0.80357	0.839000	0.47603	2.734000	0.47368	2.606000	0.88127	0.561000	0.74099	GAT	.		0.682	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	
KLF15	28999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126071030	126071030	+	Missense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr3:126071030C>A	ENST00000296233.3	-	2	966	c.736G>T	c.(736-738)Gtc>Ttc	p.V246F	KLF15_ENST00000509675.1_5'Flank	NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	246					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		GCAACCTTGACATTCTCTGGG	0.622																																					p.V246F		.											.	KLF15	91	0			c.G736T						.						36.0	27.0	30.0					3																	126071030		2202	4299	6501	SO:0001583	missense	28999	exon2			CCTTGACATTCTC	AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.736G>T	3.37:g.126071030C>A	ENSP00000296233:p.Val246Phe	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	38.0	NM_014079		Missense_Mutation	SNP	ENST00000296233.3	37	CCDS3036.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827128	0.50739	.	.	ENSG00000163884	ENST00000296233	T	0.08546	3.08	4.44	2.62	0.31277	.	0.152058	0.56097	D	0.000024	T	0.09468	0.0233	L	0.50333	1.59	0.40588	D	0.981462	P	0.50272	0.933	P	0.46479	0.518	T	0.15122	-1.0448	10	0.38643	T	0.18	.	5.2394	0.15464	0.0:0.6723:0.0:0.3277	.	246	Q9UIH9	KLF15_HUMAN	F	246	ENSP00000296233:V246F	ENSP00000296233:V246F	V	-	1	0	KLF15	127553720	0.999000	0.42202	0.845000	0.33349	0.937000	0.57800	1.717000	0.37991	1.177000	0.42855	0.491000	0.48974	GTC	.		0.622	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
KNDC1	85442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	135015133	135015133	+	Missense_Mutation	SNP	G	G	T	rs368551158		TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr10:135015133G>T	ENST00000304613.3	+	17	3139	c.3118G>T	c.(3118-3120)Gta>Tta	p.V1040L	KNDC1_ENST00000368571.2_Missense_Mutation_p.V975L|KNDC1_ENST00000368572.2_Missense_Mutation_p.V1042L			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1040					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TCAGAGGTCCGTAAAAGCCGA	0.667																																					p.V1040L		.											.	KNDC1	229	0			c.G3118T						.						45.0	53.0	50.0					10																	135015133		2203	4300	6503	SO:0001583	missense	85442	exon17			AGGTCCGTAAAAG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3118G>T	10.37:g.135015133G>T	ENSP00000304437:p.Val1040Leu	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	35.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.337933	0.41398	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.11495	2.77;2.77;2.77	5.06	-4.93	0.03066	.	0.964186	0.08524	N	0.932960	T	0.08268	0.0206	L	0.51422	1.61	0.09310	N	1	P;B;P	0.35844	0.484;0.023;0.524	B;B;B	0.31390	0.097;0.016;0.129	T	0.21177	-1.0253	10	0.48119	T	0.1	-6.0095	6.3875	0.21569	0.6225:0.2391:0.1383:0.0	.	1040;975;1040	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	L	1040;1042;975	ENSP00000304437:V1040L;ENSP00000357561:V1042L;ENSP00000357560:V975L	ENSP00000304437:V1040L	V	+	1	0	KNDC1	134865123	0.000000	0.05858	0.000000	0.03702	0.576000	0.36127	-0.517000	0.06275	-0.891000	0.03940	-0.657000	0.03884	GTA	.		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KRT79	338785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53223841	53223841	+	Missense_Mutation	SNP	T	T	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:53223841T>G	ENST00000330553.5	-	4	855	c.821A>C	c.(820-822)cAg>cCg	p.Q274P		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	274	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTCAATCTCCTGGGTCAAGGT	0.542																																					p.Q274P		.											.	KRT79	72	0			c.A821C						.						139.0	113.0	122.0					12																	53223841		2203	4300	6503	SO:0001583	missense	338785	exon4			ATCTCCTGGGTCA	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.821A>C	12.37:g.53223841T>G	ENSP00000328358:p.Gln274Pro	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	26.0	NM_175834	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	CCDS8839.1	.	.	.	.	.	.	.	.	.	.	T	18.55	3.647889	0.67358	.	.	ENSG00000185640	ENST00000330553	D	0.88975	-2.45	4.54	3.39	0.38822	Filament (1);	0.653695	0.13294	N	0.398792	D	0.87172	0.6111	M	0.64404	1.975	0.32998	D	0.525895	B	0.30542	0.284	B	0.34346	0.18	D	0.88158	0.2855	10	0.87932	D	0	.	8.717	0.34416	0.0:0.0914:0.0:0.9086	.	274	Q5XKE5	K2C79_HUMAN	P	274	ENSP00000328358:Q274P	ENSP00000328358:Q274P	Q	-	2	0	KRT79	51510108	1.000000	0.71417	0.388000	0.26195	0.981000	0.71138	5.601000	0.67606	1.063000	0.40649	0.533000	0.62120	CAG	.		0.542	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
KRTAP19-1	337882	broad.mit.edu;ucsc.edu;mdanderson.org	37	21	31852477	31852477	+	Nonsense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr21:31852477C>A	ENST00000390689.2	-	1	186	c.160G>T	c.(160-162)Gga>Tga	p.G54*		NM_181607.1	NP_853638.1	Q8IUB9	KR191_HUMAN	keratin associated protein 19-1	54	26 X 2 AA repeats of G-[YCGS].					intermediate filament (GO:0005882)		p.G54*(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						GAGCCATATCCGTAGCTTCCA	0.562																																					p.G54X		.											.	KRTAP19-1	68	1	Substitution - Nonsense(1)	lung(1)	c.G160T						.						216.0	228.0	224.0					21																	31852477		2203	4300	6503	SO:0001587	stop_gained	337882	exon1			CATATCCGTAGCT	AJ457067	CCDS13594.1	21q22.1	2010-03-10			ENSG00000184351	ENSG00000184351		"""Keratin associated proteins"""	18936	protein-coding gene	gene with protein product						12359730	Standard	NM_181607		Approved	KAP19.1	uc011acx.2	Q8IUB9	OTTHUMG00000057768	ENST00000390689.2:c.160G>T	21.37:g.31852477C>A	ENSP00000375108:p.Gly54*	Somatic	106.0	1.0		WXS	Illumina HiSeq	Phase_I	116.0	23.0	NM_181607	A4QN27|Q3LI75	Nonsense_Mutation	SNP	ENST00000390689.2	37	CCDS13594.1	.	.	.	.	.	.	.	.	.	.	c	13.07	2.127821	0.37533	.	.	ENSG00000184351	ENST00000390689;ENST00000433652	.	.	.	3.76	-1.07	0.09968	.	.	.	.	.	.	.	.	.	.	.	0.29998	N	0.816232	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	1.983	0.03430	0.3164:0.4066:0.1676:0.1094	.	.	.	.	X	54;45	.	ENSP00000375108:G54X	G	-	1	0	KRTAP19-1	30774348	0.992000	0.36948	0.000000	0.03702	0.005000	0.04900	0.272000	0.18644	-0.013000	0.14199	0.491000	0.48974	GGA	.		0.562	KRTAP19-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128220.2		
L3MBTL2	83746	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41616796	41616796	+	Missense_Mutation	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr22:41616796G>T	ENST00000216237.5	+	7	935	c.777G>T	c.(775-777)tgG>tgT	p.W259C		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	259					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATGACTTCTGGTGCAACCTGG	0.542																																					p.W259C		.											.	L3MBTL2	92	0			c.G777T						.						148.0	122.0	131.0					22																	41616796		2203	4300	6503	SO:0001583	missense	83746	exon7			CTTCTGGTGCAAC	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.777G>T	22.37:g.41616796G>T	ENSP00000216237:p.Trp259Cys	Somatic	61.0	1.0		WXS	Illumina HiSeq	Phase_I	47.0	14.0	NM_031488	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	CCDS14011.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.10|16.10	3.026803|3.026803	0.54683|0.54683	.|.	.|.	ENSG00000100395|ENSG00000100395	ENST00000449635|ENST00000216237	.|T	.|0.39592	.|1.07	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.054398	.|0.85682	.|D	.|0.000000	T|T	0.74313|0.74313	0.3700|0.3700	M|M	0.92507|0.92507	3.315|3.315	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.999;1.0	T|T	0.80801|0.80801	-0.1220|-0.1220	5|10	.|0.87932	.|D	.|0	.|.	19.5068|19.5068	0.95121|0.95121	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|259;259	.|Q969R5-3;Q969R5	.|.;LMBL2_HUMAN	L|C	207|259	.|ENSP00000216237:W259C	.|ENSP00000216237:W259C	V|W	+|+	1|3	0|0	L3MBTL2|L3MBTL2	39946742|39946742	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	9.869000|9.869000	0.99810|0.99810	2.690000|2.690000	0.91761|0.91761	0.462000|0.462000	0.41574|0.41574	GTG|TGG	.		0.542	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488	
LINGO3	645191	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	2290105	2290105	+	Silent	SNP	C	C	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr19:2290105C>G	ENST00000585527.1	-	1	1918	c.1671G>C	c.(1669-1671)ggG>ggC	p.G557G	LINGO3_ENST00000404279.1_Silent_p.G557G			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	557						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						TTTTGTGCTGCCCGCGGCCGC	0.647																																					p.G557G		.											.	.	.	0			c.G1671C						.						16.0	20.0	19.0					19																	2290105		1952	4155	6107	SO:0001819	synonymous_variant	645191	exon2			GTGCTGCCCGCGG	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1671G>C	19.37:g.2290105C>G		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	29.0	NM_001101391		Silent	SNP	ENST00000585527.1	37	CCDS45905.1																																																																																			.		0.647	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391	
MAP10	54627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	232943321	232943321	+	Missense_Mutation	SNP	A	A	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:232943321A>G	ENST00000418460.1	+	1	2679	c.2552A>G	c.(2551-2553)tAt>tGt	p.Y851C		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	709	Ser-rich.				cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										AGCCCTTGCTATTCTGAAGAT	0.368																																					p.Y851C		.											.	.	.	0			c.A2552G						.						39.0	37.0	37.0					1																	232943321		1859	4097	5956	SO:0001583	missense	54627	exon1			CTTGCTATTCTGA	AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.2552A>G	1.37:g.232943321A>G	ENSP00000403208:p.Tyr851Cys	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	17.0	NM_019090	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	ENST00000418460.1	37	CCDS44334.1	.	.	.	.	.	.	.	.	.	.	A	9.895	1.205211	0.22205	.	.	ENSG00000212916	ENST00000418460	.	.	.	6.08	-0.784	0.10954	.	0.725019	0.11209	U	0.587917	T	0.18087	0.0434	L	0.28115	0.83	0.28640	N	0.907237	B	0.34200	0.441	B	0.28139	0.086	T	0.15378	-1.0439	9	0.40728	T	0.16	-1.4459	2.4469	0.04508	0.5292:0.2301:0.1301:0.1106	.	709	Q9P2G4	K1383_HUMAN	C	851	.	ENSP00000403208:Y851C	Y	+	2	0	KIAA1383	231009944	0.991000	0.36638	0.951000	0.38953	0.443000	0.32047	0.360000	0.20250	-0.073000	0.12842	-0.326000	0.08463	TAT	.		0.368	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092317.3	NM_019090	
MFSD3	113655	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	145735205	145735205	+	Missense_Mutation	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr8:145735205G>T	ENST00000301327.4	+	1	749	c.489G>T	c.(487-489)tgG>tgT	p.W163C	RECQL4_ENST00000532237.1_5'Flank|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3	163	Leu-rich.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CCTTCTCGTGGCCGCAACTCT	0.726											OREG0019059	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W163C		.											.	MFSD3	69	0			c.G489T						.						7.0	7.0	7.0					8																	145735205		2084	4077	6161	SO:0001583	missense	113655	exon1			CTCGTGGCCGCAA		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177	ENST00000301327.4:c.489G>T	8.37:g.145735205G>T	ENSP00000301327:p.Trp163Cys	Somatic	53.0	0.0	1696	WXS	Illumina HiSeq	Phase_I	121.0	56.0	NM_138431		Missense_Mutation	SNP	ENST00000301327.4	37	CCDS6431.1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198655	0.58126	.	.	ENSG00000167700	ENST00000301327	T	0.71934	-0.61	5.02	5.02	0.67125	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.86410	0.5926	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89046	0.3452	10	0.87932	D	0	-13.5672	16.1659	0.81754	0.0:0.0:1.0:0.0	.	163	Q96ES6	MFSD3_HUMAN	C	163	ENSP00000301327:W163C	ENSP00000301327:W163C	W	+	3	0	MFSD3	145706013	1.000000	0.71417	0.980000	0.43619	0.032000	0.12392	4.076000	0.57591	2.484000	0.83849	0.561000	0.74099	TGG	.		0.726	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
MTHFD2L	441024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	75040279	75040279	+	Missense_Mutation	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr4:75040279T>C	ENST00000395759.2	+	2	227	c.200T>C	c.(199-201)aTa>aCa	p.I67T	MTHFD2L_ENST00000325278.6_Missense_Mutation_p.I9T|MTHFD2L_ENST00000433372.1_5'UTR|MTHFD2L_ENST00000331145.6_Missense_Mutation_p.I9T	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	67					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			CAGAAAGAAATACAGCGAGGT	0.388																																					p.I67T		.											.	MTHFD2L	91	0			c.T200C						.						67.0	68.0	68.0					4																	75040279		2203	4300	6503	SO:0001583	missense	441024	exon2			AAGAAATACAGCG	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.200T>C	4.37:g.75040279T>C	ENSP00000379108:p.Ile67Thr	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	32.0	NM_001144978	Q6P079|Q8N560	Missense_Mutation	SNP	ENST00000395759.2	37	CCDS47075.1	.	.	.	.	.	.	.	.	.	.	T	15.86	2.959234	0.53400	.	.	ENSG00000163738	ENST00000395759;ENST00000331145;ENST00000359107;ENST00000325278	T;T;T;T	0.37235	1.63;1.25;1.21;1.63	5.36	4.14	0.48551	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	0.214037	0.51477	D	0.000085	T	0.42539	0.1207	M	0.64170	1.965	0.80722	D	1	P;P	0.38863	0.65;0.609	P;B	0.45913	0.497;0.197	T	0.44390	-0.9331	10	0.87932	D	0	-12.5868	9.7124	0.40254	0.0:0.0841:0.0:0.9159	.	67;9	Q9H903;Q9H903-3	MTD2L_HUMAN;.	T	67;9;9;9	ENSP00000379108:I67T;ENSP00000330982:I9T;ENSP00000352012:I9T;ENSP00000321984:I9T	ENSP00000321984:I9T	I	+	2	0	MTHFD2L	75259143	1.000000	0.71417	0.861000	0.33841	0.611000	0.37282	4.404000	0.59735	2.248000	0.74166	0.523000	0.50628	ATA	.		0.388	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004346	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	9088914	9088914	+	Nonsense_Mutation	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr19:9088914C>T	ENST00000397910.4	-	1	3104	c.2901G>A	c.(2899-2901)tgG>tgA	p.W967*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	967	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAGTCTCTGGCCAAGTTGTGC	0.468																																					p.W967X		.											.	MUC16	566	0			c.G2901A						.						237.0	230.0	232.0					19																	9088914		2010	4178	6188	SO:0001587	stop_gained	94025	exon1			CTCTGGCCAAGTT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2901G>A	19.37:g.9088914C>T	ENSP00000381008:p.Trp967*	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	35.0	NM_024690	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	41	8.930720	0.99006	.	.	ENSG00000181143	ENST00000397910	.	.	.	1.27	1.27	0.21489	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.9117	0.19031	0.0:1.0:0.0:0.0	.	.	.	.	X	967	.	ENSP00000381008:W967X	W	-	3	0	MUC16	8949914	0.000000	0.05858	0.002000	0.10522	0.481000	0.33189	-0.172000	0.09868	0.995000	0.38917	0.205000	0.17691	TGG	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NADK2	133686	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	36219713	36219713	+	Missense_Mutation	SNP	T	T	C	rs376035643		TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:36219713T>C	ENST00000381937.4	-	5	628	c.629A>G	c.(628-630)tAt>tGt	p.Y210C	NADK2-AS1_ENST00000501794.2_RNA|NADK2_ENST00000514504.1_Missense_Mutation_p.Y210C|NADK2_ENST00000282512.3_Missense_Mutation_p.Y47C|NADK2_ENST00000397338.1_Missense_Mutation_p.Y47C|NADK2_ENST00000506945.1_Missense_Mutation_p.Y47C	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	210					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										CTCACCACGATAGAACTTCTG	0.348																																					p.Y210C		.											.	NADKD1	92	0			c.A629G						.	T	CYS/TYR,CYS/TYR	2,4404	4.2+/-10.8	0,2,2201	114.0	109.0	111.0		629,140	-5.0	0.9	5		111	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NADKD1	NM_001085411.1,NM_153013.3	194,194	0,3,6500	CC,CT,TT		0.0116,0.0454,0.0231	probably-damaging,probably-damaging	210/443,47/280	36219713	3,13003	2203	4300	6503	SO:0001583	missense	133686	exon5			CCACGATAGAACT	BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.629A>G	5.37:g.36219713T>C	ENSP00000371362:p.Tyr210Cys	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	9.0	NM_001085411	B5MC93|Q6UTX5|Q96NM0	Missense_Mutation	SNP	ENST00000381937.4	37	CCDS47197.1	.	.	.	.	.	.	.	.	.	.	T	12.30	1.895917	0.33442	4.54E-4	1.16E-4	ENSG00000152620	ENST00000397338;ENST00000282512;ENST00000381937;ENST00000506945;ENST00000514504;ENST00000511088	T;T;T;T;T;T	0.42900	0.96;0.96;0.98;0.96;0.98;0.96	5.77	-5.04	0.02964	ATP-NAD kinase, PpnK-type, alpha/beta (1);ATP-NAD kinase, PpnK-type (1);	0.703006	0.15269	N	0.271376	T	0.26376	0.0644	L	0.40543	1.245	0.25338	N	0.988972	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.002;0.001;0.003	T	0.13522	-1.0506	10	0.41790	T	0.15	-1.0699	7.6134	0.28144	0.0:0.1977:0.4572:0.345	.	47;210;210	B7Z8V7;Q4G0N4-2;Q4G0N4	.;.;NAKD1_HUMAN	C	47;47;210;47;210;47	ENSP00000380499:Y47C;ENSP00000282512:Y47C;ENSP00000371362:Y210C;ENSP00000422250:Y47C;ENSP00000421029:Y210C;ENSP00000426084:Y47C	ENSP00000282512:Y47C	Y	-	2	0	NADKD1	36255470	0.997000	0.39634	0.877000	0.34402	0.929000	0.56500	0.482000	0.22276	-0.748000	0.04753	-0.321000	0.08615	TAT	.		0.348	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367541.1	NM_153013	
NAT10	55226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	34152419	34152419	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr11:34152419G>A	ENST00000257829.3	+	13	1510	c.1304G>A	c.(1303-1305)aGc>aAc	p.S435N	NAT10_ENST00000531159.2_Missense_Mutation_p.S363N|NAT10_ENST00000527971.1_Intron	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	435						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				CGTCAACAGAGCGCCCAGAGC	0.567																																					p.S435N		.											.	NAT10	92	0			c.G1304A						.						108.0	98.0	102.0					11																	34152419		2202	4298	6500	SO:0001583	missense	55226	exon13			AACAGAGCGCCCA	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.1304G>A	11.37:g.34152419G>A	ENSP00000257829:p.Ser435Asn	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	16.0	NM_024662	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	ENST00000257829.3	37	CCDS7889.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.776677	0.70107	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.34275	1.37;1.37	5.53	5.53	0.82687	Domain of unknown function DUF699, exodeoxyribonuclease V alpha chain (1);	0.000000	0.85682	D	0.000000	T	0.38081	0.1027	L	0.52573	1.65	0.80722	D	1	B	0.20368	0.044	B	0.26614	0.071	T	0.12142	-1.0559	10	0.21540	T	0.41	-17.198	19.8251	0.96614	0.0:0.0:1.0:0.0	.	435	Q9H0A0	NAT10_HUMAN	N	435;363	ENSP00000257829:S435N;ENSP00000433011:S363N	ENSP00000257829:S435N	S	+	2	0	NAT10	34108995	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.689000	0.84165	2.763000	0.94921	0.561000	0.74099	AGC	.		0.567	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	113103884	113103884	+	Missense_Mutation	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr11:113103884C>T	ENST00000533760.1	+	12	1753	c.1154C>T	c.(1153-1155)cCa>cTa	p.P385L	NCAM1_ENST00000401611.2_Missense_Mutation_p.P512L|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Missense_Mutation_p.P503L	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	513	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CCCTCTTCACCATCCATCGAC	0.547																																					p.P539L		.											.	NCAM1	23	0			c.C1616T						.						67.0	68.0	68.0					11																	113103884		2023	4180	6203	SO:0001583	missense	4684	exon15			CTTCACCATCCAT		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1154C>T	11.37:g.113103884C>T	ENSP00000473281:p.Pro385Leu	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	22.0	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	C	34	5.293049	0.95546	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.79749	-0.58;-1.3	6.06	6.06	0.98353	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	D	0.90899	0.7140	.	.	.	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90796	0.4690	9	0.87932	D	0	-15.3726	20.6208	0.99490	0.0:1.0:0.0:0.0	.	513;503;513;503	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	L	385;512;503	ENSP00000384055:P512L;ENSP00000318472:P503L	ENSP00000318472:P503L	P	+	2	0	NCAM1	112609094	1.000000	0.71417	0.969000	0.41365	0.995000	0.86356	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	CCA	.		0.547	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
NLRX1	79671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	119054109	119054109	+	Silent	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr11:119054109C>A	ENST00000409109.1	+	10	3476	c.2889C>A	c.(2887-2889)gtC>gtA	p.V963V	PDZD3_ENST00000322712.4_5'Flank|NLRX1_ENST00000409991.1_Silent_p.V963V|NLRX1_ENST00000409265.4_Intron|PDZD3_ENST00000525131.1_5'Flank|PDZD3_ENST00000392817.2_5'Flank|NLRX1_ENST00000292199.2_Silent_p.V963V|NLRX1_ENST00000525863.1_Intron|PDZD3_ENST00000531114.1_5'Flank|PDZD3_ENST00000355547.5_5'Flank	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	963	LRRCT.|Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		AGGGCGAGGTCAGGGCCCTCC	0.622																																					p.V963V		.											.	NLRX1	92	0			c.C2889A						.						27.0	29.0	28.0					11																	119054109		2200	4295	6495	SO:0001819	synonymous_variant	79671	exon10			CGAGGTCAGGGCC	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.2889C>A	11.37:g.119054109C>A		Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	6.0	NM_024618	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Silent	SNP	ENST00000409109.1	37	CCDS8416.1																																																																																			.		0.622	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	
NPB	256933	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	79860624	79860624	+	Nonstop_Mutation	SNP	A	A	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr17:79860624A>G	ENST00000333383.7	+	2	547	c.378A>G	c.(376-378)tgA>tgG	p.*126W	NPB_ENST00000573081.1_Nonstop_Mutation_p.*157W|PCYT2_ENST00000538936.2_3'UTR	NM_148896.3	NP_683694.1	Q8NG41	NPB_HUMAN	neuropeptide B	0					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)						all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TCGCCGCCTGAGCCCGGACCT	0.761																																					p.X126W		.											.	.	.	0			c.A378G						.						17.0	23.0	21.0					17																	79860624		2179	4284	6463	SO:0001578	stop_lost	256933	exon2			CGCCTGAGCCCGG		CCDS11790.1	17q25.3	2013-02-26			ENSG00000183979	ENSG00000183979		"""Endogenous ligands"""	30099	protein-coding gene	gene with protein product	"""prepro-NPB"""	607996				12118011, 12401809	Standard	NM_148896		Approved	PPL7, PPNPB	uc002kcd.3	Q8NG41	OTTHUMG00000177983	ENST00000333383.7:c.378A>G	17.37:g.79860624A>G	ENSP00000332766:p.*126Trpext*41	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	53.0	NM_148896	A0AUX9|A6NJD6|B9EJC3	Missense_Mutation	SNP	ENST00000333383.7	37	CCDS11790.1	.	.	.	.	.	.	.	.	.	.	a	11.88	1.769416	0.31320	.	.	ENSG00000183979	ENST00000333383	.	.	.	3.61	3.61	0.41365	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9285	0.47205	1.0:0.0:0.0:0.0	.	.	.	.	W	126	.	.	X	+	3	0	NPB	77453916	1.000000	0.71417	0.264000	0.24511	0.126000	0.20510	3.761000	0.55242	1.494000	0.48533	0.454000	0.30748	TGA	.		0.761	NPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440109.2	NM_148896	
NUDCD3	23386	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44425666	44425666	+	Missense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr7:44425666C>A	ENST00000355451.7	-	6	1309	c.1030G>T	c.(1030-1032)Ggc>Tgc	p.G344C	NUDCD3_ENST00000460110.1_5'UTR	NM_015332.3	NP_056147.2	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3	344										endometrium(2)|large_intestine(1)|lung(3)|skin(1)	7						AATCGCTGGCCTCGGAAGGGA	0.532																																					p.G344C		.											.	NUDCD3	90	0			c.G1030T						.						90.0	82.0	85.0					7																	44425666		2203	4300	6503	SO:0001583	missense	23386	exon6			GCTGGCCTCGGAA	BC003691	CCDS5490.2	7p13-p12	2005-03-18			ENSG00000015676	ENSG00000015676			22208	protein-coding gene	gene with protein product		610296					Standard	NM_015332		Approved	KIAA1068	uc003tkz.3	Q8IVD9	OTTHUMG00000129174	ENST00000355451.7:c.1030G>T	7.37:g.44425666C>A	ENSP00000347626:p.Gly344Cys	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	19.0	NM_015332	Q9BTI3|Q9H7W9|Q9UPT4	Missense_Mutation	SNP	ENST00000355451.7	37	CCDS5490.2	.	.	.	.	.	.	.	.	.	.	C	32	5.146243	0.94603	.	.	ENSG00000015676	ENST00000355451;ENST00000338427	T	0.66280	-0.2	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.82157	0.4976	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83601	0.0128	10	0.87932	D	0	-18.37	19.8237	0.96607	0.0:1.0:0.0:0.0	.	344	Q8IVD9	NUDC3_HUMAN	C	344;100	ENSP00000347626:G344C	ENSP00000345922:G100C	G	-	1	0	NUDCD3	44392191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.507000	0.81676	2.786000	0.95864	0.655000	0.94253	GGC	.		0.532	NUDCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251248.3	NM_015332	
PCDHB16	57717	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140564287	140564287	+	Missense_Mutation	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:140564287G>T	ENST00000361016.2	+	1	3308	c.2153G>T	c.(2152-2154)aGg>aTg	p.R718M		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	718					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGAGGAGCAGGGCGGCCTCG	0.662																																					p.R718M		.											.	PCDHB16	92	0			c.G2153T						.						64.0	75.0	71.0					5																	140564287		2200	4296	6496	SO:0001583	missense	57717	exon1			GGAGCAGGGCGGC	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.2153G>T	5.37:g.140564287G>T	ENSP00000354293:p.Arg718Met	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	45.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	11.88	1.771170	0.31320	.	.	ENSG00000196963	ENST00000361016	T	0.14022	2.54	3.91	3.04	0.35103	.	0.981373	0.08278	N	0.970377	T	0.29652	0.0740	H	0.96015	3.755	0.09310	N	1	B	0.27416	0.178	B	0.28784	0.094	T	0.40831	-0.9542	10	0.62326	D	0.03	.	5.2203	0.15366	0.1875:0.0:0.6478:0.1647	.	718	Q9NRJ7	PCDBG_HUMAN	M	718	ENSP00000354293:R718M	ENSP00000354293:R718M	R	+	2	0	PCDHB16	140544471	0.184000	0.23200	0.002000	0.10522	0.054000	0.15201	1.391000	0.34475	0.640000	0.30582	-0.346000	0.07831	AGG	.		0.662	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB13	56123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140595793	140595793	+	Missense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:140595793C>A	ENST00000341948.4	+	1	2285	c.2098C>A	c.(2098-2100)Ctc>Atc	p.L700I		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	700					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGTCTTCGCTCTTCCTCTT	0.697																																					p.L700I		.											.	PCDHB13	93	0			c.C2098A						.						89.0	94.0	92.0					5																	140595793		2201	4293	6494	SO:0001583	missense	56123	exon1			TCTTCGCTCTTCC	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.2098C>A	5.37:g.140595793C>A	ENSP00000345491:p.Leu700Ile	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	28.0	NM_018933	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	-	19.49	3.837698	0.71373	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.28454	1.61	3.5	3.5	0.40072	.	.	.	.	.	T	0.57740	0.2074	M	0.92026	3.265	0.27852	N	0.94069	D	0.89917	1.0	D	0.74674	0.984	T	0.52064	-0.8625	9	0.51188	T	0.08	.	6.2763	0.20983	0.0:0.7031:0.1903:0.1066	.	700	Q9Y5F0	PCDBD_HUMAN	I	700;700;646	ENSP00000345491:L700I	ENSP00000345491:L700I	L	+	1	0	PCDHB13	140575977	0.003000	0.15002	0.996000	0.52242	0.548000	0.35241	0.290000	0.18975	1.688000	0.51068	0.298000	0.19748	CTC	.		0.697	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
PEG10	23089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	94293280	94293280	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr7:94293280G>A	ENST00000482108.1	+	2	891	c.412G>A	c.(412-414)Gag>Aag	p.E138K	PEG10_ENST00000488574.1_Missense_Mutation_p.E138K	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	138	Necessary for interaction with ALK1.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AGCAAAGCTGGAGCGCTCCCA	0.537																																					p.E214K		.											.	PEG10	23	0			c.G640A						.						93.0	99.0	97.0					7																	94293280		2049	4198	6247	SO:0001583	missense	23089	exon2			AAGCTGGAGCGCT	AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.412G>A	7.37:g.94293280G>A	ENSP00000417587:p.Glu138Lys	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	23.0	NM_001172438	Q96A68|Q9UPV1	Missense_Mutation	SNP	ENST00000482108.1	37	CCDS55126.1	.	.	.	.	.	.	.	.	.	.	G	11.64	1.698943	0.30142	.	.	ENSG00000242265	ENST00000482108;ENST00000488574	T;T	0.13657	2.57;2.57	4.23	2.16	0.27623	Retrotransposon gag protein (1);	.	.	.	.	T	0.07503	0.0189	N	0.12961	0.28	0.09310	N	0.999994	P;P	0.38300	0.626;0.626	B;B	0.34489	0.184;0.184	T	0.30090	-0.9990	9	0.31617	T	0.26	.	9.8918	0.41294	0.0:0.4088:0.5912:0.0	.	214;138	B4DSP0;Q86TG7	.;PEG10_HUMAN	K	138	ENSP00000417587:E138K;ENSP00000418944:E138K	ENSP00000417587:E138K	E	+	1	0	PEG10	94131216	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	2.221000	0.42917	1.092000	0.41356	0.555000	0.69702	GAG	.		0.537	PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340751.1	NM_015068	
PITPNM1	9600	ucsc.edu;bcgsc.ca	37	11	67266192	67266192	+	Silent	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr11:67266192C>T	ENST00000534749.1	-	9	1547	c.1359G>A	c.(1357-1359)gtG>gtA	p.V453V	PITPNM1_ENST00000436757.2_Silent_p.V453V|PITPNM1_ENST00000356404.3_Silent_p.V453V			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	453					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TCAGCGTCTGCACATCCGCCT	0.662																																					p.V453V	GBM(28;144 709 4607 5525)	.											.	PITPNM1	227	0			c.G1359A						.						69.0	68.0	68.0					11																	67266192		2199	4294	6493	SO:0001819	synonymous_variant	9600	exon10			CGTCTGCACATCC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1359G>A	11.37:g.67266192C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001130848	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	ENST00000534749.1	37	CCDS31620.1																																																																																			.		0.662	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
POU4F1	5457	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	79175699	79175699	+	Missense_Mutation	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr13:79175699C>T	ENST00000377208.5	-	2	1322	c.1111G>A	c.(1111-1113)Gag>Aag	p.E371K	RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000606124.1_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	371					axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		AAGTAGGCCTCGAGGGAGCGC	0.637																																					p.E371K	Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)	.											.	POU4F1	515	0			c.G1111A						.						49.0	54.0	53.0					13																	79175699		2203	4300	6503	SO:0001583	missense	5457	exon2			AGGCCTCGAGGGA	X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.1111G>A	13.37:g.79175699C>T	ENSP00000366413:p.Glu371Lys	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	8.0	NM_006237	Q14986|Q15318|Q5T227	Missense_Mutation	SNP	ENST00000377208.5	37	CCDS31996.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270368	0.80469	.	.	ENSG00000152192	ENST00000377208	D	0.97575	-4.44	4.35	4.35	0.52113	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.85682	U	0.000000	D	0.98018	0.9347	M	0.67625	2.065	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.99257	1.0889	10	0.87932	D	0	.	16.8947	0.86097	0.0:1.0:0.0:0.0	.	371	Q01851	PO4F1_HUMAN	K	371	ENSP00000366413:E371K	ENSP00000366413:E371K	E	-	1	0	POU4F1	78073700	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.622000	0.83099	2.159000	0.67721	0.499000	0.49734	GAG	.		0.637	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045360.3		
PYGO2	90780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154931467	154931467	+	Missense_Mutation	SNP	C	C	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:154931467C>A	ENST00000368457.2	-	3	1180	c.1009G>T	c.(1009-1011)Gtg>Ttg	p.V337L	PYGO2_ENST00000368456.1_Missense_Mutation_p.V300L|PBXIP1_ENST00000539880.1_5'Flank|RP11-307C12.12_ENST00000605085.1_RNA|PYGO2_ENST00000483463.1_5'Flank|PBXIP1_ENST00000368460.3_5'Flank|PBXIP1_ENST00000542459.1_5'Flank|PBXIP1_ENST00000368465.1_5'Flank|PBXIP1_ENST00000368463.3_5'Flank	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	337					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TCATCGTTCACCTCACTCCGA	0.627																																					p.V337L	NSCLC(87;357 1460 1955 21029 23522)	.											.	PYGO2	227	0			c.G1009T						.						74.0	58.0	63.0					1																	154931467		2203	4300	6503	SO:0001583	missense	90780	exon3			CGTTCACCTCACT	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.1009G>T	1.37:g.154931467C>A	ENSP00000357442:p.Val337Leu	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	24.0	NM_138300	Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	37	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056857	0.76074	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.62788	0.0;0.0	4.85	4.85	0.62838	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000004	T	0.67571	0.2907	L	0.47190	1.495	0.58432	D	0.999993	D	0.61080	0.989	D	0.66497	0.944	T	0.71334	-0.4624	10	0.87932	D	0	-9.8878	16.926	0.86176	0.0:1.0:0.0:0.0	.	337	Q9BRQ0	PYGO2_HUMAN	L	337;300	ENSP00000357442:V337L;ENSP00000357441:V300L	ENSP00000357441:V300L	V	-	1	0	PYGO2	153198091	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.619000	0.83057	2.524000	0.85096	0.561000	0.74099	GTG	.		0.627	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300	
RAD54L2	23132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	51690041	51690041	+	Silent	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr3:51690041G>A	ENST00000409535.2	+	19	3206	c.3081G>A	c.(3079-3081)caG>caA	p.Q1027Q	RAD54L2_ENST00000296477.3_Silent_p.Q721Q	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1027						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GTCCTGTGCAGTCCACCCCCA	0.507																																					p.Q1027Q		.											.	RAD54L2	93	0			c.G3081A						.						158.0	144.0	148.0					3																	51690041		2203	4300	6503	SO:0001819	synonymous_variant	23132	exon19			TGTGCAGTCCACC	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.3081G>A	3.37:g.51690041G>A		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	20.0	NM_015106	Q8TB57|Q9BV54	Silent	SNP	ENST00000409535.2	37	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	G	9.162	1.019044	0.19355	.	.	ENSG00000164080	ENST00000432863	.	.	.	6.04	4.26	0.50523	.	.	.	.	.	T	0.62036	0.2395	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58651	-0.7599	4	.	.	.	-14.8414	10.7866	0.46409	0.2092:0.0:0.7908:0.0	.	.	.	.	I	856	.	.	V	+	1	0	RAD54L2	51665081	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.253000	0.51469	0.889000	0.36185	0.563000	0.77884	GTC	.		0.507	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
SCRIB	23513	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	144885835	144885835	+	Silent	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr8:144885835C>T	ENST00000320476.3	-	23	3402	c.3396G>A	c.(3394-3396)gaG>gaA	p.E1132E	SCRIB_ENST00000356994.2_Silent_p.E1132E|SCRIB_ENST00000377533.3_Silent_p.E1051E	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1132	Interaction with ARHGEF7.|PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			TGAAGATGCCCTCGTCTGTGG	0.697																																					p.E1132E	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB	228	0			c.G3396A						.						3.0	5.0	4.0					8																	144885835		1879	3830	5709	SO:0001819	synonymous_variant	23513	exon23			GATGCCCTCGTCT	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.3396G>A	8.37:g.144885835C>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	14.0	NM_015356	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	.	.	.	.	.	.	.	.	.	.	c	0.834	-0.744378	0.03065	.	.	ENSG00000180900	ENST00000526832	.	.	.	4.52	1.12	0.20585	.	.	.	.	.	T	0.51312	0.1667	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39722	-0.9600	4	.	.	.	.	5.1092	0.14800	0.0:0.4824:0.0:0.5176	.	.	.	.	R	128	.	.	G	-	1	0	SCRIB	144957823	0.959000	0.32827	0.993000	0.49108	0.199000	0.23934	0.099000	0.15210	0.460000	0.27045	-0.400000	0.06385	GGG	.		0.697	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
SLC12A4	6560	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67995581	67995581	+	Missense_Mutation	SNP	G	G	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr16:67995581G>C	ENST00000316341.3	-	3	379	c.239C>G	c.(238-240)tCg>tGg	p.S80W	SLC12A4_ENST00000338335.3_Missense_Mutation_p.S80W|SLC12A4_ENST00000537830.2_Missense_Mutation_p.S74W|SLC12A4_ENST00000572010.1_5'UTR|SLC12A4_ENST00000572037.1_Missense_Mutation_p.S32W|SLC12A4_ENST00000576616.1_Missense_Mutation_p.S80W|SLC12A4_ENST00000541864.2_Missense_Mutation_p.S49W|SLC12A4_ENST00000422611.2_Missense_Mutation_p.S82W	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	80					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CAGAAGAGACGATACCTTTGG	0.637																																					p.S82W		.											SLC12A4,NS,carcinoma,+1	SLC12A4	91	0			c.C245G						.						112.0	100.0	104.0					16																	67995581		2198	4300	6498	SO:0001583	missense	6560	exon2			AGAGACGATACCT		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.239C>G	16.37:g.67995581G>C	ENSP00000318557:p.Ser80Trp	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	18.0	NM_001145962	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	37	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878438	0.91740	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.89681	-2.16;-2.02;-2.03;-2.55;-2.02	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.95010	0.8385	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.987;0.995;0.999;0.998;0.987;0.996	D	0.94933	0.8084	10	0.87932	D	0	.	20.0787	0.97763	0.0:0.0:1.0:0.0	.	82;80;49;74;80;80	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	W	82;49;74;80;80	ENSP00000395983:S82W;ENSP00000438334:S49W;ENSP00000445962:S74W;ENSP00000343374:S80W;ENSP00000318557:S80W	ENSP00000318557:S80W	S	-	2	0	SLC12A4	66553082	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.420000	0.97426	2.757000	0.94681	0.462000	0.41574	TCG	.		0.637	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
SLC8A3	6547	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	70634966	70634966	+	Silent	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr14:70634966G>A	ENST00000381269.2	-	2	927	c.174C>T	c.(172-174)gtC>gtT	p.V58V	SLC8A3_ENST00000357887.3_Silent_p.V58V|SLC8A3_ENST00000356921.2_Silent_p.V58V|SLC8A3_ENST00000528359.1_Silent_p.V58V|SLC8A3_ENST00000534137.1_Silent_p.V58V	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	58					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		TTGGCAGGATGACACCCTCCT	0.547																																					p.V58V		.											.	SLC8A3	225	0			c.C174T						.						72.0	61.0	65.0					14																	70634966		2203	4300	6503	SO:0001819	synonymous_variant	6547	exon2			CAGGATGACACCC	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.174C>T	14.37:g.70634966G>A		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	5.0	NM_183002	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1																																																																																			.		0.547	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
SLCO1B3	28234	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	21008043	21008043	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:21008043G>A	ENST00000381545.3	+	4	385	c.166G>A	c.(166-168)Gaa>Aaa	p.E56K	SLCO1B7_ENST00000554957.1_Missense_Mutation_p.E56K|SLCO1B3_ENST00000545880.1_3'UTR|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.E56K|LST3_ENST00000540229.1_Missense_Mutation_p.E56K|LST3_ENST00000381541.3_Missense_Mutation_p.E56K|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.E56K	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	56					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	CACTCAAATAGAAAGGAGATT	0.323																																					p.E56K		.											.	SLCO1B3	155	0			c.G166A						.						85.0	80.0	82.0					12																	21008043		2203	4297	6500	SO:0001583	missense	28234	exon4			CAAATAGAAAGGA		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.166G>A	12.37:g.21008043G>A	ENSP00000370956:p.Glu56Lys	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	33.0	NM_019844	E7EMT8|Q5JAR4	Missense_Mutation	SNP	ENST00000381545.3	37	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477973	0.63849	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046;ENSG00000257046;ENSG00000205754	ENST00000540853;ENST00000261196;ENST00000381545;ENST00000553473;ENST00000381541;ENST00000540229;ENST00000554957	T;T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	3.76	3.76	0.43208	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.88385	0.6422	H	0.95645	3.7	0.53688	D	0.99997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.92397	0.5926	10	0.87932	D	0	.	15.7766	0.78224	0.0:0.0:1.0:0.0	.	56;56;56	F5H094;Q5JAR4;Q9NPD5	.;.;SO1B3_HUMAN	K	56	ENSP00000442000:E56K;ENSP00000261196:E56K;ENSP00000370956:E56K;ENSP00000451758:E56K;ENSP00000370952:E56K;ENSP00000441269:E56K;ENSP00000452013:E56K	ENSP00000370952:E56K	E	+	1	0	SLCO1B3;SLCO1B7;RP11-545J16.1	20899310	1.000000	0.71417	0.996000	0.52242	0.219000	0.24729	8.799000	0.91895	1.926000	0.55796	0.460000	0.39030	GAA	.		0.323	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
SMG1	23049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	18852978	18852978	+	Nonsense_Mutation	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr16:18852978G>T	ENST00000446231.2	-	41	7017	c.6605C>A	c.(6604-6606)tCa>tAa	p.S2202*	SMG1_ENST00000389467.3_Nonsense_Mutation_p.S2202*			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2202	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						GATTAGTCCTGATCTTGTTCC	0.433																																					p.S2202X		.											.	SMG1	1160	0			c.C6605A						.						236.0	223.0	227.0					16																	18852978		1953	4142	6095	SO:0001587	stop_gained	23049	exon41			AGTCCTGATCTTG	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6605C>A	16.37:g.18852978G>T	ENSP00000402515:p.Ser2202*	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	85.0	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Nonsense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	50	16.663238	0.99869	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	.	.	.	5.48	5.48	0.80851	.	0.000000	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.7139	0.96107	0.0:0.0:1.0:0.0	.	.	.	.	X	2202	.	ENSP00000374118:S2202X	S	-	2	0	SMG1	18760479	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	9.733000	0.98818	2.722000	0.93159	0.655000	0.94253	TCA	.		0.433	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
SMIM5	643008	broad.mit.edu;mdanderson.org	37	17	73636294	73636294	+	Missense_Mutation	SNP	G	G	A	rs374017473	byFrequency	TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr17:73636294G>A	ENST00000537494.1	+	1	3620	c.13G>A	c.(13-15)Gac>Aac	p.D5N	SMIM5_ENST00000375215.3_Missense_Mutation_p.D5N|RECQL5_ENST00000423245.2_Intron|RECQL5_ENST00000317905.5_Intron			Q71RC9	SMIM5_HUMAN	small integral membrane protein 5	5						integral component of membrane (GO:0016021)											GGCTGCCACCGACTTCGTGCA	0.672													G|||	22	0.00439297	0.0	0.0	5008	,	,		16481	0.0		0.0	False		,,,				2504	0.0225				p.D5N		.											.	.	.	0			c.G13A						.						46.0	49.0	48.0					17																	73636294		692	1591	2283	SO:0001583	missense	643008	exon2			GCCACCGACTTCG		CCDS54165.1	17q25.1	2014-01-02	2012-10-23	2012-10-23	ENSG00000204323	ENSG00000204323			40030	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 109"""	C17orf109		24318988	Standard	NM_001162995		Approved		uc002jow.2	Q71RC9	OTTHUMG00000167882	ENST00000537494.1:c.13G>A	17.37:g.73636294G>A	ENSP00000477017:p.Asp5Asn	Somatic	59.0	1.0		WXS	Illumina HiSeq	Phase_I	52.0	12.0	NM_001162995		Missense_Mutation	SNP	ENST00000537494.1	37	CCDS54165.1	.	.	.	.	.	.	.	.	.	.	G	2.947	-0.217568	0.06101	.	.	ENSG00000204323	ENST00000375215	.	.	.	5.22	-1.54	0.08584	.	.	.	.	.	T	0.24661	0.0598	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26573	-1.0099	7	0.16420	T	0.52	.	11.7074	0.51605	0.3947:0.0:0.6053:0.0	.	5	Q71RC9	CQ109_HUMAN	N	5	.	ENSP00000364363:D5N	D	+	1	0	C17orf109	71147889	0.003000	0.15002	0.012000	0.15200	0.151000	0.21798	0.328000	0.19681	-0.230000	0.09840	-0.290000	0.09829	GAC	.		0.672	SMIM5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396808.2	NM_001162995	
SORCS2	57537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	7725465	7725465	+	Silent	SNP	C	C	T	rs373781482		TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr4:7725465C>T	ENST00000507866.2	+	19	2575	c.2466C>T	c.(2464-2466)gaC>gaT	p.D822D	SORCS2_ENST00000329016.9_Silent_p.D650D	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	822	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						ACCTTGGGGACGGCTTCAAGG	0.607																																					p.D822D		.											.	SORCS2	91	0			c.C2466T						.						157.0	158.0	158.0					4																	7725465		2094	4216	6310	SO:0001819	synonymous_variant	57537	exon19			TGGGGACGGCTTC	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2466C>T	4.37:g.7725465C>T		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	17.0	NM_020777	Q9P2L7	Silent	SNP	ENST00000507866.2	37	CCDS47008.1																																																																																			.		0.607	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	
SRCIN1	80725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	36719591	36719591	+	Silent	SNP	A	A	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr17:36719591A>C	ENST00000264659.7	-	5	932	c.708T>G	c.(706-708)gcT>gcG	p.A236A	SRCIN1_ENST00000578925.1_Silent_p.A270A|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	108					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						AGACGTTGCGAGCCTCGTCTT	0.632																																					p.A236A		.											.	.	.	0			c.T708G						.						46.0	50.0	49.0					17																	36719591		2153	4233	6386	SO:0001819	synonymous_variant	80725	exon5			GTTGCGAGCCTCG		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.708T>G	17.37:g.36719591A>C		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	15.0	NM_025248	Q75T46|Q8N4W8	Silent	SNP	ENST00000264659.7	37	CCDS45660.1																																																																																			.		0.632	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441878.4	NM_025248	
ST14	6768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	130058517	130058517	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr11:130058517G>A	ENST00000278742.5	+	3	752	c.334G>A	c.(334-336)Gag>Aag	p.E112K		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	112	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CAACTCCACTGAGTTTGTAAG	0.567																																					p.E112K		.											.	ST14	94	0			c.G334A						.						105.0	95.0	98.0					11																	130058517		2201	4297	6498	SO:0001583	missense	6768	exon3			TCCACTGAGTTTG	AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.334G>A	11.37:g.130058517G>A	ENSP00000278742:p.Glu112Lys	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	10.0	NM_021978	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	ENST00000278742.5	37	CCDS8487.1	.	.	.	.	.	.	.	.	.	.	G	33	5.243791	0.95272	.	.	ENSG00000149418	ENST00000278742	T	0.48201	0.82	5.54	5.54	0.83059	SEA (1);	0.000000	0.35320	N	0.003292	T	0.70343	0.3213	M	0.80183	2.485	0.80722	D	1	D	0.71674	0.998	D	0.69654	0.965	T	0.73898	-0.3837	10	0.66056	D	0.02	.	17.2464	0.87029	0.0:0.0:1.0:0.0	.	112	Q9Y5Y6	ST14_HUMAN	K	112	ENSP00000278742:E112K	ENSP00000278742:E112K	E	+	1	0	ST14	129563727	1.000000	0.71417	0.926000	0.36857	0.916000	0.54674	5.317000	0.65822	2.594000	0.87642	0.655000	0.94253	GAG	.		0.567	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386119.1		
TAS2R1	50834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	9630121	9630121	+	Silent	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:9630121G>A	ENST00000382492.2	-	1	342	c.24C>T	c.(22-24)atC>atT	p.I8I	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	8					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						GAAGAAAATAGATAATGAGGT	0.333																																					p.I8I		.											.	TAS2R1	93	0			c.C24T						.						41.0	43.0	43.0					5																	9630121		2136	4281	6417	SO:0001819	synonymous_variant	50834	exon1			AAAATAGATAATG	AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.24C>T	5.37:g.9630121G>A		Somatic	234.0	1.0		WXS	Illumina HiSeq	Phase_I	261.0	119.0	NM_019599	Q646G8	Silent	SNP	ENST00000382492.2	37	CCDS3876.1																																																																																			.		0.333	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206988.2		
TBATA	219793	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	72541762	72541764	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr10:72541762_72541764delCTT	ENST00000299290.1	-	4	459_461	c.70_72delAAG	c.(70-72)aagdel	p.K24del	TBATA_ENST00000456372.2_In_Frame_Del_p.K24del|TBATA_ENST00000545575.1_In_Frame_Del_p.K14del	NM_152710.2	NP_689923	Q96M53	TBATA_HUMAN	thymus, brain and testes associated	24					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|nucleus (GO:0005634)											TGCGCCCTGACTTCTTCTCCAGT	0.586																																					p.24_24del		.											.	.	.	0			c.70_72del						.																																			SO:0001651	inframe_deletion	219793	exon4			CCCTGACTTCTTC	AK057382	CCDS7308.1	10q22.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166220	ENSG00000166220			23511	protein-coding gene	gene with protein product		612640	"""chromosome 10 open reading frame 27"""	C10orf27		20937703	Standard	NM_152710		Approved	FLJ32820, spatial	uc001jrj.1	Q96M53	OTTHUMG00000018413	ENST00000299290.1:c.70_72delAAG	10.37:g.72541765_72541767delCTT	ENSP00000299290:p.Lys24del	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	10.0	NM_152710	A4QPA8|B2RPQ2|Q5T4G2	In_Frame_Del	DEL	ENST00000299290.1	37	CCDS7308.1																																																																																			.		0.586	TBATA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048519.1	NM_152710	
TGM5	9333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43552276	43552276	+	Missense_Mutation	SNP	A	A	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr15:43552276A>T	ENST00000220420.5	-	3	417	c.410T>A	c.(409-411)aTc>aAc	p.I137N	TGM5_ENST00000349114.4_Intron	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	137					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GAAAAGCAGGATGAACTCCCC	0.597																																					p.I137N		.											.	TGM5	90	0			c.T410A						.						60.0	68.0	65.0					15																	43552276		2202	4299	6501	SO:0001583	missense	9333	exon3			AGCAGGATGAACT	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.410T>A	15.37:g.43552276A>T	ENSP00000220420:p.Ile137Asn	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	7.0	NM_201631	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	ENST00000220420.5	37	CCDS32212.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.011226	0.75046	.	.	ENSG00000104055	ENST00000220420;ENST00000396996	D	0.88975	-2.45	5.24	5.24	0.73138	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.134038	0.51477	D	0.000097	D	0.92280	0.7551	M	0.69358	2.11	0.80722	D	1	D	0.63046	0.992	P	0.60068	0.868	D	0.92796	0.6252	10	0.62326	D	0.03	-25.2619	13.3764	0.60741	1.0:0.0:0.0:0.0	.	137	O43548	TGM5_HUMAN	N	137;136	ENSP00000220420:I137N	ENSP00000220420:I137N	I	-	2	0	TGM5	41339568	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	2.411000	0.44600	2.103000	0.63969	0.533000	0.62120	ATC	.		0.597	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432257.1	NM_004245	
THBS4	7060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79351761	79351761	+	Missense_Mutation	SNP	A	A	G			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:79351761A>G	ENST00000350881.2	+	3	636	c.446A>G	c.(445-447)cAg>cGg	p.Q149R	THBS4_ENST00000511733.1_Missense_Mutation_p.Q58R|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	149	Laminin G-like.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GACTGCATCCAGGTGGATTCC	0.587																																					p.Q149R		.											.	THBS4	90	0			c.A446G						.						57.0	62.0	60.0					5																	79351761		2203	4300	6503	SO:0001583	missense	7060	exon3			GCATCCAGGTGGA		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.446A>G	5.37:g.79351761A>G	ENSP00000339730:p.Gln149Arg	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	23.0	NM_003248	B2R909|Q86TG2	Missense_Mutation	SNP	ENST00000350881.2	37	CCDS4049.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.338829	0.24253	.	.	ENSG00000113296	ENST00000350881;ENST00000511733	T;T	0.02067	4.47;4.47	5.93	3.59	0.41128	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.196433	0.46758	N	0.000274	T	0.02342	0.0072	L	0.45581	1.43	0.34312	D	0.685576	B	0.02656	0.0	B	0.04013	0.001	T	0.31641	-0.9936	9	.	.	.	-5.7053	5.8409	0.18633	0.7146:0.1413:0.1441:0.0	.	149	P35443	TSP4_HUMAN	R	149;58	ENSP00000339730:Q149R;ENSP00000422298:Q58R	.	Q	+	2	0	THBS4	79387517	1.000000	0.71417	0.884000	0.34674	0.974000	0.67602	3.026000	0.49689	1.069000	0.40788	0.533000	0.62120	CAG	.		0.587	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226977.1		
TMEM26	219623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	63195964	63195964	+	Silent	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr10:63195964T>C	ENST00000399298.3	-	2	602	c.234A>G	c.(232-234)ccA>ccG	p.P78P	TMEM26_ENST00000399293.1_Silent_p.P78P	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	78						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					GCCATAATGATGGAACGATGC	0.338																																					p.P78P		.											.	TMEM26	90	0			c.A234G						.						69.0	68.0	68.0					10																	63195964		1823	4075	5898	SO:0001819	synonymous_variant	219623	exon2			TAATGATGGAACG	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.234A>G	10.37:g.63195964T>C		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	12.0	NM_178505	Q6ZVM0|Q8IVN9	Silent	SNP	ENST00000399298.3	37	CCDS41530.1																																																																																			.		0.338	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505	
TMEM51	55092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	15541674	15541674	+	Missense_Mutation	SNP	T	T	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:15541674T>A	ENST00000428417.1	+	2	537	c.91T>A	c.(91-93)Tgg>Agg	p.W31R	TMEM51_ENST00000376008.2_Missense_Mutation_p.W31R|TMEM51_ENST00000434578.2_Missense_Mutation_p.W31R|TMEM51_ENST00000376014.3_Missense_Mutation_p.W31R|TMEM51_ENST00000400796.3_Missense_Mutation_p.W31R	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	31						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		CATGGCCATGTGGAACCTGGT	0.622																																					p.W31R		.											.	TMEM51	90	0			c.T91A						.						124.0	128.0	127.0					1																	15541674		2203	4300	6503	SO:0001583	missense	55092	exon2			GCCATGTGGAACC	AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.91T>A	1.37:g.15541674T>A	ENSP00000394899:p.Trp31Arg	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	16.0	NM_018022	A8K819	Missense_Mutation	SNP	ENST00000428417.1	37	CCDS154.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.686444	0.88639	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.78000	0.4215	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80786	-0.1227	10	0.87932	D	0	-0.5077	14.6591	0.68855	0.0:0.0:0.0:1.0	.	31;31	Q9BSA0;Q9NW97	.;TMM51_HUMAN	R	31	ENSP00000394899:W31R;ENSP00000365182:W31R;ENSP00000412298:W31R;ENSP00000409665:W31R;ENSP00000383600:W31R;ENSP00000365176:W31R	ENSP00000303666:W31R	W	+	1	0	TMEM51	15414261	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.117000	0.77129	2.073000	0.62155	0.533000	0.62120	TGG	.		0.622	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32064613	32064613	+	Silent	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:32064613C>T	ENST00000479795.1	-	3	1157	c.1017G>A	c.(1015-1017)acG>acA	p.T339T	TNXB_ENST00000375247.2_Silent_p.T339T|TNXB_ENST00000375244.3_Silent_p.T339T			P22105	TENX_HUMAN	tenascin XB	339	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGCAGCTCCGCGTACCACAGT	0.726																																					p.T339T		.											.	TNXB	90	0			c.G1017A						.						14.0	17.0	16.0					6																	32064613		2140	4225	6365	SO:0001819	synonymous_variant	7148	exon3			GCTCCGCGTACCA	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.1017G>A	6.37:g.32064613C>T		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	23.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000479795.1	37																																																																																				.		0.726	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000357059.1	NM_019105	
TPO	7173	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	1488563	1488563	+	Missense_Mutation	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr2:1488563C>T	ENST00000345913.4	+	9	1625	c.1534C>T	c.(1534-1536)Ccc>Tcc	p.P512S	TPO_ENST00000382201.3_Missense_Mutation_p.P512S|TPO_ENST00000346956.3_Missense_Mutation_p.P512S|TPO_ENST00000329066.4_Missense_Mutation_p.P512S|TPO_ENST00000349624.3_Missense_Mutation_p.P339S|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000337415.3_Missense_Mutation_p.P512S|TPO_ENST00000382198.1_Missense_Mutation_p.P339S	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	512					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CCAGGAGCACCCCGACCTGCC	0.647																																					p.P512S		.											.	TPO	332	0			c.C1534T						.						48.0	50.0	49.0					2																	1488563		2203	4300	6503	SO:0001583	missense	7173	exon9			GAGCACCCCGACC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1534C>T	2.37:g.1488563C>T	ENSP00000318820:p.Pro512Ser	Somatic	131.0	1.0		WXS	Illumina HiSeq	Phase_I	79.0	18.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	c	12.48	1.950031	0.34377	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607	T;T;T;T;T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74	5.13	3.23	0.37069	.	0.322779	0.37393	N	0.002105	T	0.76004	0.3927	L	0.39147	1.195	0.40585	D	0.981433	P;D;P;D	0.54601	0.843;0.967;0.843;0.959	P;P;P;P	0.57720	0.57;0.692;0.57;0.826	T	0.75566	-0.3273	10	0.54805	T	0.06	-8.8135	11.4758	0.50297	0.145:0.7236:0.1314:0.0	.	512;339;512;512	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	S	512;512;512;339;512;512;339;441;43	ENSP00000337263:P512S;ENSP00000318820:P512S;ENSP00000263886:P512S;ENSP00000332044:P339S;ENSP00000329869:P512S;ENSP00000371636:P512S;ENSP00000371633:P339S;ENSP00000405788:P441S;ENSP00000419461:P43S	ENSP00000329869:P512S	P	+	1	0	TPO	1467570	0.194000	0.23325	0.003000	0.11579	0.146000	0.21551	1.094000	0.30951	0.463000	0.27118	0.556000	0.70494	CCC	.		0.647	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TRAF3IP3	80342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	209953855	209953855	+	Missense_Mutation	SNP	C	C	G	rs147808288		TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:209953855C>G	ENST00000367024.1	+	15	1869	c.1353C>G	c.(1351-1353)aaC>aaG	p.N451K	TRAF3IP3_ENST00000367025.3_Missense_Mutation_p.N451K|TRAF3IP3_ENST00000477431.1_Intron|TRAF3IP3_ENST00000010338.4_Missense_Mutation_p.N431K|TRAF3IP3_ENST00000367026.3_Missense_Mutation_p.N431K			Q9Y228	T3JAM_HUMAN	TRAF3 interacting protein 3	451						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32				OV - Ovarian serous cystadenocarcinoma(81;0.045)		CCTTCCCTAACGAAGTGGAGC	0.537																																					p.N451K		.											.	TRAF3IP3	291	0			c.C1353G						.	C	LYS/ASN	0,4406		0,0,2203	119.0	116.0	117.0		1353	-10.5	0.0	1	dbSNP_134	117	1,8599	1.2+/-3.3	0,1,4299	no	missense	TRAF3IP3	NM_025228.2	94	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	possibly-damaging	451/552	209953855	1,13005	2203	4300	6503	SO:0001583	missense	80342	exon15			CCCTAACGAAGTG		CCDS1490.1, CCDS1490.2, CCDS73023.1	1q32.3-q41	2008-02-05			ENSG00000009790	ENSG00000009790			30766	protein-coding gene	gene with protein product	"""TRAF3 interacting Jun N terminal kinase (JNK) activating modulator"""	608255				14572659	Standard	XR_247044		Approved	T3JAM	uc001hho.3	Q9Y228	OTTHUMG00000036480	ENST00000367024.1:c.1353C>G	1.37:g.209953855C>G	ENSP00000355991:p.Asn451Lys	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	26.0	NM_025228	A1L464|A6NIU9|Q2YDB5|Q4VY06|Q7Z706	Missense_Mutation	SNP	ENST00000367024.1	37	CCDS1490.2	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.591468	0.00864	0.0	1.16E-4	ENSG00000009790	ENST00000367025;ENST00000367026;ENST00000367024;ENST00000010338	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.24	-10.5	0.00291	.	1.377270	0.04492	N	0.379749	T	0.57359	0.2048	L	0.51422	1.61	0.38779	D	0.95471	B;B	0.09022	0.002;0.002	B;B	0.13407	0.009;0.009	T	0.25187	-1.0139	10	0.32370	T	0.25	0.0096	0.141	0.00083	0.2846:0.2051:0.1741:0.3362	.	451;431	Q9Y228;Q9Y228-2	T3JAM_HUMAN;.	K	451;431;451;431	ENSP00000355992:N451K;ENSP00000355993:N431K;ENSP00000355991:N451K;ENSP00000010338:N431K	ENSP00000010338:N431K	N	+	3	2	TRAF3IP3	208020478	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-2.464000	0.00996	-3.257000	0.00203	-2.051000	0.00406	AAC	C|1.000;G|0.000		0.537	TRAF3IP3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088734.2		
TRAK2	66008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	202250957	202250957	+	Silent	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr2:202250957T>C	ENST00000332624.3	-	14	2375	c.1947A>G	c.(1945-1947)gcA>gcG	p.A649A		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	649					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						CTGGTCCACCTGCTGAAGTAA	0.443																																					p.A649A		.											.	TRAK2	90	0			c.A1947G						.						107.0	95.0	99.0					2																	202250957		2203	4300	6503	SO:0001819	synonymous_variant	66008	exon14			TCCACCTGCTGAA	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.1947A>G	2.37:g.202250957T>C		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	36.0	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Silent	SNP	ENST00000332624.3	37	CCDS2347.1																																																																																			.		0.443	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
TRIM58	25893	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	248020828	248020828	+	Missense_Mutation	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:248020828C>T	ENST00000366481.3	+	1	328	c.280C>T	c.(280-282)Cgg>Tgg	p.R94W		NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	94						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			gcccggggcgcggcgATGCGC	0.786																																					p.R94W		.											.	TRIM58	96	0			c.C280T						.						1.0	1.0	1.0					1																	248020828		736	1572	2308	SO:0001583	missense	25893	exon1			GGGGCGCGGCGAT	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.280C>T	1.37:g.248020828C>T	ENSP00000355437:p.Arg94Trp	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	4.0	NM_015431	Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	37	CCDS1636.1	.	.	.	.	.	.	.	.	.	.	C	10.11	1.259758	0.23051	.	.	ENSG00000162722	ENST00000366481	T	0.45668	0.89	4.15	3.23	0.37069	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, B-box (3);	0.894581	0.09608	N	0.779360	T	0.40067	0.1102	M	0.64260	1.97	0.09310	N	1	B	0.22080	0.064	B	0.20955	0.032	T	0.33420	-0.9869	10	0.72032	D	0.01	.	7.1619	0.25669	0.0:0.8806:0.0:0.1194	.	94	Q8NG06	TRI58_HUMAN	W	94	ENSP00000355437:R94W	ENSP00000355437:R94W	R	+	1	2	TRIM58	246087451	0.000000	0.05858	0.027000	0.17364	0.056000	0.15407	0.372000	0.20467	2.289000	0.77006	0.650000	0.86243	CGG	.		0.786	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	230661327	230661327	+	Frame_Shift_Del	DEL	G	G	-			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr2:230661327delG	ENST00000283943.5	-	24	3749	c.3571delC	c.(3571-3573)catfs	p.H1191fs	TRIP12_ENST00000389044.4_Frame_Shift_Del_p.H1239fs|TRIP12_ENST00000389045.3_Frame_Shift_Del_p.H921fs	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1191					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AAAAATACATGAAGAAATCGC	0.323																																					p.H1191fs		.											.	TRIP12	572	0			c.3571delC						.						102.0	105.0	104.0					2																	230661327		2203	4300	6503	SO:0001589	frameshift_variant	9320	exon24			ATACATGAAGAAA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3571delC	2.37:g.230661327delG	ENSP00000283943:p.His1191fs	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	184.0	46.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Frame_Shift_Del	DEL	ENST00000283943.5	37	CCDS33391.1																																																																																			.		0.323	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
TRMT61A	115708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	103996384	103996384	+	Silent	SNP	T	T	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr14:103996384T>A	ENST00000389749.4	+	2	176	c.69T>A	c.(67-69)ggT>ggA	p.G23G	RP11-600F24.7_ENST00000568177.1_RNA	NM_152307.2	NP_689520.2	Q96FX7	TRM61_HUMAN	tRNA methyltransferase 61 homolog A (S. cerevisiae)	23						nucleus (GO:0005634)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			skin(1)	1						TGGGCCATGGTGCAATGGTGG	0.627																																					p.G23G		.											.	TRMT61A	90	0			c.T69A						.						47.0	51.0	49.0					14																	103996384		2199	4298	6497	SO:0001819	synonymous_variant	115708	exon2			CCATGGTGCAATG	AK097771	CCDS41994.1	14q32	2009-01-09	2009-01-09	2009-01-09		ENSG00000166166			23790	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 172"""	C14orf172		16043508	Standard	NM_152307		Approved	FLJ40452, GCD14, Gcd14p, hTRM61	uc010aws.3	Q96FX7		ENST00000389749.4:c.69T>A	14.37:g.103996384T>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	11.0	NM_152307	A6NN78|Q8N7Q9	Silent	SNP	ENST00000389749.4	37	CCDS41994.1																																																																																			.		0.627	TRMT61A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414988.1	NM_152307	
TROAP	10024	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	49723688	49723688	+	Silent	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr12:49723688C>T	ENST00000257909.3	+	12	1289	c.1213C>T	c.(1213-1215)Ctg>Ttg	p.L405L	TROAP_ENST00000547923.1_Silent_p.L113L|TROAP_ENST00000551245.1_Silent_p.L405L	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	405					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						TATAAGGTCACTGGAGGGTTC	0.567																																					p.L405L		.											.	TROAP	91	0			c.C1213T						.						118.0	118.0	118.0					12																	49723688		2203	4300	6503	SO:0001819	synonymous_variant	10024	exon12			AGGTCACTGGAGG	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1213C>T	12.37:g.49723688C>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	8.0	NM_005480	F8VSF9|Q6PJU7|Q8N5B2	Silent	SNP	ENST00000257909.3	37	CCDS8784.1																																																																																			.		0.567	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
TRPM1	4308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	31325061	31325061	+	Missense_Mutation	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr15:31325061G>A	ENST00000256552.6	-	22	2930	c.2783C>T	c.(2782-2784)gCc>gTc	p.A928V	TRPM1_ENST00000397795.2_Missense_Mutation_p.A906V|RP11-348B17.1_ENST00000558755.1_RNA|TRPM1_ENST00000542188.1_Missense_Mutation_p.A945V|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TGTGGAAATGGCCACGAGATC	0.468																																					p.A945V		.											.	TRPM1	94	0			c.C2834T						.						171.0	163.0	165.0					15																	31325061		1957	4144	6101	SO:0001583	missense	4308	exon21			GAAATGGCCACGA	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.2783C>T	15.37:g.31325061G>A	ENSP00000256552:p.Ala928Val	Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	29.0	NM_001252020		Missense_Mutation	SNP	ENST00000256552.6	37	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	G	33	5.277508	0.95459	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	D;D;D	0.98150	-4.75;-4.75;-4.75	5.59	5.59	0.84812	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98513	0.9504	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.79108	0.891;0.992	D	0.99797	1.1034	10	0.87932	D	0	-27.6228	19.5857	0.95489	0.0:0.0:1.0:0.0	.	900;906	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	V	906;945;928;906	ENSP00000380897:A906V;ENSP00000437849:A945V;ENSP00000256552:A928V	ENSP00000256552:A928V	A	-	2	0	TRPM1	29112353	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.823000	0.86660	2.616000	0.88540	0.643000	0.83706	GCC	.		0.468	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
TTC13	79573	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	231059660	231059660	+	Missense_Mutation	SNP	G	G	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr1:231059660G>C	ENST00000366661.4	-	15	1748	c.1741C>G	c.(1741-1743)Ccc>Gcc	p.P581A	TTC13_ENST00000366662.4_Missense_Mutation_p.P528A|TTC13_ENST00000414259.1_Missense_Mutation_p.P528A	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	581										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		CACAGCACGGGCTGGTCTGGG	0.403																																					p.P581A		.											.	TTC13	92	0			c.C1741G						.						86.0	85.0	86.0					1																	231059660		2203	4300	6503	SO:0001583	missense	79573	exon15			GCACGGGCTGGTC		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.1741C>G	1.37:g.231059660G>C	ENSP00000355621:p.Pro581Ala	Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	120.0	22.0	NM_024525	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	37	CCDS1588.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.525584	0.85600	.	.	ENSG00000143643	ENST00000366661;ENST00000366662;ENST00000414259;ENST00000486879	T;T;T	0.34667	1.35;1.35;1.35	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	L	0.42245	1.32	0.80722	D	1	D;D;P;D	0.76494	0.993;0.999;0.946;0.993	P;D;P;P	0.80764	0.725;0.994;0.586;0.725	T	0.51639	-0.8680	10	0.49607	T	0.09	-10.8775	19.3595	0.94431	0.0:0.0:1.0:0.0	.	506;528;528;581	Q69YR0;E9PGV4;Q8NBP0-2;Q8NBP0	.;.;.;TTC13_HUMAN	A	581;528;528;15	ENSP00000355621:P581A;ENSP00000355622:P528A;ENSP00000416631:P528A	ENSP00000355621:P581A	P	-	1	0	TTC13	229126283	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.864000	0.99589	2.576000	0.86940	0.655000	0.94253	CCC	.		0.403	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	NM_024525	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179593438	179593438	+	Silent	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr2:179593438T>C	ENST00000591111.1	-	64	18488	c.18264A>G	c.(18262-18264)gaA>gaG	p.E6088E	RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.E6405E|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Silent_p.E5161E			Q8WZ42	TITIN_HUMAN	titin	12875	Ig-like 42.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACAACACATTCCAAGGTCA	0.378																																					p.E6405E		.											.	TTN	636	0			c.A19215G						.						92.0	86.0	88.0					2																	179593438		1876	4109	5985	SO:0001819	synonymous_variant	7273	exon66			AACACATTCCAAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18264A>G	2.37:g.179593438T>C		Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	54.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
VPS52	6293	ucsc.edu;bcgsc.ca	37	6	33218759	33218759	+	Silent	SNP	C	C	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr6:33218759C>T	ENST00000445902.2	-	20	2249	c.2031G>A	c.(2029-2031)gcG>gcA	p.A677A	HCG25_ENST00000442228.1_RNA|VPS52_ENST00000436044.2_Silent_p.A552A|VPS52_ENST00000482399.1_3'UTR|HCG25_ENST00000450514.1_RNA|VPS52_ENST00000478934.1_5'UTR|HCG25_ENST00000422366.1_RNA|HCG25_ENST00000427196.1_RNA	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	677					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						GCTGGGTCAGCGCTCCCTGGT	0.562																																					p.A677A		.											.	VPS52	95	0			c.G2031A						.						55.0	60.0	58.0					6																	33218759		1510	2709	4219	SO:0001819	synonymous_variant	6293	exon20			GGTCAGCGCTCCC	AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.2031G>A	6.37:g.33218759C>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_022553	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Silent	SNP	ENST00000445902.2	37	CCDS4770.2																																																																																			.		0.562	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
ZNF16	7564	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	146157910	146157910	+	Nonsense_Mutation	SNP	G	G	T			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr8:146157910G>T	ENST00000276816.4	-	4	449	c.263C>A	c.(262-264)tCa>tAa	p.S88*	ZNF16_ENST00000394909.2_Nonsense_Mutation_p.S88*	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	88	Necessary for transcription activation.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		TTCTGCCTGTGATTCCAAATC	0.428																																					p.S88X		.											.	ZNF16	95	0			c.C263A						.						108.0	102.0	104.0					8																	146157910		2203	4300	6503	SO:0001587	stop_gained	7564	exon3			GCCTGTGATTCCA	X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.263C>A	8.37:g.146157910G>T	ENSP00000276816:p.Ser88*	Somatic	239.0	0.0		WXS	Illumina HiSeq	Phase_I	500.0	48.0	NM_006958	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Nonsense_Mutation	SNP	ENST00000276816.4	37	CCDS6437.1	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153540	0.38021	.	.	ENSG00000170631	ENST00000276816;ENST00000394909;ENST00000532351;ENST00000527811	.	.	.	4.24	2.45	0.29901	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	8.0479	0.30559	0.2009:0.0:0.7991:0.0	.	.	.	.	X	88	.	ENSP00000276816:S88X	S	-	2	0	ZNF16	146128714	0.537000	0.26386	0.243000	0.24186	0.525000	0.34531	0.711000	0.25764	0.439000	0.26476	0.563000	0.77884	TCA	.		0.428	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382978.1	NM_006958	
ZNF366	167465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71756953	71756953	+	Missense_Mutation	SNP	T	T	C			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr5:71756953T>C	ENST00000318442.5	-	2	861	c.371A>G	c.(370-372)tAt>tGt	p.Y124C		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	124					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		CTGAGAGTCATACTTGGGGCG	0.587																																					p.Y124C		.											.	ZNF366	91	0			c.A371G						.						147.0	166.0	160.0					5																	71756953		2203	4300	6503	SO:0001583	missense	167465	exon2			GAGTCATACTTGG	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.371A>G	5.37:g.71756953T>C	ENSP00000313158:p.Tyr124Cys	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	218.0	56.0	NM_152625	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	ENST00000318442.5	37	CCDS4015.1	.	.	.	.	.	.	.	.	.	.	T	8.834	0.940543	0.18281	.	.	ENSG00000178175	ENST00000318442	T	0.36699	1.24	5.92	-1.93	0.07594	.	0.874296	0.10129	N	0.712320	T	0.15782	0.0380	N	0.11560	0.145	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17684	-1.0361	10	0.37606	T	0.19	-5.042	3.5965	0.08008	0.3581:0.2433:0.0:0.3986	.	124	Q8N895	ZN366_HUMAN	C	124	ENSP00000313158:Y124C	ENSP00000313158:Y124C	Y	-	2	0	ZNF366	71792709	0.036000	0.19791	0.009000	0.14445	0.974000	0.67602	0.253000	0.18296	-0.539000	0.06273	0.459000	0.35465	TAT	.		0.587	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
ZNF467	168544	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149462853	149462853	+	Silent	SNP	G	G	A			TCGA-O8-A75V-01A-11D-A32G-10	TCGA-O8-A75V-10A-01D-A32G-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9a1fc125-b2f3-4a19-aeb1-faf45a3ee8ed	296a0e3f-6a54-44cf-bb8d-480cda70d695	g.chr7:149462853G>A	ENST00000302017.3	-	5	1151	c.738C>T	c.(736-738)tgC>tgT	p.C246C	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	246					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGCACTCCGCGCACGGGTAGG	0.677																																					p.C246C		.											.	ZNF467	90	0			c.C738T						.						26.0	21.0	22.0					7																	149462853		2203	4300	6503	SO:0001819	synonymous_variant	168544	exon5			CTCCGCGCACGGG	BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.738C>T	7.37:g.149462853G>A		Somatic	113.0	1.0		WXS	Illumina HiSeq	Phase_I	116.0	30.0	NM_207336		Silent	SNP	ENST00000302017.3	37	CCDS5899.1																																																																																			.		0.677	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349833.1	NM_207336	
