#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAD2	161931	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	84230532	84230532	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:84230532C>T	ENST00000315906.5	+	10	1756	c.1704C>T	c.(1702-1704)ggC>ggT	p.G568G	RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Silent_p.G650G|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	568	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						ACCAGCAGGGCCTGGGGGCTT	0.667																																					p.G650G		.											.	ADAD2	68	0			c.C1950T						.						10.0	12.0	11.0					16																	84230532		2187	4289	6476	SO:0001819	synonymous_variant	161931	exon11			GCAGGGCCTGGGG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1704C>T	16.37:g.84230532C>T		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	16.0	NM_139174	B2RCL6|Q8NA94	Silent	SNP	ENST00000315906.5	37	CCDS45536.1																																																																																			.		0.667	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
AGAP11	119385	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	10	88768173	88768173	+	RNA	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:88768173C>T	ENST00000444431.1	+	0	2773				RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.10_ENST00000451760.1_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										AACTATTCCTCCTCCATTCCA	0.478																																					p.S55F		.											.	.	.	0			c.C164T						.						109.0	113.0	111.0					10																	88768173		2135	4268	6403			119385	exon12			ATTCCTCCTCCAT			10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88768173C>T		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	7.0	NM_133447	B9EIP7|D3DWE4	Missense_Mutation	SNP	ENST00000444431.1	37																																																																																				.		0.478	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447	
AHCTF1	25909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247014692	247014692	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:247014692T>C	ENST00000391829.2	-	33	4739	c.4616A>G	c.(4615-4617)aAt>aGt	p.N1539S	AHCTF1_ENST00000366508.1_Missense_Mutation_p.N1574S|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Missense_Mutation_p.N1548S			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1539	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AAATGAAAGATTCCTAGCCTC	0.328																																					p.N1548S	Colon(145;197 1800 4745 15099 26333)	.											.	AHCTF1	97	0			c.A4643G						.						29.0	29.0	29.0					1																	247014692		2200	4297	6497	SO:0001583	missense	25909	exon33			GAAAGATTCCTAG		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4616A>G	1.37:g.247014692T>C	ENSP00000375705:p.Asn1539Ser	Somatic	235.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	43.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	T	0.335	-0.953685	0.02285	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.28895	1.59;1.59;1.59	6.17	-4.03	0.04021	.	0.574707	0.18629	N	0.135631	T	0.08626	0.0214	N	0.08118	0	0.09310	N	1	B;B;B	0.20052	0.041;0.004;0.003	B;B;B	0.16722	0.016;0.007;0.003	T	0.31641	-0.9936	10	0.05525	T	0.97	-6.6212	3.355	0.07165	0.0954:0.3805:0.189:0.3351	.	400;1574;1539	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	S	1574;1548;1539	ENSP00000355464:N1574S;ENSP00000355465:N1548S;ENSP00000375705:N1539S	ENSP00000355465:N1548S	N	-	2	0	AHCTF1	245081315	0.026000	0.19158	0.016000	0.15963	0.653000	0.38743	-0.820000	0.04457	-0.589000	0.05874	0.533000	0.62120	AAT	.		0.328	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
AHR	196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	17382597	17382597	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:17382597A>C	ENST00000242057.4	+	11	3099	c.2456A>C	c.(2455-2457)aAt>aCt	p.N819T		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	819				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857). {ECO:0000305}.	apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AATAACATAAATAACACTCAG	0.373																																					p.N819T		.											.	AHR	227	0			c.A2456C						.						176.0	168.0	171.0					7																	17382597		2203	4300	6503	SO:0001583	missense	196	exon11			ACATAAATAACAC	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2456A>C	7.37:g.17382597A>C	ENSP00000242057:p.Asn819Thr	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	25.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	8.702	0.909958	0.17833	.	.	ENSG00000106546	ENST00000242057	T	0.46451	0.87	5.35	-6.25	0.02039	.	0.673664	0.15455	N	0.261409	T	0.36413	0.0966	L	0.59436	1.845	0.09310	N	1	B	0.34181	0.44	B	0.30646	0.118	T	0.18999	-1.0319	10	0.59425	D	0.04	.	19.0415	0.93002	0.2359:0.0:0.7641:0.0	.	819	P35869	AHR_HUMAN	T	819	ENSP00000242057:N819T	ENSP00000242057:N819T	N	+	2	0	AHR	17349122	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.874000	0.04210	-1.090000	0.03069	0.533000	0.62120	AAT	.		0.373	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
AHR	196	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	17382606	17382606	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:17382606A>C	ENST00000242057.4	+	11	3108	c.2465A>C	c.(2464-2466)cAg>cCg	p.Q822P		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	822				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857). {ECO:0000305}.	apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AATAACACTCAGACTACCACA	0.363																																					p.Q822P		.											.	AHR	227	0			c.A2465C						.						191.0	180.0	184.0					7																	17382606		2203	4300	6503	SO:0001583	missense	196	exon11			ACACTCAGACTAC	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2465A>C	7.37:g.17382606A>C	ENSP00000242057:p.Gln822Pro	Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	26.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	5.009	0.187412	0.09547	.	.	ENSG00000106546	ENST00000242057	T	0.50277	0.75	4.92	3.74	0.42951	.	0.542144	0.19216	N	0.119809	T	0.36991	0.0987	L	0.47016	1.485	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.21245	-1.0251	10	0.30854	T	0.27	.	7.1893	0.25816	0.7009:0.1425:0.0:0.1566	.	822	P35869	AHR_HUMAN	P	822	ENSP00000242057:Q822P	ENSP00000242057:Q822P	Q	+	2	0	AHR	17349131	0.722000	0.28017	0.010000	0.14722	0.066000	0.16364	1.866000	0.39489	0.918000	0.36919	0.533000	0.62120	CAG	.		0.363	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
AHR	196	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	7	17382611	17382611	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:17382611A>G	ENST00000242057.4	+	11	3113	c.2470A>G	c.(2470-2472)Acc>Gcc	p.T824A		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	824				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857). {ECO:0000305}.	apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	CACTCAGACTACCACACATCT	0.378																																					p.T824A		.											.	AHR	227	0			c.A2470G						.						200.0	188.0	192.0					7																	17382611		2203	4300	6503	SO:0001583	missense	196	exon11			CAGACTACCACAC	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2470A>G	7.37:g.17382611A>G	ENSP00000242057:p.Thr824Ala	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	26.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.282525	0.00251	.	.	ENSG00000106546	ENST00000242057	T	0.41758	0.99	4.92	-9.85	0.00476	.	1.132360	0.06303	N	0.701195	T	0.14700	0.0355	N	0.02973	-0.45	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37478	-0.9704	10	0.02654	T	1	.	14.1452	0.65347	0.164:0.084:0.673:0.079	.	824	P35869	AHR_HUMAN	A	824	ENSP00000242057:T824A	ENSP00000242057:T824A	T	+	1	0	AHR	17349136	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-1.026000	0.03596	-3.335000	0.00184	-0.250000	0.11733	ACC	.		0.378	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
ALS2CL	259173	ucsc.edu;bcgsc.ca	37	3	46718422	46718422	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:46718422C>A	ENST00000318962.4	-	17	1931	c.1848G>T	c.(1846-1848)agG>agT	p.R616S	ALS2CL_ENST00000415953.1_Missense_Mutation_p.R616S|ALS2CL_ENST00000383742.3_5'UTR	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	616					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CCTGCAGGTCCCTGGGGCAGC	0.667																																					p.R616S		.											.	ALS2CL	155	0			c.G1848T						.						56.0	66.0	62.0					3																	46718422		2203	4300	6503	SO:0001583	missense	259173	exon17			CAGGTCCCTGGGG	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.1848G>T	3.37:g.46718422C>A	ENSP00000313670:p.Arg616Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_001190707	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	ENST00000318962.4	37	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	C	3.924	-0.017557	0.07681	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.54479	0.57;0.57	4.65	-0.337	0.12654	.	0.679139	0.13620	N	0.374479	T	0.26484	0.0647	N	0.14661	0.345	0.40925	D	0.984349	B	0.09022	0.002	B	0.06405	0.002	T	0.11591	-1.0581	10	0.13108	T	0.6	.	4.3519	0.11160	0.151:0.4422:0.0:0.4068	.	616	Q60I27	AL2CL_HUMAN	S	616	ENSP00000313670:R616S;ENSP00000413223:R616S	ENSP00000313670:R616S	R	-	3	2	ALS2CL	46693426	0.066000	0.20996	0.054000	0.19295	0.851000	0.48451	-0.257000	0.08745	-0.268000	0.09312	0.561000	0.74099	AGG	.		0.667	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	
ANKS1B	56899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	99638191	99638191	+	Splice_Site	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:99638191A>G	ENST00000547776.2	-	14	2347	c.2348T>C	c.(2347-2349)aTt>aCt	p.I783T	ANKS1B_ENST00000547010.1_Splice_Site_p.I363T|ANKS1B_ENST00000329257.7_Splice_Site_p.I783T|ANKS1B_ENST00000550833.1_5'Flank	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	783						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TATTTTGTCAATCTGTAAGAA	0.299																																					p.I783T		.											.	.	.	0			c.T2348C						.						153.0	137.0	142.0					12																	99638191		1830	4069	5899	SO:0001630	splice_region_variant	56899	exon14			TTGTCAATCTGTA	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2347-1T>C	12.37:g.99638191A>G		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	9.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	A	19.59	3.857087	0.71834	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702	T;T;T	0.71817	-0.0;-0.6;0.0	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.80934	0.4719	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;0.981	D;D	0.97110	1.0;0.966	T	0.80417	-0.1391	9	.	.	.	-8.7181	14.3914	0.66981	1.0:0.0:0.0:0.0	.	363;783	Q7Z6G8-6;Q7Z6G8	.;ANS1B_HUMAN	T	783;363;783;362	ENSP00000449629:I783T;ENSP00000448512:I363T;ENSP00000331381:I783T	.	I	-	2	0	ANKS1B	98162322	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.543000	0.82106	2.192000	0.70111	0.459000	0.35465	ATT	.		0.299	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	Missense_Mutation
ANKS1B	56899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	99793570	99793570	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:99793570A>G	ENST00000547776.2	-	12	1594	c.1595T>C	c.(1594-1596)aTt>aCt	p.I532T	ANKS1B_ENST00000547010.1_Missense_Mutation_p.I112T|ANKS1B_ENST00000329257.7_Missense_Mutation_p.I532T	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	532						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		AGAAGACACAATGGATGTTCG	0.388																																					p.I532T		.											.	.	.	0			c.T1595C						.						156.0	164.0	162.0					12																	99793570		1887	4113	6000	SO:0001583	missense	56899	exon12			GACACAATGGATG	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1595T>C	12.37:g.99793570A>G	ENSP00000449629:p.Ile532Thr	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	14.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	37	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316865	0.60524	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000549866	T;T;T;T	0.61980	0.83;0.06;0.83;0.52	5.73	5.73	0.89815	.	0.266741	0.30879	N	0.008699	T	0.51432	0.1674	N	0.22421	0.69	0.80722	D	1	P;P;B	0.37330	0.59;0.59;0.18	B;B;B	0.41332	0.266;0.354;0.076	T	0.49960	-0.8883	9	.	.	.	-10.4795	13.5328	0.61631	1.0:0.0:0.0:0.0	.	498;112;532	F8VVQ4;Q7Z6G8-6;Q7Z6G8	.;.;ANS1B_HUMAN	T	532;112;532;111;498	ENSP00000449629:I532T;ENSP00000448512:I112T;ENSP00000331381:I532T;ENSP00000449894:I498T	.	I	-	2	0	ANKS1B	98317701	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	6.278000	0.72614	2.184000	0.69523	0.477000	0.44152	ATT	.		0.388	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
AP1G1	164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	71772938	71772938	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:71772938A>C	ENST00000299980.4	-	21	2616	c.2175T>G	c.(2173-2175)aaT>aaG	p.N725K	AP1G1_ENST00000569748.1_Missense_Mutation_p.N725K|AP1G1_ENST00000433195.2_Missense_Mutation_p.N748K|AP1G1_ENST00000393512.3_Missense_Mutation_p.N728K|AP1G1_ENST00000564155.1_Missense_Mutation_p.N150K|AP1G1_ENST00000423132.2_Missense_Mutation_p.N728K	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	725	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TGGGGTTGGTATTTGACCGTT	0.433																																					p.N728K		.											.	AP1G1	92	0			c.T2184G						.						251.0	221.0	231.0					16																	71772938		2198	4300	6498	SO:0001583	missense	164	exon22			GTTGGTATTTGAC	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2175T>G	16.37:g.71772938A>C	ENSP00000299980:p.Asn725Lys	Somatic	325.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	61.0	NM_001030007	O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	ENST00000299980.4	37	CCDS32480.1	.	.	.	.	.	.	.	.	.	.	A	12.37	1.919106	0.33908	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.29	0.176	0.15049	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, gamma-adaptin, appendage (2);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);	0.040642	0.85682	D	0.000000	T	0.29061	0.0722	L	0.40543	1.245	0.50171	D	0.999855	B;B;B	0.18741	0.008;0.03;0.013	B;B;B	0.22386	0.039;0.039;0.023	T	0.07578	-1.0765	10	0.20519	T	0.43	-12.3069	9.006	0.36111	0.3551:0.0:0.6449:0.0	.	725;748;728	O43747;B3KXW5;O43747-2	AP1G1_HUMAN;.;.	K	725;728;728;748	ENSP00000299980:N725K;ENSP00000377148:N728K;ENSP00000409153:N728K;ENSP00000403259:N748K	ENSP00000299980:N725K	N	-	3	2	AP1G1	70330439	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	1.178000	0.31981	-0.224000	0.09928	0.528000	0.53228	AAT	.		0.433	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
AREG	374	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	75312480	75312480	+	Silent	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:75312480T>A	ENST00000395748.3	+	2	503	c.291T>A	c.(289-291)atT>atA	p.I97I	AREG_ENST00000502307.1_Silent_p.I97I|AREG_ENST00000264487.2_Silent_p.I97I	NM_001657.2	NP_001648.1	P15514	AREG_HUMAN	amphiregulin	97					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|G-protein coupled receptor signaling pathway (GO:0007186)|glial cell proliferation (GO:0014009)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in thelarche (GO:0060744)|negative regulation of osteoblast differentiation (GO:0045668)|neuron projection development (GO:0031175)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of phosphorylation (GO:0042327)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to peptide hormone (GO:0043434)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	growth factor activity (GO:0008083)			lung(4)	4			Lung(101;0.196)			CTGGCTATATTGTCGATGATT	0.453																																					p.I97I		.											.	AREG	946	0			c.T291A						.						105.0	119.0	114.0					4																	75312480		2200	4298	6498	SO:0001819	synonymous_variant	374	exon2			CTATATTGTCGAT	M30704	CCDS3565.1	4q13.3	2014-06-19	2008-08-01		ENSG00000109321	ENSG00000109321		"""Endogenous ligands"""	651	protein-coding gene	gene with protein product		104640	"""schwannoma-derived growth factor"", ""amphiregulin B"""	SDGF, AREGB			Standard	NM_001657		Approved		uc021xpc.1	P15514	OTTHUMG00000130006	ENST00000395748.3:c.291T>A	4.37:g.75312480T>A		Somatic	516.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	55.0	NM_001657	Q5U026	Silent	SNP	ENST00000395748.3	37	CCDS3565.1																																																																																			.		0.453	AREG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252277.1		
AREG	374	broad.mit.edu;mdanderson.org	37	4	75482235	75482235	+	Silent	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:75482235T>A	ENST00000380846.3	+	2	501	c.291T>A	c.(289-291)atT>atA	p.I97I	AC142293.3_ENST00000510419.1_RNA			P15514	AREG_HUMAN		97					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|G-protein coupled receptor signaling pathway (GO:0007186)|glial cell proliferation (GO:0014009)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in thelarche (GO:0060744)|negative regulation of osteoblast differentiation (GO:0045668)|neuron projection development (GO:0031175)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of phosphorylation (GO:0042327)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to peptide hormone (GO:0043434)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	growth factor activity (GO:0008083)			kidney(1)	1						CTGGCTATATTGTCGATGATT	0.448																																					p.I97I		.											.	AREG	946	0			c.T291A						.						14.0	7.0	9.0					4																	75482235		1473	2765	4238	SO:0001819	synonymous_variant	374	exon2			CTATATTGTCGAT																												ENST00000380846.3:c.291T>A	4.37:g.75482235T>A		Somatic	215.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	31.0	NM_001657	Q5U026	Silent	SNP	ENST00000380846.3	37																																																																																				.		0.448	AREGB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362747.1		
ATP10B	23120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	159992727	159992727	+	Silent	SNP	T	T	C	rs528864040		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:159992727T>C	ENST00000327245.5	-	26	4965	c.4119A>G	c.(4117-4119)acA>acG	p.T1373T		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1373					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGTCCTGTCCTGTGATAGATG	0.542													T|||	1	0.000199681	0.0	0.0	5008	,	,		15610	0.0		0.0	False		,,,				2504	0.001				p.T1373T		.											.	ATP10B	72	0			c.A4119G						.						123.0	133.0	130.0					5																	159992727		1984	4168	6152	SO:0001819	synonymous_variant	23120	exon26			CTGTCCTGTGATA	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.4119A>G	5.37:g.159992727T>C		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	20.0	NM_025153	Q9H725	Silent	SNP	ENST00000327245.5	37	CCDS43394.1																																																																																			.		0.542	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
ATP2B1	490	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	89992431	89992431	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:89992431T>C	ENST00000359142.3	-	20	3665	c.3441A>G	c.(3439-3441)gtA>gtG	p.V1147V	ATP2B1_ENST00000428670.3_Intron|ATP2B1_ENST00000393164.2_Intron|ATP2B1_ENST00000348959.3_Intron|ATP2B1_ENST00000261173.2_Intron	NM_001001323.1	NP_001001323.1	P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	1147					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						AAATATTTGTTACATCATGAT	0.453																																					p.V1147V		.											.	ATP2B1	516	0			c.A3441G						.						198.0	197.0	198.0					12																	89992431		1980	4164	6144	SO:0001819	synonymous_variant	490	exon20			ATTTGTTACATCA	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000359142.3:c.3441A>G	12.37:g.89992431T>C		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	5.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	ENST00000359142.3	37	CCDS41817.1																																																																																			.		0.453	ATP2B1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406652.1	NM_001682	
ATP6V0A2	23545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	124229432	124229432	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:124229432C>A	ENST00000330342.3	+	13	1766	c.1518C>A	c.(1516-1518)gaC>gaA	p.D506E		NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	506					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		GTTACAGTGACAGCGTCGTTA	0.522																																					p.D506E		.											.	ATP6V0A2	92	0			c.C1518A						.						176.0	147.0	157.0					12																	124229432		2203	4300	6503	SO:0001583	missense	23545	exon13			CAGTGACAGCGTC	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.1518C>A	12.37:g.124229432C>A	ENSP00000332247:p.Asp506Glu	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	17.0	NM_012463	A8K026|Q6NUM0	Missense_Mutation	SNP	ENST00000330342.3	37	CCDS9254.1	.	.	.	.	.	.	.	.	.	.	C	2.760	-0.258082	0.05791	.	.	ENSG00000185344	ENST00000330342	D	0.84146	-1.81	5.32	4.37	0.52481	.	0.625902	0.18375	N	0.143130	T	0.69806	0.3152	N	0.21240	0.645	0.37146	D	0.901955	B	0.06786	0.001	B	0.12837	0.008	T	0.61964	-0.6954	10	0.02654	T	1	-34.0027	7.9518	0.30019	0.1624:0.7527:0.0:0.0849	.	506	Q9Y487	VPP2_HUMAN	E	506	ENSP00000332247:D506E	ENSP00000332247:D506E	D	+	3	2	ATP6V0A2	122795385	0.031000	0.19500	0.937000	0.37676	0.018000	0.09664	0.737000	0.26144	2.503000	0.84419	0.555000	0.69702	GAC	.		0.522	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
BCAN	63827	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156616630	156616630	+	Silent	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:156616630G>A	ENST00000329117.5	+	3	465	c.129G>A	c.(127-129)gcG>gcA	p.A43A	RP11-284F21.10_ENST00000605886.1_RNA|BCAN_ENST00000361588.5_Silent_p.A43A|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	43	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CGGGCGACGCGCCACTGCAGG	0.721																																					p.A43A		.											.	BCAN	516	0			c.G129A						.						15.0	17.0	17.0					1																	156616630		2177	4239	6416	SO:0001819	synonymous_variant	63827	exon3			CGACGCGCCACTG	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.129G>A	1.37:g.156616630G>A		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	8.0	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	ENST00000329117.5	37	CCDS1149.1																																																																																			.		0.721	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
C10orf113	387638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	21435299	21435299	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:21435299C>G	ENST00000534331.1	-	1	189	c.139G>C	c.(139-141)Gct>Cct	p.A47P	C10orf113_ENST00000529198.1_Missense_Mutation_p.A47P|NEBL_ENST00000417816.2_Intron|C10orf113_ENST00000377118.4_Missense_Mutation_p.A37P	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	47										endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						TACATTTCAGCCACACAAGAA	0.433																																					p.A47P		.											.	C10orf113	93	0			c.G139C						.						153.0	136.0	142.0					10																	21435299		2203	4300	6503	SO:0001583	missense	387638	exon1			TTTCAGCCACACA		CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.139G>C	10.37:g.21435299C>G	ENSP00000433646:p.Ala47Pro	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	27.0	NM_001177483	B9EIM9|E9PRX7	Missense_Mutation	SNP	ENST00000534331.1	37	CCDS31162.2	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289650	0.40494	.	.	ENSG00000204683	ENST00000534331;ENST00000529198;ENST00000377118	T;T	0.39406	1.08;1.08	5.44	-7.19	0.01500	.	.	.	.	.	T	0.16428	0.0395	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24368	-1.0162	9	0.87932	D	0	5.4267	2.2927	0.04143	0.321:0.1168:0.3841:0.178	.	47	Q5VZT2	CJ113_HUMAN	P	47;47;37	ENSP00000433646:A47P;ENSP00000366322:A37P	ENSP00000366322:A37P	A	-	1	0	C10orf113	21475305	0.000000	0.05858	0.000000	0.03702	0.117000	0.20001	-0.009000	0.12765	-0.789000	0.04498	-0.950000	0.02660	GCT	.		0.433	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047108.3	NM_001010896	
C1QTNF2	114898	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	159797621	159797621	+	Silent	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:159797621C>A	ENST00000393975.3	-	1	27	c.24G>T	c.(22-24)ccG>ccT	p.P8P		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	0					activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCAGAGCGTCGGCCCCAGGC	0.687																																					p.P8P		.											.	C1QTNF2	91	0			c.G24T						.						14.0	17.0	16.0					5																	159797621		1838	4041	5879	SO:0001819	synonymous_variant	114898	exon1			GAGCGTCGGCCCC	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.24G>T	5.37:g.159797621C>A		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	4.0	NM_031908		Silent	SNP	ENST00000393975.3	37	CCDS4351.2																																																																																			.		0.687	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
C2CD5	9847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	22610088	22610088	+	Silent	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:22610088T>A	ENST00000333957.4	-	23	2796	c.2541A>T	c.(2539-2541)acA>acT	p.T847T	C2CD5_ENST00000545552.1_Silent_p.T901T|C2CD5_ENST00000396028.2_Silent_p.T889T|C2CD5_ENST00000544930.1_Silent_p.T703T|C2CD5_ENST00000536386.1_Silent_p.T900T|C2CD5_ENST00000542676.1_Silent_p.T898T|C2CD5_ENST00000446597.1_Silent_p.T898T	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	847					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CTTTTTCAACTGTCATGGCTA	0.413																																					p.T847T		.											.	.	.	0			c.A2541T						.						86.0	79.0	81.0					12																	22610088		2203	4300	6503	SO:0001819	synonymous_variant	9847	exon23			TTCAACTGTCATG	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.2541A>T	12.37:g.22610088T>A		Somatic	183.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	16.0	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	ENST00000333957.4	37	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	T	5.333	0.246717	0.10130	.	.	ENSG00000111731	ENST00000539615	.	.	.	4.96	-0.673	0.11373	.	.	.	.	.	T	0.42223	0.1193	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22382	-1.0218	4	.	.	.	-20.7239	2.6175	0.04907	0.238:0.0694:0.3488:0.3438	.	.	.	.	L	148	.	.	Q	-	2	0	KIAA0528	22501355	0.847000	0.29606	0.966000	0.40874	0.882000	0.50991	-0.013000	0.12678	-0.267000	0.09325	-0.316000	0.08728	CAG	.		0.413	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
CAND1	55832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	67699601	67699602	+	Frame_Shift_Ins	INS	-	-	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:67699601_67699602insT	ENST00000545606.1	+	10	2590_2591	c.2153_2154insT	c.(2152-2157)actttgfs	p.L719fs		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	719					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTTCTTACCACTTTGGCAAAAG	0.436																																					p.T718fs		.											.	CAND1	516	0			c.2153_2154insT						.																																			SO:0001589	frameshift_variant	55832	exon10			TTACCACTTTGGC		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2156dupT	12.37:g.67699604_67699604dupT	ENSP00000442318:p.Leu719fs	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	32.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Frame_Shift_Ins	INS	ENST00000545606.1	37	CCDS8977.1																																																																																			.		0.436	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
CCM2	83605	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	45108142	45108142	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:45108142G>T	ENST00000258781.6	+	5	722	c.573G>T	c.(571-573)gaG>gaT	p.E191D	CCM2_ENST00000381112.3_Missense_Mutation_p.E212D|CCM2_ENST00000541586.1_Missense_Mutation_p.E133D|CCM2_ENST00000474617.1_Intron|CCM2_ENST00000475551.1_Missense_Mutation_p.E185D|CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000544363.1_Intron	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	191	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GGCCCGTGGAGGCATGCTGCC	0.632																																					p.E212D		.											.	CCM2	90	0			c.G636T						.						96.0	87.0	90.0					7																	45108142		2203	4300	6503	SO:0001583	missense	83605	exon5			CGTGGAGGCATGC	BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.573G>T	7.37:g.45108142G>T	ENSP00000258781:p.Glu191Asp	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	4.0	NM_001029835	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Missense_Mutation	SNP	ENST00000258781.6	37	CCDS5500.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.65|12.65	2.002989|2.002989	0.35320|0.35320	.|.	.|.	ENSG00000136280|ENSG00000136280	ENST00000258781;ENST00000541586;ENST00000475551;ENST00000381112|ENST00000480382	T;T;T;T|.	0.40756|.	1.02;1.02;1.02;1.02|.	4.74|4.74	1.25|1.25	0.21368|0.21368	Phosphotyrosine interaction domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.43255|0.43255	0.1239|0.1239	L|L	0.39566|0.39566	1.225|1.225	0.45979|0.45979	D|D	0.998792|0.998792	B;B;B;B|.	0.29301|.	0.241;0.015;0.037;0.015|.	B;B;B;B|.	0.29353|.	0.101;0.016;0.024;0.016|.	T|T	0.15578|0.15578	-1.0432|-1.0432	10|5	0.37606|.	T|.	0.19|.	-30.1843|-30.1843	4.1403|4.1403	0.10189|0.10189	0.5451:0.1929:0.262:0.0|0.5451:0.1929:0.262:0.0	.|.	154;212;133;191|.	B7Z8D5;E9PDJ3;F5H551;Q9BSQ5|.	.;.;.;CCM2_HUMAN|.	D|M	191;133;185;212|17	ENSP00000258781:E191D;ENSP00000444725:E133D;ENSP00000417180:E185D;ENSP00000370503:E212D|.	ENSP00000258781:E191D|.	E|R	+|+	3|2	2|0	CCM2|CCM2	45074667|45074667	0.888000|0.888000	0.30383|0.30383	0.735000|0.735000	0.30896|0.30896	0.981000|0.981000	0.71138|0.71138	0.056000|0.056000	0.14256|0.14256	0.089000|0.089000	0.17243|0.17243	-0.258000|-0.258000	0.10820|0.10820	GAG|AGG	.		0.632	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251348.1	NM_031443	
CCNB3	85417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	50037976	50037976	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chrX:50037976T>A	ENST00000376042.1	+	5	616	c.318T>A	c.(316-318)aaT>aaA	p.N106K	CCNB3_ENST00000276014.7_Missense_Mutation_p.N106K|CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	106					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CCAAAAAGAATAAGCGGAATC	0.393																																					p.N106K		.											.	CCNB3	482	0			c.T318A						.						121.0	103.0	109.0					X																	50037976		2203	4300	6503	SO:0001583	missense	85417	exon4			AAAGAATAAGCGG	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.318T>A	X.37:g.50037976T>A	ENSP00000365210:p.Asn106Lys	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	16.0	NM_033031	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	T	9.444	1.088815	0.20390	.	.	ENSG00000147082	ENST00000376042;ENST00000396540;ENST00000276014	T;T	0.11063	2.81;2.81	3.83	1.31	0.21738	.	18.892400	0.00166	N	0.000002	T	0.10594	0.0259	L	0.43152	1.355	0.09310	N	1	B	0.18461	0.028	B	0.11329	0.006	T	0.27739	-1.0065	9	.	.	.	.	3.3901	0.07286	0.0:0.1305:0.2346:0.6349	.	106	Q8WWL7	CCNB3_HUMAN	K	106	ENSP00000365210:N106K;ENSP00000276014:N106K	.	N	+	3	2	CCNB3	50054716	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	0.994000	0.29693	0.065000	0.16485	0.478000	0.44815	AAT	.		0.393	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1		
CCRN4L	25819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	139965791	139965791	+	Splice_Site	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:139965791A>T	ENST00000280614.2	+	3	653		c.e3-1		ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)						circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					TTTTCTTTTCAGCTCTTGGAG	0.458																																					.	Ovarian(144;566 1842 19130 21379 22209)	.											.	CCRN4L	91	0			c.461-2A>T						.						44.0	45.0	45.0					4																	139965791		2203	4300	6503	SO:0001630	splice_region_variant	25819	exon3			CTTTTCAGCTCTT	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.461-1A>T	4.37:g.139965791A>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	10.0	5.0	NM_012118	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Splice_Site	SNP	ENST00000280614.2	37	CCDS3743.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937617	0.73557	.	.	ENSG00000151014	ENST00000280614	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9463	0.71035	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCRN4L	140185241	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.262000	0.95591	1.938000	0.56188	0.454000	0.30748	.	.		0.458	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118	Intron
CEP57	9702	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	95560987	95560987	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:95560987A>C	ENST00000325542.5	+	9	1161	c.923A>C	c.(922-924)cAg>cCg	p.Q308P	CEP57_ENST00000537677.1_Missense_Mutation_p.Q281P|CEP57_ENST00000325486.5_Missense_Mutation_p.Q282P|CEP57_ENST00000541150.1_Missense_Mutation_p.Q299P	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	308	Mediates interaction with microtubules. {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCCAATGTTCAGCTTGTCTTG	0.403									Mosaic Variegated Aneuploidy Syndrome																												p.Q308P		.											.	CEP57	91	0			c.A923C						.						146.0	134.0	138.0					11																	95560987		2201	4298	6499	SO:0001583	missense	9702	exon9	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	ATGTTCAGCTTGT	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.923A>C	11.37:g.95560987A>C	ENSP00000317902:p.Gln308Pro	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	11.0	NM_014679	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	37	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.180260	0.78677	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000541150;ENST00000537093	T;T;T;T;T	0.60040	0.37;0.3;0.94;0.31;0.22	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	T	0.76997	0.4066	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.97110	0.994;1.0;0.986	T	0.80221	-0.1472	10	0.87932	D	0	-3.107	15.9926	0.80217	1.0:0.0:0.0:0.0	.	299;282;308	F5H5F7;Q86XR8-2;Q86XR8	.;.;CEP57_HUMAN	P	281;308;282;299;67	ENSP00000441392:Q281P;ENSP00000317902:Q308P;ENSP00000317487:Q282P;ENSP00000443436:Q299P;ENSP00000444749:Q67P	ENSP00000317487:Q282P	Q	+	2	0	CEP57	95200635	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	7.705000	0.84606	2.185000	0.69588	0.260000	0.18958	CAG	.		0.403	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395983.1	NM_014679	
CHRNA2	1135	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	27324790	27324790	+	Silent	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:27324790G>T	ENST00000520933.2	-	4	558	c.405C>A	c.(403-405)gtC>gtA	p.V135V	CHRNA2_ENST00000240132.2_Silent_p.V120V|CHRNA2_ENST00000407991.1_Silent_p.V135V			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	135					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	TCTCAGAAGGGACCCTGAGAG	0.557																																					p.V135V		.											.	CHRNA2	91	0			c.C405A						.						121.0	114.0	116.0					8																	27324790		2203	4300	6503	SO:0001819	synonymous_variant	1135	exon5			AGAAGGGACCCTG	U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.405C>A	8.37:g.27324790G>T		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	5.0	NM_000742	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Silent	SNP	ENST00000520933.2	37	CCDS6059.1																																																																																			.		0.557	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376125.4		
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	125192135	125192135	+	Nonsense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:125192135A>T	ENST00000431078.1	+	5	968	c.604A>T	c.(604-606)Aaa>Taa	p.K202*		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	202	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GAGTACTCTCAAAGATGTGAT	0.483																																					p.K202X		.											.	CNTNAP5	524	0			c.A604T						.						124.0	118.0	120.0					2																	125192135		2003	4197	6200	SO:0001587	stop_gained	129684	exon5			ACTCTCAAAGATG	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.604A>T	2.37:g.125192135A>T	ENSP00000399013:p.Lys202*	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	28.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Nonsense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	A	42	9.240057	0.99111	.	.	ENSG00000155052	ENST00000431078	.	.	.	5.48	5.48	0.80851	.	0.000000	0.50627	D	0.000111	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7735	0.69699	1.0:0.0:0.0:0.0	.	.	.	.	X	202	.	ENSP00000399013:K202X	K	+	1	0	CNTNAP5	124908605	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	9.169000	0.94788	2.084000	0.62774	0.533000	0.62120	AAA	.		0.483	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CR2	1380	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207647181	207647181	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:207647181C>T	ENST00000367058.3	+	11	2203	c.2014C>T	c.(2014-2016)Ctt>Ttt	p.L672F	CR2_ENST00000458541.2_Missense_Mutation_p.L645F|CR2_ENST00000367059.3_Missense_Mutation_p.L672F|CR2_ENST00000367057.3_Missense_Mutation_p.L731F	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	672	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TCTTCAAGAACTTCCAGCTGG	0.428																																					p.L731F		.											.	CR2	232	0			c.C2191T						.						123.0	122.0	122.0					1																	207647181		2203	4300	6503	SO:0001583	missense	1380	exon12			CAAGAACTTCCAG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2014C>T	1.37:g.207647181C>T	ENSP00000356025:p.Leu672Phe	Somatic	128.0	1.0		WXS	Illumina HiSeq	Phase_I	86.0	25.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	37	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	C	6.406	0.443027	0.12164	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.35421	1.43;1.31;1.45;1.39	5.26	-0.265	0.12946	Sushi/SCR/CCP (2);	.	.	.	.	T	0.46795	0.1411	L	0.51422	1.61	0.09310	N	1	D;P;P	0.52996	0.957;0.95;0.946	D;P;P	0.63703	0.917;0.861;0.754	T	0.36432	-0.9748	9	0.51188	T	0.08	.	8.3533	0.32316	0.4399:0.3114:0.2487:0.0	.	672;672;731	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	F	672;731;672;645	ENSP00000356025:L672F;ENSP00000356024:L731F;ENSP00000356026:L672F;ENSP00000404222:L645F	ENSP00000356024:L731F	L	+	1	0	CR2	205713804	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.282000	0.08445	-0.349000	0.08274	-0.868000	0.02995	CTT	.		0.428	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
CRISP2	7180	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	49668498	49668498	+	Splice_Site	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:49668498C>G	ENST00000339139.4	-	5	303		c.e5-1			NM_001142407.2|NM_001142408.2|NM_001142417.2|NM_001142435.2|NM_001261822.1|NM_003296.3	NP_001135879.1|NP_001135880.1|NP_001135889.1|NP_001135907.1|NP_001248751.1|NP_003287.1	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2						single organismal cell-cell adhesion (GO:0016337)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			AAGCGGGATCCTAAAAGAAAA	0.318																																					.		.											.	CRISP2	91	0			c.67-1G>C						.						58.0	58.0	58.0					6																	49668498		2203	4300	6503	SO:0001630	splice_region_variant	7180	exon5			GGGATCCTAAAAG	X95239	CCDS4928.1	6p12.3	2009-03-12	2003-09-03	2003-09-05	ENSG00000124490	ENSG00000124490			12024	protein-coding gene	gene with protein product	"""cancer/testis antigen 36"""	187430	"""testis specific protein 1 (probe H4-1 p3-1)"""	GAPDL5, TPX1		2613236, 8665901	Standard	NM_003296		Approved	CRISP-2, CT36	uc003ozo.3	P16562	OTTHUMG00000014822	ENST00000339139.4:c.67-1G>C	6.37:g.49668498C>G		Somatic	108.0	1.0		WXS	Illumina HiSeq	Phase_I	60.0	9.0	NM_001142435	A8K8M0|Q53FF2|Q5U8Z9|Q7Z7B2	Splice_Site	SNP	ENST00000339139.4	37	CCDS4928.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.961026	0.34565	.	.	ENSG00000124490	ENST00000339139;ENST00000211238	.	.	.	5.42	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0267	0.47748	0.1853:0.8147:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CRISP2	49776457	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	2.902000	0.48703	1.450000	0.47717	0.650000	0.86243	.	.		0.318	CRISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040870.2	NM_003296	Intron
CRTC2	200186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153920974	153920974	+	Silent	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:153920974G>A	ENST00000368633.1	-	13	1948	c.1821C>T	c.(1819-1821)caC>caT	p.H607H	CRTC2_ENST00000368630.3_Silent_p.H287H|DENND4B_ENST00000361217.4_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	607					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGCGGGAACAGTGGGTCAAGT	0.562																																					p.H607H		.											.	CRTC2	228	0			c.C1821T						.						127.0	115.0	119.0					1																	153920974		2203	4300	6503	SO:0001819	synonymous_variant	200186	exon13			GGAACAGTGGGTC	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.1821C>T	1.37:g.153920974G>A		Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	16.0	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Silent	SNP	ENST00000368633.1	37	CCDS30875.1																																																																																			.		0.562	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
CSRP2BP	57325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	18165423	18165423	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr20:18165423A>G	ENST00000435364.3	+	9	2503	c.2162A>G	c.(2161-2163)tAt>tGt	p.Y721C	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.Y593C|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.Y720C	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	721	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						TTCATGATCTATCATCTGATT	0.443																																					p.Y721C		.											.	CSRP2BP	525	0			c.A2162G						.						175.0	142.0	154.0					20																	18165423		2203	4300	6503	SO:0001583	missense	57325	exon9			TGATCTATCATCT	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.2162A>G	20.37:g.18165423A>G	ENSP00000392318:p.Tyr721Cys	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	8.0	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421144	0.83559	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	5.99	5.99	0.97316	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.30759	0.0775	N	0.12471	0.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.31052	-0.9957	10	0.87932	D	0	-15.7416	16.4943	0.84223	1.0:0.0:0.0:0.0	.	593;721	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	C	721;720;721;593	ENSP00000278816:Y721C;ENSP00000366909:Y720C;ENSP00000392318:Y721C;ENSP00000425909:Y593C	ENSP00000278816:Y721C	Y	+	2	0	CSRP2BP	18113423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.228000	0.95250	2.291000	0.77112	0.533000	0.62120	TAT	.		0.443	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
DCDC2	51473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	24205315	24205315	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:24205315T>G	ENST00000378454.3	-	8	1239	c.938A>C	c.(937-939)aAa>aCa	p.K313T	DCDC2_ENST00000378450.3_Missense_Mutation_p.K66T	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	313					cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TGCTCCAGCTTTGAAAATGCC	0.433																																					p.K313T		.											.	DCDC2	91	0			c.A938C						.						207.0	198.0	201.0					6																	24205315		2203	4299	6502	SO:0001583	missense	51473	exon9			CCAGCTTTGAAAA	AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.938A>C	6.37:g.24205315T>G	ENSP00000367715:p.Lys313Thr	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	16.0	NM_001195610	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Missense_Mutation	SNP	ENST00000378454.3	37	CCDS4550.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.392928	0.83011	.	.	ENSG00000146038	ENST00000378454;ENST00000378450	T;T	0.59364	4.18;0.27	6.07	6.07	0.98685	.	0.170523	0.51477	D	0.000083	T	0.71151	0.3306	M	0.78049	2.395	0.42088	D	0.991287	P;D	0.71674	0.891;0.998	B;D	0.68039	0.439;0.955	T	0.76063	-0.3096	10	0.87932	D	0	-0.4623	16.3141	0.82909	0.0:0.0:0.0:1.0	.	313;66	Q9UHG0;Q9UHG0-2	DCDC2_HUMAN;.	T	313;66	ENSP00000367715:K313T;ENSP00000367711:K66T	ENSP00000367711:K66T	K	-	2	0	DCDC2	24313294	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.679000	0.54634	2.326000	0.78906	0.533000	0.62120	AAA	.		0.433	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356	
DDRGK1	65992	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3171873	3171873	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr20:3171873A>T	ENST00000354488.3	-	8	798	c.741T>A	c.(739-741)aaT>aaA	p.N247K	DDRGK1_ENST00000496781.1_5'UTR	NM_023935.1	NP_076424.1	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1	247	PCI.					endoplasmic reticulum (GO:0005783)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7						CCTGGATGCGATTTATGGTGT	0.517																																					p.N247K		.											.	DDRGK1	90	0			c.T741A						.						130.0	108.0	115.0					20																	3171873		2203	4300	6503	SO:0001583	missense	65992	exon8			GATGCGATTTATG	AL121891	CCDS13050.1	20p13	2011-08-18	2008-10-03	2008-10-03	ENSG00000198171	ENSG00000198171			16110	protein-coding gene	gene with protein product	"""Dashurin"""		"""chromosome 20 open reading frame 116"""	C20orf116		20036718, 20228063, 21494687	Standard	NM_023935		Approved	dJ1187M17.3	uc002wic.3	Q96HY6	OTTHUMG00000031732	ENST00000354488.3:c.741T>A	20.37:g.3171873A>T	ENSP00000346483:p.Asn247Lys	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	6.0	NM_023935	A6NIU5|C9JSZ5|Q9BW47	Missense_Mutation	SNP	ENST00000354488.3	37	CCDS13050.1	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750690	0.69533	.	.	ENSG00000198171	ENST00000354488	T	0.46819	0.86	5.19	2.18	0.27775	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.237095	0.49916	D	0.000133	T	0.45836	0.1362	L	0.45352	1.415	0.80722	D	1	P	0.48911	0.917	P	0.54629	0.757	T	0.32903	-0.9889	10	0.11794	T	0.64	-16.6113	8.4055	0.32612	0.2671:0.0:0.7329:0.0	.	247	Q96HY6	DDRGK_HUMAN	K	247	ENSP00000346483:N247K	ENSP00000346483:N247K	N	-	3	2	DDRGK1	3119873	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.538000	0.36094	0.284000	0.22305	-0.242000	0.12053	AAT	.		0.517	DDRGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077709.2	NM_023935	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84844030	84844030	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:84844030A>T	ENST00000237449.6	+	22	3504	c.3496A>T	c.(3496-3498)Aac>Tac	p.N1166Y	DNAH6_ENST00000398278.2_Missense_Mutation_p.N1166Y|DNAH6_ENST00000389394.3_Missense_Mutation_p.N1166Y			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1166	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AACTTTTCAAAACAATAATGC	0.274																																					p.N1166Y		.											.	DNAH6	69	0			c.A3496T						.						43.0	39.0	40.0					2																	84844030		692	1579	2271	SO:0001583	missense	1768	exon23			TTTCAAAACAATA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3496A>T	2.37:g.84844030A>T	ENSP00000237449:p.Asn1166Tyr	Somatic	328.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	80.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313751	0.60414	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.61510	0.1;0.1;0.1	5.14	5.14	0.70334	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.71693	0.3370	M	0.64997	1.995	0.34886	D	0.745037	D	0.63046	0.992	D	0.67900	0.954	T	0.81022	-0.1121	9	0.66056	D	0.02	.	13.9504	0.64113	1.0:0.0:0.0:0.0	.	1166	Q9C0G6	DYH6_HUMAN	Y	1166	ENSP00000374045:N1166Y;ENSP00000381326:N1166Y;ENSP00000237449:N1166Y	ENSP00000237449:N1166Y	N	+	1	0	DNAH6	84697541	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.768000	0.62293	1.934000	0.56057	0.455000	0.32223	AAC	.		0.274	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DNAJC19	131118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	180704791	180704791	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:180704791T>C	ENST00000382564.2	-	4	319	c.149A>G	c.(148-150)tAt>tGt	p.Y50C	DNAJC19_ENST00000486355.1_Missense_Mutation_p.Y50C|DNAJC19_ENST00000479269.1_Missense_Mutation_p.Y25C|DNAJC19_ENST00000491873.1_Missense_Mutation_p.Y25C	NM_145261.3	NP_660304.1	Q96DA6	TIM14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 19	50					cellular protein metabolic process (GO:0044267)|genitalia development (GO:0048806)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				large_intestine(2)|lung(1)	3	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			CCCACCTCTATAATAGCCACC	0.328																																					p.Y50C		.											.	DNAJC19	226	0			c.A149G						.						81.0	88.0	85.0					3																	180704791		2203	4300	6503	SO:0001583	missense	131118	exon4			CCTCTATAATAGC		CCDS33895.1, CCDS54684.1	3q26.33	2014-09-17			ENSG00000205981	ENSG00000205981		"""Heat shock proteins / DNAJ (HSP40)"""	30528	protein-coding gene	gene with protein product		608977				19564938	Standard	NM_145261		Approved	TIMM14, Tim14, Pam18	uc003fkt.3	Q96DA6	OTTHUMG00000158180	ENST00000382564.2:c.149A>G	3.37:g.180704791T>C	ENSP00000372005:p.Tyr50Cys	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	27.0	NM_145261	B2R4B1|C9JBV1	Missense_Mutation	SNP	ENST00000382564.2	37	CCDS33895.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.266136	0.80358	.	.	ENSG00000205981	ENST00000382564;ENST00000491873;ENST00000479269	.	.	.	5.77	5.77	0.91146	.	0.052954	0.85682	D	0.000000	T	0.79992	0.4542	M	0.93375	3.41	0.80722	D	1	D	0.59767	0.986	P	0.53722	0.733	D	0.85443	0.1156	9	0.66056	D	0.02	-1.6047	14.9515	0.71077	0.0:0.0:0.0:1.0	.	50	Q96DA6	TIM14_HUMAN	C	50;25;25	.	ENSP00000372005:Y50C	Y	-	2	0	DNAJC19	182187485	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.599000	0.74127	2.326000	0.78906	0.528000	0.53228	TAT	.		0.328	DNAJC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350336.1	NM_145261	
DYNC1H1	1778	broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	102463601	102463601	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:102463601A>C	ENST00000360184.4	+	16	3958	c.3794A>C	c.(3793-3795)aAg>aCg	p.K1265T		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1265	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAGAAGACCAAGCCTGTCACG	0.567																																					p.K1265T		.											.	DYNC1H1	98	0			c.A3794C						.						39.0	38.0	39.0					14																	102463601		2203	4300	6503	SO:0001583	missense	1778	exon16			AGACCAAGCCTGT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.3794A>C	14.37:g.102463601A>C	ENSP00000348965:p.Lys1265Thr	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	7.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.041036	0.93685	.	.	ENSG00000197102	ENST00000360184	T	0.59502	0.26	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.80803	0.4693	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81913	-0.0715	10	0.32370	T	0.25	.	16.5724	0.84622	1.0:0.0:0.0:0.0	.	1265	Q14204	DYHC1_HUMAN	T	1265	ENSP00000348965:K1265T	ENSP00000348965:K1265T	K	+	2	0	DYNC1H1	101533354	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.276000	0.95745	2.313000	0.78055	0.455000	0.32223	AAG	.		0.567	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
DYSF	8291	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	71827927	71827927	+	Silent	SNP	G	G	A	rs139983909	byFrequency	TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:71827927G>A	ENST00000258104.3	+	34	4075	c.3798G>A	c.(3796-3798)ccG>ccA	p.P1266P	DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000429174.2_Silent_p.P1266P|DYSF_ENST00000409651.1_Silent_p.P1298P|DYSF_ENST00000394120.2_Silent_p.P1267P|DYSF_ENST00000410020.3_Silent_p.P1284P|DYSF_ENST00000409366.1_Silent_p.P1267P|DYSF_ENST00000410041.1_Silent_p.P1284P|DYSF_ENST00000413539.2_Silent_p.P1297P|DYSF_ENST00000409744.1_Silent_p.P1253P|DYSF_ENST00000409582.3_Silent_p.P1283P|DYSF_ENST00000409762.1_Silent_p.P1283P	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1266					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GCAGCCAGCCGTCGGGGGAGC	0.622													g|||	2	0.000399361	0.0008	0.0	5008	,	,		17253	0.001		0.0	False		,,,				2504	0.0				p.P1298P		.											.	DYSF	158	0			c.G3894A						.	A	,,,,,,,,,,,,,	0,4406		0,0,2203	49.0	59.0	56.0		3801,3756,3756,3798,3891,3849,3849,3894,3801,3759,3852,3759,3852,3798	-11.1	0.0	2	dbSNP_134	56	4,8594		0,4,4295	yes	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DYSF	NM_001130455.1,NM_001130976.1,NM_001130977.1,NM_001130978.1,NM_001130979.1,NM_001130980.1,NM_001130981.1,NM_001130982.1,NM_001130983.1,NM_001130984.1,NM_001130985.1,NM_001130986.1,NM_001130987.1,NM_003494.3	,,,,,,,,,,,,,	0,4,6498	AA,AG,GG		0.0465,0.0,0.0308	,,,,,,,,,,,,,	1267/2082,1252/2067,1252/2088,1266/2102,1297/2112,1283/2098,1283/2119,1298/2113,1267/2103,1253/2089,1284/2099,1253/2068,1284/2120,1266/2081	71827927	4,13000	2203	4299	6502	SO:0001819	synonymous_variant	8291	exon35			CCAGCCGTCGGGG	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3798G>A	2.37:g.71827927G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	5.0	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	CCDS1918.1																																																																																			G|1.000;A|0.000		0.622	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
DZIP3	9666	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108347953	108347953	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:108347953T>C	ENST00000361582.3	+	8	856	c.626T>C	c.(625-627)aTt>aCt	p.I209T	DZIP3_ENST00000463306.1_Missense_Mutation_p.I209T	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	209					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TTACAAGAAATTGGAGACAAA	0.308																																					p.I209T		.											.	DZIP3	91	0			c.T626C						.						102.0	108.0	106.0					3																	108347953		2203	4300	6503	SO:0001583	missense	9666	exon8			AAGAAATTGGAGA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.626T>C	3.37:g.108347953T>C	ENSP00000355028:p.Ile209Thr	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	15.0	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.743053	0.30865	.	.	ENSG00000198919	ENST00000393969;ENST00000361582;ENST00000486815;ENST00000479138;ENST00000463306	T;T	0.30714	1.52;1.52	4.37	3.2	0.36748	.	0.000000	0.52532	D	0.000061	T	0.34571	0.0902	N	0.19112	0.55	0.31840	N	0.623543	D	0.76494	0.999	D	0.78314	0.991	T	0.38757	-0.9646	10	0.87932	D	0	-8.7949	6.6666	0.23044	0.0:0.109:0.0:0.891	.	209	Q86Y13	DZIP3_HUMAN	T	209;209;125;209;209	ENSP00000355028:I209T;ENSP00000419981:I209T	ENSP00000355028:I209T	I	+	2	0	DZIP3	109830643	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.064000	0.41432	0.701000	0.31803	0.482000	0.46254	ATT	.		0.308	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
EDNRA	1909	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	148463734	148463734	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:148463734C>T	ENST00000324300.5	+	8	1763	c.1248C>T	c.(1246-1248)aaC>aaT	p.N416N	EDNRA_ENST00000503721.1_3'UTR|EDNRA_ENST00000511804.1_Silent_p.N191N|EDNRA_ENST00000339690.5_3'UTR|EDNRA_ENST00000358556.4_Silent_p.N307N|EDNRA_ENST00000506066.1_Silent_p.N307N	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	416					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	ACAACCACAACACAGACCGGA	0.507																																					p.N416N		.											.	EDNRA	586	0			c.C1248T						.						163.0	167.0	166.0					4																	148463734		2203	4300	6503	SO:0001819	synonymous_variant	1909	exon8			CCACAACACAGAC	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.1248C>T	4.37:g.148463734C>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	6.0	NM_001957	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Silent	SNP	ENST00000324300.5	37	CCDS3769.1																																																																																			.		0.507	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
EFCAB13	124989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	45518054	45518054	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:45518054A>G	ENST00000331493.2	+	25	3307	c.2896A>G	c.(2896-2898)Aag>Gag	p.K966E		NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	966						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AAATATTGCTAAGCTTAACCC	0.274																																					p.K966E		.											.	.	.	0			c.A2896G						.						63.0	69.0	67.0					17																	45518054		2201	4287	6488	SO:0001583	missense	124989	exon25			ATTGCTAAGCTTA	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.2896A>G	17.37:g.45518054A>G	ENSP00000332111:p.Lys966Glu	Somatic	263.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	61.0	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	.	11.74	1.729799	0.30684	.	.	ENSG00000178852	ENST00000331493	T	0.61510	0.1	1.77	1.77	0.24775	.	.	.	.	.	T	0.50274	0.1606	N	0.08118	0	0.09310	N	0.999995	D	0.60575	0.988	D	0.65010	0.931	T	0.33624	-0.9861	9	0.87932	D	0	.	5.6013	0.17355	1.0:0.0:0.0:0.0	.	966	Q8IY85	CQ057_HUMAN	E	966	ENSP00000332111:K966E	ENSP00000332111:K966E	K	+	1	0	C17orf57	42873053	0.006000	0.16342	0.005000	0.12908	0.279000	0.26890	0.557000	0.23454	1.066000	0.40716	0.255000	0.18592	AAG	.		0.274	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
EIF2AK4	440275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	40321621	40321621	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr15:40321621A>G	ENST00000263791.5	+	34	4560	c.4517A>G	c.(4516-4518)aAt>aGt	p.N1506S	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.N1478S	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	1506					cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GCTTCCGATAATCTTGCAGTG	0.323																																					p.N1506S		.											.	EIF2AK4	757	0			c.A4517G						.						119.0	116.0	117.0					15																	40321621		1836	4074	5910	SO:0001583	missense	440275	exon34			CCGATAATCTTGC	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.4517A>G	15.37:g.40321621A>G	ENSP00000263791:p.Asn1506Ser	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	19.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	A	9.610	1.131109	0.21041	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.40756	1.02;1.02	5.83	4.71	0.59529	Serine/threonine-protein kinase GCN2, anticodon binding domain (1);	0.092562	0.85682	D	0.000000	T	0.15825	0.0381	N	0.02916	-0.46	0.41036	D	0.985193	B;B	0.13145	0.006;0.007	B;B	0.15052	0.007;0.012	T	0.16247	-1.0409	10	0.05436	T	0.98	-28.7942	9.7267	0.40337	0.9215:0.0:0.0785:0.0	.	1478;1506	Q9P2K8-2;Q9P2K8	.;E2AK4_HUMAN	S	1506;1478	ENSP00000263791:N1506S;ENSP00000372174:N1478S	ENSP00000263791:N1506S	N	+	2	0	EIF2AK4	38108913	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.756000	0.38390	2.212000	0.71576	0.533000	0.62120	AAT	.		0.323	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
EMC10	284361	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50981193	50981193	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:50981193C>T	ENST00000334976.6	+	2	168	c.122C>T	c.(121-123)gCg>gTg	p.A41V	EMC10_ENST00000598585.1_Missense_Mutation_p.A41V|FAM71E1_ENST00000595790.1_5'Flank|EMC10_ENST00000376918.3_Missense_Mutation_p.A41V|CTD-2545M3.2_ENST00000598194.1_RNA|FAM71E1_ENST00000600100.1_5'Flank	NM_206538.2	NP_996261.1	Q5UCC4	EMC10_HUMAN	ER membrane protein complex subunit 10	41						ER membrane protein complex (GO:0072546)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)											CAGGCTGGGGCGGAAGGTCGA	0.612																																					p.A41V		.											.	.	.	0			c.C122T						.						81.0	79.0	79.0					19																	50981193		2203	4300	6503	SO:0001583	missense	284361	exon2			CTGGGGCGGAAGG	BC062607	CCDS12796.1, CCDS42594.1	19q13.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000161671	ENSG00000161671			27609	protein-coding gene	gene with protein product	"""hematopoietic signal peptide-containing secreted 1"", ""hematopoietic signal peptide-containing membrane domain-containing 1"""	614545	"""chromosome 19 open reading frame 63"""	C19orf63		12975309, 22119785	Standard	NM_175063		Approved	INM02, HSS1, HSM1	uc002psl.3	Q5UCC4		ENST00000334976.6:c.122C>T	19.37:g.50981193C>T	ENSP00000334037:p.Ala41Val	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	6.0	NM_175063	Q5UCC6|Q69YT5|Q6UWP3|Q86YL4|Q8N541	Missense_Mutation	SNP	ENST00000334976.6	37	CCDS12796.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.491977	0.26774	.	.	ENSG00000161671	ENST00000334976;ENST00000376918;ENST00000376920	.	.	.	3.74	-0.836	0.10770	.	0.560520	0.16961	N	0.192519	T	0.27098	0.0664	L	0.40543	1.245	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.08055	0.002;0.003;0.003	T	0.16808	-1.0390	9	0.24483	T	0.36	-10.8405	6.6222	0.22810	0.0:0.5772:0.0:0.4228	.	41;41;41	Q5UCC4;Q5UCC4-2;Q5UCC4-3	INM02_HUMAN;.;.	V	41	.	ENSP00000334037:A41V	A	+	2	0	C19orf63	55673005	0.000000	0.05858	0.001000	0.08648	0.124000	0.20399	-0.332000	0.07904	-0.039000	0.13602	-1.717000	0.00709	GCG	.		0.612	EMC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464760.2	NM_175063	
EPHA10	284656	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	38185617	38185617	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:38185617A>G	ENST00000373048.4	-	14	2525	c.2526T>C	c.(2524-2526)ttT>ttC	p.F842F	EPHA10_ENST00000540011.1_3'UTR|EPHA10_ENST00000330210.7_Silent_p.F337F|EPHA10_ENST00000427468.2_Silent_p.F842F|EPHA10_ENST00000446149.2_5'UTR	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCCGCTCCCCAAAGGCCATCA	0.607																																					p.F842F		.											.	EPHA10	1246	0			c.T2526C						.						62.0	66.0	65.0					1																	38185617		2203	4300	6503	SO:0001819	synonymous_variant	284656	exon14			CTCCCCAAAGGCC	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.2526T>C	1.37:g.38185617A>G		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	28.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	37	CCDS41305.1																																																																																			.		0.607	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
ERAP1	51752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	96116195	96116195	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:96116195A>G	ENST00000443439.2	-	18	2668	c.2602T>C	c.(2602-2604)Tca>Cca	p.S868P	ERAP1_ENST00000514604.1_5'Flank|ERAP1_ENST00000296754.3_Missense_Mutation_p.S868P	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	868					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		ATGGAAGATGAGCCAAGTTCA	0.318																																					p.S868P		.											.	ERAP1	70	0			c.T2602C						.						74.0	76.0	75.0					5																	96116195		2203	4300	6503	SO:0001583	missense	51752	exon18			AAGATGAGCCAAG	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.2602T>C	5.37:g.96116195A>G	ENSP00000406304:p.Ser868Pro	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	9.0	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	37	CCDS47250.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789163	0.49997	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.07114	3.22;3.22	6.09	6.09	0.99107	.	0.063289	0.64402	D	0.000003	T	0.34454	0.0898	M	0.85197	2.74	0.54753	D	0.999983	B;D;D	0.89917	0.018;0.999;1.0	B;D;D	0.81914	0.315;0.995;0.995	T	0.14392	-1.0474	10	0.87932	D	0	.	16.331	0.83014	1.0:0.0:0.0:0.0	.	868;868;868	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	P	868	ENSP00000296754:S868P;ENSP00000406304:S868P	ENSP00000296754:S868P	S	-	1	0	ERAP1	96141951	1.000000	0.71417	0.996000	0.52242	0.462000	0.32619	6.407000	0.73280	2.338000	0.79540	0.533000	0.62120	TCA	.		0.318	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
EXOC3L1	283849	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	67221359	67221359	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:67221359C>T	ENST00000314586.6	-	5	1049	c.809G>A	c.(808-810)gGg>gAg	p.G270E	EXOC3L1_ENST00000562887.1_Intron	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	270	Mediates interaction with EXOC2, EXOC4 and EXOC5. {ECO:0000250}.				exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						TGGTAGGGCCCCTGGTGCAGG	0.677																																					p.G270E		.											.	EXOC3L1	110	0			c.G809A						.						18.0	21.0	20.0					16																	67221359		2193	4291	6484	SO:0001583	missense	283849	exon5			AGGGCCCCTGGTG	AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.809G>A	16.37:g.67221359C>T	ENSP00000325674:p.Gly270Glu	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	4.0	NM_178516	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	ENST00000314586.6	37	CCDS10832.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726238	0.48833	.	.	ENSG00000179044	ENST00000314586;ENST00000545725;ENST00000314553	T;T	0.17854	3.39;2.25	5.7	3.67	0.42095	.	0.103766	0.64402	D	0.000003	T	0.31295	0.0792	M	0.63428	1.95	0.09310	N	0.999998	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.79108	0.986;0.992;0.981	T	0.10222	-1.0639	10	0.11794	T	0.64	-36.3307	10.3742	0.44073	0.1237:0.6523:0.2239:0.0	.	209;209;270	F5H4W1;B7Z6U0;Q86VI1	.;.;EX3L1_HUMAN	E	270;209;214	ENSP00000325674:G270E;ENSP00000439910:G209E	ENSP00000325008:G214E	G	-	2	0	EXOC3L1	65778860	0.010000	0.17322	0.989000	0.46669	0.837000	0.47467	1.504000	0.35726	2.694000	0.91930	0.555000	0.69702	GGG	.		0.677	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268827.2	NM_178516	
FAM185A	222234	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102412867	102412867	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:102412867T>G	ENST00000413034.2	+	5	805	c.805T>G	c.(805-807)Tta>Gta	p.L269V	FAM185A_ENST00000409231.3_Missense_Mutation_p.L152V|FAM185A_ENST00000481697.1_3'UTR	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	269										kidney(1)	1						TAATATAACATTACAAAGCAA	0.318																																					p.L269V		.											.	.	.	0			c.T805G						.						243.0	219.0	226.0					7																	102412867		692	1591	2283	SO:0001583	missense	222234	exon5			ATAACATTACAAA	BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.805T>G	7.37:g.102412867T>G	ENSP00000395340:p.Leu269Val	Somatic	361.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	43.0	NM_001145268	A8MUR7|B4DQD3|C9IZ91	Missense_Mutation	SNP	ENST00000413034.2	37	CCDS47676.1	.	.	.	.	.	.	.	.	.	.	T	0.221	-1.028411	0.02045	.	.	ENSG00000222011	ENST00000432852;ENST00000409231;ENST00000413034	T;T	0.37058	1.22;1.28	3.97	-0.438	0.12268	.	.	.	.	.	T	0.17323	0.0416	L	0.27944	0.81	0.29862	N	0.827606	B;B	0.27625	0.183;0.057	B;B	0.24974	0.057;0.045	T	0.34004	-0.9846	9	0.06099	T	0.92	-4.5472	4.7384	0.13001	0.1879:0.0:0.387:0.4251	.	152;269	Q8N0U4-3;Q8N0U4	.;F185A_HUMAN	V	169;152;269	ENSP00000387066:L152V;ENSP00000395340:L269V	ENSP00000387066:L152V	L	+	1	2	FAM185A	102200103	0.037000	0.19845	0.516000	0.27786	0.943000	0.58893	-0.058000	0.11750	0.157000	0.19338	0.338000	0.21704	TTA	.		0.318	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349482.1	NM_001145268	
FBN1	2200	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48808530	48808530	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr15:48808530T>C	ENST00000316623.5	-	11	1632	c.1177A>G	c.(1177-1179)Atg>Gtg	p.M393V		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	393					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GGAATTACCATAGGAACAGAG	0.483																																					p.M393V		.											.	FBN1	92	0			c.A1177G						.						66.0	69.0	68.0					15																	48808530		2197	4296	6493	SO:0001583	missense	2200	exon11			TTACCATAGGAAC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1177A>G	15.37:g.48808530T>C	ENSP00000325527:p.Met393Val	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	4.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	6.334	0.429725	0.11987	.	.	ENSG00000166147	ENST00000316623	T	0.80566	-1.39	5.54	-3.06	0.05379	Matrix fibril-associated (1);	0.827694	0.11605	N	0.547342	T	0.51635	0.1686	N	0.08118	0	0.21020	N	0.999809	B	0.02656	0.0	B	0.01281	0.0	T	0.38394	-0.9663	10	0.14656	T	0.56	.	2.0393	0.03546	0.1465:0.1959:0.4312:0.2265	.	393	P35555	FBN1_HUMAN	V	393	ENSP00000325527:M393V	ENSP00000325527:M393V	M	-	1	0	FBN1	46595822	0.789000	0.28775	0.957000	0.39632	0.797000	0.45037	0.226000	0.17776	-0.387000	0.07809	-0.316000	0.08728	ATG	.		0.483	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FHOD1	29109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67267989	67267989	+	Silent	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:67267989G>T	ENST00000258201.4	-	13	1864	c.1617C>A	c.(1615-1617)ctC>ctA	p.L539L		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	539	FH1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CCCCAATAGAGAGCCTGGGTG	0.592																																					p.L539L		.											.	FHOD1	221	0			c.C1617A						.						86.0	92.0	90.0					16																	67267989		2198	4300	6498	SO:0001819	synonymous_variant	29109	exon13			AATAGAGAGCCTG	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.1617C>A	16.37:g.67267989G>T		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	10.0	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	37	CCDS10834.1																																																																																			.		0.592	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
PLEKHA3	65977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179343059	179343059	+	5'Flank	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:179343059T>C	ENST00000234453.5	+	0	0				FKBP7_ENST00000424785.2_Silent_p.L56L|FKBP7_ENST00000464248.1_5'UTR|FKBP7_ENST00000434643.2_Silent_p.L56L	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			AATGGGCATTTAGTAGGTCTC	0.468																																					p.L56L		.											.	FKBP7	90	0			c.A168G						.						120.0	114.0	116.0					2																	179343059		2203	4300	6503	SO:0001631	upstream_gene_variant	51661	exon1			GGCATTTAGTAGG	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446		2.37:g.179343059T>C	Exception_encountered	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	9.0	NM_181342	Q4ZG69|Q86TQ1|Q9NXT3	Silent	SNP	ENST00000234453.5	37	CCDS33336.1																																																																																			.		0.468	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335241.2	NM_019091	
FLT4	2324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	180048202	180048202	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:180048202C>T	ENST00000261937.6	-	14	2149	c.2071G>A	c.(2071-2073)Gtg>Atg	p.V691M	FLT4_ENST00000502649.1_Missense_Mutation_p.V691M|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000393347.3_Missense_Mutation_p.V691M	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	691	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAGTCGCTCACGTTCACCAGG	0.627																																					p.V691M	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4	1490	0			c.G2071A						.						32.0	34.0	33.0					5																	180048202		2203	4298	6501	SO:0001583	missense	2324	exon14			CGCTCACGTTCAC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2071G>A	5.37:g.180048202C>T	ENSP00000261937:p.Val691Met	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	25.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397803	0.83120	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	D;D;D	0.82803	-1.65;-1.65;-1.65	4.53	3.64	0.41730	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89856	0.6836	M	0.79926	2.475	0.58432	D	0.999991	D;D;D;P	0.89917	1.0;0.984;0.972;0.946	D;P;P;P	0.75020	0.985;0.908;0.764;0.703	D	0.90474	0.4455	9	0.72032	D	0.01	.	11.2555	0.49052	0.0:0.8499:0.0:0.1501	.	691;501;691;691	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	M	691;691;691;501	ENSP00000261937:V691M;ENSP00000377016:V691M;ENSP00000426057:V691M	ENSP00000261937:V691M	V	-	1	0	FLT4	179980808	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.941000	0.49011	2.249000	0.74217	0.561000	0.74099	GTG	.		0.627	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
GDF15	9518	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	18499150	18499150	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:18499150C>G	ENST00000252809.3	+	2	364	c.332C>G	c.(331-333)cCc>cGc	p.P111R	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	111					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						GCCGCCCTTCCCGAGGGGCTC	0.697											OREG0025363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P111R		.											.	GDF15	650	0			c.C332G						.						17.0	21.0	20.0					19																	18499150		2173	4281	6454	SO:0001583	missense	9518	exon2			CCCTTCCCGAGGG	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.332C>G	19.37:g.18499150C>G	ENSP00000252809:p.Pro111Arg	Somatic	118.0	0.0	726	WXS	Illumina HiSeq	Phase_I	57.0	11.0	NM_004864	O14629|P78360|Q9BWA0|Q9NRT0	Missense_Mutation	SNP	ENST00000252809.3	37	CCDS12376.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269549	0.40095	.	.	ENSG00000130513	ENST00000252809	T	0.81415	-1.49	4.31	-1.01	0.10169	.	1.302550	0.05372	N	0.535644	T	0.65386	0.2686	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.46911	-0.9157	10	0.21014	T	0.42	-1.9864	7.2446	0.26115	0.0:0.3754:0.5197:0.1049	.	111	Q99988	GDF15_HUMAN	R	111	ENSP00000252809:P111R	ENSP00000252809:P111R	P	+	2	0	GDF15	18360150	0.000000	0.05858	0.001000	0.08648	0.111000	0.19643	0.641000	0.24720	-0.005000	0.14395	0.305000	0.20034	CCC	.		0.697	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
GMEB1	10691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	29040743	29040743	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:29040743T>C	ENST00000294409.2	+	10	1270	c.1180T>C	c.(1180-1182)Tct>Cct	p.S394P	GMEB1_ENST00000361872.4_Missense_Mutation_p.S384P|GMEB1_ENST00000373816.1_Missense_Mutation_p.S384P|GMEB1_ENST00000480454.1_3'UTR	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	394					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CTTGAGCCCTTCTCCTCCTGT	0.557																																					p.S394P		.											.	GMEB1	90	0			c.T1180C						.						104.0	99.0	101.0					1																	29040743		2203	4300	6503	SO:0001583	missense	10691	exon10			AGCCCTTCTCCTC	AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.1180T>C	1.37:g.29040743T>C	ENSP00000294409:p.Ser394Pro	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	19.0	NM_006582	B1AT48|Q9NWH1|Q9UKD0	Missense_Mutation	SNP	ENST00000294409.2	37	CCDS327.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.264587	0.59431	.	.	ENSG00000162419	ENST00000373816;ENST00000456852;ENST00000361872;ENST00000294409	T;T;T	0.61980	0.06;0.06;0.06	5.47	5.47	0.80525	.	0.131431	0.52532	D	0.000066	T	0.54498	0.1862	L	0.52573	1.65	0.26378	N	0.976773	B;B	0.12630	0.006;0.006	B;B	0.09377	0.004;0.004	T	0.53599	-0.8416	10	0.72032	D	0.01	-15.6911	9.1279	0.36828	0.0:0.0828:0.0:0.9172	.	394;384	Q9Y692;B1AT47	GMEB1_HUMAN;.	P	384;360;384;394	ENSP00000362922:S384P;ENSP00000355186:S384P;ENSP00000294409:S394P	ENSP00000294409:S394P	S	+	1	0	GMEB1	28913330	0.973000	0.33851	1.000000	0.80357	0.998000	0.95712	1.856000	0.39389	2.076000	0.62316	0.533000	0.62120	TCT	.		0.557	GMEB1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000010333.1	NM_006582	
GPATCH8	23131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42476641	42476641	+	Missense_Mutation	SNP	T	T	C	rs542607889		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:42476641T>C	ENST00000591680.1	-	8	2834	c.2804A>G	c.(2803-2805)tAt>tGt	p.Y935C	GPATCH8_ENST00000434000.1_Missense_Mutation_p.Y857C	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	935	Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		ACTGAGGCTATAGTCATCATC	0.542													T|||	1	0.000199681	0.0008	0.0	5008	,	,		17745	0.0		0.0	False		,,,				2504	0.0				p.Y935C		.											.	GPATCH8	94	0			c.A2804G						.						95.0	94.0	94.0					17																	42476641		2203	4300	6503	SO:0001583	missense	23131	exon8			AGGCTATAGTCAT	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.2804A>G	17.37:g.42476641T>C	ENSP00000467556:p.Tyr935Cys	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	17.0	NM_001002909	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.559071	0.27827	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.12465	2.68	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000003	T	0.21962	0.0529	N	0.19112	0.55	0.41506	D	0.988317	D	0.76494	0.999	D	0.80764	0.994	T	0.03887	-1.0995	10	0.39692	T	0.17	-14.2362	13.4516	0.61174	0.0:0.0:0.0:1.0	.	935	Q9UKJ3	GPTC8_HUMAN	C	935;857	ENSP00000395016:Y857C	ENSP00000335486:Y935C	Y	-	2	0	GPATCH8	39832167	1.000000	0.71417	0.998000	0.56505	0.747000	0.42532	3.731000	0.55013	2.190000	0.69967	0.454000	0.30748	TAT	.		0.542	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
GPR98	84059	broad.mit.edu;bcgsc.ca	37	5	89990498	89990498	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:89990498A>G	ENST00000405460.2	+	33	8021	c.7925A>G	c.(7924-7926)gAg>gGg	p.E2642G		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2642	Calx-beta 18. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.E2642V(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGTGCTGGAGAGATTCTGACC	0.413																																					p.E2642G		.											GPR98,NS,carcinoma,0	GPR98	103	1	Substitution - Missense(1)	ovary(1)	c.A7925G						.						78.0	82.0	81.0					5																	89990498		1942	4130	6072	SO:0001583	missense	84059	exon33			CTGGAGAGATTCT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7925A>G	5.37:g.89990498A>G	ENSP00000384582:p.Glu2642Gly	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	5.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.351|9.351	1.065630|1.065630	0.20067|0.20067	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.16743|.	2.32|.	5.51|5.51	4.34|4.34	0.51931|0.51931	Na-Ca exchanger/integrin-beta4 (2);|.	0.378209|.	0.35407|.	N|.	0.003223|.	T|T	0.16938|0.16938	0.0407|0.0407	N|N	0.00652|0.00652	-1.29|-1.29	0.80722|0.80722	D|D	1|1	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.11329|.	0.004;0.006|.	T|T	0.09640|0.09640	-1.0665|-1.0665	10|5	0.13108|.	T|.	0.6|.	.|.	11.7439|11.7439	0.51809|0.51809	0.9301:0.0:0.0699:0.0|0.9301:0.0:0.0699:0.0	.|.	2642;2642|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	G|G	2642|208	ENSP00000384582:E2642G|.	ENSP00000296619:E2642G|.	E|R	+|+	2|1	0|2	GPR98|GPR98	90026254|90026254	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.944000|0.944000	0.59088|0.59088	5.069000|5.069000	0.64370|0.64370	1.006000|1.006000	0.39211|0.39211	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.		0.413	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GRIA4	2893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	105804564	105804564	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:105804564A>T	ENST00000530497.1	+	13	2163	c.2163A>T	c.(2161-2163)aaA>aaT	p.K721N	GRIA4_ENST00000525187.1_Missense_Mutation_p.K721N|GRIA4_ENST00000393127.2_Missense_Mutation_p.K721N|AP000673.1_ENST00000583628.1_RNA|GRIA4_ENST00000282499.5_Missense_Mutation_p.K721N			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	721					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		CCAAGGGCAAATTTGCCTTTC	0.468																																					p.K721N		.											.	GRIA4	230	0			c.A2163T						.						90.0	79.0	83.0					11																	105804564		2202	4299	6501	SO:0001583	missense	2893	exon14			GGGCAAATTTGCC	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2163A>T	11.37:g.105804564A>T	ENSP00000435775:p.Lys721Asn	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	12.0	NM_001077243	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.388945	0.61956	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187;ENST00000539249	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	5.51	3.19	0.36642	Ionotropic glutamate receptor (2);	0.000000	0.64402	D	0.000001	T	0.46737	0.1408	L	0.43554	1.36	0.58432	D	0.999995	D;D	0.89917	0.972;1.0	P;D	0.91635	0.896;0.999	T	0.20009	-1.0288	10	0.33940	T	0.23	.	8.8697	0.35309	0.6549:0.0:0.3451:0.0	.	721;721	P48058;G3V164	GRIA4_HUMAN;.	N	721;721;721;721;26	ENSP00000282499:K721N;ENSP00000376835:K721N;ENSP00000435775:K721N;ENSP00000432180:K721N	ENSP00000282499:K721N	K	+	3	2	GRIA4	105309774	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.552000	0.45828	0.390000	0.25115	0.482000	0.46254	AAA	.		0.468	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
GRM3	2913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	86493597	86493597	+	Splice_Site	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:86493597G>T	ENST00000361669.2	+	6	3665		c.e6-1		GRM3_ENST00000439827.1_Splice_Site|GRM3_ENST00000394720.2_Splice_Site|GRM3_ENST00000536043.1_Splice_Site|GRM3_ENST00000546348.1_Splice_Site	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TTGTTTTCCAGCCTCTGCAAG	0.498																																					.	GBM(52;969 1098 3139 52280)	.											.	GRM3	528	0			c.2567-1G>T						.						219.0	185.0	197.0					7																	86493597		2203	4300	6503	SO:0001630	splice_region_variant	2913	exon6			TTTCCAGCCTCTG		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2567-1G>T	7.37:g.86493597G>T		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	15.0	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Splice_Site	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.472337	0.84533	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043;ENST00000439827;ENST00000394720	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4659	0.94939	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRM3	86331533	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.502000	0.90505	2.840000	0.97914	0.655000	0.94253	.	.		0.498	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		Intron
HEATR1	55127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236751283	236751283	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:236751283T>C	ENST00000366582.3	-	13	1705	c.1591A>G	c.(1591-1593)Ata>Gta	p.I531V	HEATR1_ENST00000366581.2_Missense_Mutation_p.I531V	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	531					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACAACATCTATATTATCATCA	0.343																																					p.I531V		.											.	HEATR1	93	0			c.A1591G						.						123.0	116.0	119.0					1																	236751283		2203	4299	6502	SO:0001583	missense	55127	exon13			CATCTATATTATC	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1591A>G	1.37:g.236751283T>C	ENSP00000355541:p.Ile531Val	Somatic	239.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	20.0	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	T	0.046	-1.265675	0.01433	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66460	-0.11;-0.21	5.84	-7.28	0.01456	Armadillo-like helical (1);Armadillo-type fold (1);	0.475201	0.23973	N	0.042742	T	0.21267	0.0512	N	0.02011	-0.69	0.30579	N	0.762751	B	0.02656	0.0	B	0.04013	0.001	T	0.45687	-0.9244	10	0.02654	T	1	.	2.2291	0.03992	0.489:0.189:0.0855:0.2364	.	531	Q9H583	HEAT1_HUMAN	V	531	ENSP00000355541:I531V;ENSP00000355540:I531V	ENSP00000355540:I531V	I	-	1	0	HEATR1	234817906	0.000000	0.05858	0.032000	0.17829	0.370000	0.29829	-0.847000	0.04331	-0.736000	0.04831	0.533000	0.62120	ATA	.		0.343	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
HECTD4	283450	broad.mit.edu;bcgsc.ca	37	12	112703691	112703696	+	In_Frame_Del	DEL	TCATCC	TCATCC	-			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	TCATCC	TCATCC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:112703691_112703696delTCATCC	ENST00000430131.2	-	14	2333_2338	c.1188_1193delGGATGA	c.(1186-1194)gaggatgat>gat	p.ED396del	RN7SKP71_ENST00000364558.1_RNA|HECTD4_ENST00000550722.1_In_Frame_Del_p.ED684del|HECTD4_ENST00000377560.5_In_Frame_Del_p.ED646del			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	396					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CCTGTAATGATCATCCTCATCACTGC	0.422																																					p.684_686del		.											.	.	.	0			c.2052_2057del						.																																			SO:0001651	inframe_deletion	283450	exon15			TAATGATCATCCT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.1188_1193delGGATGA	12.37:g.112703691_112703696delTCATCC	ENSP00000404379:p.Glu396_Asp397del	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	8.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	In_Frame_Del	DEL	ENST00000430131.2	37																																																																																				.		0.422	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
HEG1	57493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	124732258	124732258	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:124732258G>T	ENST00000311127.4	-	6	2232	c.2165C>A	c.(2164-2166)tCc>tAc	p.S722Y	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	722	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TGTCGTTAAGGATACTGGTAA	0.493																																					p.S722Y		.											.	HEG1	70	0			c.C2165A						.						200.0	201.0	201.0					3																	124732258		2061	4209	6270	SO:0001583	missense	57493	exon6			GTTAAGGATACTG	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2165C>A	3.37:g.124732258G>T	ENSP00000311502:p.Ser722Tyr	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	19.0	NM_020733	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186032	0.38609	.	.	ENSG00000173706	ENST00000311127	D	0.89415	-2.51	5.2	4.29	0.51040	.	0.000000	0.38492	U	0.001667	D	0.92743	0.7693	M	0.66939	2.045	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.96	D	0.85642	0.1277	10	0.66056	D	0.02	.	12.7971	0.57565	0.0:0.0:0.8379:0.1621	.	722;722	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	Y	722	ENSP00000311502:S722Y	ENSP00000311502:S722Y	S	-	2	0	HEG1	126214948	0.303000	0.24463	0.154000	0.22540	0.016000	0.09150	3.333000	0.52090	2.706000	0.92434	0.561000	0.74099	TCC	.		0.493	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
HGS	9146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	17	79663472	79663473	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:79663472_79663473GA>TT	ENST00000329138.4	+	16	1614_1615	c.1479_1480GA>TT	c.(1477-1482)gaGAag>gaTTag	p.493_494EK>D*		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	493	Interaction with NF2.|Interaction with SNAP25 and TRAK2. {ECO:0000250}.|Interaction with SNX1. {ECO:0000250}.|Interaction with STAM1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			AGCACCGGGAGAAGCTTCGCCG	0.658																																					p.E493D|p.K494X		.											.	HGS	91	0			c.G1479T|c.A1480T						.																																			SO:0001587	stop_gained	9146	exon16			CCGGGAGAAGCTT|CGGGAGAAGCTTC	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		Exception_encountered	17.37:g.79663472_79663473delinsTT	ENSP00000331201:p.E493_K494delinsD*	Somatic	34.0|33.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	11.0|10.0	NM_004712	Q9NR36	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000329138.4	37	CCDS11784.1																																																																																			.		0.658	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	
HIAT1	64645	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	100542807	100542807	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:100542807A>G	ENST00000370152.3	+	9	1114	c.978A>G	c.(976-978)gcA>gcG	p.A326A	RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	326					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TACAGTTGGCATGGTATGGCT	0.303																																					p.A326A		.											.	HIAT1	90	0			c.A978G						.						104.0	106.0	105.0					1																	100542807		2203	4299	6502	SO:0001819	synonymous_variant	64645	exon9			GTTGGCATGGTAT	AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.978A>G	1.37:g.100542807A>G		Somatic	320.0	1.0		WXS	Illumina HiSeq	Phase_I	138.0	37.0	NM_033055	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Silent	SNP	ENST00000370152.3	37	CCDS763.1																																																																																			.		0.303	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029657.1	NM_033055	
HOXD1	3231	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	177054752	177054752	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:177054752A>G	ENST00000331462.4	+	2	1092	c.869A>G	c.(868-870)gAa>gGa	p.E290G	HOXD-AS1_ENST00000425005.1_RNA|HOXD-AS1_ENST00000417086.1_RNA|HOXD-AS1_ENST00000452365.1_RNA|HOXD-AS1_ENST00000413969.1_RNA|HOXD-AS1_ENST00000436126.1_RNA	NM_024501.2	NP_078777.1	Q9GZZ0	HXD1_HUMAN	homeobox D1	290					embryonic skeletal system development (GO:0048706)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		AGGGAACGAGAAGGGCTTCTG	0.552																																					p.E290G		.											.	HOXD1	90	0			c.A869G						.						117.0	126.0	123.0					2																	177054752		2203	4300	6503	SO:0001583	missense	3231	exon2			AACGAGAAGGGCT		CCDS2271.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128645	ENSG00000128645		"""Homeoboxes / ANTP class : HOXL subclass"""	5132	protein-coding gene	gene with protein product		142987	"""homeo box D1"""	HOX4, HOX4G		1973146, 1358459	Standard	NM_024501		Approved		uc002ukv.5	Q9GZZ0	OTTHUMG00000132512	ENST00000331462.4:c.869A>G	2.37:g.177054752A>G	ENSP00000328598:p.Glu290Gly	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	8.0	NM_024501	B2RAB4	Missense_Mutation	SNP	ENST00000331462.4	37	CCDS2271.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593027	0.86953	.	.	ENSG00000128645	ENST00000331462	D	0.91843	-2.92	5.66	5.66	0.87406	Homeobox (1);Homeodomain-like (1);	0.000000	0.48767	D	0.000163	D	0.93533	0.7936	L	0.34521	1.04	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.978	D	0.94038	0.7307	10	0.54805	T	0.06	.	15.5503	0.76145	1.0:0.0:0.0:0.0	.	290;290	Q96CA4;Q9GZZ0	.;HXD1_HUMAN	G	290	ENSP00000328598:E290G	ENSP00000328598:E290G	E	+	2	0	HOXD1	176762998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.344000	0.79328	2.143000	0.66587	0.533000	0.62120	GAA	.		0.552	HOXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255693.2		
HSPA6	3310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161494890	161494890	+	Missense_Mutation	SNP	G	G	C	rs373442940		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:161494890G>C	ENST00000309758.4	+	1	855	c.442G>C	c.(442-444)Gtg>Ctg	p.V148L	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	148					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AGTGATCACCGTGCCCGCCTA	0.637																																					p.V148L		.											.	HSPA6	226	0			c.G442C						.						27.0	30.0	29.0					1																	161494890		2202	4300	6502	SO:0001583	missense	3310	exon1			ATCACCGTGCCCG		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.442G>C	1.37:g.161494890G>C	ENSP00000310219:p.Val148Leu	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	13.0	NM_002155	Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	ENST00000309758.4	37	CCDS1231.1	.	.	.	.	.	.	.	.	.	.	.	17.50	3.405612	0.62288	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.01745	4.66	3.43	3.43	0.39272	.	0.000000	0.38897	U	0.001534	T	0.17365	0.0417	H	0.99962	5.075	0.51482	D	0.999924	D	0.89917	1.0	D	0.91635	0.999	T	0.48019	-0.9071	10	0.87932	D	0	-27.8476	12.3829	0.55317	0.0:0.0:1.0:0.0	.	148	P17066	HSP76_HUMAN	L	148;124	ENSP00000310219:V148L	ENSP00000310219:V148L	V	+	1	0	HSPA6	159761514	1.000000	0.71417	0.318000	0.25279	0.472000	0.32918	8.329000	0.90017	1.725000	0.51514	0.586000	0.80456	GTG	.		0.637	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	NM_002155	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	26647155	26647155	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:26647155A>G	ENST00000381340.3	-	39	5717	c.5301T>C	c.(5299-5301)aaT>aaC	p.N1767N		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1767					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AAATTCTGTCATTTTTGGTGT	0.388																																					p.N1767N		.											.	ITPR2	542	0			c.T5301C						.						109.0	96.0	100.0					12																	26647155		1866	4105	5971	SO:0001819	synonymous_variant	3709	exon39			TCTGTCATTTTTG	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5301T>C	12.37:g.26647155A>G		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	10.0	NM_002223	O94773	Silent	SNP	ENST00000381340.3	37	CCDS41764.1																																																																																			.		0.388	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
ITSN1	6453	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	35134244	35134244	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr21:35134244A>G	ENST00000381318.3	+	9	1030	c.742A>G	c.(742-744)Att>Gtt	p.I248V	AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Missense_Mutation_p.I248V|ITSN1_ENST00000399355.2_Missense_Mutation_p.I248V|ITSN1_ENST00000381285.4_Missense_Mutation_p.I248V|ITSN1_ENST00000399326.3_Missense_Mutation_p.I248V|ITSN1_ENST00000381291.4_Missense_Mutation_p.I248V|ITSN1_ENST00000399349.1_Missense_Mutation_p.I248V|ITSN1_ENST00000399352.1_Missense_Mutation_p.I248V|ITSN1_ENST00000399353.1_Missense_Mutation_p.I211V|ITSN1_ENST00000399338.4_Missense_Mutation_p.I248V|ITSN1_ENST00000488166.1_3'UTR|ITSN1_ENST00000399367.3_Missense_Mutation_p.I248V|ITSN1_ENST00000379960.5_Missense_Mutation_p.I248V	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	248	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						AGCAAGAACTATTCTTATGCA	0.433																																					p.I248V		.											.	ITSN1	94	0			c.A742G						.						220.0	192.0	201.0					21																	35134244		2203	4300	6503	SO:0001583	missense	6453	exon9			AGAACTATTCTTA	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.742A>G	21.37:g.35134244A>G	ENSP00000370719:p.Ile248Val	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	6.0	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.453537	0.43531	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000381283;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82	6.03	6.03	0.97812	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.28014	0.82	0.58432	D	0.999998	B;B;B;B;B;P;B;B;B;B	0.40000	0.418;0.418;0.418;0.127;0.365;0.698;0.127;0.127;0.365;0.418	B;B;B;B;B;D;B;B;B;B	0.67231	0.353;0.353;0.353;0.159;0.24;0.95;0.118;0.118;0.24;0.353	T	0.05068	-1.0908	10	0.02654	T	1	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	211;211;211;248;248;248;248;248;248;211	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	V	211;248;248;248;248;248;248;248;248;248;188;248;248;248;248	ENSP00000382290:I211V;ENSP00000370719:I248V;ENSP00000370691:I248V;ENSP00000370685:I248V;ENSP00000382301:I248V;ENSP00000382289:I248V;ENSP00000382292:I248V;ENSP00000382286:I248V;ENSP00000370683:I188V;ENSP00000382275:I248V;ENSP00000387377:I248V;ENSP00000382265:I248V;ENSP00000369294:I248V	ENSP00000369294:I248V	I	+	1	0	ITSN1	34056114	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.031000	0.76491	2.302000	0.77476	0.533000	0.62120	ATT	.		0.433	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
JAGN1	84522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9934999	9934999	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:9934999T>C	ENST00000307768.4	+	2	659	c.490T>C	c.(490-492)Tac>Cac	p.Y164H		NM_032492.3	NP_115881.3			jagunal homolog 1 (Drosophila)											breast(1)|central_nervous_system(1)|endometrium(4)|lung(3)|ovary(1)	10	Medulloblastoma(99;0.227)					CTGGCAGTTGTACTACAGCAA	0.512																																					p.Y164H		.											.	JAGN1	91	0			c.T490C						.						179.0	112.0	135.0					3																	9934999		2203	4300	6503	SO:0001583	missense	84522	exon2			CAGTTGTACTACA	AK074760	CCDS2588.1	3p25.2	2010-03-23			ENSG00000171135	ENSG00000171135			26926	protein-coding gene	gene with protein product						12477932	Standard	NM_032492		Approved	GL009, FLJ14602	uc003btt.4	Q8N5M9	OTTHUMG00000128523	ENST00000307768.4:c.490T>C	3.37:g.9934999T>C	ENSP00000306106:p.Tyr164His	Somatic	241.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	54.0	NM_032492		Missense_Mutation	SNP	ENST00000307768.4	37	CCDS2588.1	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508007	0.64410	.	.	ENSG00000171135	ENST00000307768;ENST00000543379	.	.	.	5.56	3.19	0.36642	.	0.059088	0.64402	N	0.000001	T	0.75443	0.3850	M	0.75264	2.295	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.74942	-0.3492	9	0.87932	D	0	-22.2684	9.5034	0.39031	0.0:0.145:0.0:0.855	.	164	Q8N5M9	JAGN1_HUMAN	H	164;162	.	ENSP00000306106:Y164H	Y	+	1	0	JAGN1	9909999	1.000000	0.71417	0.519000	0.27824	0.817000	0.46193	6.213000	0.72194	0.414000	0.25790	0.260000	0.18958	TAC	.		0.512	JAGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250335.1	NM_032492	
KBTBD12	166348	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	127702969	127702969	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:127702969T>C	ENST00000405109.1	+	6	2187	c.1720T>C	c.(1720-1722)Ttg>Ctg	p.L574L	KBTBD12_ENST00000343941.4_Silent_p.L149L|KBTBD12_ENST00000492025.1_3'UTR|KBTBD12_ENST00000407609.3_Silent_p.L181L|KBTBD12_ENST00000405256.1_Silent_p.L574L			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	574										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CAAAGAAATATTGGAACTGGA	0.453																																					p.L574L		.											.	KBTBD12	23	0			c.T1720C						.						156.0	147.0	150.0					3																	127702969		2203	4300	6503	SO:0001819	synonymous_variant	166348	exon5			GAAATATTGGAAC		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1720T>C	3.37:g.127702969T>C		Somatic	177.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	18.0	NM_207335	B5MCC6|Q6ZRK1	Silent	SNP	ENST00000405109.1	37	CCDS33848.2																																																																																			.		0.453	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
KIAA0232	9778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6862633	6862633	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:6862633A>G	ENST00000307659.5	+	7	979	c.524A>G	c.(523-525)tAt>tGt	p.Y175C	KIAA0232_ENST00000425103.1_Missense_Mutation_p.Y175C	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	175							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TTCAGGTACTATGAAGCATTT	0.358																																					p.Y175C		.											.	KIAA0232	92	0			c.A524G						.						129.0	124.0	125.0					4																	6862633		1902	4126	6028	SO:0001583	missense	9778	exon7			GGTACTATGAAGC	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.524A>G	4.37:g.6862633A>G	ENSP00000303928:p.Tyr175Cys	Somatic	176.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	11.0	NM_014743	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	37	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.222657	0.79464	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.75657	0.3879	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78221	-0.2288	9	0.87932	D	0	-11.9197	15.6476	0.77068	1.0:0.0:0.0:0.0	.	175	Q92628	K0232_HUMAN	C	175	.	ENSP00000303928:Y175C	Y	+	2	0	KIAA0232	6913534	1.000000	0.71417	0.952000	0.39060	0.857000	0.48899	8.881000	0.92415	2.103000	0.63969	0.533000	0.62120	TAT	.		0.358	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
ICE1	23379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	5462475	5462475	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:5462475G>T	ENST00000296564.7	+	13	3250	c.3028G>T	c.(3028-3030)Gtg>Ttg	p.V1010L		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1010					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGAAGTGACTGTGTCAGGAGG	0.547																																					p.V1010L		.											.	KIAA0947	48	0			c.G3028T						.						70.0	73.0	72.0					5																	5462475		2012	4195	6207	SO:0001583	missense	23379	exon13			GTGACTGTGTCAG																												ENST00000296564.7:c.3028G>T	5.37:g.5462475G>T	ENSP00000296564:p.Val1010Leu	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	13.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	a	1.978	-0.434756	0.04669	.	.	ENSG00000164151	ENST00000296564	T	0.08984	3.03	3.9	-5.33	0.02713	.	2.536700	0.01415	N	0.014178	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32929	-0.9888	10	0.02654	T	1	-0.0224	1.6646	0.02799	0.3694:0.2282:0.2877:0.1147	.	1010	Q9Y2F5	K0947_HUMAN	L	1010	ENSP00000296564:V1010L	ENSP00000296564:V1010L	V	+	1	0	KIAA0947	5515475	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.373000	0.07494	-1.178000	0.02741	-0.871000	0.02989	GTG	.		0.547	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
KIF25	3834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168445527	168445527	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:168445527G>T	ENST00000443060.2	+	10	1397	c.1006G>T	c.(1006-1008)Gtg>Ttg	p.V336L	KIF25_ENST00000351261.3_Missense_Mutation_p.V284L|KIF25_ENST00000354419.2_Missense_Mutation_p.V336L			Q9UIL4	KIF25_HUMAN	kinesin family member 25	336	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GAAGTTACTGGTGATTCTCTG	0.562																																					p.V336L		.											.	KIF25	92	0			c.G1006T						.						124.0	134.0	131.0					6																	168445527		2203	4300	6503	SO:0001583	missense	3834	exon9			TTACTGGTGATTC	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.1006G>T	6.37:g.168445527G>T	ENSP00000388878:p.Val336Leu	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	13.0	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	G	7.299	0.612739	0.14066	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.69175	-0.38;-0.38;1.14	4.12	3.24	0.37175	Kinesin, motor domain (3);	0.221217	0.31495	N	0.007550	T	0.25195	0.0612	N	0.12920	0.275	0.27757	N	0.943963	P;B	0.40638	0.725;0.043	B;B	0.36666	0.23;0.105	T	0.07751	-1.0756	10	0.72032	D	0.01	-18.3591	5.641	0.17565	0.1136:0.202:0.6844:0.0	.	284;336	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	L	336;336;284	ENSP00000388878:V336L;ENSP00000346401:V336L;ENSP00000252688:V284L	ENSP00000252688:V284L	V	+	1	0	KIF25	168188376	1.000000	0.71417	0.128000	0.21923	0.087000	0.18053	2.977000	0.49297	0.692000	0.31613	0.609000	0.83330	GTG	.		0.562	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
KLB	152831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39448206	39448206	+	Silent	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:39448206G>T	ENST00000257408.4	+	4	1957	c.1860G>T	c.(1858-1860)ctG>ctT	p.L620L		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	620	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GACAGGCCCTGAGGTACTACA	0.602																																					p.L620L		.											.	KLB	69	0			c.G1860T						.						91.0	88.0	89.0					4																	39448206		2203	4300	6503	SO:0001819	synonymous_variant	152831	exon4			GGCCCTGAGGTAC	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1860G>T	4.37:g.39448206G>T		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	16.0	NM_175737	Q2M3K8	Silent	SNP	ENST00000257408.4	37	CCDS3451.1																																																																																			.		0.602	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
KLHL8	57563	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88106860	88106860	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:88106860G>C	ENST00000273963.5	-	3	649	c.308C>G	c.(307-309)gCc>gGc	p.A103G	KLHL8_ENST00000512111.1_Missense_Mutation_p.A103G|KLHL8_ENST00000425278.2_Intron|KLHL8_ENST00000498875.2_Intron|KLHL8_ENST00000545252.1_Intron	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	103	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CGTTTGCTTGGCTTCAGCCAT	0.398																																					p.A103G		.											.	KLHL8	90	0			c.C308G						.						46.0	45.0	46.0					4																	88106860		2203	4300	6503	SO:0001583	missense	57563	exon3			TGCTTGGCTTCAG	AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.308C>G	4.37:g.88106860G>C	ENSP00000273963:p.Ala103Gly	Somatic	181.0	2.0		WXS	Illumina HiSeq	Phase_I	59.0	18.0	NM_020803	Q53XA3|Q6N018	Missense_Mutation	SNP	ENST00000273963.5	37	CCDS3617.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814977	0.70912	.	.	ENSG00000145332	ENST00000273963;ENST00000512111	T;T	0.70516	-0.49;-0.49	5.75	5.75	0.90469	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.095133	0.64402	D	0.000001	T	0.66954	0.2842	L	0.37466	1.105	0.80722	D	1	B	0.20164	0.042	B	0.25506	0.061	T	0.62647	-0.6810	10	0.62326	D	0.03	.	19.9444	0.97176	0.0:0.0:1.0:0.0	.	103	Q9P2G9	KLHL8_HUMAN	G	103	ENSP00000273963:A103G;ENSP00000424131:A103G	ENSP00000273963:A103G	A	-	2	0	KLHL8	88325884	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.803000	0.99136	2.706000	0.92434	0.650000	0.86243	GCC	.		0.398	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1		
KLRC2	3822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10584707	10584707	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:10584707A>G	ENST00000381902.2	-	5	588	c.582T>C	c.(580-582)caT>caC	p.H194H	KLRC2_ENST00000381901.1_Silent_p.H194H|KLRC2_ENST00000536833.2_Silent_p.H135H|NKG2-E_ENST00000539033.1_Intron	NM_002260.3	NP_002251.2	P26717	NKG2C_HUMAN	killer cell lectin-like receptor subfamily C, member 2	194	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11						GAACTTACTTATGTTTGAAAG	0.318																																					p.H194H		.											.	KLRC2	514	0			c.T582C						.						56.0	54.0	55.0					12																	10584707		2046	4138	6184	SO:0001819	synonymous_variant	3822	exon5			TTACTTATGTTTG	X54869	CCDS31745.1	12p13	2009-12-03				ENSG00000205809		"""Killer cell lectin-like receptors"", ""CD molecules"""	6375	protein-coding gene	gene with protein product		602891				9598306	Standard	NM_002260		Approved	NKG2-C, CD159c		P26717		ENST00000381902.2:c.582T>C	12.37:g.10584707A>G		Somatic	377.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	24.0	NM_002260	O43802|Q52M74|Q9NR42	Silent	SNP	ENST00000381902.2	37	CCDS31745.1	.	.	.	.	.	.	.	.	.	.	a	0.022	-1.408978	0.01155	.	.	ENSG00000205809	ENST00000537017	.	.	.	1.72	-3.44	0.04796	.	.	.	.	.	T	0.37046	0.0989	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33548	-0.9864	4	.	.	.	.	0.5812	0.00712	0.231:0.1467:0.1671:0.4551	.	.	.	.	T	72	.	.	I	-	2	0	KLRC2	10475974	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.234000	0.02931	-2.238000	0.00712	-1.801000	0.00618	ATA	.		0.318	KLRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400111.1	NM_002260	
KRT12	3859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39017949	39017949	+	Silent	SNP	G	G	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:39017949G>C	ENST00000251643.4	-	8	1472	c.1449C>G	c.(1447-1449)gtC>gtG	p.V483V	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	483	Tail.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	CTTGAGATGAGACCACCTCAC	0.378																																					p.V483V		.											.	KRT12	91	0			c.C1449G						.						137.0	135.0	136.0					17																	39017949		2203	4300	6503	SO:0001819	synonymous_variant	3859	exon8			AGATGAGACCACC		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1449C>G	17.37:g.39017949G>C		Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	21.0	NM_000223	B2R9E0	Silent	SNP	ENST00000251643.4	37	CCDS11378.1																																																																																			.		0.378	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
KRT18	3875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53345925	53345925	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:53345925T>A	ENST00000388835.3	+	6	1181	c.971T>A	c.(970-972)cTg>cAg	p.L324Q	KRT18_ENST00000388837.2_Missense_Mutation_p.L324Q|KRT8_ENST00000552551.1_5'Flank|AC107016.2_ENST00000581256.1_RNA|KRT8_ENST00000549198.1_5'Flank|KRT8_ENST00000546897.1_5'Flank|KRT18_ENST00000550600.1_Missense_Mutation_p.L324Q	NM_000224.2	NP_000215.1	P05783	K1C18_HUMAN	keratin 18	324	Coil 2.|Interaction with DNAJB6.|Necessary for interaction with PNN.|Rod.				anatomical structure morphogenesis (GO:0009653)|cell cycle (GO:0007049)|extrinsic apoptotic signaling pathway (GO:0097191)|Golgi to plasma membrane CFTR protein transport (GO:0043000)|hepatocyte apoptotic process (GO:0097284)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of apoptotic process (GO:0043066)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell periphery (GO:0071944)|centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			central_nervous_system(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	11						GAGAACAGCCTGAGGGAGGTG	0.612																																					p.L324Q		.											.	KRT18	91	0			c.T971A						.						13.0	15.0	14.0					12																	53345925		2193	4282	6475	SO:0001583	missense	3875	exon6			ACAGCCTGAGGGA		CCDS31809.1	12q13	2013-01-16			ENSG00000111057	ENSG00000111057		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6430	protein-coding gene	gene with protein product		148070				1705144, 16831889	Standard	NM_000224		Approved		uc001sbg.3	P05783	OTTHUMG00000169882	ENST00000388835.3:c.971T>A	12.37:g.53345925T>A	ENSP00000373487:p.Leu324Gln	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	6.0	NM_000224	Q53G38|Q5U0N8|Q9BW26	Missense_Mutation	SNP	ENST00000388835.3	37	CCDS31809.1	.	.	.	.	.	.	.	.	.	.	t	21.0	4.084436	0.76642	.	.	ENSG00000111057	ENST00000388837;ENST00000550600;ENST00000388835	D;D;D	0.90788	-2.73;-2.73;-2.73	4.0	4.0	0.46444	Filament (1);	0.142260	0.29980	N	0.010713	D	0.96658	0.8909	H	0.98388	4.22	0.44825	D	0.997838	P;P	0.51057	0.941;0.92	P;P	0.61940	0.751;0.896	D	0.97270	0.9910	10	0.87932	D	0	.	11.5011	0.50437	0.0:0.0:0.0:1.0	.	324;324	F8VZY9;P05783	.;K1C18_HUMAN	Q	324	ENSP00000373489:L324Q;ENSP00000447278:L324Q;ENSP00000373487:L324Q	ENSP00000373487:L324Q	L	+	2	0	KRT18	51632192	0.991000	0.36638	1.000000	0.80357	0.955000	0.61496	7.682000	0.84083	2.049000	0.60858	0.459000	0.35465	CTG	.		0.612	KRT18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406405.1	NM_199187	
KTN1	3895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	56078888	56078888	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:56078888A>G	ENST00000395314.3	+	2	190	c.122A>G	c.(121-123)cAg>cGg	p.Q41R	KTN1_ENST00000395309.3_Missense_Mutation_p.Q41R|KTN1_ENST00000416613.1_Missense_Mutation_p.Q41R|KTN1_ENST00000395308.1_Missense_Mutation_p.Q41R|KTN1_ENST00000413890.2_Missense_Mutation_p.Q41R|KTN1_ENST00000438792.2_Missense_Mutation_p.Q41R|KTN1_ENST00000395311.1_Missense_Mutation_p.Q41R	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	41					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						CTTGCAAAACAGAAAAGAGAA	0.284			T	RET	papillary thryoid																																p.Q41R		.		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1	1147	0			c.A122G						.						35.0	37.0	37.0					14																	56078888		2202	4297	6499	SO:0001583	missense	3895	exon2			CAAAACAGAAAAG		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.122A>G	14.37:g.56078888A>G	ENSP00000378725:p.Gln41Arg	Somatic	212.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	33.0	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.106183	0.77096	.	.	ENSG00000126777	ENST00000557267;ENST00000413890;ENST00000395309;ENST00000555498;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	D;D;D;D;D;D;D;D;D	0.98937	-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25	5.49	5.49	0.81192	.	0.130124	0.34879	N	0.003603	D	0.97660	0.9233	L	0.59436	1.845	0.54753	D	0.999987	P;P;P;P	0.40834	0.64;0.73;0.64;0.561	B;B;B;B	0.42625	0.393;0.22;0.393;0.329	D	0.98010	1.0365	10	0.49607	T	0.09	-2.9399	15.5747	0.76368	1.0:0.0:0.0:0.0	.	41;41;41;41	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	R	41	ENSP00000451641:Q41R;ENSP00000394992:Q41R;ENSP00000378720:Q41R;ENSP00000451878:Q41R;ENSP00000391964:Q41R;ENSP00000378725:Q41R;ENSP00000378719:Q41R;ENSP00000378722:Q41R;ENSP00000388807:Q41R	ENSP00000378719:Q41R	Q	+	2	0	KTN1	55148641	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.596000	0.90844	2.074000	0.62210	0.482000	0.46254	CAG	.		0.284	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
LILRB1	10859	broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	55143684	55143685	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.|Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:55143684_55143685CC>AA	ENST00000396331.1	+	6	1014_1015	c.657_658CC>AA	c.(655-660)gtCCta>gtAAta	p.L220I	LILRB1_ENST00000396317.1_Missense_Mutation_p.L220I|LILRB1_ENST00000396332.4_Missense_Mutation_p.L220I|LILRB1_ENST00000434867.2_Missense_Mutation_p.L220I|LILRB1_ENST00000396315.1_Missense_Mutation_p.L220I|LILRB1_ENST00000396327.3_Missense_Mutation_p.L220I|LILRB1_ENST00000448689.1_Missense_Mutation_p.L220I|AC009892.1_ENST00000578908.1_RNA|LILRB1_ENST00000418536.2_Missense_Mutation_p.L220I|LILRB1_ENST00000396321.2_Missense_Mutation_p.L220I|LILRB1_ENST00000324602.7_Missense_Mutation_p.L220I|LILRB1_ENST00000427581.2_Missense_Mutation_p.L256I	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	220	Ig-like C2-type 2.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		AGCTCCTGGTCCTAGGTGAGAA	0.584										HNSCC(37;0.09)																											p.V219V|p.L220I		.											.	LILRB1	137	0			c.C657A|c.C658A						.																																			SO:0001583	missense	10859	exon5			CCTGGTCCTAGGT|CTGGTCCTAGGTG	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		Exception_encountered	19.37:g.55143684_55143685delinsAA	ENSP00000379622:p.Leu220Ile	Somatic	107.0|105.0	1.0|0.0		WXS	Illumina HiSeq	Phase_I	24.0	8.0|9.0	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent|Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1																																																																																			.		0.584	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
LMBRD1	55788	hgsc.bcm.edu;broad.mit.edu	37	6	70408942	70408944	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:70408942_70408944delAAG	ENST00000370577.3	-	13	1558_1560	c.1329_1331delCTT	c.(1327-1332)tactta>taa	p.443_444YL>*	LMBRD1_ENST00000370570.1_In_Frame_Del_p.370_371YL>*	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	443					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)	p.Y443*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						TACCTCTATTAAGTAATTTTGGC	0.281																																					p.443_444del		.											.	LMBRD1	91	1	Substitution - Nonsense(1)	endometrium(1)	c.1329_1331del						.																																			SO:0001651	inframe_deletion	55788	exon13			TCTATTAAGTAAT	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.1329_1331delCTT	6.37:g.70408942_70408944delAAG	ENSP00000359609:p.Tyr443_Leu444delins*	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	14.0	NM_018368	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	In_Frame_Del	DEL	ENST00000370577.3	37	CCDS4969.1																																																																																			.		0.281	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
LMNA	4000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156100406	156100406	+	Splice_Site	SNP	A	A	G	rs113610699		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:156100406A>G	ENST00000368300.4	+	2	568		c.e2-1		LMNA_ENST00000368297.1_Splice_Site|LMNA_ENST00000368301.2_Splice_Site|LMNA_ENST00000392353.3_Splice_Site|LMNA_ENST00000347559.2_Splice_Site|LMNA_ENST00000361308.4_Splice_Site|LMNA_ENST00000368299.3_Splice_Site|LMNA_ENST00000473598.2_Splice_Site|LMNA_ENST00000448611.2_Splice_Site	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TCTCTTCTTTAGCAATACCAA	0.577									Werner syndrome;Hutchinson-Gilford Progeria Syndrome		OREG0013866	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	LMNA	228	0			c.357-2A>G						.						46.0	45.0	45.0					1																	156100406		2203	4300	6503	SO:0001630	splice_region_variant	4000	exon2	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	TTCTTTAGCAATA	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.357-1A>G	1.37:g.156100406A>G		Somatic	89.0	0.0	1775	WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Splice_Site	SNP	ENST00000368300.4	37	CCDS1129.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.054233	0.55218	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000292302;ENST00000392355;ENST00000448611;ENST00000368297;ENST00000504687;ENST00000473598;ENST00000392353	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7178	0.62708	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LMNA	154367030	1.000000	0.71417	0.958000	0.39756	0.496000	0.33645	9.267000	0.95665	2.129000	0.65627	0.533000	0.62120	.	.		0.577	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	Intron
MARS	4141	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57910031	57910031	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:57910031A>C	ENST00000262027.5	+	20	2601	c.2467A>C	c.(2467-2469)Aaa>Caa	p.K823Q	MIR616_ENST00000385293.1_RNA|MARS_ENST00000315473.5_3'UTR|RN7SL312P_ENST00000582079.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	823					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	TCTCCAGGCAAAAACGTCCCC	0.443																																					p.K823Q		.											.	MARS	654	0			c.A2467C						.						67.0	66.0	67.0					12																	57910031		2203	4300	6503	SO:0001583	missense	4141	exon20			CAGGCAAAAACGT	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2467A>C	12.37:g.57910031A>C	ENSP00000262027:p.Lys823Gln	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	34.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	37	CCDS8942.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.41|13.41	2.228173|2.228173	0.39399|0.39399	.|.	.|.	ENSG00000166986|ENSG00000166986	ENST00000262027;ENST00000552914|ENST00000547665	T;T|.	0.32272|.	1.48;1.46|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.052554|0.052554	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.60340|0.60340	0.2261|0.2261	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	B|.	0.09022|.	0.002|.	B|.	0.06405|.	0.002|.	T|T	0.58020|0.58020	-0.7710|-0.7710	10|6	0.17832|.	T|.	0.49|.	-14.8197|-14.8197	12.8869|12.8869	0.58049|0.58049	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	823|.	P56192|.	SYMC_HUMAN|.	Q|T	823;142|88	ENSP00000262027:K823Q;ENSP00000449787:K142Q|.	ENSP00000262027:K823Q|.	K|K	+|+	1|2	0|0	MARS|MARS	56196298|56196298	0.741000|0.741000	0.28217|0.28217	0.961000|0.961000	0.40146|0.40146	0.039000|0.039000	0.13416|0.13416	3.452000|3.452000	0.52971|0.52971	2.216000|2.216000	0.71823|0.71823	0.459000|0.459000	0.35465|0.35465	AAA|AAA	.		0.443	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
MARS	4141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57910051	57910051	+	Silent	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:57910051A>C	ENST00000262027.5	+	20	2621	c.2487A>C	c.(2485-2487)gcA>gcC	p.A829A	MIR616_ENST00000385293.1_RNA|MARS_ENST00000315473.5_3'UTR|RN7SL312P_ENST00000582079.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	829					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CGAAGCCAGCAGTTGTAGAGA	0.463																																					p.A829A		.											.	MARS	654	0			c.A2487C						.						67.0	63.0	64.0					12																	57910051		2203	4300	6503	SO:0001819	synonymous_variant	4141	exon20			GCCAGCAGTTGTA	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2487A>C	12.37:g.57910051A>C		Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	35.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Silent	SNP	ENST00000262027.5	37	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	A	8.087	0.773576	0.16051	.	.	ENSG00000166986	ENST00000547665	.	.	.	4.84	2.33	0.28932	.	.	.	.	.	T	0.57403	0.2051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49844	-0.8896	4	.	.	.	-4.0E-4	8.4778	0.33023	0.6898:0.0:0.0:0.3101	.	.	.	.	R	95	.	.	S	+	1	0	MARS	56196318	0.009000	0.17119	0.759000	0.31340	0.015000	0.08874	0.255000	0.18333	0.371000	0.24564	0.459000	0.35465	AGT	.		0.463	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
MELK	9833	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	36677291	36677291	+	Frame_Shift_Del	DEL	A	A	-			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:36677291delA	ENST00000298048.2	+	18	2097	c.1913delA	c.(1912-1914)tacfs	p.Y638fs	MELK_ENST00000545008.1_Frame_Shift_Del_p.Y567fs|MELK_ENST00000536860.1_Frame_Shift_Del_p.Y590fs|MELK_ENST00000538311.1_Frame_Shift_Del_p.Y444fs|MELK_ENST00000536987.1_Frame_Shift_Del_p.Y507fs|MELK_ENST00000543751.1_Frame_Shift_Del_p.Y606fs|MELK_ENST00000536329.1_Frame_Shift_Del_p.Y567fs|MELK_ENST00000541717.1_Frame_Shift_Del_p.Y597fs	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	638	Autoinhibitory region.|KA1. {ECO:0000255|PROSITE- ProRule:PRU00565}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GCCTGGGTTTACAAAAGATTA	0.463																																					p.Y638fs	Ovarian(82;980 1317 7225 14391 18624)	.											.	MELK	760	0			c.1913delA						.						90.0	86.0	87.0					9																	36677291		2203	4300	6503	SO:0001589	frameshift_variant	9833	exon18			GGGTTTACAAAAG	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1913delA	9.37:g.36677291delA	ENSP00000298048:p.Tyr638fs	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	16.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Frame_Shift_Del	DEL	ENST00000298048.2	37	CCDS6606.1																																																																																			.		0.463	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
MELK	9833	hgsc.bcm.edu;bcgsc.ca	37	9	36677293	36677293	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:36677293A>C	ENST00000298048.2	+	18	2099	c.1915A>C	c.(1915-1917)Aaa>Caa	p.K639Q	MELK_ENST00000545008.1_Missense_Mutation_p.K568Q|MELK_ENST00000536860.1_Missense_Mutation_p.K591Q|MELK_ENST00000538311.1_Missense_Mutation_p.K445Q|MELK_ENST00000536987.1_Missense_Mutation_p.K508Q|MELK_ENST00000543751.1_Missense_Mutation_p.K607Q|MELK_ENST00000536329.1_Missense_Mutation_p.K568Q|MELK_ENST00000541717.1_Missense_Mutation_p.K598Q	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	639	Autoinhibitory region.|KA1. {ECO:0000255|PROSITE- ProRule:PRU00565}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CTGGGTTTACAAAAGATTAGT	0.458																																					p.K639Q	Ovarian(82;980 1317 7225 14391 18624)	.											.	MELK	760	0			c.A1915C						.						87.0	83.0	84.0					9																	36677293		2203	4300	6503	SO:0001583	missense	9833	exon18			GTTTACAAAAGAT	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1915A>C	9.37:g.36677293A>C	ENSP00000298048:p.Lys639Gln	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	17.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	37	CCDS6606.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341660	0.81911	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.75	5.75	0.90469	Kinase-associated KA1 (4);	0.092179	0.64402	D	0.000001	T	0.74512	0.3726	M	0.82056	2.57	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0;1.0	T	0.78505	-0.2178	10	0.87932	D	0	-13.7741	16.0623	0.80847	1.0:0.0:0.0:0.0	.	559;568;591;598;568;607;639	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	Q	639;445;508;568;591;568;598;607	ENSP00000298048:K639Q;ENSP00000438226:K445Q;ENSP00000439184:K508Q;ENSP00000445452:K568Q;ENSP00000439792:K591Q;ENSP00000443550:K568Q;ENSP00000437804:K598Q;ENSP00000441596:K607Q	ENSP00000298048:K639Q	K	+	1	0	MELK	36667293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.683000	0.91236	2.195000	0.70347	0.533000	0.62120	AAA	.		0.458	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
KMT2D	8085	broad.mit.edu;mdanderson.org	37	12	49431342	49431342	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:49431342A>T	ENST00000301067.7	-	34	9796	c.9797T>A	c.(9796-9798)cTt>cAt	p.L3266H	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3266	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTGTGCTGAAAGCTGCTGCTT	0.567																																					p.L3266H		.											.	MLL2	612	0			c.T9797A						.						24.0	26.0	25.0					12																	49431342		2163	4238	6401	SO:0001583	missense	8085	exon34			GCTGAAAGCTGCT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9797T>A	12.37:g.49431342A>T	ENSP00000301067:p.Leu3266His	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	3.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	A	9.241	1.038380	0.19669	.	.	ENSG00000167548	ENST00000301067	D	0.81996	-1.56	5.21	5.21	0.72293	.	0.000000	0.31685	N	0.007232	D	0.83450	0.5257	N	0.24115	0.695	0.37894	D	0.930813	D	0.89917	1.0	D	0.68192	0.956	D	0.86446	0.1770	10	0.87932	D	0	.	10.86	0.46821	0.8422:0.1578:0.0:0.0	.	3266	O14686	MLL2_HUMAN	H	3266	ENSP00000301067:L3266H	ENSP00000301067:L3266H	L	-	2	0	MLL2	47717609	.	.	1.000000	0.80357	0.958000	0.62258	.	.	2.281000	0.76405	0.533000	0.62120	CTT	.		0.567	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
MROH7	374977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	55144944	55144944	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:55144944A>T	ENST00000421030.2	+	12	2343	c.2058A>T	c.(2056-2058)ggA>ggT	p.G686G	MROH7-TTC4_ENST00000414150.2_Silent_p.G686G|MROH7_ENST00000339553.5_Silent_p.G686G|MROH7_ENST00000454855.2_Silent_p.G204G|MROH7_ENST00000545244.1_Silent_p.G254G|MROH7_ENST00000395690.2_Silent_p.G686G|MROH7_ENST00000409996.1_Silent_p.G254G	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	686						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											AGGAATTTGGAGACTTCCTGG	0.562																																					p.G686G		.											.	.	.	0			c.A2058T						.						107.0	111.0	109.0					1																	55144944		1904	4121	6025	SO:0001819	synonymous_variant	374977	exon12			ATTTGGAGACTTC	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2058A>T	1.37:g.55144944A>T		Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	19.0	NM_001039464	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	37	CCDS41342.2																																																																																			.		0.562	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547	
MRVI1	10335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	10613101	10613101	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:10613101A>G	ENST00000436272.1	-	17	2231	c.2153T>C	c.(2152-2154)tTg>tCg	p.L718S	MRVI1_ENST00000424001.1_Missense_Mutation_p.L430S|MRVI1_ENST00000423302.2_Missense_Mutation_p.L745S|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000421747.1_Missense_Mutation_p.L736S|MRVI1_ENST00000547195.1_Missense_Mutation_p.L654S|MRVI1_ENST00000541483.1_Missense_Mutation_p.L539S|MRVI1_ENST00000558540.1_Missense_Mutation_p.L430S|MRVI1_ENST00000545852.1_Missense_Mutation_p.L430S|MRVI1-AS1_ENST00000529979.1_RNA|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000527509.2_Missense_Mutation_p.L654S|MRVI1_ENST00000534266.2_Missense_Mutation_p.L430S|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000531107.1_Missense_Mutation_p.L737S|MRVI1_ENST00000552103.1_Missense_Mutation_p.L654S			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	718					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TTACTTTTCCAAAAGTGCAGG	0.443																																					p.L745S		.											.	MRVI1	25	0			c.T2234C						.						51.0	49.0	50.0					11																	10613101		1915	4136	6051	SO:0001583	missense	10335	exon18			TTTTCCAAAAGTG	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.2153T>C	11.37:g.10613101A>G	ENSP00000412229:p.Leu718Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	12.0	NM_130385	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	37		.	.	.	.	.	.	.	.	.	.	A	24.6	4.546730	0.86022	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38;2.38;2.38;2.38	5.37	5.37	0.77165	.	0.187718	0.35124	N	0.003430	T	0.36193	0.0958	L	0.51422	1.61	0.42507	D	0.992953	P;D;D;D	0.76494	0.774;0.999;0.999;0.999	P;D;D;D	0.75484	0.465;0.986;0.986;0.976	T	0.04767	-1.0928	10	0.51188	T	0.08	-6.0099	15.204	0.73162	1.0:0.0:0.0:0.0	.	539;718;737;736	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	S	736;719;718;654;654;430;430;745;539;737;654	ENSP00000414598:L736S;ENSP00000412229:L718S;ENSP00000448278:L654S;ENSP00000446764:L654S;ENSP00000441971:L430S;ENSP00000401205:L430S;ENSP00000412130:L745S;ENSP00000437784:L539S;ENSP00000432436:L737S;ENSP00000432067:L654S	ENSP00000307885:L719S	L	-	2	0	MRVI1	10569677	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.682000	0.68182	2.254000	0.74563	0.533000	0.62120	TTG	.		0.443	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
MSH6	2956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	48027047	48027047	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:48027047A>G	ENST00000234420.5	+	4	2077	c.1925A>G	c.(1924-1926)tAt>tGt	p.Y642C	MSH6_ENST00000540021.1_Missense_Mutation_p.Y512C|MSH6_ENST00000538136.1_Missense_Mutation_p.Y340C|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	642					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAGGAAGAATATTTTAGGGAA	0.453			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.Y642C		.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6	3014	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A1925G						.						95.0	94.0	95.0					2																	48027047		2203	4300	6503	SO:0001583	missense	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	AAGAATATTTTAG	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1925A>G	2.37:g.48027047A>G	ENSP00000234420:p.Tyr642Cys	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	17.0	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	A	13.39	2.221981	0.39300	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.87809	-2.3;-2.3;-2.3	5.49	5.49	0.81192	DNA mismatch repair protein MutS, connector (1);	0.118381	0.64402	D	0.000013	D	0.95149	0.8428	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.967	D	0.96333	0.9245	10	0.87932	D	0	-12.5268	15.5875	0.76495	1.0:0.0:0.0:0.0	.	512;642;642	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	C	642;640;512;340	ENSP00000234420:Y642C;ENSP00000446475:Y512C;ENSP00000438580:Y340C	ENSP00000234420:Y642C	Y	+	2	0	MSH6	47880551	1.000000	0.71417	0.979000	0.43373	0.272000	0.26649	8.891000	0.92485	2.089000	0.63090	0.477000	0.44152	TAT	.		0.453	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
MSTN	2660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	190924808	190924808	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:190924808C>T	ENST00000260950.4	-	2	859	c.727G>A	c.(727-729)Gga>Aga	p.G243R	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	243					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			TCTCCTGGTCCTGGGAAGGTT	0.348																																					p.G243R		.											.	MSTN	650	0			c.G727A						.						122.0	120.0	121.0					2																	190924808		2203	4300	6503	SO:0001583	missense	2660	exon2			CTGGTCCTGGGAA	AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.727G>A	2.37:g.190924808C>T	ENSP00000260950:p.Gly243Arg	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	81.0	NM_005259	A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	ENST00000260950.4	37	CCDS2303.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.493228	0.26774	.	.	ENSG00000138379	ENST00000260950	T	0.66280	-0.2	5.25	4.38	0.52667	Transforming growth factor-beta, N-terminal (1);	0.218941	0.46442	N	0.000283	T	0.47967	0.1474	L	0.27053	0.805	0.43642	D	0.996043	B	0.02656	0.0	B	0.06405	0.002	T	0.37126	-0.9719	10	0.22706	T	0.39	-6.8459	14.0005	0.64431	0.0:0.9274:0.0:0.0726	.	243	O14793	GDF8_HUMAN	R	243	ENSP00000260950:G243R	ENSP00000260950:G243R	G	-	1	0	MSTN	190633053	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.183000	0.50918	1.453000	0.47775	0.585000	0.79938	GGA	.		0.348	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255917.2	NM_005259	
MYH11	4629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	15931900	15931900	+	Silent	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:15931900C>A	ENST00000300036.5	-	2	319	c.210G>T	c.(208-210)acG>acT	p.T70T	MYH11_ENST00000576790.2_Silent_p.T70T|MYH11_ENST00000396324.3_Silent_p.T70T|MYH11_ENST00000452625.2_Silent_p.T70T	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	70					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTTTCCCAACCGTGACCTTCT	0.577			T	CBFB	AML																																p.T70T		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	666	0			c.G210T						.						310.0	261.0	277.0					16																	15931900		2197	4300	6497	SO:0001819	synonymous_variant	4629	exon2			CCCAACCGTGACC	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.210G>T	16.37:g.15931900C>A		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	12.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1																																																																																			.		0.577	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
MYH7	4625	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23901921	23901921	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:23901921C>T	ENST00000355349.3	-	5	591	c.429G>A	c.(427-429)cgG>cgA	p.R143R		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	143	Myosin motor.		R -> G (in CMH1). {ECO:0000269|PubMed:12820698}.|R -> Q (in CMH1). {ECO:0000269|PubMed:15358028, ECO:0000269|PubMed:15563892}.|R -> W (in CMH1). {ECO:0000269|PubMed:12974739}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCTTCTTGCCCCGGTAGGCAG	0.592																																					p.R143R		.											MYH7,NS,carcinoma,-2	MYH7	94	0			c.G429A						.						80.0	78.0	78.0					14																	23901921		2203	4300	6503	SO:0001819	synonymous_variant	4625	exon5			CTTGCCCCGGTAG	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.429G>A	14.37:g.23901921C>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	5.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	ENST00000355349.3	37	CCDS9601.1																																																																																			.		0.592	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
NAA11	84779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	80246710	80246710	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:80246710A>G	ENST00000286794.4	-	1	494	c.322T>C	c.(322-324)Tct>Cct	p.S108P	NAA11_ENST00000513733.1_5'Flank	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	108	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						ACGTGCAGAGACACGTATTTG	0.532																																					p.S108P		.											.	NAA11	24	0			c.T322C						.						58.0	62.0	61.0					4																	80246710		2109	4244	6353	SO:0001583	missense	84779	exon1			GCAGAGACACGTA		CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.322T>C	4.37:g.80246710A>G	ENSP00000286794:p.Ser108Pro	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	7.0	NM_032693	Q66K19|Q6P479	Missense_Mutation	SNP	ENST00000286794.4	37	CCDS47084.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.386248	0.61956	.	.	ENSG00000156269	ENST00000286794	T	0.35048	1.33	5.17	5.17	0.71159	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	U	0.000000	T	0.71281	0.3321	H	0.97103	3.94	0.80722	D	1	D	0.69078	0.997	D	0.72982	0.979	T	0.81243	-0.1021	9	.	.	.	-16.9732	13.3112	0.60380	1.0:0.0:0.0:0.0	.	108	Q9BSU3	NAA11_HUMAN	P	108	ENSP00000286794:S108P	.	S	-	1	0	NAA11	80465734	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	8.223000	0.89779	2.308000	0.77769	0.533000	0.62120	TCT	.		0.532	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362922.1		
NAA15	80155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	140299908	140299908	+	Splice_Site	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:140299908A>G	ENST00000296543.5	+	17	2379		c.e17-1		NAA15_ENST00000398947.1_Splice_Site	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						CTCTTTTTATAGAAAAGTTTC	0.348																																					.		.											.	NAA15	92	0			c.2057-2A>G						.						121.0	105.0	110.0					4																	140299908		1791	4067	5858	SO:0001630	splice_region_variant	80155	exon17			TTTTATAGAAAAG	AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.2057-1A>G	4.37:g.140299908A>G		Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	22.0	NM_057175	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Splice_Site	SNP	ENST00000296543.5	37	CCDS43270.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.222284	0.79464	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2127	0.82178	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAA15	140519358	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.730000	0.91510	2.236000	0.73375	0.533000	0.62120	.	.		0.348	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	Intron
NBAS	51594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	15523423	15523423	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:15523423C>T	ENST00000281513.5	-	29	3301	c.3276G>A	c.(3274-3276)gaG>gaA	p.E1092E	NBAS_ENST00000441750.1_Silent_p.E972E	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1092					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TCCAATGAGACTCACTGACAG	0.373																																					p.E1092E		.											.	NBAS	94	0			c.G3276A						.						89.0	88.0	89.0					2																	15523423		2203	4300	6503	SO:0001819	synonymous_variant	51594	exon29			ATGAGACTCACTG	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3276G>A	2.37:g.15523423C>T		Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	25.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	C	8.232	0.804942	0.16467	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	T	0.76673	0.4020	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74312	-0.3706	4	.	.	.	.	19.9559	0.97218	0.0:1.0:0.0:0.0	.	.	.	.	N	140	.	.	S	-	2	0	NBAS	15440874	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	3.274000	0.51631	2.728000	0.93425	0.462000	0.41574	AGT	.		0.373	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
NBPF10	100132406	broad.mit.edu;mdanderson.org	37	1	145365361	145365361	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:145365361C>G	ENST00000342960.5	+	80	10021	c.9986C>G	c.(9985-9987)cCt>cGt	p.P3329R	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	643						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TATTCAACTCCTTCAGGTTGT	0.473																																					p.P3329R		.											.	.	.	0			c.C9986G						.																																			SO:0001583	missense	100132406	exon80			CAACTCCTTCAGG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.9986C>G	1.37:g.145365361C>G	ENSP00000345684:p.Pro3329Arg	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	5.0	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	37	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	8.913	0.959240	0.18507	.	.	ENSG00000163386	ENST00000342960	T	0.09817	2.94	0.74	0.74	0.18330	.	.	.	.	.	T	0.07503	0.0189	M	0.70595	2.14	0.09310	N	1	.	.	.	.	.	.	T	0.28964	-1.0027	7	0.54805	T	0.06	.	4.8933	0.13737	0.0:1.0:0.0:0.0	.	.	.	.	R	3329	ENSP00000345684:P3329R	ENSP00000345684:P3329R	P	+	2	0	NBPF10	144076718	0.060000	0.20803	0.007000	0.13788	0.025000	0.11179	-0.752000	0.04797	0.725000	0.32318	0.152000	0.16155	CCT	.		0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
NPSR1	387129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34867130	34867130	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:34867130C>T	ENST00000360581.1	+	5	724	c.596C>T	c.(595-597)gCc>gTc	p.A199V	NPSR1_ENST00000381539.3_Missense_Mutation_p.A199V|NPSR1_ENST00000381542.1_Missense_Mutation_p.A133V|NPSR1_ENST00000531252.1_Missense_Mutation_p.A188V|NPSR1_ENST00000359791.1_Missense_Mutation_p.A199V	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	199						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	CAGTGCTGGGCCCTGTGGCCT	0.537																																					p.A199V		.											.	NPSR1	94	0			c.C596T						.						159.0	137.0	144.0					7																	34867130		2203	4300	6503	SO:0001583	missense	387129	exon5			GCTGGGCCCTGTG	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.596C>T	7.37:g.34867130C>T	ENSP00000353788:p.Ala199Val	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	13.0	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	37	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.877943	0.91664	.	.	ENSG00000187258	ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539;ENST00000334481	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.57051	0.2027	L	0.55743	1.74	0.51012	D	0.999903	D;D;D;P;D;P	0.89917	0.999;0.992;1.0;0.767;0.99;0.898	D;P;D;P;P;P	0.85130	0.997;0.814;0.997;0.661;0.741;0.823	T	0.53865	-0.8378	10	0.45353	T	0.12	-26.2085	18.2637	0.90044	0.0:1.0:0.0:0.0	.	133;188;133;199;199;199	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	V	199;133;199;188;199;62	ENSP00000353788:A199V;ENSP00000370953:A133V;ENSP00000352839:A199V;ENSP00000433258:A188V;ENSP00000370950:A199V	ENSP00000334093:A62V	A	+	2	0	NPSR1	34833655	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.937000	0.56575	2.553000	0.86117	0.655000	0.94253	GCC	.		0.537	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
NPC1L1	29881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44578553	44578553	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:44578553A>G	ENST00000289547.4	-	2	1498	c.1443T>C	c.(1441-1443)agT>agC	p.S481S	NPC1L1_ENST00000546276.1_Silent_p.S481S|NPC1L1_ENST00000423141.1_Silent_p.S481S|NPC1L1_ENST00000381160.3_Silent_p.S481S	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	481					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	AGTCGTAGAGACTGGTATTGT	0.597																																					p.S481S		.											.	NPC1L1	94	0			c.T1443C						.						127.0	109.0	115.0					7																	44578553		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon2			GTAGAGACTGGTA		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1443T>C	7.37:g.44578553A>G		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	20.0	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	37	CCDS5491.1																																																																																			.		0.597	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
NR2C1	7181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	95451647	95451647	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:95451647T>C	ENST00000333003.5	-	6	882	c.552A>G	c.(550-552)caA>caG	p.Q184Q	NR2C1_ENST00000330677.7_Silent_p.Q184Q|NR2C1_ENST00000393101.3_Silent_p.Q184Q|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	184					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						TTCTTTCACATTGGACAGCTA	0.348																																					p.Q184Q		.											.	NR2C1	187	0			c.A552G						.						86.0	89.0	88.0					12																	95451647		2203	4300	6503	SO:0001819	synonymous_variant	7181	exon6			TTCACATTGGACA	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.552A>G	12.37:g.95451647T>C		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	20.0	NM_001032287	A8K5K4|Q15625|Q15626	Silent	SNP	ENST00000333003.5	37	CCDS9051.1																																																																																			.		0.348	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	NM_003297	
NRG1	3084	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	31498106	31498106	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:31498106C>G	ENST00000520407.1	+	1	836	c.606C>G	c.(604-606)gaC>gaG	p.D202E	NRG1_ENST00000519301.1_Intron	NM_013962.2	NP_039256.2	Q02297	NRG1_HUMAN	neuregulin 1	585	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TCAAGGAGGACAGCAGGTACA	0.692																																					p.D202E		.											.	NRG1	525	0			c.C606G						.						19.0	24.0	22.0					8																	31498106		2008	4158	6166	SO:0001583	missense	3084	exon1			GGAGGACAGCAGG	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000520407.1:c.606C>G	8.37:g.31498106C>G	ENSP00000434640:p.Asp202Glu	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	8.0	3.0	NM_013962	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000520407.1	37	CCDS47836.1	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048282	0.55110	.	.	ENSG00000157168	ENST00000520407;ENST00000523534	T;T	0.74002	-0.8;-0.56	4.53	4.53	0.55603	.	.	.	.	.	D	0.83087	0.5178	.	.	.	0.80722	D	1	D	0.61697	0.99	P	0.59115	0.852	D	0.85662	0.1289	8	0.66056	D	0.02	.	14.7546	0.69554	0.0:1.0:0.0:0.0	.	202	Q02297-9	.	E	202;55	ENSP00000434640:D202E;ENSP00000429067:D55E	ENSP00000434640:D202E	D	+	3	2	NRG1	31617648	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.807000	0.38902	2.075000	0.62263	0.563000	0.77884	GAC	.		0.692	NRG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376412.2		
NRM	11270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30657906	30657906	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:30657906T>G	ENST00000259953.4	-	3	599	c.248A>C	c.(247-249)gAa>gCa	p.E83A	PPP1R18_ENST00000274853.3_5'Flank|PPP1R18_ENST00000488324.1_5'Flank|NRM_ENST00000376420.5_Missense_Mutation_p.E83A|NRM_ENST00000470733.1_5'UTR|PPP1R18_ENST00000399199.3_5'Flank|NRM_ENST00000376421.5_Missense_Mutation_p.E83A	NM_007243.2	NP_009174.1	Q8IXM6	NRM_HUMAN	nurim (nuclear envelope membrane protein)	83						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)				large_intestine(1)|lung(2)	3						CTTCACTCTTTCAGCTGCCAT	0.607																																					p.E83A		.											.	NRM	90	0			c.A248C						.						107.0	101.0	103.0					6																	30657906		1510	2708	4218	SO:0001583	missense	11270	exon2			ACTCTTTCAGCTG	AF143676	CCDS4686.1, CCDS59498.1	6p21.3	2010-02-17			ENSG00000137404	ENSG00000137404			8003	protein-coding gene	gene with protein product						10402458, 17517639	Standard	NM_007243		Approved	NRM29	uc031sng.1	Q8IXM6	OTTHUMG00000031223	ENST00000259953.4:c.248A>C	6.37:g.30657906T>G	ENSP00000259953:p.Glu83Ala	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	15.0	NM_001270709	B0S7R0|B0S7R1|I3XIE2|I3XIE3|Q5JP57|Q5JP58|Q5JP59|Q5JP60|Q8WU45|Q9BSX3|Q9UN92	Missense_Mutation	SNP	ENST00000259953.4	37	CCDS4686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.06|14.06	2.422431|2.422431	0.43020|0.43020	.|.	.|.	ENSG00000137404|ENSG00000137404	ENST00000259953;ENST00000376420;ENST00000376421|ENST00000444096	T;T|.	0.30448|.	1.53;1.53|.	4.6|4.6	4.6|4.6	0.57074|0.57074	.|.	0.328653|.	0.29253|.	N|.	0.012684|.	T|.	0.07638|.	0.0192|.	N|N	0.05351|0.05351	-0.065|-0.065	0.09310|0.09310	N|N	1|1	B|.	0.21688|.	0.059|.	B|.	0.22386|.	0.039|.	T|.	0.20605|.	-1.0270|.	10|.	0.09590|.	T|.	0.72|.	-3.6807|-3.6807	8.3286|8.3286	0.32173|0.32173	0.0:0.0:0.2:0.8|0.0:0.0:0.2:0.8	.|.	83|.	Q8IXM6|.	NRM_HUMAN|.	A|C	83|82	ENSP00000259953:E83A;ENSP00000365603:E83A|.	ENSP00000259953:E83A|.	E|X	-|-	2|3	0|0	NRM|NRM	30765885|30765885	0.071000|0.071000	0.21146|0.21146	0.587000|0.587000	0.28692|0.28692	0.543000|0.543000	0.35085|0.35085	1.412000|1.412000	0.34714|0.34714	1.928000|1.928000	0.55862|0.55862	0.379000|0.379000	0.24179|0.24179	GAA|TGA	.		0.607	NRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076466.2		
NUDCD1	84955	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	110283345	110283345	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:110283345A>T	ENST00000239690.4	-	8	1562	c.1188T>A	c.(1186-1188)gaT>gaA	p.D396E	NUDCD1_ENST00000427660.2_Missense_Mutation_p.D367E	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			GTTTTTCTTTATCTGGATTTG	0.294																																					p.D396E		.											.	NUDCD1	227	0			c.T1188A						.						108.0	114.0	112.0					8																	110283345		2202	4297	6499	SO:0001583	missense	84955	exon8			TTCTTTATCTGGA	AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.1188T>A	8.37:g.110283345A>T	ENSP00000239690:p.Asp396Glu	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	243.0	24.0	NM_032869		Missense_Mutation	SNP	ENST00000239690.4	37	CCDS6312.1	.	.	.	.	.	.	.	.	.	.	A	8.817	0.936643	0.18206	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	T;T	0.18338	2.22;2.22	5.7	1.99	0.26369	.	0.347524	0.34879	N	0.003613	T	0.05227	0.0139	N	0.04508	-0.205	0.25419	N	0.988283	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.30736	-0.9968	10	0.17369	T	0.5	-5.9605	1.069	0.01617	0.4223:0.2724:0.1571:0.1482	.	309;396;367	Q96RS6-3;Q96RS6;Q96RS6-2	.;NUDC1_HUMAN;.	E	396;367	ENSP00000239690:D396E;ENSP00000410707:D367E	ENSP00000239690:D396E	D	-	3	2	NUDCD1	110352521	0.582000	0.26749	1.000000	0.80357	0.889000	0.51656	-0.341000	0.07811	0.499000	0.27970	0.529000	0.55759	GAT	.		0.294	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380996.1	NM_032869	
OR5V1	81696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29323799	29323799	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:29323799A>T	ENST00000377154.1	-	4	473	c.174T>A	c.(172-174)ccT>ccA	p.P58P	OR5V1_ENST00000543825.1_Silent_p.P58P			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AATAATACATAGGTGTATGCA	0.393																																					p.P58P	Ovarian(32;43 883 21137 32120 42650)	.											.	OR5V1	72	0			c.T174A						.						153.0	150.0	151.0					6																	29323799		2203	4300	6503	SO:0001819	synonymous_variant	81696	exon1			ATACATAGGTGTA		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.174T>A	6.37:g.29323799A>T		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	18.0	NM_030876	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Silent	SNP	ENST00000377154.1	37	CCDS4657.1																																																																																			.		0.393	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3		
OR2H1	26716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29430101	29430101	+	Silent	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:29430101C>A	ENST00000377136.1	+	4	1020	c.555C>A	c.(553-555)ctC>ctA	p.L185L	OR2H1_ENST00000396792.2_Silent_p.L185L|OR2H1_ENST00000377133.1_Silent_p.L185L|OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000442615.1_Silent_p.L185L|OR2H1_ENST00000377132.1_Silent_p.L185L			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						TGATTCGACTCTCCTGTGGAG	0.502																																					p.L185L		.											.	OR2H1	90	0			c.C555A						.						189.0	194.0	192.0					6																	29430101		1511	2709	4220	SO:0001819	synonymous_variant	26716	exon3			TCGACTCTCCTGT	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.555C>A	6.37:g.29430101C>A		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	15.0	NM_030883	B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Silent	SNP	ENST00000377136.1	37	CCDS4660.1																																																																																			.		0.502	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3		
OSGIN1	29948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	83994227	83994227	+	Silent	SNP	C	C	T	rs201580564		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:83994227C>T	ENST00000343939.2	+	5	890	c.507C>T	c.(505-507)gcC>gcT	p.A169A	OSGIN1_ENST00000393306.1_Silent_p.A86A|OSGIN1_ENST00000361711.3_Silent_p.A86A|OSGIN1_ENST00000565123.1_Silent_p.A86A			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	169					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						GCCCCGTGGCCCTGCTCTTTG	0.642																																					p.A86A		.											.	OSGIN1	68	0			c.C258T						.						63.0	59.0	60.0					16																	83994227		2200	4300	6500	SO:0001819	synonymous_variant	29948	exon4			CGTGGCCCTGCTC	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.507C>T	16.37:g.83994227C>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	10.0	NM_182981	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Silent	SNP	ENST00000343939.2	37																																																																																				C|0.999;G|0.001		0.642	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
OSTM1	28962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	108372287	108372287	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:108372287A>G	ENST00000193322.3	-	4	816	c.731T>C	c.(730-732)cTt>cCt	p.L244P		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	244					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		CTTATTCTCAAGTTCATTCAT	0.338																																					p.L244P	Melanoma(162;1427 1909 3096 17430 21396)	.											.	OSTM1	68	0			c.T731C						.						212.0	186.0	195.0					6																	108372287		2203	4300	6503	SO:0001583	missense	28962	exon4			TTCTCAAGTTCAT	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.731T>C	6.37:g.108372287A>G	ENSP00000193322:p.Leu244Pro	Somatic	264.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	14.0	NM_014028	E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	ENST00000193322.3	37	CCDS5062.1	.	.	.	.	.	.	.	.	.	.	a	16.32	3.090238	0.55968	.	.	ENSG00000081087	ENST00000193322;ENST00000440575	T	0.46063	0.88	5.79	-6.46	0.01908	.	0.795303	0.11237	N	0.585048	T	0.20047	0.0482	L	0.51422	1.61	0.20764	N	0.999856	P	0.52577	0.954	P	0.48952	0.596	T	0.19321	-1.0309	10	0.40728	T	0.16	-6.5411	6.8972	0.24262	0.2689:0.3795:0.0:0.3515	.	244	Q86WC4	OSTM1_HUMAN	P	244;97	ENSP00000193322:L244P	ENSP00000193322:L244P	L	-	2	0	OSTM1	108478980	0.001000	0.12720	0.152000	0.22495	0.998000	0.95712	-0.957000	0.03861	-0.462000	0.06984	0.533000	0.62120	CTT	.		0.338	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041709.3	NM_014028	
PANX3	116337	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	124487191	124487191	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:124487191G>T	ENST00000284288.2	+	3	413	c.346G>T	c.(346-348)Gcc>Tcc	p.A116S		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	116					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		CTCCCTGCTGGCCCTGGCCTT	0.642																																					p.A116S		.											.	PANX3	68	0			c.G346T						.						41.0	34.0	36.0					11																	124487191		2201	4299	6500	SO:0001583	missense	116337	exon3			CTGCTGGCCCTGG	AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.346G>T	11.37:g.124487191G>T	ENSP00000284288:p.Ala116Ser	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	7.0	NM_052959		Missense_Mutation	SNP	ENST00000284288.2	37	CCDS8447.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973331	0.53614	.	.	ENSG00000154143	ENST00000284288	T	0.30182	1.54	4.92	4.92	0.64577	.	0.183391	0.51477	D	0.000097	T	0.33089	0.0851	L	0.55481	1.735	0.35528	D	0.801986	B	0.27910	0.193	B	0.34536	0.185	T	0.47686	-0.9098	10	0.66056	D	0.02	-8.8817	11.6131	0.51072	0.0826:0.0:0.9174:0.0	.	116	Q96QZ0	PANX3_HUMAN	S	116	ENSP00000284288:A116S	ENSP00000284288:A116S	A	+	1	0	PANX3	123992401	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.368000	0.59505	2.270000	0.75569	0.455000	0.32223	GCC	.		0.642	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387064.1		
PARG	8505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	51027418	51027418	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:51027418C>A	ENST00000402038.3	-	14	1443	c.1444G>T	c.(1444-1446)Gct>Tct	p.A482S		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	967					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)			endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		GAATGGTCAGCGGTCTCTGCA	0.517																																					p.A967S		.											.	PARG	948	0			c.G2899T						.						161.0	142.0	148.0					10																	51027418		692	1591	2283	SO:0001583	missense	8505	exon18			GGTCAGCGGTCTC	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.1444G>T	10.37:g.51027418C>A	ENSP00000384408:p.Ala482Ser	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	30.0	NM_003631	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	37		.	.	.	.	.	.	.	.	.	.	C	1.001	-0.691062	0.03303	.	.	ENSG00000227345	ENST00000402038	.	.	.	5.59	-9.35	0.00633	.	.	.	.	.	T	0.04318	0.0119	N	0.00926	-1.1	.	.	.	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.001;0.0;0.001	T	0.23511	-1.0186	7	0.07482	T	0.82	4.2817	0.626	0.00786	0.2909:0.2075:0.1096:0.392	.	885;967;518;235;482;507;967	Q86W56-2;Q86W56;A5YBK3;B4DHS4;Q5SQP4;B4DX76;Q0MQR4	.;PARG_HUMAN;.;.;.;.;.	S	482	.	ENSP00000384408:A482S	A	-	1	0	PARG	50697424	0.094000	0.21725	0.000000	0.03702	0.005000	0.04900	-0.006000	0.12833	-1.398000	0.02066	-0.982000	0.02568	GCT	.		0.517	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
PCDH11Y	83259	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	Y	4968005	4968005	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chrY:4968005A>G	ENST00000333703.4	+	5	2866	c.2353A>G	c.(2353-2355)Agt>Ggt	p.S785G	PCDH11Y_ENST00000215473.6_Missense_Mutation_p.S796G|PCDH11Y_ENST00000362095.5_Missense_Mutation_p.S796G	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	796	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTCTCTCTTCAGTGTTGTAAT	0.418																																					p.S796G		.											.	.	.	0			c.A2386G						.																																			SO:0001583	missense	83259	exon2			CTCTTCAGTGTTG	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2353A>G	Y.37:g.4968005A>G	ENSP00000330552:p.Ser785Gly	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	39.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	37	CCDS14776.1																																																																																			.		0.418	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140209555	140209555	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:140209555T>C	ENST00000529310.1	+	1	1993	c.1879T>C	c.(1879-1881)Tac>Cac	p.Y627H	PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	627	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGGGCTGTACACGGGCGA	0.667																																					p.Y627H		.											.	PCDHA6	92	0			c.T1879C						.						72.0	78.0	76.0					5																	140209555		2203	4300	6503	SO:0001583	missense	56142	exon1			GGGCTGTACACGG	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1879T>C	5.37:g.140209555T>C	ENSP00000433378:p.Tyr627His	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	9.0	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	T	5.432	0.264827	0.10294	.	.	ENSG00000081842	ENST00000529310	T	0.51071	0.72	3.98	2.8	0.32819	Cadherin (4);Cadherin-like (1);	0.000000	0.33610	U	0.004721	T	0.29524	0.0736	L	0.31207	0.915	0.80722	D	1	B;B	0.29612	0.042;0.251	B;B	0.29353	0.036;0.101	T	0.03922	-1.0992	10	0.14656	T	0.56	.	7.1846	0.25793	0.0:0.1789:0.0:0.8211	.	627;627	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	H	627	ENSP00000433378:Y627H	ENSP00000433378:Y627H	Y	+	1	0	PCDHA6	140189739	0.240000	0.23847	1.000000	0.80357	0.187000	0.23431	0.196000	0.17176	0.692000	0.31613	0.254000	0.18369	TAC	.		0.667	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140222076	140222076	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:140222076G>A	ENST00000531613.1	+	1	1170	c.1170G>A	c.(1168-1170)atG>atA	p.M390I	PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.M390I|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	390	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCCTGATGCCCCATGTCC	0.562																																					p.M390I		.											.	PCDHA8	92	0			c.G1170A						.						180.0	167.0	171.0					5																	140222076		2203	4300	6503	SO:0001583	missense	56140	exon1			CCTGATGCCCCAT	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1170G>A	5.37:g.140222076G>A	ENSP00000434655:p.Met390Ile	Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	39.0	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	G	9.768	1.172031	0.21704	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.01685	4.69;4.69	3.57	-5.89	0.02282	Cadherin (4);Cadherin-like (1);	1.579270	0.04935	U	0.457653	T	0.00875	0.0029	N	0.02129	-0.67	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.50668	-0.8801	10	0.46703	T	0.11	.	6.6828	0.23129	0.4666:0.0:0.4186:0.1148	.	390;390	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	I	390	ENSP00000434655:M390I;ENSP00000367363:M390I	ENSP00000367363:M390I	M	+	3	0	PCDHA8	140202260	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-4.392000	0.00241	-1.411000	0.02032	0.306000	0.20318	ATG	.		0.562	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PDE10A	10846	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	165801928	165801928	+	Silent	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:165801928C>A	ENST00000366882.1	-	18	1795	c.1641G>T	c.(1639-1641)ctG>ctT	p.L547L	PDE10A_ENST00000354448.4_Silent_p.L547L|PDE10A_ENST00000539869.2_Silent_p.L557L			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	547					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GACACGCAATCAGCAGTCCTT	0.473																																					p.L557L	Esophageal Squamous(22;308 615 5753 12038 40624)	.											.	PDE10A	519	0			c.G1671T						.						119.0	106.0	110.0					6																	165801928		2203	4300	6503	SO:0001819	synonymous_variant	10846	exon17			CGCAATCAGCAGT	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1641G>T	6.37:g.165801928C>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	8.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Silent	SNP	ENST00000366882.1	37																																																																																				.		0.473	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
PEX1	5189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92122372	92122372	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:92122372A>C	ENST00000248633.4	-	20	3197	c.3102T>G	c.(3100-3102)caT>caG	p.H1034Q	PEX1_ENST00000428214.1_Missense_Mutation_p.H977Q|AC007566.10_ENST00000427458.1_RNA|AC007566.10_ENST00000441539.1_RNA|PEX1_ENST00000438045.1_Missense_Mutation_p.H712Q	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1034					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CTGATGCTACATGCTGAAGGT	0.413																																					p.H1034Q		.											.	PEX1	91	0			c.T3102G						.						127.0	122.0	124.0					7																	92122372		2203	4300	6503	SO:0001583	missense	5189	exon20			TGCTACATGCTGA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3102T>G	7.37:g.92122372A>C	ENSP00000248633:p.His1034Gln	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	13.0	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	37	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	A	6.505	0.461342	0.12342	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	D;D;D	0.94723	-3.5;-3.5;-3.5	5.78	-5.7	0.02421	.	0.267324	0.43110	D	0.000616	T	0.81498	0.4835	N	0.05441	-0.05	0.42812	D	0.993966	B;P;B	0.42518	0.009;0.782;0.145	B;B;B	0.35813	0.017;0.211;0.031	T	0.74714	-0.3572	10	0.24483	T	0.36	-12.3631	11.2591	0.49071	0.3269:0.0:0.5678:0.1053	.	712;826;1034	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	Q	712;1034;977	ENSP00000410438:H712Q;ENSP00000248633:H1034Q;ENSP00000394413:H977Q	ENSP00000248633:H1034Q	H	-	3	2	PEX1	91960308	0.818000	0.29161	0.906000	0.35671	0.188000	0.23474	0.050000	0.14120	-1.112000	0.02984	-0.481000	0.04817	CAT	.		0.413	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
PEX1	5189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92122387	92122387	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:92122387A>G	ENST00000248633.4	-	20	3182	c.3087T>C	c.(3085-3087)gaT>gaC	p.D1029D	PEX1_ENST00000428214.1_Silent_p.D972D|AC007566.10_ENST00000427458.1_RNA|AC007566.10_ENST00000441539.1_RNA|PEX1_ENST00000438045.1_Silent_p.D707D	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1029					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GAAGGTCAACATCATCTGCCA	0.368																																					p.D1029D		.											.	PEX1	91	0			c.T3087C						.						117.0	114.0	115.0					7																	92122387		2203	4300	6503	SO:0001819	synonymous_variant	5189	exon20			GTCAACATCATCT	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3087T>C	7.37:g.92122387A>G		Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	12.0	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	ENST00000248633.4	37	CCDS5627.1																																																																																			.		0.368	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
PGPEP1L	145814	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	99512764	99512764	+	Silent	SNP	C	C	A	rs572947532	byFrequency	TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr15:99512764C>A	ENST00000378919.6	-	4	466	c.261G>T	c.(259-261)gtG>gtT	p.V87V	PGPEP1L_ENST00000535714.1_Silent_p.V33V|RP11-654A16.3_ENST00000559468.1_RNA	NM_001102612.2	NP_001096082.2	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase I-like	87							cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|stomach(1)	14						CAGGTAGGCACACGCCGCCCT	0.632																																					p.V87V		.											.	.	.	0			c.G261T						.						105.0	112.0	110.0					15																	99512764		2194	4293	6487	SO:0001819	synonymous_variant	145814	exon4			TAGGCACACGCCG		CCDS53977.1, CCDS58400.1	15q26.3	2010-02-16			ENSG00000183571	ENSG00000183571			27080	protein-coding gene	gene with protein product							Standard	NM_001102612		Approved		uc002bum.3	A6NFU8		ENST00000378919.6:c.261G>T	15.37:g.99512764C>A		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	17.0	NM_001102612	H0YF86	Silent	SNP	ENST00000378919.6	37	CCDS53977.1																																																																																			.		0.632	PGPEP1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415703.1	NM_001102612.2	
PHLDA1	22822	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	76425490	76425490	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:76425490A>C	ENST00000266671.5	-	1	2222	c.32T>G	c.(31-33)tTg>tGg	p.L11W	PHLDA1_ENST00000602540.1_5'Flank|RP11-290L1.2_ENST00000547721.1_RNA|RP11-290L1.3_ENST00000552367.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	11					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				GCCCAGCTCCAAGAGGCGCTC	0.692																																					p.L11W		.											.	PHLDA1	90	0			c.T32G						.						2.0	3.0	3.0					12																	76425490		1614	3601	5215	SO:0001583	missense	22822	exon1			AGCTCCAAGAGGC	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.32T>G	12.37:g.76425490A>C	ENSP00000266671:p.Leu11Trp	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	18.0	NM_007350	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	ENST00000266671.5	37	CCDS31861.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.678249	0.29783	.	.	ENSG00000139289	ENST00000266671	T	0.46451	0.87	4.71	2.87	0.33458	.	.	.	.	.	T	0.23766	0.0575	N	0.08118	0	0.09310	N	1	P	0.34757	0.467	B	0.35688	0.208	T	0.14952	-1.0454	9	0.87932	D	0	-2.3085	7.7246	0.28753	0.0897:0.1629:0.7474:0.0	.	11	Q8WV24	PHLA1_HUMAN	W	11	ENSP00000266671:L11W	ENSP00000266671:L11W	L	-	2	0	PHLDA1	74711757	0.000000	0.05858	0.352000	0.25734	0.299000	0.27559	0.161000	0.16481	0.583000	0.29574	-0.374000	0.07098	TTG	.		0.692	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
PIK3C2A	5286	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	17191152	17191152	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:17191152C>T	ENST00000265970.7	-	1	136	c.137G>A	c.(136-138)aGa>aAa	p.R46K	PIK3C2A_ENST00000540361.1_Intron|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	46	Interaction with clathrin; sufficient to induce clathrin assemby.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						AGTCACTTGTCTATCCTTTTG	0.418																																					p.R46K		.											.	PIK3C2A	1310	0			c.G137A						.						257.0	245.0	249.0					11																	17191152		2200	4293	6493	SO:0001583	missense	5286	exon1			ACTTGTCTATCCT	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.137G>A	11.37:g.17191152C>T	ENSP00000265970:p.Arg46Lys	Somatic	280.0	1.0		WXS	Illumina HiSeq	Phase_I	167.0	35.0	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	C	9.553	1.116370	0.20795	.	.	ENSG00000011405	ENST00000265970;ENST00000544896;ENST00000532035	T	0.60299	0.2	5.37	4.35	0.52113	.	0.432236	0.27677	N	0.018301	T	0.34164	0.0888	N	0.08118	0	0.80722	D	1	B;B	0.14012	0.009;0.002	B;B	0.11329	0.006;0.002	T	0.15954	-1.0419	10	0.14252	T	0.57	-17.0483	12.5995	0.56489	0.0:0.888:0.0:0.112	.	46;46	F5H5W9;O00443	.;P3C2A_HUMAN	K	46	ENSP00000265970:R46K	ENSP00000265970:R46K	R	-	2	0	PIK3C2A	17147728	0.938000	0.31826	0.936000	0.37596	0.883000	0.51084	1.646000	0.37249	2.517000	0.84864	0.585000	0.79938	AGA	.		0.418	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
PLEKHH2	130271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	43922295	43922295	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:43922295A>G	ENST00000282406.4	+	6	544	c.434A>G	c.(433-435)aAt>aGt	p.N145S		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	145					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GAATTGGAGAATCAGAATCTT	0.269																																					p.N145S		.											.	PLEKHH2	92	0			c.A434G						.						49.0	47.0	48.0					2																	43922295		2199	4296	6495	SO:0001583	missense	130271	exon6			TGGAGAATCAGAA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.434A>G	2.37:g.43922295A>G	ENSP00000282406:p.Asn145Ser	Somatic	503.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	28.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.353659	0.82243	.	.	ENSG00000152527	ENST00000282406	T	0.43688	0.94	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	L	0.58810	1.83	0.53688	D	0.999971	D;D	0.89917	0.996;1.0	P;D	0.91635	0.787;0.999	T	0.63550	-0.6612	10	0.59425	D	0.04	-30.3231	15.7573	0.78043	1.0:0.0:0.0:0.0	.	145;145	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	S	145	ENSP00000282406:N145S	ENSP00000282406:N145S	N	+	2	0	PLEKHH2	43775799	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.163000	0.77524	2.120000	0.65058	0.477000	0.44152	AAT	.		0.269	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
PLA2R1	22925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160808016	160808016	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:160808016A>T	ENST00000283243.7	-	24	3581	c.3375T>A	c.(3373-3375)acT>acA	p.T1125T	PLA2R1_ENST00000392771.1_Silent_p.T1125T	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1125	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TTATTTTGTAAGTTCTGTTTC	0.378																																					p.T1125T		.											.	PLA2R1	93	0			c.T3375A						.						198.0	182.0	187.0					2																	160808016		2203	4300	6503	SO:0001819	synonymous_variant	22925	exon24			TTTGTAAGTTCTG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3375T>A	2.37:g.160808016A>T		Somatic	301.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	73.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	CCDS33309.1																																																																																			.		0.378	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	208219347	208219347	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:208219347T>G	ENST00000367033.3	-	18	4128	c.3371A>C	c.(3370-3372)aAc>aCc	p.N1124T		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1124	IPT/TIG 3.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TTGGACATTGTTAAAGACAAA	0.502																																					p.N1124T		.											.	PLXNA2	92	0			c.A3371C						.						172.0	164.0	167.0					1																	208219347		2203	4300	6503	SO:0001583	missense	5362	exon18			ACATTGTTAAAGA	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3371A>C	1.37:g.208219347T>G	ENSP00000356000:p.Asn1124Thr	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	19.0	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411607	0.83340	.	.	ENSG00000076356	ENST00000367033	T	0.60171	0.21	4.51	4.51	0.55191	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	L	0.57536	1.79	0.80722	D	1	D	0.53151	0.958	P	0.49140	0.601	T	0.68138	-0.5488	10	0.87932	D	0	.	14.1385	0.65303	0.0:0.0:0.0:1.0	.	1124	O75051	PLXA2_HUMAN	T	1124	ENSP00000356000:N1124T	ENSP00000356000:N1124T	N	-	2	0	PLXNA2	206285970	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.708000	0.84633	1.804000	0.52760	0.460000	0.39030	AAC	.		0.502	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
POTEE	445582	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	132020969	132020969	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:132020969A>C	ENST00000356920.5	+	15	2035	c.1941A>C	c.(1939-1941)gaA>gaC	p.E647D	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	647					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.E647D(1)									TCTTGCATGAAAATAGTACGT	0.353																																					p.E647D		.											.	.	.	1	Substitution - Missense(1)	lung(1)	c.A1941C						.						27.0	29.0	28.0					2																	132020969		1938	4163	6101	SO:0001583	missense	445582	exon15			GCATGAAAATAGT	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.1941A>C	2.37:g.132020969A>C	ENSP00000439189:p.Glu647Asp	Somatic	492.0	0.0		WXS	Illumina HiSeq	Phase_I	229.0	105.0	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	9.831	1.188323	0.21954	.	.	ENSG00000188219	ENST00000356920	T	0.79247	-1.25	0.993	-0.217	0.13149	.	.	.	.	.	T	0.67325	0.2881	M	0.76838	2.35	0.25569	N	0.986913	P	0.42584	0.784	B	0.28784	0.094	T	0.61667	-0.7016	9	0.87932	D	0	.	2.8547	0.05569	0.6759:0.0:0.3241:0.0	.	647	Q6S8J3	POTEE_HUMAN	D	647	ENSP00000439189:E647D	ENSP00000439189:E647D	E	+	3	2	AC131180.1	131737439	0.810000	0.29049	0.005000	0.12908	0.012000	0.07955	1.495000	0.35627	-0.075000	0.12798	0.155000	0.16302	GAA	.		0.353	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
PPAPDC1A	196051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	122334705	122334705	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:122334705G>A	ENST00000398250.1	+	6	860	c.508G>A	c.(508-510)Gag>Aag	p.E170K	PPAPDC1A_ENST00000496437.1_3'UTR|PPAPDC1A_ENST00000369073.3_Missense_Mutation_p.E160K|PPAPDC1A_ENST00000439221.1_Missense_Mutation_p.E107K|PPAPDC1A_ENST00000541332.1_Missense_Mutation_p.E170K|PPAPDC1A_ENST00000398248.1_Intron	NM_001030059.1	NP_001025230.1	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1A	170					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phospholipid dephosphorylation (GO:0046839)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)	p.E170K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	20		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		CTGCTTCACCGAGAGTGGGCG	0.577																																					p.E170K		.											.	PPAPDC1A	135	1	Substitution - Missense(1)	large_intestine(1)	c.G508A						.																																			SO:0001583	missense	196051	exon6			TTCACCGAGAGTG	AK098668	CCDS41573.1	10q26.13	2008-02-05		2005-07-15	ENSG00000203805	ENSG00000203805			23531	protein-coding gene	gene with protein product			"""phosphatidic acid phosphatase type 2 domain containing 1"""	PPAPDC1			Standard	XM_005269592		Approved		uc001lev.1	Q5VZY2	OTTHUMG00000019168	ENST00000398250.1:c.508G>A	10.37:g.122334705G>A	ENSP00000381302:p.Glu170Lys	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	6.0	NM_001030059	A2RU82|Q08EQ2|Q0IIP2|Q495B4|Q5VZY1	Missense_Mutation	SNP	ENST00000398250.1	37	CCDS41573.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572924	0.45798	.	.	ENSG00000203805	ENST00000439221;ENST00000398250;ENST00000427079;ENST00000541332;ENST00000369073	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.52	5.52	0.82312	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.092240	0.64402	D	0.000001	T	0.28732	0.0712	N	0.24115	0.695	0.80722	D	1	P;D;B	0.57899	0.676;0.981;0.023	B;B;B	0.39738	0.294;0.308;0.005	T	0.09840	-1.0656	10	0.08179	T	0.78	-6.7691	19.441	0.94821	0.0:0.0:1.0:0.0	.	170;107;170	B7Z3R3;Q5VZY2-2;Q5VZY2	.;.;PPC1A_HUMAN	K	107;170;170;170;160	ENSP00000381302:E170K;ENSP00000407979:E170K;ENSP00000440493:E170K;ENSP00000358069:E160K	ENSP00000358069:E160K	E	+	1	0	PPAPDC1A	122324695	1.000000	0.71417	0.967000	0.41034	0.997000	0.91878	9.785000	0.99042	2.603000	0.88011	0.655000	0.94253	GAG	.		0.577	PPAPDC1A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_113641	
PPP1R15B	84919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204380351	204380351	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:204380351C>A	ENST00000367188.4	-	1	568	c.189G>T	c.(187-189)tgG>tgT	p.W63C	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	63					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GCAGTTTCGTCCAGTAACTGA	0.577																																					p.W63C		.											.	PPP1R15B	652	0			c.G189T						.						66.0	71.0	69.0					1																	204380351		2203	4300	6503	SO:0001583	missense	84919	exon1			TTTCGTCCAGTAA	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.189G>T	1.37:g.204380351C>A	ENSP00000356156:p.Trp63Cys	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	10.0	NM_032833	Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	37	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893365	0.52121	.	.	ENSG00000158615	ENST00000367188	T	0.28666	1.6	5.22	5.22	0.72569	Protein phosphatase 1, regulatory subunit 15B, N-terminal (1);	0.095508	0.45867	D	0.000324	T	0.51890	0.1701	M	0.61703	1.905	0.58432	D	0.999995	D	0.76494	0.999	D	0.69824	0.966	T	0.53194	-0.8473	10	0.87932	D	0	-2.1296	14.6287	0.68640	0.0:1.0:0.0:0.0	.	63	Q5SWA1	PR15B_HUMAN	C	63	ENSP00000356156:W63C	ENSP00000356156:W63C	W	-	3	0	PPP1R15B	202646974	0.986000	0.35501	0.669000	0.29828	0.131000	0.20780	3.691000	0.54720	2.586000	0.87340	0.655000	0.94253	TGG	.		0.577	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
PPP2R5D	5528	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42975740	42975740	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:42975740T>C	ENST00000485511.1	+	7	973	c.794T>C	c.(793-795)aTc>aCc	p.I265T	PPP2R5D_ENST00000461010.1_Missense_Mutation_p.I159T|PPP2R5D_ENST00000472118.1_Missense_Mutation_p.I257T|PPP2R5D_ENST00000394110.3_Missense_Mutation_p.I233T	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	265					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TTGCATCGCATCTATGGCAAG	0.532																																					p.I265T	Melanoma(63;587 1613 29742 31770)	.											.	PPP2R5D	1082	0			c.T794C						.						120.0	115.0	117.0					6																	42975740		2203	4300	6503	SO:0001583	missense	5528	exon7			ATCGCATCTATGG	L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.794T>C	6.37:g.42975740T>C	ENSP00000417963:p.Ile265Thr	Somatic	116.0	1.0		WXS	Illumina HiSeq	Phase_I	62.0	15.0	NM_006245	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Missense_Mutation	SNP	ENST00000485511.1	37	CCDS4878.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384655	0.82792	.	.	ENSG00000112640	ENST00000485511;ENST00000394110;ENST00000472118;ENST00000541610;ENST00000461010	T;T;T;T	0.58506	0.33;0.35;0.36;0.41	5.84	5.84	0.93424	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82563	0.5064	H	0.97214	3.96	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.91635	0.996;0.985;0.999;0.991	D	0.89049	0.3454	10	0.87932	D	0	-24.76	16.2302	0.82332	0.0:0.0:0.0:1.0	.	159;265;265;233	Q14738-3;F5GYS1;Q14738;Q14738-2	.;.;2A5D_HUMAN;.	T	265;233;257;265;159	ENSP00000417963:I265T;ENSP00000377669:I233T;ENSP00000420550:I257T;ENSP00000420674:I159T	ENSP00000377669:I233T	I	+	2	0	PPP2R5D	43083718	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.228000	0.72767	0.533000	0.62120	ATC	.		0.532	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040573.3	NM_006245	
PPP6R2	9701	ucsc.edu;bcgsc.ca	37	22	50876613	50876613	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr22:50876613C>A	ENST00000216061.5	+	19	2220	c.1850C>A	c.(1849-1851)gCt>gAt	p.A617D	PPP6R2_ENST00000395741.3_Missense_Mutation_p.A591D|PPP6R2_ENST00000359139.3_Missense_Mutation_p.A590D|PPP6R2_ENST00000395744.3_Missense_Mutation_p.A590D			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	617						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						CCCAGCGCAGCTCTGTTTGAG	0.602																																					p.A617D		.											.	PPP6R2	92	0			c.C1850A						.						100.0	102.0	101.0					22																	50876613		2203	4300	6503	SO:0001583	missense	9701	exon18			GCGCAGCTCTGTT	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1850C>A	22.37:g.50876613C>A	ENSP00000216061:p.Ala617Asp	Somatic	92.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001242898	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	37		.	.	.	.	.	.	.	.	.	.	C	26.5	4.739203	0.89573	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.35973	1.28;1.29;1.29;1.37	5.38	5.38	0.77491	.	0.103999	0.64402	D	0.000004	T	0.54498	0.1862	M	0.62723	1.935	0.58432	D	0.999999	D;D;D;P;D;P	0.69078	0.973;0.995;0.997;0.843;0.995;0.659	P;P;P;P;D;P	0.65323	0.729;0.904;0.86;0.596;0.934;0.477	T	0.44283	-0.9338	10	0.18710	T	0.47	-14.409	17.8958	0.88887	0.0:1.0:0.0:0.0	.	149;617;617;591;590;590	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	D	590;591;590;617	ENSP00000352051:A590D;ENSP00000379090:A591D;ENSP00000379093:A590D;ENSP00000216061:A617D	ENSP00000216061:A617D	A	+	2	0	PPP6R2	49223479	1.000000	0.71417	0.965000	0.40720	0.923000	0.55619	4.679000	0.61649	2.535000	0.85469	0.491000	0.48974	GCT	.		0.602	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
PSMD1	5707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	231936937	231936937	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:231936937G>T	ENST00000308696.6	+	7	851	c.689G>T	c.(688-690)aGt>aTt	p.S230I	PSMD1_ENST00000409643.1_Missense_Mutation_p.S230I|PSMD1_ENST00000373635.4_Missense_Mutation_p.S230I	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	230					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CAGGCTGTGAGTGATATCTTA	0.343																																					p.S230I		.											.	PSMD1	92	0			c.G689T						.						173.0	167.0	169.0					2																	231936937		2203	4300	6503	SO:0001583	missense	5707	exon7			CTGTGAGTGATAT	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.689G>T	2.37:g.231936937G>T	ENSP00000309474:p.Ser230Ile	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	11.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	37	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065328	0.76187	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	.	.	.	5.98	5.98	0.97165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65863	0.2732	L	0.46819	1.47	0.80722	D	1	B;P	0.35944	0.049;0.529	B;B	0.42386	0.01;0.386	T	0.64537	-0.6384	9	0.54805	T	0.06	-7.1736	20.4581	0.99154	0.0:0.0:1.0:0.0	.	230;230	Q99460;Q99460-2	PSMD1_HUMAN;.	I	230	.	ENSP00000309474:S230I	S	+	2	0	PSMD1	231645181	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.835000	0.97688	0.650000	0.86243	AGT	.		0.343	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
PSMD1	5707	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	231936939	231936939	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:231936939G>T	ENST00000308696.6	+	7	853	c.691G>T	c.(691-693)Gat>Tat	p.D231Y	PSMD1_ENST00000409643.1_Missense_Mutation_p.D231Y|PSMD1_ENST00000373635.4_Missense_Mutation_p.D231Y	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	231					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GGCTGTGAGTGATATCTTAGA	0.343																																					p.D231Y		.											.	PSMD1	92	0			c.G691T						.						177.0	170.0	172.0					2																	231936939		2203	4300	6503	SO:0001583	missense	5707	exon7			GTGAGTGATATCT	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.691G>T	2.37:g.231936939G>T	ENSP00000309474:p.Asp231Tyr	Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	12.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	37	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918713	0.73098	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	.	.	.	5.98	5.98	0.97165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78947	0.4364	M	0.69823	2.125	0.80722	D	1	B;D	0.67145	0.052;0.996	B;D	0.64877	0.04;0.93	T	0.78710	-0.2098	9	0.62326	D	0.03	-8.8292	20.4581	0.99154	0.0:0.0:1.0:0.0	.	231;231	Q99460;Q99460-2	PSMD1_HUMAN;.	Y	231	.	ENSP00000309474:D231Y	D	+	1	0	PSMD1	231645183	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.835000	0.97688	0.650000	0.86243	GAT	.		0.343	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
PSMD4	5710	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151237944	151237944	+	Silent	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:151237944G>T	ENST00000368884.3	+	6	593	c.513G>T	c.(511-513)gtG>gtT	p.V171V	PSMD4_ENST00000368881.4_Silent_p.V171V	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	171	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTCATCTGGTGACAGTGCCTC	0.522																																					p.V171V		.											.	PSMD4	90	0			c.G513T						.						106.0	96.0	99.0					1																	151237944		2203	4298	6501	SO:0001819	synonymous_variant	5710	exon6			TCTGGTGACAGTG	U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.513G>T	1.37:g.151237944G>T		Somatic	214.0	1.0		WXS	Illumina HiSeq	Phase_I	104.0	35.0	NM_002810	D3DV16|Q5VWC5|Q9NS92	Silent	SNP	ENST00000368884.3	37	CCDS991.1																																																																																			.		0.522	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034409.3	NM_002810	
RAB39A	54734	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	107799382	107799382	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:107799382C>A	ENST00000320578.2	+	1	154	c.88C>A	c.(88-90)Cag>Aag	p.Q30K	SLC35F2_ENST00000525071.1_5'Flank|SLC35F2_ENST00000429869.1_5'Flank	NM_017516.1	NP_059986.1	Q14964	RB39A_HUMAN	RAB39A, member RAS oncogene family	30					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)										CCGCTTCACCCAGGGCCGCTT	0.672																																					p.Q30K		.											.	.	.	0			c.C88A						.						44.0	42.0	43.0					11																	107799382		2201	4298	6499	SO:0001583	missense	54734	exon1			TTCACCCAGGGCC	X99962	CCDS8338.1	11q22.3	2011-11-22	2011-11-22	2011-11-22	ENSG00000179331	ENSG00000179331		"""RAB, member RAS oncogene"""	16521	protein-coding gene	gene with protein product	"""rab-related GTP-binding protein"""		"""RAB39, member RAS oncogene family"""	RAB39		9119394	Standard	NM_017516		Approved		uc001pjt.3	Q14964	OTTHUMG00000166367	ENST00000320578.2:c.88C>A	11.37:g.107799382C>A	ENSP00000322594:p.Gln30Lys	Somatic	75.0	1.0		WXS	Illumina HiSeq	Phase_I	45.0	12.0	NM_017516	A8KAA4|Q8N6W2	Missense_Mutation	SNP	ENST00000320578.2	37	CCDS8338.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.738538	0.69304	.	.	ENSG00000179331	ENST00000320578	T	0.75938	-0.98	4.61	4.61	0.57282	Small GTP-binding protein domain (1);	0.000000	0.47455	D	0.000222	T	0.48095	0.1481	N	0.01464	-0.85	0.40112	D	0.976505	B	0.23490	0.086	B	0.22152	0.038	T	0.55101	-0.8193	10	0.72032	D	0.01	.	11.6421	0.51240	0.0:0.7051:0.2949:0.0	.	30	Q14964	RB39A_HUMAN	K	30	ENSP00000322594:Q30K	ENSP00000322594:Q30K	Q	+	1	0	RAB39	107304592	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.621000	0.74228	2.548000	0.85928	0.555000	0.69702	CAG	.		0.672	RAB39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389423.1	NM_017516	
RAD23A	5886	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	13056794	13056794	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:13056794A>C	ENST00000586534.1	+	1	93	c.32A>C	c.(31-33)cAg>cCg	p.Q11P	RAD23A_ENST00000592268.1_Missense_Mutation_p.Q11P|RAD23A_ENST00000541222.1_5'UTR|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000316856.3_Missense_Mutation_p.Q11P			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	11	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						AAAACGCTGCAGCAGCAGACC	0.711								Nucleotide excision repair (NER)																													p.Q11P		.											.	RAD23A	227	0			c.A32C						.						19.0	22.0	21.0					19																	13056794		2188	4282	6470	SO:0001583	missense	5886	exon1			CGCTGCAGCAGCA		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.32A>C	19.37:g.13056794A>C	ENSP00000467024:p.Gln11Pro	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	12.0	NM_005053	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	37	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.574783	0.86542	.	.	ENSG00000179262	ENST00000316856	T	0.74421	-0.84	4.8	4.8	0.61643	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.85575	0.5728	M	0.87328	2.875	0.80722	D	1	B;D;B	0.56287	0.097;0.975;0.356	B;P;P	0.61940	0.204;0.896;0.478	D	0.87677	0.2545	10	0.66056	D	0.02	-15.5005	11.8748	0.52541	1.0:0.0:0.0:0.0	.	11;28;11	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	P	11	ENSP00000321365:Q11P	ENSP00000321365:Q11P	Q	+	2	0	RAD23A	12917794	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.613000	0.67688	1.806000	0.52798	0.533000	0.62120	CAG	.		0.711	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	
RAD23A	5886	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	13056800	13056800	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:13056800A>C	ENST00000586534.1	+	1	99	c.38A>C	c.(37-39)cAg>cCg	p.Q13P	RAD23A_ENST00000592268.1_Missense_Mutation_p.Q13P|RAD23A_ENST00000541222.1_5'UTR|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000316856.3_Missense_Mutation_p.Q13P			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	13	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						CTGCAGCAGCAGACCTTCAAG	0.726								Nucleotide excision repair (NER)																													p.Q13P		.											.	RAD23A	227	0			c.A38C						.						19.0	21.0	21.0					19																	13056800		2187	4282	6469	SO:0001583	missense	5886	exon1			AGCAGCAGACCTT		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.38A>C	19.37:g.13056800A>C	ENSP00000467024:p.Gln13Pro	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	11.0	NM_005053	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	37	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	a	19.23	3.788158	0.70337	.	.	ENSG00000179262	ENST00000316856	T	0.73789	-0.78	4.77	4.77	0.60923	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.64402	D	0.000001	D	0.88658	0.6496	M	0.93678	3.445	0.80722	D	1	B;D;B	0.53619	0.058;0.961;0.24	B;D;B	0.77557	0.156;0.99;0.305	D	0.90490	0.4466	10	0.59425	D	0.04	-12.34	11.8288	0.52282	1.0:0.0:0.0:0.0	.	13;30;13	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	P	13	ENSP00000321365:Q13P	ENSP00000321365:Q13P	Q	+	2	0	RAD23A	12917800	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.602000	0.67612	1.795000	0.52594	0.520000	0.50463	CAG	.		0.726	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	
RALGAPA1	253959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	36041819	36041819	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:36041819T>C	ENST00000389698.3	-	37	6187	c.5797A>G	c.(5797-5799)Ata>Gta	p.I1933V	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.I1946V|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.I1980V|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.I1933V	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1933	Minimal domain that binds to TCF3/E12. {ECO:0000250}.|Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATTGGATATATTACAATAAGG	0.333																																					p.I1933V		.											.	RALGAPA1	138	0			c.A5797G						.						97.0	99.0	98.0					14																	36041819		2203	4298	6501	SO:0001583	missense	253959	exon37			GATATATTACAAT	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.5797A>G	14.37:g.36041819T>C	ENSP00000374348:p.Ile1933Val	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	11.0	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.257074	0.80246	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	D;D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06;-3.06	5.15	5.15	0.70609	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.94241	0.8151	L	0.49640	1.575	0.53005	D	0.999965	D;D;P;P	0.71674	0.958;0.998;0.926;0.846	D;D;P;P	0.91635	0.966;0.999;0.879;0.759	D	0.93300	0.6676	10	0.33141	T	0.24	-15.3646	14.9932	0.71406	0.0:0.0:0.0:1.0	.	1980;1946;1933;1933	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	V	1933;1933;1933;1980;571;1946;1980	ENSP00000374348:I1933V;ENSP00000302647:I1933V;ENSP00000258840:I1980V;ENSP00000451133:I571V;ENSP00000371803:I1946V;ENSP00000451877:I1980V	ENSP00000258840:I1980V	I	-	1	0	RALGAPA1	35111570	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	1.947000	0.56498	0.377000	0.23210	ATA	.		0.333	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
RCOR3	55758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	211451497	211451497	+	Nonsense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:211451497C>G	ENST00000367005.4	+	5	522	c.381C>G	c.(379-381)taC>taG	p.Y127*	RCOR3_ENST00000452621.2_Nonsense_Mutation_p.Y185*|RCOR3_ENST00000419091.2_Nonsense_Mutation_p.Y185*|RCOR3_ENST00000367006.4_Nonsense_Mutation_p.Y185*	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	127	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		TAAAATATTACTATTCTTGGA	0.333																																					p.Y185X		.											.	RCOR3	91	0			c.C555G						.						75.0	77.0	77.0					1																	211451497		2203	4300	6503	SO:0001587	stop_gained	55758	exon6			ATATTACTATTCT	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.381C>G	1.37:g.211451497C>G	ENSP00000355972:p.Tyr127*	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	14.0	NM_001136223	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Nonsense_Mutation	SNP	ENST00000367005.4	37	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	C	34	5.381058	0.95945	.	.	ENSG00000117625	ENST00000533469;ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005	.	.	.	5.66	2.75	0.32379	.	0.055362	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.1984	11.2275	0.48892	0.0:0.7999:0.0:0.2001	.	.	.	.	X	127;185;185;185;127	.	ENSP00000355972:Y127X	Y	+	3	2	RCOR3	209518120	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.633000	0.46519	0.326000	0.23384	0.460000	0.39030	TAC	.		0.333	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
RNF145	153830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	158588365	158588365	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:158588365C>T	ENST00000424310.2	-	10	1894	c.1535G>A	c.(1534-1536)cGc>cAc	p.R512H	RNF145_ENST00000519865.1_Missense_Mutation_p.R512H|RNF145_ENST00000274542.2_Missense_Mutation_p.R540H|RNF145_ENST00000520638.1_Missense_Mutation_p.R526H|RNF145_ENST00000518284.1_5'UTR|RNF145_ENST00000521606.2_Missense_Mutation_p.R529H|RNF145_ENST00000518802.1_Missense_Mutation_p.R542H	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	512						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCATCCCTGCGGAGAAGAAA	0.448																																					p.R542H		.											.	RNF145	525	0			c.G1625A						.						46.0	45.0	46.0					5																	158588365		2203	4300	6503	SO:0001583	missense	153830	exon10			TCCCTGCGGAGAA	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.1535G>A	5.37:g.158588365C>T	ENSP00000409064:p.Arg512His	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	28.0	NM_001199380	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	37	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	C	36	5.603213	0.96614	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	D;D;D;D;D;D;D	0.82344	-1.6;-1.58;-1.58;-1.6;-1.6;-1.6;-1.6	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.91768	0.7396	M	0.79011	2.435	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.994;0.997;0.994;0.999	D	0.90729	0.4641	10	0.52906	T	0.07	-16.4831	20.6439	0.99570	0.0:1.0:0.0:0.0	.	529;526;542;512;540	B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;RN145_HUMAN;.	H	540;512;512;528;529;542;512;526	ENSP00000274542:R540H;ENSP00000430397:R512H;ENSP00000409064:R512H;ENSP00000430753:R528H;ENSP00000445115:R529H;ENSP00000430955:R542H;ENSP00000429071:R526H	ENSP00000274542:R540H	R	-	2	0	RNF145	158520943	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.711000	0.84669	2.890000	0.99128	0.650000	0.86243	CGC	.		0.448	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
RGS14	10636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176793252	176793252	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:176793252A>T	ENST00000408923.3	+	3	330	c.142A>T	c.(142-144)Agt>Tgt	p.S48C		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	48					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGCCTCCCCAGTGGTCCCAG	0.692																																					p.S48C	NSCLC(47;353 1896 28036)	.											.	RGS14	226	0			c.A142T						.						11.0	18.0	16.0					5																	176793252		1959	4141	6100	SO:0001583	missense	10636	exon3			CTCCCCAGTGGTC	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.142A>T	5.37:g.176793252A>T	ENSP00000386229:p.Ser48Cys	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	10.0	NM_006480	O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	ENST00000408923.3	37	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.601775	0.66445	.	.	ENSG00000169220	ENST00000408923;ENST00000336477	T	0.42900	0.96	4.44	3.18	0.36537	.	0.137147	0.50627	D	0.000103	T	0.39600	0.1084	L	0.57536	1.79	0.35940	D	0.833173	P	0.43885	0.82	B	0.44163	0.443	T	0.53892	-0.8374	10	0.72032	D	0.01	-7.7575	6.5417	0.22385	0.6343:0.2816:0.0841:0.0	.	48	O43566	RGS14_HUMAN	C	48	ENSP00000386229:S48C	ENSP00000336864:S48C	S	+	1	0	RGS14	176725858	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.821000	0.48065	1.645000	0.50612	0.363000	0.22086	AGT	.		0.692	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480	
RUNX1T1	862	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	93023275	93023275	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:93023275T>A	ENST00000523629.1	-	5	967	c.513A>T	c.(511-513)gaA>gaT	p.E171D	RUNX1T1_ENST00000521553.1_Missense_Mutation_p.E134D|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.E134D|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.E182D|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.E171D|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.E144D|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.E134D|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.E134D|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.E144D	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	171	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			AGTTAGTAGCTTCTTGCAGTT	0.343																																					p.E230D		.											.	RUNX1T1	1196	0			c.A690T						.						137.0	134.0	135.0					8																	93023275		2203	4300	6503	SO:0001583	missense	862	exon5			AGTAGCTTCTTGC	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.513A>T	8.37:g.93023275T>A	ENSP00000428543:p.Glu171Asp	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	6.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.037425	0.75617	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992;ENST00000521054	T;T;T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.87	5.87	0.94306	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.51907	0.1702	L	0.34521	1.04	0.80722	D	1	B;B;B;B;B	0.20261	0.011;0.043;0.025;0.043;0.02	B;B;B;B;B	0.42522	0.052;0.39;0.217;0.16;0.104	T	0.51957	-0.8639	10	0.46703	T	0.11	-14.2221	16.5764	0.84681	0.0:0.0:0.0:1.0	.	182;182;144;171;144	E7EPN4;B7Z4P4;B2R6I9;Q06455;Q06455-2	.;.;.;MTG8_HUMAN;.	D	171;144;171;134;134;134;182;144;134;171;134	ENSP00000428543:E171D;ENSP00000379520:E144D;ENSP00000265814:E171D;ENSP00000353504:E134D;ENSP00000390137:E134D;ENSP00000428742:E134D;ENSP00000402257:E182D;ENSP00000430728:E144D;ENSP00000429728:E134D;ENSP00000431094:E171D;ENSP00000427763:E134D	ENSP00000265814:E171D	E	-	3	2	RUNX1T1	93092451	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.914000	0.69964	2.371000	0.80710	0.533000	0.62120	GAA	.		0.343	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
SCN7A	6332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	167319005	167319005	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:167319005C>G	ENST00000409855.1	-	9	1103	c.977G>C	c.(976-978)gGc>gCc	p.G326A		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	326					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AGGATTTATGCCAGCTTTTAC	0.378																																					p.G326A		.											.	SCN7A	67	0			c.G977C						.						75.0	67.0	69.0					2																	167319005		1847	4101	5948	SO:0001583	missense	6332	exon9			TTTATGCCAGCTT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.977G>C	2.37:g.167319005C>G	ENSP00000386796:p.Gly326Ala	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	26.0	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717331	0.89205	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98617	-5.03;-5.03;-5.03	4.43	4.43	0.53597	Ion transport (1);	0.000000	0.49916	D	0.000127	D	0.98754	0.9581	M	0.83692	2.655	0.48236	D	0.999613	D	0.53151	0.958	P	0.54431	0.752	D	0.99671	1.0996	10	0.87932	D	0	.	15.978	0.80086	0.0:1.0:0.0:0.0	.	326	Q01118	SCN7A_HUMAN	A	326	ENSP00000386796:G326A;ENSP00000413699:G326A;ENSP00000403846:G326A	ENSP00000259060:G326A	G	-	2	0	SCN7A	167027251	0.999000	0.42202	0.927000	0.36925	0.995000	0.86356	4.835000	0.62781	2.150000	0.67090	0.585000	0.79938	GGC	.		0.378	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SEC24A	10802	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	134039534	134039535	+	Frame_Shift_Ins	INS	-	-	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:134039534_134039535insT	ENST00000398844.2	+	16	2640_2641	c.2352_2353insT	c.(2353-2355)tatfs	p.Y785fs	RNU6-1164P_ENST00000364428.1_RNA	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	785					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGACGCTGGGTATGCAGTACA	0.416																																					p.G784fs		.											.	SEC24A	68	0			c.2352_2353insT						.																																			SO:0001589	frameshift_variant	10802	exon16			CGCTGGGTATGCA	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.2353dupT	5.37:g.134039535_134039535dupT	ENSP00000381823:p.Tyr785fs	Somatic	259.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	59.0	NM_021982	A8MVW3|Q8WUV2|Q96GP7	Frame_Shift_Ins	INS	ENST00000398844.2	37	CCDS43363.1																																																																																			.		0.416	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
SEC24A	10802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	133997259	133997259	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:133997259A>G	ENST00000398844.2	+	2	836	c.548A>G	c.(547-549)aAt>aGt	p.N183S	SEC24A_ENST00000322887.4_Missense_Mutation_p.N183S	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	183	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCACTTCAAAATAGCTTCATA	0.323																																					p.N183S		.											.	SEC24A	68	0			c.A548G						.						62.0	57.0	58.0					5																	133997259		1848	4091	5939	SO:0001583	missense	10802	exon2			TTCAAAATAGCTT	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.548A>G	5.37:g.133997259A>G	ENSP00000381823:p.Asn183Ser	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	13.0	NM_001252231	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	37	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	A	11.47	1.647317	0.29246	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	D;D	0.96967	-4.19;-4.19	5.55	4.38	0.52667	.	1.361580	0.04318	N	0.350250	D	0.94768	0.8311	L	0.55481	1.735	0.25787	N	0.984663	B	0.26400	0.148	B	0.28385	0.089	T	0.81609	-0.0855	10	0.09338	T	0.73	-2.9968	12.4654	0.55755	0.8549:0.1451:0.0:0.0	.	183	O95486	SC24A_HUMAN	S	183	ENSP00000381823:N183S;ENSP00000321749:N183S	ENSP00000321749:N183S	N	+	2	0	SEC24A	134025158	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	3.240000	0.51368	0.914000	0.36822	0.533000	0.62120	AAT	.		0.323	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47098371	47098371	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:47098371T>C	ENST00000409792.3	-	15	6945	c.6903A>G	c.(6901-6903)acA>acG	p.T2301T		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2301	Gln-rich.|Low charge region.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTGTTGGACATGTCTGTCCTT	0.398			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.T2301T		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.A6903G						.						119.0	114.0	116.0					3																	47098371		2203	4300	6503	SO:0001819	synonymous_variant	29072	exon15			TGGACATGTCTGT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6903A>G	3.37:g.47098371T>C		Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	31.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Silent	SNP	ENST00000409792.3	37	CCDS2749.2																																																																																			.		0.398	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
SLC15A2	6565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121641941	121641941	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:121641941C>A	ENST00000489711.1	+	10	1310	c.922C>A	c.(922-924)Cca>Aca	p.P308T	AC072031.1_ENST00000581491.1_RNA|SLC15A2_ENST00000295605.2_Missense_Mutation_p.P277T	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	308					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CCTTTATATCCCATTGCCCAT	0.453																																					p.P308T		.											.	SLC15A2	91	0			c.C922A						.						163.0	168.0	166.0					3																	121641941		2203	4300	6503	SO:0001583	missense	6565	exon10			TATATCCCATTGC	BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.922C>A	3.37:g.121641941C>A	ENSP00000417085:p.Pro308Thr	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	19.0	NM_021082	A8K1A5|B4E2A7	Missense_Mutation	SNP	ENST00000489711.1	37	CCDS3007.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828034	0.90955	.	.	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605	T;T	0.56941	0.43;0.43	5.86	5.86	0.93980	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.72898	0.3518	M	0.73372	2.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.74481	-0.3651	10	0.87932	D	0	-10.4065	17.6924	0.88272	0.0:1.0:0.0:0.0	.	277;308	B4E2A7;Q16348	.;S15A2_HUMAN	T	308;270;277	ENSP00000417085:P308T;ENSP00000295605:P277T	ENSP00000295605:P277T	P	+	1	0	SLC15A2	123124631	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.278000	0.78587	2.781000	0.95711	0.650000	0.86243	CCA	.		0.453	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355239.1	NM_021082	
SMARCD2	6603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61914891	61914891	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:61914891C>T	ENST00000448276.2	-	2	576	c.311G>A	c.(310-312)cGa>cAa	p.R104Q	SMARCD2_ENST00000323347.10_Missense_Mutation_p.R56Q|SMARCD2_ENST00000225742.9_Missense_Mutation_p.R29Q|RN7SL805P_ENST00000581353.1_RNA	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	104	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)	p.R48L(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						CATGCCAGGTCGAAGCGGAGC	0.657																																					p.R104Q		.											.	SMARCD2	227	1	Substitution - Missense(1)	central_nervous_system(1)	c.G311A						.						44.0	53.0	50.0					17																	61914891		1995	4159	6154	SO:0001583	missense	6603	exon2			CCAGGTCGAAGCG	U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.311G>A	17.37:g.61914891C>T	ENSP00000392617:p.Arg104Gln	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	17.0	NM_001098426	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	ENST00000448276.2	37	CCDS45756.1	.	.	.	.	.	.	.	.	.	.	.	18.48	3.632781	0.67015	.	.	ENSG00000108604	ENST00000448276;ENST00000450364;ENST00000323347	T;T	0.46451	0.87;0.91	5.17	5.17	0.71159	.	0.059356	0.64402	D	0.000002	T	0.57592	0.2064	L	0.46741	1.465	0.80722	D	1	D;D;D	0.71674	0.998;0.995;0.995	D;P;P	0.72982	0.979;0.623;0.743	T	0.55872	-0.8072	10	0.51188	T	0.08	0.9492	16.2004	0.82067	0.0:1.0:0.0:0.0	.	56;67;104	Q92925-3;B9EGA3;Q92925	.;.;SMRD2_HUMAN	Q	104;67;56	ENSP00000392617:R104Q;ENSP00000318451:R56Q	ENSP00000318451:R56Q	R	-	2	0	SMARCD2	59268623	0.990000	0.36364	1.000000	0.80357	0.938000	0.57974	6.846000	0.75399	2.702000	0.92279	0.491000	0.48974	CGA	.		0.657	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444544.1	NM_001098426	
SNW1	22938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	78198864	78198864	+	Silent	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:78198864G>A	ENST00000261531.7	-	9	917	c.855C>T	c.(853-855)gcC>gcT	p.A285A	SNW1_ENST00000555761.1_Silent_p.A285A|SNW1_ENST00000554775.1_Silent_p.A123A|SLIRP_ENST00000557431.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	285	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CTGCCAATTTGGCGAAATTTT	0.383																																					p.A285A		.											.	SNW1	187	0			c.C855T						.						118.0	111.0	113.0					14																	78198864		2203	4300	6503	SO:0001819	synonymous_variant	22938	exon9			CAATTTGGCGAAA	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.855C>T	14.37:g.78198864G>A		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	17.0	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Silent	SNP	ENST00000261531.7	37	CCDS9867.1																																																																																			.		0.383	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
SOWAHB	345079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77817982	77817982	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:77817982C>G	ENST00000334306.2	-	1	1020	c.1021G>C	c.(1021-1023)Gaa>Caa	p.E341Q		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	341																	GAGCCGGGTTCCAAGGGCAGC	0.642																																					p.E341Q		.											.	.	.	0			c.G1021C						.						42.0	52.0	48.0					4																	77817982		2203	4300	6503	SO:0001583	missense	345079	exon1			CGGGTTCCAAGGG		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1021G>C	4.37:g.77817982C>G	ENSP00000334879:p.Glu341Gln	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	8.0	NM_001029870	B2RP29	Missense_Mutation	SNP	ENST00000334306.2	37	CCDS34017.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929822	0.52759	.	.	ENSG00000186212	ENST00000334306	T	0.07216	3.21	3.83	2.87	0.33458	.	.	.	.	.	T	0.04907	0.0132	L	0.27053	0.805	0.09310	N	1	P	0.37466	0.596	B	0.29267	0.1	T	0.32745	-0.9895	9	0.30078	T	0.28	-3.6903	6.8808	0.24173	0.0:0.7959:0.0:0.2041	.	341	A6NEL2	ANR56_HUMAN	Q	341	ENSP00000334879:E341Q	ENSP00000334879:E341Q	E	-	1	0	ANKRD56	78037006	0.000000	0.05858	0.006000	0.13384	0.008000	0.06430	0.970000	0.29383	1.968000	0.57251	0.491000	0.48974	GAA	.		0.642	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220333678	220333678	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:220333678C>T	ENST00000312358.7	+	12	3531	c.3399C>T	c.(3397-3399)ctC>ctT	p.L1133L	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1133	Ig-like 5.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ACGAGGGGCTCTATGCGGTCA	0.647																																					p.L1133L		.											.	SPEG	383	0			c.C3399T						.						43.0	53.0	49.0					2																	220333678		2088	4218	6306	SO:0001819	synonymous_variant	10290	exon12			GGGGCTCTATGCG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3399C>T	2.37:g.220333678C>T		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	14.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	CCDS42824.1																																																																																			.		0.647	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
SPIC	121599	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101873452	101873452	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:101873452T>C	ENST00000551346.1	+	4	349	c.190T>C	c.(190-192)Tat>Cat	p.Y64H	SPIC_ENST00000299272.5_Missense_Mutation_p.Y64H			Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	64					blastocyst development (GO:0001824)|cell differentiation (GO:0030154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	22						GGAGCCTGTCTATAATTGGAG	0.398																																					.		.											.	SPIC	227	0			.						.						67.0	62.0	63.0					12																	101873452		2203	4300	6503	SO:0001583	missense	121599	.			CCTGTCTATAATT	AF518404	CCDS9082.1	12q23	2005-10-18				ENSG00000166211			29549	protein-coding gene	gene with protein product		612568				12459275	Standard	NM_152323		Approved	MGC40611, SPI-C	uc021rcq.1	Q8N5J4	OTTHUMG00000170273	ENST00000551346.1:c.190T>C	12.37:g.101873452T>C	ENSP00000448580:p.Tyr64His	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	14.0	.		Missense_Mutation	SNP	ENST00000551346.1	37	CCDS9082.1	.	.	.	.	.	.	.	.	.	.	T	6.169	0.399352	0.11696	.	.	ENSG00000166211	ENST00000551346;ENST00000299272	T;T	0.25579	1.79;1.79	5.02	2.55	0.30701	.	0.444635	0.25030	N	0.033682	T	0.20861	0.0502	M	0.61703	1.905	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.24584	-1.0156	10	0.29301	T	0.29	-6.2112	3.4701	0.07563	0.1647:0.1891:0.0:0.6463	.	64	Q8N5J4	SPIC_HUMAN	H	64	ENSP00000448580:Y64H;ENSP00000299272:Y64H	ENSP00000299272:Y64H	Y	+	1	0	SPIC	100397583	0.007000	0.16637	0.001000	0.08648	0.623000	0.37688	1.676000	0.37565	0.226000	0.20979	0.454000	0.30748	TAT	.		0.398	SPIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408260.1	NM_152323	
TAAR5	9038	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	132910065	132910065	+	Frame_Shift_Del	DEL	A	A	-	rs138145315		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:132910065delA	ENST00000258034.2	-	1	812	c.761delT	c.(760-762)ctgfs	p.L254fs		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	254					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		AGCAATGCCCAGGGTCTTGGC	0.527																																					p.L254fs		.											.	TAAR5	91	0			c.761delT						.						64.0	65.0	65.0					6																	132910065		2203	4300	6503	SO:0001589	frameshift_variant	9038	exon1			ATGCCCAGGGTCT	AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.761delT	6.37:g.132910065delA	ENSP00000258034:p.Leu254fs	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	12.0	NM_003967	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Frame_Shift_Del	DEL	ENST00000258034.2	37	CCDS5156.1																																																																																			.		0.527	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042257.1	NM_003967	
TAOK3	51347	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	118636888	118636888	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:118636888T>C	ENST00000392533.3	-	13	1652	c.1162A>G	c.(1162-1164)Atc>Gtc	p.I388V	TAOK3_ENST00000419821.2_Missense_Mutation_p.I388V	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	388	Ser-rich.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGGAATTGATTGTGCTTTCG	0.498																																					p.I388V		.											.	TAOK3	933	0			c.A1162G						.						220.0	163.0	182.0					12																	118636888		2203	4300	6503	SO:0001583	missense	51347	exon13			AATTGATTGTGCT	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1162A>G	12.37:g.118636888T>C	ENSP00000376317:p.Ile388Val	Somatic	130.0	1.0		WXS	Illumina HiSeq	Phase_I	57.0	13.0	NM_016281	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Missense_Mutation	SNP	ENST00000392533.3	37	CCDS9188.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-2.002769	0.00431	.	.	ENSG00000135090	ENST00000419821;ENST00000392533;ENST00000359811	T;T	0.35605	1.3;1.3	5.19	-5.23	0.02798	.	0.771943	0.12164	N	0.493696	T	0.07908	0.0198	N	0.01576	-0.805	0.19300	N	0.999977	B	0.02656	0.0	B	0.01281	0.0	T	0.32241	-0.9914	10	0.02654	T	1	.	4.1697	0.10324	0.0852:0.4086:0.2562:0.25	.	388	Q9H2K8	TAOK3_HUMAN	V	388;388;8	ENSP00000416374:I388V;ENSP00000376317:I388V	ENSP00000352863:I8V	I	-	1	0	TAOK3	117121271	0.000000	0.05858	0.001000	0.08648	0.334000	0.28698	-0.948000	0.03897	-0.746000	0.04766	-0.334000	0.08254	ATC	.		0.498	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401456.2	NM_016281	
THEG	51298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	367179	367179	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:367179G>A	ENST00000342640.4	-	7	841	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	THEG_ENST00000346878.2_Missense_Mutation_p.R243W	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	267			R -> Q (in dbSNP:rs2278287).		cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)				NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGGATCCGCGAGCTGGGG	0.572																																					p.R267W		.											.	THEG	91	0			c.C799T						.						81.0	85.0	84.0					19																	367179		2203	4300	6503	SO:0001583	missense	51298	exon7			GGATCCGCGAGCT	AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.799C>T	19.37:g.367179G>A	ENSP00000340088:p.Arg267Trp	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	11.0	NM_016585	A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	37	CCDS12025.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323748	0.24080	.	.	ENSG00000105549	ENST00000342640;ENST00000346878	T;T	0.60548	0.18;0.18	3.32	2.28	0.28536	.	0.128748	0.34802	N	0.003662	T	0.71178	0.3309	M	0.79123	2.44	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59478	-0.7447	10	0.87932	D	0	-10.9218	7.1811	0.25774	0.0:0.0:0.664:0.336	.	243;267	Q9P2T0-2;Q9P2T0	.;THEG_HUMAN	W	267;243	ENSP00000340088:R267W;ENSP00000264820:R243W	ENSP00000340088:R267W	R	-	1	2	THEG	318179	0.928000	0.31464	0.007000	0.13788	0.004000	0.04260	1.648000	0.37271	0.882000	0.36016	0.555000	0.69702	CGG	.		0.572	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2		
TIMP4	7079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	12195209	12195209	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:12195209T>C	ENST00000287814.4	-	5	991	c.481A>G	c.(481-483)Acc>Gcc	p.T161A	SYN2_ENST00000432424.2_RNA	NM_003256.3	NP_003247.1	Q99727	TIMP4_HUMAN	TIMP metallopeptidase inhibitor 4	161					central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|ovulation cycle (GO:0042698)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)|sarcomere (GO:0030017)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11						TAGCAGGTGGTGATCTAGAGT	0.502																																					p.T161A	Melanoma(199;1446 2144 30617 38794 51714)	.											.	TIMP4	226	0			c.A481G						.						120.0	110.0	114.0					3																	12195209		2203	4300	6503	SO:0001583	missense	7079	exon5			AGGTGGTGATCTA	U76456	CCDS2608.1	3p25	2005-10-31	2005-08-08		ENSG00000157150	ENSG00000157150			11823	protein-coding gene	gene with protein product		601915	"""tissue inhibitor of metalloproteinase 4"""			8939999, 9693046	Standard	NM_003256		Approved		uc003bwo.3	Q99727	OTTHUMG00000129763	ENST00000287814.4:c.481A>G	3.37:g.12195209T>C	ENSP00000287814:p.Thr161Ala	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	12.0	NM_003256	B2R7K6	Missense_Mutation	SNP	ENST00000287814.4	37	CCDS2608.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.305396	0.40795	.	.	ENSG00000157150	ENST00000287814	D	0.93307	-3.2	4.88	4.88	0.63580	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.118425	0.56097	D	0.000025	D	0.89989	0.6875	M	0.62723	1.935	0.42982	D	0.994464	B	0.28584	0.216	B	0.28553	0.091	D	0.85526	0.1206	10	0.12103	T	0.63	.	10.5746	0.45219	0.144:0.0:0.0:0.856	.	161	Q99727	TIMP4_HUMAN	A	161	ENSP00000287814:T161A	ENSP00000287814:T161A	T	-	1	0	TIMP4	12170209	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.220000	0.42908	2.052000	0.61016	0.402000	0.26972	ACC	.		0.502	TIMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251978.1	NM_003256	
TMEM14C	51522	broad.mit.edu;ucsc.edu	37	6	10726176	10726176	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:10726176G>T	ENST00000541412.1	+	4	519	c.134G>T	c.(133-135)gGc>gTc	p.G45V	TMEM14C_ENST00000467415.1_3'UTR|TMEM14C_ENST00000229563.5_Missense_Mutation_p.G45V	NM_001165258.1	NP_001158730.1	Q9P0S9	TM14C_HUMAN	transmembrane protein 14C	45					heme biosynthetic process (GO:0006783)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				large_intestine(2)|lung(3)	5	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)	Epithelial(50;0.246)			CTGCTCTTTGGCAGTCTAGCC	0.542																																					p.G45V		.											.	TMEM14C	90	0			c.G134T						.						137.0	120.0	126.0					6																	10726176		2203	4300	6503	SO:0001583	missense	51522	exon4			TCTTTGGCAGTCT	AF151028	CCDS4514.1	6p24.1	2008-02-26	2004-04-16	2004-04-21	ENSG00000111843	ENSG00000111843			20952	protein-coding gene	gene with protein product		615318	"""chromosome 6 open reading frame 53"""	C6orf53		11042152, 12958361	Standard	NM_016462		Approved	HSPC194, bA421M1.6, NET26	uc021ylj.1	Q9P0S9	OTTHUMG00000014242	ENST00000541412.1:c.134G>T	6.37:g.10726176G>T	ENSP00000444561:p.Gly45Val	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	4.0	NM_001165258	Q5T4I6	Missense_Mutation	SNP	ENST00000541412.1	37	CCDS4514.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471913	0.43942	.	.	ENSG00000111843	ENST00000541412;ENST00000342277;ENST00000229563	T;T	0.68765	-0.35;-0.35	3.92	3.92	0.45320	.	0.102864	0.64402	D	0.000003	D	0.84511	0.5488	H	0.96269	3.795	0.80722	D	1	D;D	0.71674	0.992;0.998	D;D	0.76071	0.978;0.987	D	0.89871	0.4023	10	0.87932	D	0	.	14.6971	0.69129	0.0:0.0:1.0:0.0	.	45;45	Q53F27;Q9P0S9	.;TM14C_HUMAN	V	45	ENSP00000444561:G45V;ENSP00000229563:G45V	ENSP00000229563:G45V	G	+	2	0	TMEM14C	10834162	1.000000	0.71417	0.017000	0.16124	0.009000	0.06853	8.320000	0.89995	1.708000	0.51301	0.462000	0.41574	GGC	.		0.542	TMEM14C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039829.1	NM_016462	
TNC	3371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	117808755	117808755	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:117808755C>T	ENST00000350763.4	-	17	5470	c.5059G>A	c.(5059-5061)Gaa>Aaa	p.E1687K	TNC_ENST00000341037.4_Missense_Mutation_p.E1505K|TNC_ENST00000423613.2_Intron|TNC_ENST00000346706.3_Missense_Mutation_p.E1141K|TNC_ENST00000481475.1_5'Flank|TNC_ENST00000340094.3_Missense_Mutation_p.E1323K|TNC_ENST00000542877.1_Missense_Mutation_p.E1324K|TNC_ENST00000535648.1_Missense_Mutation_p.E1232K|TNC_ENST00000537320.1_Intron|TNC_ENST00000345230.3_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1687	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AGTTCAATTTCGTATTCAGTA	0.443																																					p.E1687K		.											.	TNC	517	0			c.G5059A						.						223.0	209.0	214.0					9																	117808755		2203	4300	6503	SO:0001583	missense	3371	exon17			CAATTTCGTATTC		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5059G>A	9.37:g.117808755C>T	ENSP00000265131:p.Glu1687Lys	Somatic	334.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	76.0	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.14|12.14	1.847912|1.847912	0.32699|0.32699	.|.	.|.	ENSG00000041982|ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877|ENST00000544972	T;T;T;T;T;T|.	0.58210|.	0.35;0.35;0.35;0.35;0.35;0.35|.	5.81|5.81	4.91|4.91	0.64330|0.64330	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.240480|.	0.41294|.	D|.	0.000913|.	T|T	0.48768|0.48768	0.1518|0.1518	N|N	0.21194|0.21194	0.64|0.64	0.80722|0.80722	D|D	1|1	B|.	0.31519|.	0.327|.	B|.	0.27380|.	0.079|.	T|T	0.42258|0.42258	-0.9462|-0.9462	10|5	0.06099|.	T|.	0.92|.	.|.	11.8032|11.8032	0.52139|0.52139	0.0:0.8588:0.0:0.1412|0.0:0.8588:0.0:0.1412	.|.	1687|.	P24821|.	TENA_HUMAN|.	K|Q	1323;1232;1141;1687;1505;1324|249	ENSP00000344400:E1323K;ENSP00000438152:E1232K;ENSP00000344555:E1141K;ENSP00000265131:E1687K;ENSP00000339553:E1505K;ENSP00000442242:E1324K|.	ENSP00000344400:E1323K|.	E|R	-|-	1|2	0|0	TNC|TNC	116848576|116848576	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.993000|0.993000	0.82548|0.82548	3.744000|3.744000	0.55112|0.55112	1.438000|1.438000	0.47492|0.47492	0.563000|0.563000	0.77884|0.77884	GAA|CGA	.		0.443	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
TNFRSF11B	4982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	119936661	119936661	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:119936661T>G	ENST00000297350.4	-	5	1536	c.1158A>C	c.(1156-1158)ttA>ttC	p.L386F		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	386					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			CTATCATTTCTAAAAATAACT	0.398																																					p.L386F		.											.	TNFRSF11B	651	0			c.A1158C						.						145.0	149.0	148.0					8																	119936661		2203	4300	6503	SO:0001583	missense	4982	exon5			CATTTCTAAAAAT	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.1158A>C	8.37:g.119936661T>G	ENSP00000297350:p.Leu386Phe	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	230.0	18.0	NM_002546	B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	ENST00000297350.4	37	CCDS6326.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741784	0.49151	.	.	ENSG00000164761	ENST00000297350	T	0.78364	-1.17	5.69	2.15	0.27550	.	0.347193	0.24366	N	0.039155	T	0.78013	0.4217	L	0.29908	0.895	0.37574	D	0.919541	D	0.89917	1.0	D	0.85130	0.997	T	0.75377	-0.3339	9	.	.	.	-5.9162	8.6482	0.34018	0.0:0.2149:0.0:0.7851	.	386	O00300	TR11B_HUMAN	F	386	ENSP00000297350:L386F	.	L	-	3	2	TNFRSF11B	120005842	0.914000	0.31030	0.971000	0.41717	0.720000	0.41350	-0.145000	0.10265	0.468000	0.27243	0.533000	0.62120	TTA	.		0.398	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1		
TNFRSF11B	4982	broad.mit.edu;bcgsc.ca	37	8	119936683	119936683	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:119936683T>G	ENST00000297350.4	-	5	1514	c.1136A>C	c.(1135-1137)aAa>aCa	p.K379T		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	379					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			CTGATACAATTTGTACATTGT	0.393																																					p.K379T		.											.	TNFRSF11B	651	0			c.A1136C						.						172.0	176.0	175.0					8																	119936683		2203	4300	6503	SO:0001583	missense	4982	exon5			TACAATTTGTACA	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.1136A>C	8.37:g.119936683T>G	ENSP00000297350:p.Lys379Thr	Somatic	178.0	1.0		WXS	Illumina HiSeq	Phase_I	284.0	21.0	NM_002546	B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	ENST00000297350.4	37	CCDS6326.1	.	.	.	.	.	.	.	.	.	.	T	11.96	1.795899	0.31777	.	.	ENSG00000164761	ENST00000297350	T	0.76968	-1.06	5.69	3.84	0.44239	.	0.253598	0.38778	N	0.001561	T	0.54367	0.1854	N	0.08118	0	0.23589	N	0.997344	B	0.27559	0.181	B	0.23419	0.046	T	0.39482	-0.9612	9	.	.	.	-15.7739	8.7739	0.34749	0.0:0.6753:0.0:0.3247	.	379	O00300	TR11B_HUMAN	T	379	ENSP00000297350:K379T	.	K	-	2	0	TNFRSF11B	120005864	0.986000	0.35501	0.726000	0.30738	0.877000	0.50540	0.778000	0.26732	0.702000	0.31825	0.533000	0.62120	AAA	.		0.393	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1		
TNFRSF11B	4982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	119936888	119936888	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:119936888C>G	ENST00000297350.4	-	5	1309	c.931G>C	c.(931-933)Gac>Cac	p.D311H		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	311	Death 2.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			TTTTCAATGTCTTCTGCTCCC	0.478																																					p.D311H		.											.	TNFRSF11B	651	0			c.G931C						.						193.0	151.0	165.0					8																	119936888		2203	4300	6503	SO:0001583	missense	4982	exon5			CAATGTCTTCTGC	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.931G>C	8.37:g.119936888C>G	ENSP00000297350:p.Asp311His	Somatic	250.0	0.0		WXS	Illumina HiSeq	Phase_I	392.0	25.0	NM_002546	B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	ENST00000297350.4	37	CCDS6326.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110816	0.56398	.	.	ENSG00000164761	ENST00000297350	D	0.94000	-3.33	5.65	5.65	0.86999	Death (1);	1.453660	0.03646	N	0.240271	D	0.96213	0.8765	L	0.54323	1.7	0.44843	D	0.997855	P	0.46512	0.879	P	0.56398	0.797	D	0.86941	0.2079	9	.	.	.	-14.9045	20.0822	0.97779	0.0:1.0:0.0:0.0	.	311	O00300	TR11B_HUMAN	H	311	ENSP00000297350:D311H	.	D	-	1	0	TNFRSF11B	120006069	1.000000	0.71417	0.988000	0.46212	0.231000	0.25187	5.574000	0.67424	2.826000	0.97356	0.563000	0.77884	GAC	.		0.478	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1		
TNR	7143	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	175306706	175306707	+	Frame_Shift_Ins	INS	-	-	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:175306706_175306707insA	ENST00000367674.2	-	19	4199_4200	c.3491_3492insT	c.(3490-3492)ttafs	p.L1164fs	RP3-518E13.2_ENST00000569593.1_RNA|TNR_ENST00000263525.2_Frame_Shift_Ins_p.L1164fs			Q92752	TENR_HUMAN	tenascin R	1164	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGTACACTTGTAATTTCTGGCT	0.505																																					p.L1164fs		.											.	TNR	324	0			c.3492_3493insT						.																																			SO:0001589	frameshift_variant	7143	exon19			CACTTGTAATTTC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3492dupT	1.37:g.175306708_175306708dupA	ENSP00000356646:p.Leu1164fs	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	15.0	NM_003285	C9J563|Q15568|Q5R3G0	Frame_Shift_Ins	INS	ENST00000367674.2	37	CCDS1318.1																																																																																			.		0.505	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
TNXB	7148	broad.mit.edu;bcgsc.ca	37	6	32012931	32012931	+	Silent	SNP	C	C	A	rs545042173		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:32012931C>A	ENST00000375244.3	-	32	10980	c.10779G>T	c.(10777-10779)acG>acT	p.T3593T	TNXB_ENST00000375247.2_Silent_p.T3591T|TNXB_ENST00000451343.1_Silent_p.T22T			P22105	TENX_HUMAN	tenascin XB	3638					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCTGCCCGTTCGTGTCCTCAT	0.637																																					p.T3591T		.											.	TNXB	90	0			c.G10773T						.						62.0	54.0	57.0					6																	32012931		1507	2706	4213	SO:0001819	synonymous_variant	7148	exon32			CCCGTTCGTGTCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10779G>T	6.37:g.32012931C>A		Somatic	402.0	0.0		WXS	Illumina HiSeq	Phase_I	255.0	13.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37																																																																																				.		0.637	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578410	7578410	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:7578410T>A	ENST00000269305.4	-	5	709	c.520A>T	c.(520-522)Agg>Tgg	p.R174W	TP53_ENST00000420246.2_Missense_Mutation_p.R174W|TP53_ENST00000413465.2_Missense_Mutation_p.R174W|TP53_ENST00000455263.2_Missense_Mutation_p.R174W|TP53_ENST00000359597.4_Missense_Mutation_p.R174W|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R174W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	174	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|R -> M (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in a sporadic cancer; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R174W(12)|p.0?(8)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R81W(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*73(1)|p.R174fs*70(1)|p.R174G(1)|p.R42W(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.R174fs*3(1)|p.R174fs*7(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAGCGCCTCACAACCTCC	0.657		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R174W	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,cerebellum,primitive_neuroectodermal_tumour-medulloblastoma,+1	TP53	70225	43	Substitution - Missense(15)|Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(6)|Insertion - Frameshift(1)	liver(11)|breast(7)|lung(4)|oesophagus(4)|bone(4)|large_intestine(3)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|ovary(1)|prostate(1)	c.A520T	GRCh37	CM942119	TP53	M		.						50.0	50.0	50.0					17																	7578410		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGCGCCTCACAAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.520A>T	17.37:g.7578410T>A	ENSP00000269305:p.Arg174Trp	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	19.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919495	0.73098	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99820	-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93	5.59	1.97	0.26223	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.297542	0.32190	N	0.006445	D	0.99764	0.9904	M	0.84585	2.705	0.39545	D	0.968872	D;D;D;D;D;D;D	0.89917	1.0;0.996;0.998;1.0;0.997;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.978;0.977;0.999;0.997;0.987;0.998	D	0.98344	1.0540	10	0.87932	D	0	-14.7463	12.0783	0.53657	0.0:0.0:0.417:0.583	.	135;174;174;81;174;174;174	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	W	174;174;174;174;174;174;163;81;42;81;42	ENSP00000410739:R174W;ENSP00000352610:R174W;ENSP00000269305:R174W;ENSP00000398846:R174W;ENSP00000391127:R174W;ENSP00000391478:R174W;ENSP00000425104:R42W;ENSP00000423862:R81W	ENSP00000269305:R174W	R	-	1	2	TP53	7519135	0.002000	0.14202	0.176000	0.23000	0.618000	0.37518	1.330000	0.33781	0.094000	0.17404	0.533000	0.62120	AGG	.		0.657	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRAPPC4	51399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118889521	118889521	+	Missense_Mutation	SNP	G	G	A	rs372565482		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:118889521G>A	ENST00000533632.1	+	1	380	c.16G>A	c.(16-18)Gtg>Atg	p.V6M	TRAPPC4_ENST00000434101.2_Missense_Mutation_p.V6M|TRAPPC4_ENST00000525303.1_Missense_Mutation_p.V6M|TRAPPC4_ENST00000533058.1_Missense_Mutation_p.V6M|TRAPPC4_ENST00000359005.4_Missense_Mutation_p.V6M|TRAPPC4_ENST00000528230.1_Missense_Mutation_p.V6M|MIR3656_ENST00000577421.1_RNA|RPS25_ENST00000528547.1_5'Flank|RPS25_ENST00000527673.1_5'Flank	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4	6					dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		GATTTTTAGTGTGTATGTGGT	0.577																																					p.V6M		.											.	TRAPPC4	90	0			c.G16A						.	G	MET/VAL	0,4400		0,0,2200	139.0	133.0	135.0		16	5.9	1.0	11		135	1,8589	1.2+/-3.3	0,1,4294	no	missense	TRAPPC4	NM_016146.4	21	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	6/220	118889521	1,12989	2200	4295	6495	SO:0001583	missense	51399	exon1			TTTAGTGTGTATG	AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296		ENST00000533632.1:c.16G>A	11.37:g.118889521G>A	ENSP00000436005:p.Val6Met	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	12.0	NM_016146	A8K3A5|B4DME1	Missense_Mutation	SNP	ENST00000533632.1	37	CCDS8407.1	.	.	.	.	.	.	.	.	.	.	G	36	5.850332	0.97023	0.0	1.16E-4	ENSG00000196655	ENST00000533632;ENST00000528230;ENST00000525303;ENST00000434101;ENST00000359005;ENST00000533058	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.86	5.86	0.93980	Longin-like (1);	0.052096	0.85682	D	0.000000	D	0.91462	0.7305	M	0.80982	2.52	0.80722	D	1	P;D;D;D	0.67145	0.946;0.996;0.985;0.994	P;D;P;P	0.64506	0.694;0.926;0.801;0.881	D	0.91756	0.5416	10	0.87932	D	0	-20.6589	20.1796	0.98194	0.0:0.0:1.0:0.0	.	6;6;6;6	B4DF86;B4DME1;Q9Y296;B4DF36	.;.;TPPC4_HUMAN;.	M	6	ENSP00000436005:V6M;ENSP00000436827:V6M;ENSP00000435339:V6M;ENSP00000405033:V6M;ENSP00000351896:V6M;ENSP00000432920:V6M	ENSP00000351896:V6M	V	+	1	0	TRAPPC4	118394731	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.408000	0.97327	2.784000	0.95788	0.655000	0.94253	GTG	.		0.577	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389332.1	NM_016146	
TTC27	55622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32891709	32891709	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:32891709G>T	ENST00000317907.4	+	7	1044	c.813G>T	c.(811-813)ttG>ttT	p.L271F		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	271										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						CAGGTGCTTTGGGAAAAAGAA	0.368																																					p.L271F		.											.	TTC27	90	0			c.G813T						.						104.0	110.0	108.0					2																	32891709		2203	4300	6503	SO:0001583	missense	55622	exon7			TGCTTTGGGAAAA	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.813G>T	2.37:g.32891709G>T	ENSP00000313953:p.Leu271Phe	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	8.0	NM_017735	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441403	0.63067	.	.	ENSG00000018699	ENST00000317907	T	0.71222	-0.55	5.74	0.907	0.19321	.	0.000000	0.64402	D	0.000001	D	0.83161	0.5194	M	0.88640	2.97	0.53688	D	0.999972	D	0.89917	1.0	D	0.73708	0.981	T	0.82452	-0.0450	10	0.72032	D	0.01	-0.8942	9.5603	0.39364	0.3601:0.0:0.6399:0.0	.	271	Q6P3X3	TTC27_HUMAN	F	271	ENSP00000313953:L271F	ENSP00000313953:L271F	L	+	3	2	TTC27	32745213	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	1.388000	0.34442	0.092000	0.17331	-0.218000	0.12543	TTG	.		0.368	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
TTC28	23331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	28378235	28378235	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr22:28378235T>C	ENST00000397906.2	-	23	7561	c.7420A>G	c.(7420-7422)Aga>Gga	p.R2474G	TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000435348.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2474					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GGGAAAAATCTTCCTGGAGAC	0.592																																					p.R2474G		.											.	.	.	0			c.A7420G						.						10.0	11.0	11.0					22																	28378235		691	1587	2278	SO:0001583	missense	23331	exon23			AAAATCTTCCTGG	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.7420A>G	22.37:g.28378235T>C	ENSP00000381003:p.Arg2474Gly	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	6.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	37	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.500918	0.64298	.	.	ENSG00000100154	ENST00000397906	D	0.90788	-2.73	5.23	2.99	0.34606	.	0.000000	0.85682	D	0.000000	D	0.91081	0.7193	L	0.29908	0.895	0.53688	D	0.999976	D	0.63880	0.993	D	0.72338	0.977	D	0.90051	0.4149	10	0.72032	D	0.01	-18.8902	11.391	0.49815	0.0:0.0:0.2887:0.7113	.	2474	Q96AY4	TTC28_HUMAN	G	2474	ENSP00000381003:R2474G	ENSP00000381003:R2474G	R	-	1	2	TTC28	26708235	1.000000	0.71417	0.878000	0.34440	0.996000	0.88848	3.493000	0.53266	0.348000	0.23949	0.533000	0.62120	AGA	.		0.592	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
TTC38	55020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	46671305	46671305	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr22:46671305A>G	ENST00000381031.3	+	5	602	c.526A>G	c.(526-528)Atc>Gtc	p.I176V	TTC38_ENST00000445282.2_Intron	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	176						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						GACACCTGACATCCCCCTAAG	0.443																																					p.I176V		.											.	TTC38	91	0			c.A526G						.						100.0	99.0	99.0					22																	46671305		1882	4098	5980	SO:0001583	missense	55020	exon5			CCTGACATCCCCC		CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.526A>G	22.37:g.46671305A>G	ENSP00000370419:p.Ile176Val	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	11.0	NM_017931	Q8WV27|Q9NWP8	Missense_Mutation	SNP	ENST00000381031.3	37	CCDS43030.1	.	.	.	.	.	.	.	.	.	.	A	2.428	-0.331558	0.05314	.	.	ENSG00000075234	ENST00000381031;ENST00000421359	T	0.38240	1.15	5.93	-3.47	0.04753	.	0.605314	0.18640	N	0.135310	T	0.18551	0.0445	N	0.25485	0.75	0.29617	N	0.846493	B	0.09022	0.002	B	0.06405	0.002	T	0.20273	-1.0280	9	.	.	.	-19.539	8.1272	0.31005	0.4056:0.1836:0.4108:0.0	.	176	Q5R3I4	TTC38_HUMAN	V	176	ENSP00000370419:I176V	.	I	+	1	0	TTC38	45049969	0.001000	0.12720	0.016000	0.15963	0.829000	0.46940	0.033000	0.13754	-0.310000	0.08766	0.533000	0.62120	ATC	.		0.443	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000318469.1	NM_017931	
TTF1	7270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135277159	135277159	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:135277159A>T	ENST00000334270.2	-	2	1089	c.1050T>A	c.(1048-1050)ccT>ccA	p.P350P		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	350					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CGAGGCTCTCAGGCATGGCCA	0.468																																					p.P350P		.											.	TTF1	94	0			c.T1050A						.						129.0	124.0	125.0					9																	135277159		2203	4300	6503	SO:0001819	synonymous_variant	7270	exon2			GCTCTCAGGCATG	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1050T>A	9.37:g.135277159A>T		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	44.0	NM_007344	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Silent	SNP	ENST00000334270.2	37	CCDS6948.1																																																																																			.		0.468	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344	
UBE2D3	7323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	103747665	103747665	+	Start_Codon_SNP	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:103747665T>C	ENST00000453744.2	-	2	514	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	UBE2D3_ENST00000394804.2_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000394803.5_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000513098.1_5'UTR|UBE2D3_ENST00000507845.1_5'Flank|UBE2D3_ENST00000350435.7_5'Flank|UBE2D3_ENST00000321805.7_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000394801.4_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000343106.5_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000338145.3_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000502404.1_5'Flank|UBE2D3_ENST00000349311.8_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000505207.1_5'Flank|RP11-10L12.4_ENST00000501133.2_RNA|UBE2D3_ENST00000504211.1_5'Flank|UBE2D3_ENST00000357194.6_Intron	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	1					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TTCAGCGCCATAGTGTGTGCT	0.577																																					p.M1V		.											.	UBE2D3	226	0			c.A1G						.						223.0	208.0	213.0					4																	103747665		2203	4300	6503	SO:0001582	initiator_codon_variant	7323	exon2			GCGCCATAGTGTG	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.1A>G	4.37:g.103747665T>C	ENSP00000396901:p.Met1Val	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	9.0	NM_181886	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	ENST00000453744.2	37	CCDS3660.1	.	.	.	.	.	.	.	.	.	.	T	13.33	2.203650	0.38905	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000338145;ENST00000349311;ENST00000508238;ENST00000502690;ENST00000508249	T;T;T;T;T;T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;0.95	4.61	3.41	0.39046	Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.76300	0.3968	.	.	.	0.80722	D	1	B;P	0.34826	0.034;0.471	B;P	0.50405	0.347;0.64	T	0.75892	-0.3157	8	0.87932	D	0	.	7.1484	0.25595	0.0:0.1017:0.0:0.8983	.	1;1	P61077;P61077-2	UB2D3_HUMAN;.	V	1	ENSP00000396901:M1V;ENSP00000378280:M1V;ENSP00000378282:M1V;ENSP00000378283:M1V;ENSP00000345285:M1V;ENSP00000318494:M1V;ENSP00000337208:M1V;ENSP00000344069:M1V;ENSP00000423487:M1V;ENSP00000425762:M1V;ENSP00000421310:M1V	ENSP00000318494:M1V	M	-	1	0	UBE2D3	103966800	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.734000	0.38166	0.893000	0.36288	0.455000	0.32223	ATG	.		0.577	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893	Missense_Mutation
VAMP3	9341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	7837247	7837247	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:7837247G>A	ENST00000054666.6	+	3	215	c.100G>A	c.(100-102)Gac>Aac	p.D34N	RP3-467L1.6_ENST00000602406.1_RNA|VAMP3_ENST00000470357.1_Missense_Mutation_p.D6N	NM_004781.3	NP_004772.1	Q15836	VAMP3_HUMAN	vesicle-associated membrane protein 3	34	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				calcium ion-dependent exocytosis (GO:0017156)|exocytosis (GO:0006887)|Golgi to plasma membrane protein transport (GO:0043001)|membrane fusion (GO:0061025)|positive regulation of receptor recycling (GO:0001921)|protein complex assembly (GO:0006461)|retrograde transport, endosome to Golgi (GO:0042147)|SNARE complex assembly (GO:0035493)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)|SNARE complex (GO:0031201)|synapse (GO:0045202)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;6.33e-69)|GBM - Glioblastoma multiforme(8;2.07e-34)|Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.38e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000805)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		AGTTAACGTGGACAAGGTTCT	0.527																																					p.D34N		.											.	VAMP3	90	0			c.G100A						.						102.0	95.0	97.0					1																	7837247		2203	4300	6503	SO:0001583	missense	9341	exon3			AACGTGGACAAGG	BC003570	CCDS88.1	1p36.23	2013-02-13	2012-10-17		ENSG00000049245	ENSG00000049245		"""Vesicle-associated membrane proteins"""	12644	protein-coding gene	gene with protein product	"""cellubrevin"""	603657				9885218	Standard	NM_004781		Approved	CEB	uc001aol.3	Q15836	OTTHUMG00000001225	ENST00000054666.6:c.100G>A	1.37:g.7837247G>A	ENSP00000054666:p.Asp34Asn	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	9.0	NM_004781	Q9BRV4	Missense_Mutation	SNP	ENST00000054666.6	37	CCDS88.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440217	0.63067	.	.	ENSG00000049245	ENST00000054666	T	0.33216	1.42	6.17	5.24	0.73138	Synaptobrevin (4);	0.000000	0.85682	D	0.000000	T	0.39358	0.1075	M	0.62723	1.935	0.80722	D	1	B	0.29766	0.256	B	0.36378	0.223	T	0.23940	-1.0174	10	0.49607	T	0.09	-0.399	17.4035	0.87467	0.0:0.1246:0.8754:0.0	.	34	Q15836	VAMP3_HUMAN	N	34	ENSP00000054666:D34N	ENSP00000054666:D34N	D	+	1	0	VAMP3	7759834	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	9.760000	0.98935	1.565000	0.49641	0.655000	0.94253	GAC	.		0.527	VAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003625.1	NM_004781	
VN1R2	317701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	53762414	53762414	+	Nonsense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:53762414T>A	ENST00000341702.3	+	1	870	c.786T>A	c.(784-786)taT>taA	p.Y262*		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	262					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		AGTCAGTATATGCAGCATTGA	0.448																																					p.Y262X		.											.	VN1R2	90	0			c.T786A						.						151.0	139.0	143.0					19																	53762414		2203	4300	6503	SO:0001587	stop_gained	317701	exon1			AGTATATGCAGCA	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.786T>A	19.37:g.53762414T>A	ENSP00000351244:p.Tyr262*	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	24.0	NM_173856	A1L411|Q8TDU4	Nonsense_Mutation	SNP	ENST00000341702.3	37	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	T	16.39	3.111238	0.56398	.	.	ENSG00000196131	ENST00000341702	.	.	.	2.94	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.3225	0.07056	0.0:0.1296:0.2441:0.6263	.	.	.	.	X	262	.	ENSP00000351244:Y262X	Y	+	3	2	VN1R2	58454226	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.271000	0.18626	0.529000	0.28599	0.486000	0.48141	TAT	.		0.448	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
VSTM1	284415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54554674	54554674	+	Silent	SNP	T	T	A	rs566804822		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:54554674T>A	ENST00000338372.2	-	4	559	c.384A>T	c.(382-384)tcA>tcT	p.S128S	VSTM1_ENST00000376626.1_Silent_p.S128S|VSTM1_ENST00000425006.2_Silent_p.S128S|VSTM1_ENST00000366170.2_Silent_p.S40S	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	128					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CTGTTTTCATTGAGGGAGCTT	0.383																																					p.S128S		.											.	VSTM1	90	0			c.A384T						.						130.0	118.0	122.0					19																	54554674		2203	4300	6503	SO:0001819	synonymous_variant	284415	exon4			TTTCATTGAGGGA	AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.384A>T	19.37:g.54554674T>A		Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	26.0	NM_198481	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Silent	SNP	ENST00000338372.2	37	CCDS12872.1																																																																																			.		0.383	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481	
WAC	51322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	28884889	28884889	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:28884889T>C	ENST00000354911.4	+	7	999	c.838T>C	c.(838-840)Ttt>Ctt	p.F280L	WAC_ENST00000428935.1_Missense_Mutation_p.F235L|WAC_ENST00000375664.4_Missense_Mutation_p.F235L|WAC_ENST00000347934.4_Intron|WAC_ENST00000375646.1_Intron	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	280					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						AAAGAAATCATTTGATGCTAA	0.433																																					p.F280L		.											.	WAC	154	0			c.T838C						.						131.0	120.0	124.0					10																	28884889		2203	4300	6503	SO:0001583	missense	51322	exon7			AAATCATTTGATG	AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.838T>C	10.37:g.28884889T>C	ENSP00000346986:p.Phe280Leu	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	9.0	NM_016628	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	ENST00000354911.4	37	CCDS7159.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.762548	0.49574	.	.	ENSG00000095787	ENST00000375664;ENST00000354911;ENST00000428935;ENST00000424454;ENST00000538000	T;T;T	0.30981	1.99;1.98;1.51	5.41	5.41	0.78517	.	0.307413	0.38897	N	0.001522	T	0.22627	0.0546	L	0.29908	0.895	0.38121	D	0.937842	B;B	0.25272	0.122;0.075	B;B	0.22601	0.04;0.018	T	0.09930	-1.0652	10	0.11794	T	0.64	-9.7218	15.4254	0.75045	0.0:0.0:0.0:1.0	.	235;280	Q9BTA9-2;Q9BTA9	.;WAC_HUMAN	L	235;280;235;235;235	ENSP00000364816:F235L;ENSP00000346986:F280L;ENSP00000399706:F235L	ENSP00000346986:F280L	F	+	1	0	WAC	28924895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.331000	0.59273	2.047000	0.60756	0.454000	0.30748	TTT	.		0.433	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1	NM_100264	
WDR17	116966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	177071048	177071048	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:177071048C>A	ENST00000280190.4	+	15	2216	c.2060C>A	c.(2059-2061)aCt>aAt	p.T687N	WDR17_ENST00000508596.1_Missense_Mutation_p.T663N|WDR17_ENST00000393643.2_Missense_Mutation_p.T663N|WDR17_ENST00000507824.2_Missense_Mutation_p.T670N			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	687										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GCCTTAGTCACTCCTGTACAA	0.408																																					p.T687N		.											.	WDR17	95	0			c.C2060A						.						110.0	113.0	112.0					4																	177071048		2203	4300	6503	SO:0001583	missense	116966	exon15			TAGTCACTCCTGT	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2060C>A	4.37:g.177071048C>A	ENSP00000280190:p.Thr687Asn	Somatic	379.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	45.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	C	11.53	1.667257	0.29604	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.58506	0.36;0.38;0.33	5.38	5.38	0.77491	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.364693	0.27319	N	0.019907	T	0.45915	0.1366	L	0.33485	1.01	0.33193	D	0.551143	B;B	0.12013	0.005;0.005	B;B	0.11329	0.006;0.006	T	0.51756	-0.8665	10	0.21014	T	0.42	-11.1321	13.9314	0.63998	0.1899:0.8101:0.0:0.0	.	663;687	E7EQX0;Q8IZU2	.;WDR17_HUMAN	N	663;663;687;670	ENSP00000422763:T663N;ENSP00000377258:T663N;ENSP00000280190:T687N	ENSP00000280190:T687N	T	+	2	0	WDR17	177308042	0.991000	0.36638	0.988000	0.46212	0.788000	0.44548	4.442000	0.59988	2.505000	0.84491	0.563000	0.77884	ACT	.		0.408	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
XIRP1	165904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	39230338	39230338	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:39230338A>G	ENST00000340369.3	-	2	827	c.599T>C	c.(598-600)cTg>cCg	p.L200P	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.L200P	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	200					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CAGGCGGTCCAGCGGCCGCGT	0.627																																					p.L200P		.											.	XIRP1	158	0			c.T599C						.						45.0	47.0	46.0					3																	39230338		2203	4300	6503	SO:0001583	missense	165904	exon2			CGGTCCAGCGGCC	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.599T>C	3.37:g.39230338A>G	ENSP00000343140:p.Leu200Pro	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	11.0	NM_001198621	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.409130	0.62399	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.58358	0.34;0.34	4.66	3.4	0.38934	.	0.000000	0.64402	D	0.000003	T	0.68339	0.2990	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71484	-0.4579	10	0.87932	D	0	.	9.3876	0.38352	0.8207:0.1793:0.0:0.0	.	200;200	Q702N8;Q702N8-2	XIRP1_HUMAN;.	P	200	ENSP00000379550:L200P;ENSP00000343140:L200P	ENSP00000343140:L200P	L	-	2	0	XIRP1	39205342	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.338000	0.79269	1.877000	0.54381	0.482000	0.46254	CTG	.		0.627	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
ZKSCAN4	387032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28217606	28217606	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:28217606C>G	ENST00000377294.2	-	2	673	c.430G>C	c.(430-432)Gtt>Ctt	p.V144L	ZKSCAN4_ENST00000423974.2_5'UTR	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	144					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TGGTCACCAACGGGAACCTAG	0.438																																					p.V144L		.											.	ZKSCAN4	91	0			c.G430C						.						211.0	195.0	200.0					6																	28217606		2203	4300	6503	SO:0001583	missense	387032	exon2			CACCAACGGGAAC	AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.430G>C	6.37:g.28217606C>G	ENSP00000366509:p.Val144Leu	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	9.0	NM_019110	B2RE32|Q5U7L4	Missense_Mutation	SNP	ENST00000377294.2	37	CCDS4647.1	.	.	.	.	.	.	.	.	.	.	C	0.719	-0.784323	0.02907	.	.	ENSG00000187626	ENST00000377294	T	0.05447	3.44	4.29	1.02	0.19986	Transcription regulator SCAN (1);	.	.	.	.	T	0.00875	0.0029	N	0.08118	0	0.09310	N	0.999998	B	0.19073	0.033	B	0.17722	0.019	T	0.47983	-0.9074	9	0.36615	T	0.2	.	3.063	0.06205	0.2038:0.5124:0.0:0.2837	.	144	Q969J2	ZKSC4_HUMAN	L	144	ENSP00000366509:V144L	ENSP00000366509:V144L	V	-	1	0	ZKSCAN4	28325585	0.027000	0.19231	0.002000	0.10522	0.029000	0.11900	0.216000	0.17585	0.042000	0.15717	-0.182000	0.12963	GTT	.		0.438	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040179.1	NM_019110	
ZNF195	7748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	3381365	3381365	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:3381365C>T	ENST00000399602.4	-	6	999	c.873G>A	c.(871-873)gaG>gaA	p.E291E	ZNF195_ENST00000354599.6_Silent_p.E219E|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000343338.7_Silent_p.E223E|ZNF195_ENST00000429541.2_Silent_p.E223E|ZNF195_ENST00000438262.2_3'UTR|ZNF195_ENST00000005082.9_Silent_p.E268E|ZNF195_ENST00000526601.1_Silent_p.E272E	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		TGTCAATGTTCTCAGGTTCAG	0.378																																					p.E291E		.											.	ZNF195	90	0			c.G873A						.						97.0	93.0	94.0					11																	3381365		1904	4155	6059	SO:0001819	synonymous_variant	7748	exon6			AATGTTCTCAGGT		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.873G>A	11.37:g.3381365C>T		Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	16.0	NM_001130520	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	37	CCDS44522.1																																																																																			.		0.378	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2		
ZNF211	10520	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58152694	58152694	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:58152694T>C	ENST00000347302.3	+	3	1019	c.840T>C	c.(838-840)agT>agC	p.S280S	ZNF211_ENST00000299871.5_Silent_p.S345S|ZNF211_ENST00000240731.4_Silent_p.S293S|ZNF211_ENST00000544273.1_Silent_p.S292S|ZNF211_ENST00000254182.7_Silent_p.S271S|ZNF211_ENST00000541801.1_Silent_p.S271S|ZNF211_ENST00000391703.3_Silent_p.S219S|ZNF211_ENST00000420680.1_Silent_p.S284S	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGTCCACAGTGAAGAAAGGC	0.408																																					p.S345S		.											.	ZNF211	92	0			c.T1035C						.						121.0	113.0	116.0					19																	58152694		2203	4300	6503	SO:0001819	synonymous_variant	10520	exon5			CCACAGTGAAGAA	U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.840T>C	19.37:g.58152694T>C		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	6.0	NM_001265597	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Silent	SNP	ENST00000347302.3	37	CCDS12957.1	.	.	.	.	.	.	.	.	.	.	T	8.553	0.876040	0.17395	.	.	ENSG00000121417	ENST00000407202	.	.	.	3.27	3.27	0.37495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9252	0.24412	0.2057:0.0:0.0:0.7943	.	.	.	.	R	284	.	.	X	+	1	0	ZNF211	62844506	0.000000	0.05858	0.172000	0.22920	0.998000	0.95712	-0.704000	0.05058	1.486000	0.48398	0.472000	0.43445	TGA	.		0.408	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1		
ZNF365	22891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	64148261	64148261	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:64148261C>G	ENST00000395254.3	+	3	1130	c.850C>G	c.(850-852)Ctg>Gtg	p.L284V	ZNF365_ENST00000466727.1_3'UTR|ZNF365_ENST00000410046.3_Missense_Mutation_p.L284V|ZNF365_ENST00000395255.3_Missense_Mutation_p.L284V	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					GCGGGTAGAACTGGCGGAGAA	0.567																																					p.L284V		.											.	ZNF365	92	0			c.C850G						.						55.0	57.0	56.0					10																	64148261		2203	4300	6503	SO:0001583	missense	22891	exon3			GTAGAACTGGCGG	AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.850C>G	10.37:g.64148261C>G	ENSP00000378674:p.Leu284Val	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	9.0	NM_014951		Missense_Mutation	SNP	ENST00000395254.3	37	CCDS31209.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.629947	0.67015	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T;T;T	0.35421	1.31;1.31;1.31	5.58	-1.35	0.09114	.	2.215180	0.02118	N	0.055432	T	0.54775	0.1879	M	0.69823	2.125	0.80722	D	1	D;D;P;D	0.69078	0.997;0.986;0.948;0.974	D;P;P;P	0.64042	0.921;0.78;0.706;0.706	T	0.51679	-0.8675	10	0.51188	T	0.08	-5.0613	6.445	0.21871	0.0:0.518:0.1143:0.3677	.	284;284;284;299	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	V	284	ENSP00000378674:L284V;ENSP00000378675:L284V;ENSP00000387091:L284V	ENSP00000378674:L284V	L	+	1	2	ZNF365	63818267	0.002000	0.14202	0.984000	0.44739	0.985000	0.73830	-0.049000	0.11924	-0.201000	0.10284	0.655000	0.94253	CTG	.		0.567	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951	
ZC3H14	79882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	89034417	89034418	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:89034417_89034418GG>TT	ENST00000251038.5	+	3	339_340	c.114_115GG>TT	c.(112-117)gtGGcc>gtTTcc	p.A39S	ZC3H14_ENST00000302216.8_Missense_Mutation_p.A39S|ZC3H14_ENST00000555755.1_Missense_Mutation_p.A39S|ZC3H14_ENST00000393514.5_Missense_Mutation_p.A39S|ZC3H14_ENST00000359301.3_Missense_Mutation_p.A5S|ZC3H14_ENST00000336693.4_Missense_Mutation_p.A5S|ZC3H14_ENST00000556945.1_Missense_Mutation_p.A39S|ZC3H14_ENST00000557607.1_Intron	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	39						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						TGGTGATGGTGGCCAACAAGAA	0.371																																					p.A39S		.											.	.	.	0			.						.																																			SO:0001583	missense	79882	.			GATGGTGGCCAAC	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	Exception_encountered	14.37:g.89034417_89034418delinsTT	ENSP00000251038:p.Ala39Ser	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	11.0	.	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	DNP	ENST00000251038.5	37	CCDS32133.1																																																																																			.		0.371	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
ABCB5	340273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	20691108	20691109	+	Missense_Mutation	DNP	GG	GG	TT	rs560906981		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:20691108_20691109GG>TT	ENST00000404938.2	+	13	2050_2051	c.1398_1399GG>TT	c.(1396-1401)gtGGtt>gtTTtt	p.V467F	ABCB5_ENST00000406935.1_Missense_Mutation_p.V22F|ABCB5_ENST00000477094.1_3'UTR|ABCB5_ENST00000443026.2_Missense_Mutation_p.V22F|ABCB5_ENST00000258738.6_Missense_Mutation_p.V22F	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	467	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATATTGGAGTGGTTAGTCAAGA	0.446																																					p.V467F		.											.	.	.	0			.						.																																			SO:0001583	missense	340273	.			TGGAGTGGTTAGT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	Exception_encountered	7.37:g.20691108_20691109delinsTT	ENSP00000384881:p.Val467Phe	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	24.0	.	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	DNP	ENST00000404938.2	37	CCDS55090.1																																																																																			.		0.446	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
