#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACOX2	8309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	58517052	58517052	+	Missense_Mutation	SNP	G	G	T	rs75760511		TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr3:58517052G>T	ENST00000302819.5	-	7	1036	c.745C>A	c.(745-747)Caa>Aaa	p.Q249K	ACOX2_ENST00000459701.2_Missense_Mutation_p.Q249K	NM_003500.3	NP_003491.1	Q99424	ACOX2_HUMAN	acyl-CoA oxidase 2, branched chain	249					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity (GO:0033791)|acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		TTGTCTGTTTGATCAAAGTCC	0.532																																					p.Q249K		.											.	ACOX2	90	0			c.C745A						.						156.0	130.0	139.0					3																	58517052		2203	4300	6503	SO:0001583	missense	8309	exon7			CTGTTTGATCAAA	X95190	CCDS33775.1	3p14.3	2012-07-13	2010-04-30		ENSG00000168306	ENSG00000168306	1.17.99.3		120	protein-coding gene	gene with protein product	"""trihydroxycoprostanoyl-CoA oxidase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholestanoyl-CoA 24-hydroxylase"""	601641	"""acyl-Coenzyme A oxidase 2, branched chain"""			8943006, 9070889	Standard	NM_003500		Approved	BRCACOX, BRCOX, THCCox	uc003dkl.3	Q99424	OTTHUMG00000159154	ENST00000302819.5:c.745C>A	3.37:g.58517052G>T	ENSP00000307697:p.Gln249Lys	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	26.0	NM_003500	A6NF16|B2R8U5	Missense_Mutation	SNP	ENST00000302819.5	37	CCDS33775.1	.	.	.	.	.	.	.	.	.	.	G	1.940	-0.443906	0.04604	.	.	ENSG00000168306	ENST00000459701;ENST00000302819	T;T	0.62788	-0.0;-0.0	5.06	-0.654	0.11443	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	1.021070	0.07774	N	0.952337	T	0.42245	0.1194	L	0.29908	0.895	0.09310	N	1	B	0.19200	0.034	B	0.20184	0.028	T	0.22173	-1.0224	10	0.10377	T	0.69	-11.0312	3.9363	0.09307	0.1326:0.0978:0.4994:0.2701	.	249	Q99424	ACOX2_HUMAN	K	249	ENSP00000418562:Q249K;ENSP00000307697:Q249K	ENSP00000307697:Q249K	Q	-	1	0	ACOX2	58492092	0.001000	0.12720	0.000000	0.03702	0.093000	0.18481	0.469000	0.22067	-0.398000	0.07679	-0.165000	0.13383	CAA	.		0.532	ACOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353541.1		
ANK1	286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	41554074	41554074	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr8:41554074C>G	ENST00000347528.4	-	26	2850	c.2767G>C	c.(2767-2769)Ggt>Cgt	p.G923R	ANK1_ENST00000396942.1_Missense_Mutation_p.G923R|ANK1_ENST00000289734.7_Missense_Mutation_p.G923R|ANK1_ENST00000265709.8_Missense_Mutation_p.G964R|ANK1_ENST00000379758.2_Missense_Mutation_p.G923R|ANK1_ENST00000396945.1_Missense_Mutation_p.G923R|ANK1_ENST00000352337.4_Missense_Mutation_p.G923R	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	923	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			ATGGAACCACCCCGGGCGTCA	0.647																																					p.G964R		.											.	ANK1	716	0			c.G2890C						.						49.0	45.0	46.0					8																	41554074		2202	4300	6502	SO:0001583	missense	286	exon27			AACCACCCCGGGC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.2767G>C	8.37:g.41554074C>G	ENSP00000339620:p.Gly923Arg	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	23.0	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	37	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.180926|5.180926	0.94846|0.94846	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000520299|ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	.|T;T;T;T;T;T;T	.|0.68181	.|-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	5.67|5.67	5.67|5.67	0.87782|0.87782	.|ZU5 (3);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.84243|0.84243	0.5429|0.5429	M|M	0.83118|0.83118	2.625|2.625	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|0.999;0.998;1.0;1.0;0.999;1.0	D|D	0.85809|0.85809	0.1378|0.1378	6|10	.|0.87932	.|D	.|0	.|.	19.7607|19.7607	0.96316|0.96316	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|964;923;923;923;923;239	.|P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.|.;.;ANK1_HUMAN;.;.;.	A|R	244|923;923;923;923;923;923;964;923	.|ENSP00000339620:G923R;ENSP00000289734:G923R;ENSP00000369082:G923R;ENSP00000380149:G923R;ENSP00000380147:G923R;ENSP00000309131:G923R;ENSP00000265709:G964R	.|ENSP00000265709:G964R	G|G	-|-	2|1	0|0	ANK1|ANK1	41673231|41673231	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.865000|0.865000	0.49528|0.49528	7.785000|7.785000	0.85724|0.85724	2.686000|2.686000	0.91538|0.91538	0.561000|0.561000	0.74099|0.74099	GGG|GGT	.		0.647	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89350329	89350329	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr16:89350329G>A	ENST00000301030.4	-	9	3081	c.2621C>T	c.(2620-2622)gCc>gTc	p.A874V	ANKRD11_ENST00000378330.2_Missense_Mutation_p.A874V	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	874	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GATGAGCTTGGCCACAGAGTC	0.562																																					p.A874V		.											.	ANKRD11	139	0			c.C2621T						.						68.0	74.0	72.0					16																	89350329		2198	4300	6498	SO:0001583	missense	29123	exon9			AGCTTGGCCACAG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2621C>T	16.37:g.89350329G>A	ENSP00000301030:p.Ala874Val	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	21.0	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.353671	0.61293	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000330736	T;T	0.37235	1.21;1.21	5.51	5.51	0.81932	.	0.074531	0.53938	D	0.000048	T	0.34048	0.0884	L	0.50919	1.6	0.80722	D	1	P;B	0.37731	0.607;0.132	B;B	0.32465	0.146;0.038	T	0.08207	-1.0733	10	0.25751	T	0.34	.	19.4153	0.94694	0.0:0.0:1.0:0.0	.	493;874	Q7Z5E5;Q6UB99	.;ANR11_HUMAN	V	874;874;493	ENSP00000301030:A874V;ENSP00000367581:A874V	ENSP00000301030:A874V	A	-	2	0	ANKRD11	87877830	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.017000	0.76399	2.595000	0.87683	0.561000	0.74099	GCC	.		0.562	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ARID5B	84159	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	63851284	63851284	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr10:63851284T>C	ENST00000279873.7	+	10	2472	c.2062T>C	c.(2062-2064)Tcc>Ccc	p.S688P	ARID5B_ENST00000309334.5_Missense_Mutation_p.S445P	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	688					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					AGGCATCATGTCCCCACTGGC	0.527																																					p.S688P		.											.	ARID5B	94	0			c.T2062C						.						59.0	57.0	57.0					10																	63851284		2203	4300	6503	SO:0001583	missense	84159	exon10			ATCATGTCCCCAC	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.2062T>C	10.37:g.63851284T>C	ENSP00000279873:p.Ser688Pro	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	10.0	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.215448	0.79352	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.69175	-0.29;-0.38	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.80884	0.4709	M	0.67953	2.075	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.82772	-0.0292	10	0.87932	D	0	-18.4042	16.2674	0.82597	0.0:0.0:0.0:1.0	.	688	Q14865	ARI5B_HUMAN	P	688;445	ENSP00000279873:S688P;ENSP00000308862:S445P	ENSP00000279873:S688P	S	+	1	0	ARID5B	63521290	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.499000	0.81566	2.242000	0.73789	0.533000	0.62120	TCC	.		0.527	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
ATAD2	29028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	124340448	124340448	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr8:124340448C>T	ENST00000287394.5	-	25	3957	c.3850G>A	c.(3850-3852)Gat>Aat	p.D1284N	ATAD2_ENST00000521903.1_Missense_Mutation_p.D602N	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1284					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TCATTTTCATCAGAAATATGT	0.308																																					p.D1284N		.											.	ATAD2	92	0			c.G3850A						.						50.0	48.0	49.0					8																	124340448		2202	4299	6501	SO:0001583	missense	29028	exon25			TTTCATCAGAAAT	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3850G>A	8.37:g.124340448C>T	ENSP00000287394:p.Asp1284Asn	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	17.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	C	2.482	-0.319418	0.05386	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	D;T	0.92048	-2.96;1.48	5.01	2.22	0.28083	.	12.131900	0.00166	N	0.000000	D	0.86066	0.5844	N	0.22421	0.69	0.23341	N	0.997879	B	0.02656	0.0	B	0.01281	0.0	T	0.71097	-0.4691	10	0.25751	T	0.34	-5.7908	5.7605	0.18196	0.1543:0.6797:0.0:0.166	.	1284	Q6PL18	ATAD2_HUMAN	N	1284;602	ENSP00000287394:D1284N;ENSP00000429213:D602N	ENSP00000287394:D1284N	D	-	1	0	ATAD2	124409629	0.993000	0.37304	0.256000	0.24389	0.116000	0.19942	1.279000	0.33191	0.240000	0.21263	-0.158000	0.13435	GAT	.		0.308	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
ATP10B	23120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	160047535	160047535	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr5:160047535C>A	ENST00000327245.5	-	15	3081	c.2235G>T	c.(2233-2235)caG>caT	p.Q745H	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	745					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCACAGTCACCTGCTCAGGTG	0.617																																					p.Q745H		.											.	ATP10B	72	0			c.G2235T						.						33.0	37.0	35.0					5																	160047535		2109	4220	6329	SO:0001583	missense	23120	exon15			AGTCACCTGCTCA	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2235G>T	5.37:g.160047535C>A	ENSP00000313600:p.Gln745His	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	50.0	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	37	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799211	0.70567	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	T;T	0.58940	0.3;0.3	5.36	1.08	0.20341	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.143106	0.51477	D	0.000086	T	0.58366	0.2117	L	0.31752	0.955	0.39672	D	0.970765	D;D	0.64830	0.994;0.994	D;D	0.66497	0.944;0.944	T	0.54649	-0.8262	9	.	.	.	.	10.7446	0.46172	0.0:0.6901:0.0:0.3099	.	353;745	Q2YDW8;O94823	.;AT10B_HUMAN	H	745;353	ENSP00000313600:Q745H;ENSP00000431081:Q353H	.	Q	-	3	2	ATP10B	159980113	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.539000	0.23175	0.277000	0.22141	0.655000	0.94253	CAG	.		0.617	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
SPATA33	124045	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	89724816	89724816	+	Silent	SNP	A	A	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr16:89724816A>T	ENST00000301031.4	+	2	195	c.195A>T	c.(193-195)gcA>gcT	p.A65A	SPATA33_ENST00000579310.1_Silent_p.A66A|CHMP1A_ENST00000535997.2_5'Flank|CHMP1A_ENST00000550102.1_5'Flank|CHMP1A_ENST00000397901.3_5'Flank|CHMP1A_ENST00000547614.1_5'Flank|SPATA33_ENST00000568929.1_Silent_p.A35A|CHMP1A_ENST00000253475.5_5'Flank	NM_001271908.1|NM_153025.1	NP_001258837.1|NP_694570.1	Q96N06	SPT33_HUMAN	spermatogenesis associated 33	65						cytoplasm (GO:0005737)|nucleus (GO:0005634)											CGCCGCCGGCAGCTTCGCTGG	0.667																																					p.A66A		.											.	C16orf55	90	0			c.A198T						.						10.0	13.0	12.0					16																	89724816		2187	4275	6462	SO:0001819	synonymous_variant	124045	exon2			GCCGGCAGCTTCG	AK056168	CCDS10983.1, CCDS62012.1, CCDS73929.1	16q24.3	2013-07-16	2013-07-05	2013-07-05	ENSG00000167523	ENSG00000167523			26463	protein-coding gene	gene with protein product		615409	"""chromosome 16 open reading frame 55"""	C16orf55		23844118	Standard	NM_153025		Approved	FLJ31606	uc010vpk.2	Q96N06	OTTHUMG00000138048	ENST00000301031.4:c.195A>T	16.37:g.89724816A>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	24.0	NM_001271910	A8WFL2|B4DZN8	Silent	SNP	ENST00000301031.4	37	CCDS10983.1																																																																																			.		0.667	SPATA33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269924.2	NM_153025	
PLXNC1	10154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	94703723	94703723	+	IGR	SNP	T	T	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr12:94703723T>A	ENST00000258526.4	+	0	7346				CCDC41_ENST00000397809.5_Missense_Mutation_p.M658L|CCDC41_ENST00000339839.5_Missense_Mutation_p.M658L	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GGTAGTTCCATGCTTGGAACC	0.363																																					p.M658L		.											.	CCDC41	90	0			c.A1972T						.						182.0	169.0	173.0					12																	94703723		1879	4107	5986	SO:0001628	intergenic_variant	51134	exon16			GTTCCATGCTTGG	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235		12.37:g.94703723T>A		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	57.0	NM_016122	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	T	5.027	0.190655	0.09547	.	.	ENSG00000173588	ENST00000552632;ENST00000339839;ENST00000397809	T;T	0.40756	1.02;1.02	5.94	-2.11	0.07187	.	.	.	.	.	T	0.19886	0.0478	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23476	-1.0187	9	0.25106	T	0.35	3.714	9.2095	0.37309	0.0:0.5051:0.3138:0.1811	.	650	Q9Y592	CCD41_HUMAN	L	122;658;658	ENSP00000344655:M658L;ENSP00000380911:M658L	ENSP00000344655:M658L	M	-	1	0	CCDC41	93227854	0.089000	0.21612	0.038000	0.18304	0.002000	0.02628	-0.071000	0.11505	-0.295000	0.08960	-0.472000	0.04984	ATG	.		0.363	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
CCDC53	51019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	102439885	102439885	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr12:102439885G>C	ENST00000240079.6	-	3	324	c.163C>G	c.(163-165)Ctt>Gtt	p.L55V	CCDC53_ENST00000545679.1_Missense_Mutation_p.L55V|CCDC53_ENST00000539515.1_5'UTR	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53	55						actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						CGAAGTGAAAGGTCTGCCAGT	0.279																																					p.L55V		.											.	.	.	0			c.C163G						.						46.0	42.0	43.0					12																	102439885		1796	4062	5858	SO:0001583	missense	51019	exon3			GTGAAAGGTCTGC	AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.163C>G	12.37:g.102439885G>C	ENSP00000240079:p.Leu55Val	Somatic	248.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	108.0	NM_016053	B2RC74|Q53FF0|Q6IAI4|Q96QK0	Missense_Mutation	SNP	ENST00000240079.6	37	CCDS44959.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441377	0.25900	.	.	ENSG00000120860	ENST00000240079;ENST00000545679;ENST00000542923	.	.	.	5.37	5.37	0.77165	.	0.107337	0.64402	D	0.000006	T	0.43122	0.1233	N	0.25485	0.75	0.39799	D	0.97254	P;P	0.42827	0.566;0.791	B;B	0.43155	0.212;0.41	T	0.25606	-1.0127	9	0.14252	T	0.57	-21.5529	16.3866	0.83507	0.0:0.0:1.0:0.0	.	55;55	F5GZ97;Q9Y3C0	.;CCD53_HUMAN	V	55;55;5	.	ENSP00000240079:L55V	L	-	1	0	CCDC53	100964015	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.617000	0.54181	2.659000	0.90383	0.655000	0.94253	CTT	.		0.279	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398685.1	NM_016053	
CDH4	1002	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60318687	60318687	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr20:60318687G>T	ENST00000360469.5	+	3	326	c.238G>T	c.(238-240)Ggg>Tgg	p.G80W	CDH4_ENST00000543233.1_Missense_Mutation_p.G6W|RP11-429E11.2_ENST00000442888.1_RNA|RP11-429E11.2_ENST00000447909.1_RNA	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	80					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CTTCAAAGTTGGGGCAGATGG	0.592																																					p.G80W		.											.	CDH4	282	0			c.G238T						.						61.0	42.0	48.0					20																	60318687		2202	4299	6501	SO:0001583	missense	1002	exon3			AAAGTTGGGGCAG	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.238G>T	20.37:g.60318687G>T	ENSP00000353656:p.Gly80Trp	Somatic	147.0	1.0		WXS	Illumina HiSeq	Phase_I	109.0	29.0	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.807960	0.31961	.	.	ENSG00000179242	ENST00000360469;ENST00000543233	T;T	0.61859	0.07;0.07	5.11	3.11	0.35812	Cadherin prodomain-like (1);Cadherin-like (1);	0.296242	0.35970	N	0.002863	T	0.61286	0.2335	L	0.55481	1.735	0.31635	N	0.648557	D	0.57571	0.98	P	0.55455	0.776	T	0.64976	-0.6280	9	.	.	.	.	8.6494	0.34025	0.3023:0.0:0.6977:0.0	.	80	P55283	CADH4_HUMAN	W	80;6	ENSP00000353656:G80W;ENSP00000443301:G6W	.	G	+	1	0	CDH4	59752082	0.999000	0.42202	0.257000	0.24404	0.026000	0.11368	1.799000	0.38824	0.518000	0.28383	0.491000	0.48974	GGG	.		0.592	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109794350	109794350	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:109794350A>G	ENST00000271332.3	+	1	1710	c.1649A>G	c.(1648-1650)gAc>gGc	p.D550G		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	550	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GTGGGACATGACTTCCCCTTC	0.557																																					p.D550G	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.A1649G						.						118.0	99.0	105.0					1																	109794350		2203	4300	6503	SO:0001583	missense	1952	exon1			GACATGACTTCCC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1649A>G	1.37:g.109794350A>G	ENSP00000271332:p.Asp550Gly	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	26.0	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	11.05	1.524698	0.27299	.	.	ENSG00000143126	ENST00000271332	T	0.50548	0.74	4.78	3.66	0.41972	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.14442	0.0349	N	0.17564	0.495	0.37407	D	0.913078	B	0.09022	0.002	B	0.17433	0.018	T	0.04386	-1.0955	9	0.32370	T	0.25	.	8.91	0.35548	0.8442:0.0:0.1558:0.0	.	550	Q9HCU4	CELR2_HUMAN	G	550	ENSP00000271332:D550G	ENSP00000271332:D550G	D	+	2	0	CELSR2	109595873	0.849000	0.29639	0.992000	0.48379	0.877000	0.50540	2.250000	0.43178	0.900000	0.36469	0.529000	0.55759	GAC	.		0.557	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
COL3A1	1281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	189871670	189871670	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr2:189871670C>A	ENST00000304636.3	+	44	3379	c.3209C>A	c.(3208-3210)gCt>gAt	p.A1070D	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1070	Triple-helical region.			A -> P (in Ref. 15; AA sequence). {ECO:0000305}.	aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TAGGGCCCTGCTGGCCCTGCT	0.373																																					p.A1070D		.											.	COL3A1	581	0			c.C3209A						.						89.0	94.0	93.0					2																	189871670		2203	4300	6503	SO:0001583	missense	1281	exon44			GCCCTGCTGGCCC	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3209C>A	2.37:g.189871670C>A	ENSP00000304408:p.Ala1070Asp	Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	98.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.618143	0.46736	.	.	ENSG00000168542	ENST00000304636	D	0.93426	-3.22	4.99	4.99	0.66335	.	0.475449	0.17935	N	0.157026	D	0.94374	0.8191	L	0.56199	1.76	0.80722	D	1	D	0.53462	0.96	P	0.57371	0.819	D	0.91715	0.5384	10	0.11794	T	0.64	.	18.6397	0.91390	0.0:1.0:0.0:0.0	.	1070	P02461	CO3A1_HUMAN	D	1070	ENSP00000304408:A1070D	ENSP00000304408:A1070D	A	+	2	0	COL3A1	189579915	0.344000	0.24827	1.000000	0.80357	0.260000	0.26232	1.002000	0.29796	2.476000	0.83614	0.655000	0.94253	GCT	.		0.373	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	3216738	3216738	+	Silent	SNP	G	G	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr8:3216738G>A	ENST00000520002.1	-	22	3798	c.3243C>T	c.(3241-3243)gcC>gcT	p.A1081A	CSMD1_ENST00000400186.3_Silent_p.A1081A|CSMD1_ENST00000602723.1_Silent_p.A1081A|CSMD1_ENST00000537824.1_Silent_p.A1080A|CSMD1_ENST00000542608.1_Silent_p.A1080A|CSMD1_ENST00000539096.1_Silent_p.A1080A|CSMD1_ENST00000602557.1_Silent_p.A1081A			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1081	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAAGCTTGGTGGCACCTTCTA	0.542																																					p.A1080A		.											.	CSMD1	86	0			c.C3240T						.						71.0	77.0	75.0					8																	3216738		2203	4300	6503	SO:0001819	synonymous_variant	64478	exon21			CTTGGTGGCACCT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3243C>T	8.37:g.3216738G>A		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	41.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	t	14.13	2.442437	0.43326	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.18	-7.27	0.01461	.	.	.	.	.	T	0.44973	0.1319	.	.	.	0.41715	D	0.989474	.	.	.	.	.	.	T	0.46898	-0.9158	4	.	.	.	.	5.3646	0.16107	0.1842:0.1181:0.5163:0.1814	.	.	.	.	Y	561	.	.	H	-	1	0	CSMD1	3204145	0.157000	0.22836	0.098000	0.21074	0.814000	0.46013	-0.481000	0.06552	-2.368000	0.00604	-1.692000	0.00727	CAC	.		0.542	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266113	41266113	+	Missense_Mutation	SNP	C	C	G	rs121913416|rs121913403		TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr3:41266113C>G	ENST00000349496.5	+	3	390	c.110C>G	c.(109-111)tCt>tGt	p.S37C	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S30C|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S37C|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S37C|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S37C	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	37			S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes). {ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> C (in PTR, hepatoblastoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:9927029}.|S -> F (in PTR). {ECO:0000269|PubMed:10192393}.|S -> Y (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|SG -> W (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S37F(172)|p.S37C(141)|p.A5_A80del(53)|p.S37Y(31)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.S37_G38>W(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GGAATCCATTCTGGTGCCACT	0.498	S37C(JHUEM2_ENDOMETRIUM)|S37C(SNU398_LIVER)|S37F(HUTU80_SMALL_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S37C	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0	CTNNB1	24361	474	Substitution - Missense(344)|Deletion - In frame(102)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(145)|endometrium(64)|stomach(38)|skin(34)|ovary(33)|central_nervous_system(28)|pancreas(28)|large_intestine(22)|pituitary(22)|lung(21)|biliary_tract(15)|thyroid(4)|soft_tissue(4)|urinary_tract(4)|small_intestine(3)|oesophagus(3)|adrenal_gland(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|bone(1)|breast(1)	c.C110G						.						93.0	78.0	83.0					3																	41266113		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TCCATTCTGGTGC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.110C>G	3.37:g.41266113C>G	ENSP00000344456:p.Ser37Cys	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	49.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407996	0.83340	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71;0.71;0.71;0.71	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72819	0.3508	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75297	-0.3367	10	0.87932	D	0	-15.9763	19.9596	0.97236	0.0:1.0:0.0:0.0	.	37	P35222	CTNB1_HUMAN	C	30;37;37;37;37;30;37;37;37	ENSP00000400508:S30C;ENSP00000385604:S37C;ENSP00000412219:S37C;ENSP00000379486:S37C;ENSP00000344456:S37C;ENSP00000411226:S30C;ENSP00000379488:S37C;ENSP00000409302:S37C;ENSP00000401599:S37C	ENSP00000344456:S37C	S	+	2	0	CTNNB1	41241117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DNM2	1785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10906053	10906053	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr19:10906053G>T	ENST00000355667.6	+	9	1214	c.1134G>T	c.(1132-1134)gaG>gaT	p.E378D	DNM2_ENST00000314646.5_Missense_Mutation_p.E378D|DNM2_ENST00000389253.4_Missense_Mutation_p.E378D|DNM2_ENST00000408974.4_Missense_Mutation_p.E378D|DNM2_ENST00000585892.1_Missense_Mutation_p.E378D|DNM2_ENST00000359692.6_Missense_Mutation_p.E378D	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	378					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CTCAGATGGAGTTTGACGAGA	0.562			"""F, N, Splice, Mis, O"""		ETP ALL																																p.E378D		.		Rec	yes		19	19p13.2	1785	dynamin 2		L	.	DNM2	471	0			c.G1134T						.						172.0	129.0	143.0					19																	10906053		2203	4300	6503	SO:0001583	missense	1785	exon9			GATGGAGTTTGAC		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.1134G>T	19.37:g.10906053G>T	ENSP00000347890:p.Glu378Asp	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	29.0	NM_001005361	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	ENST00000355667.6	37	CCDS45968.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.694089	0.30052	.	.	ENSG00000079805	ENST00000389252;ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646	T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68	5.29	3.03	0.35002	Dynamin central domain (1);	0.441600	0.25938	N	0.027333	T	0.47507	0.1449	N	0.16066	0.365	0.49389	D	0.999787	B;B;B;B;P	0.39576	0.31;0.004;0.002;0.024;0.679	B;B;B;B;B	0.40066	0.248;0.029;0.012;0.033;0.318	T	0.37384	-0.9708	10	0.09590	T	0.72	-6.6102	6.9382	0.24478	0.327:0.0:0.673:0.0	.	111;378;378;378;378	B4DJ53;A8K1B6;P50570-2;P50570;E9PEQ4	.;.;.;DYN2_HUMAN;.	D	367;378;378;378;378;378	ENSP00000386192:E378D;ENSP00000347890:E378D;ENSP00000352721:E378D;ENSP00000373905:E378D;ENSP00000313164:E378D	ENSP00000313164:E378D	E	+	3	2	DNM2	10767053	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.032000	0.41127	1.249000	0.43950	-0.140000	0.14226	GAG	.		0.562	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452592.1	NM_004945	
EMC7	56851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	34376643	34376643	+	Silent	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr15:34376643C>T	ENST00000256545.4	-	5	729	c.621G>A	c.(619-621)ttG>ttA	p.L207L		NM_020154.2	NP_064539.1	Q9NPA0	EMC7_HUMAN	ER membrane protein complex subunit 7	207						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										AAACATCAGGCAACTCATGGT	0.428																																					p.L207L		.											.	.	.	0			c.G621A						.						155.0	134.0	141.0					15																	34376643		2201	4298	6499	SO:0001819	synonymous_variant	56851	exon5			ATCAGGCAACTCA	AJ245874	CCDS10032.1	15q14	2012-05-30	2012-05-30	2012-05-30	ENSG00000134153	ENSG00000134153			24301	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 24"""	C15orf24		10873569, 22119785	Standard	NM_020154		Approved	C11orf3	uc001zhm.3	Q9NPA0	OTTHUMG00000129367	ENST00000256545.4:c.621G>A	15.37:g.34376643C>T		Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	44.0	NM_020154	B2RC00|Q96ED5	Silent	SNP	ENST00000256545.4	37	CCDS10032.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.298|8.298	0.819278|0.819278	0.16607|0.16607	.|.	.|.	ENSG00000134153|ENSG00000134153	ENST00000527822|ENST00000528949	.|.	.|.	.|.	5.19|5.19	4.27|4.27	0.50696|0.50696	.|.	.|.	.|.	.|.	.|.	T|T	0.69504|0.69504	0.3118|0.3118	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.68953|0.68953	-0.5273|-0.5273	4|4	.|.	.|.	.|.	-13.7048|-13.7048	13.7651|13.7651	0.62990|0.62990	0.0:0.926:0.0:0.074|0.0:0.926:0.0:0.074	.|.	.|.	.|.	.|.	T|Y	157|143	.|.	.|.	A|C	-|-	1|2	0|0	C15orf24|C15orf24	32163935|32163935	0.999000|0.999000	0.42202|0.42202	0.997000|0.997000	0.53966|0.53966	0.984000|0.984000	0.73092|0.73092	0.665000|0.665000	0.25083|0.25083	1.410000|1.410000	0.46936|0.46936	0.557000|0.557000	0.71058|0.71058	GCC|TGC	.		0.428	EMC7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251519.1	NM_020154	
GAREML	150946	ucsc.edu;bcgsc.ca	37	2	26399314	26399314	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr2:26399314G>T	ENST00000401533.2	+	2	344	c.214G>T	c.(214-216)Gtc>Ttc	p.V72F		NM_001168241.1	NP_001161713.1	Q75VX8	GAREL_HUMAN	GRB2 associated, regulator of MAPK1-like	72	CABIT.					extracellular vesicular exosome (GO:0070062)											GGGCCACTATGTCATCGGGCC	0.612																																					p.V72F		.											.	.	.	0			c.G214T						.						72.0	65.0	67.0					2																	26399314		692	1591	2283	SO:0001583	missense	150946	exon2			CACTATGTCATCG	AK090454, AB015349, AB124552	CCDS54336.1, CCDS54337.1	2p23.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000157833	ENSG00000157833			27172	protein-coding gene	gene with protein product			"""family with sequence similarity 59, member B"""	FAM59B			Standard	NM_001168241		Approved	KIAA2038, FLJ00375	uc002rgw.2	Q75VX8	OTTHUMG00000151935	ENST00000401533.2:c.214G>T	2.37:g.26399314G>T	ENSP00000384593:p.Val72Phe	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001168241	B5MC97|B7WNK9|Q8NF27|Q9UIK8	Missense_Mutation	SNP	ENST00000401533.2	37	CCDS54336.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975713	0.92982	.	.	ENSG00000157833	ENST00000401533	T	0.14516	2.5	4.94	4.94	0.65067	.	0.185131	0.33916	N	0.004438	T	0.39226	0.1070	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.30679	-0.9970	10	0.87932	D	0	-29.3469	16.7116	0.85387	0.0:0.0:1.0:0.0	.	72	Q75VX8	FA59B_HUMAN	F	72	ENSP00000384593:V72F	ENSP00000384593:V72F	V	+	1	0	FAM59B	26252818	1.000000	0.71417	0.987000	0.45799	0.862000	0.49288	9.298000	0.96132	2.287000	0.76781	0.462000	0.41574	GTC	.		0.612	GAREML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324498.2	NM_001168241	
HLA-DMB	3109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	32906517	32906518	+	Frame_Shift_Ins	INS	-	-	GCCCATT			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr6:32906517_32906518insGCCCATT	ENST00000418107.2	-	2	542_543	c.280_281insAATGGGC	c.(280-282)cttfs	p.L94fs	AL645941.1_ENST00000390777.1_RNA|HLA-DMB_ENST00000416244.2_Frame_Shift_Ins_p.L94fs|XXbac-BPG181M17.5_ENST00000429234.1_Frame_Shift_Ins_p.L126fs	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	94	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)			breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						ACAATTCTGAAGCCCATTGCGC	0.559																																					p.L94fs		.											.	HLA-DMB	90	0			c.281_282insAATGGGC						.																																			SO:0001589	frameshift_variant	3109	exon2			TTCTGAAGCCCAT		CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.274_280dupAATGGGC	6.37:g.32906518_32906524dupGCCCATT	ENSP00000398890:p.Leu94fs	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	45.0	NM_002118	O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Frame_Shift_Ins	INS	ENST00000418107.2	37	CCDS4760.1																																																																																			.		0.559	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076340.2	NM_002118	
HSD3B7	80270	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30997473	30997473	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr16:30997473delA	ENST00000297679.5	+	3	363	c.270delA	c.(268-270)gtafs	p.V90fs	HSD3B7_ENST00000353250.5_Frame_Shift_Del_p.V90fs|AC135048.1_ENST00000602217.1_Frame_Shift_Del_p.Y21fs|HSD3B7_ENST00000262520.6_Frame_Shift_Del_p.V90fs	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	90					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CTGGGCTGGTAGACGTGTTTG	0.627																																					p.V90fs		.											.	HSD3B7	90	0			c.270delA						.						65.0	53.0	57.0					16																	30997473		2197	4300	6497	SO:0001589	frameshift_variant	80270	exon3			GCTGGTAGACGTG	AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.270delA	16.37:g.30997473delA	ENSP00000297679:p.Val90fs	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	43.0	NM_025193	Q96M28|Q9BSN9	Frame_Shift_Del	DEL	ENST00000297679.5	37	CCDS10698.1																																																																																			.		0.627	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255554.2		
IGSF10	285313	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	151161484	151161484	+	Missense_Mutation	SNP	G	G	A	rs369808974		TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr3:151161484G>A	ENST00000282466.3	-	5	5250	c.5251C>T	c.(5251-5253)Cgt>Tgt	p.R1751C	IGSF10_ENST00000495443.1_5'Flank	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1751	Ig-like C2-type 4.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCTTTGGTACGTCTCTCCAGG	0.512																																					p.R1751C		.											.	IGSF10	102	0			c.C5251T						.						130.0	114.0	119.0					3																	151161484		2203	4300	6503	SO:0001583	missense	285313	exon5			TGGTACGTCTCTC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5251C>T	3.37:g.151161484G>A	ENSP00000282466:p.Arg1751Cys	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	51.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284827	0.59867	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.78707	-1.2	5.25	5.25	0.73442	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.617921	0.14325	N	0.326772	D	0.87605	0.6219	M	0.85373	2.75	0.09310	N	0.99999	D	0.76494	0.999	D	0.63033	0.91	T	0.80407	-0.1395	9	.	.	.	.	12.0695	0.53607	0.0:0.0:0.7068:0.2932	.	1751	Q6WRI0	IGS10_HUMAN	C	1751;378	ENSP00000282466:R1751C	.	R	-	1	0	IGSF10	152644174	0.799000	0.28903	0.714000	0.30535	0.993000	0.82548	3.270000	0.51600	2.458000	0.83093	0.585000	0.79938	CGT	.		0.512	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
IL6	3569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	22767222	22767222	+	Missense_Mutation	SNP	T	T	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr7:22767222T>A	ENST00000404625.1	+	3	638	c.179T>A	c.(178-180)aTc>aAc	p.I60N	IL6_ENST00000420258.2_Missense_Mutation_p.I114N|IL6_ENST00000401651.1_Intron|IL6_ENST00000258743.5_Missense_Mutation_p.I60N|IL6_ENST00000406575.1_Missense_Mutation_p.I60N|IL6_ENST00000401630.3_Missense_Mutation_p.I37N|IL6_ENST00000407492.1_Intron|AC073072.5_ENST00000325042.2_RNA			P05231	IL6_HUMAN	interleukin 6	60					acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	ATTCGGTACATCCTCGACGGC	0.592																																					p.I60N	Esophageal Squamous(47;342 1214 13936 33513)	.											.	IL6	514	0			c.T179A						.						103.0	98.0	100.0					7																	22767222		2203	4300	6503	SO:0001583	missense	3569	exon2			GGTACATCCTCGA	M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.179T>A	7.37:g.22767222T>A	ENSP00000385675:p.Ile60Asn	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	56.0	NM_000600	Q9UCU2|Q9UCU3|Q9UCU4	Missense_Mutation	SNP	ENST00000404625.1	37	CCDS5375.1	.	.	.	.	.	.	.	.	.	.	T	16.88	3.244650	0.59103	.	.	ENSG00000136244	ENST00000404625;ENST00000426291;ENST00000258743;ENST00000420258;ENST00000401630;ENST00000406575	T;T;T;T;T;T	0.28069	1.63;1.63;1.63;1.63;1.63;1.63	5.73	4.58	0.56647	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.529823	0.22030	N	0.065612	T	0.49338	0.1551	M	0.62723	1.935	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.995;0.997	T	0.39603	-0.9606	10	0.87932	D	0	-12.0626	8.6145	0.33822	0.0:0.0866:0.0:0.9134	.	114;60;60	B4DNQ5;B5MC14;P05231	.;.;IL6_HUMAN	N	60;60;60;114;37;60	ENSP00000385675:I60N;ENSP00000405150:I60N;ENSP00000258743:I60N;ENSP00000405994:I114N;ENSP00000384928:I37N;ENSP00000385227:I60N	ENSP00000258743:I60N	I	+	2	0	IL6	22733747	0.061000	0.20836	0.001000	0.08648	0.004000	0.04260	3.470000	0.53100	1.112000	0.41740	0.454000	0.30748	ATC	.		0.592	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250225.2	NM_000600	
IQSEC2	23096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53277343	53277343	+	Silent	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chrX:53277343C>T	ENST00000375368.5	-	6	2705	c.2505G>A	c.(2503-2505)cgG>cgA	p.R835R	IQSEC2_ENST00000396435.3_Silent_p.R845R|IQSEC2_ENST00000375365.2_Silent_p.R640R			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	835	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CACCCTGAACCCGGATATGGG	0.587																																					p.R845R		.											.	IQSEC2	178	0			c.G2535A						.						95.0	56.0	69.0					X																	53277343		2203	4300	6503	SO:0001819	synonymous_variant	23096	exon7			CTGAACCCGGATA	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2505G>A	X.37:g.53277343C>T		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	79.0	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	ENST00000375368.5	37																																																																																				.		0.587	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
ISG20	3669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	89182609	89182609	+	Silent	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr15:89182609C>T	ENST00000306072.5	+	2	370	c.12C>T	c.(10-12)agC>agT	p.S4S	ISG20_ENST00000560741.1_Silent_p.S4S|ISG20_ENST00000379224.5_Silent_p.S4S	NM_002201.4	NP_002192.2	Q96AZ6	ISG20_HUMAN	interferon stimulated exonuclease gene 20kDa	4					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA catabolic process, exonucleolytic (GO:0000738)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	3'-5'-exoribonuclease activity (GO:0000175)|exonuclease activity (GO:0004527)|exoribonuclease II activity (GO:0008859)|metal ion binding (GO:0046872)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|U1 snRNA binding (GO:0030619)|U2 snRNA binding (GO:0030620)|U3 snoRNA binding (GO:0034511)			large_intestine(1)|lung(3)|prostate(1)	5	Lung NSC(78;0.0554)|all_lung(78;0.103)		BRCA - Breast invasive adenocarcinoma(143;0.12)			TGGCTGGGAGCCGTGAGGTGG	0.662											OREG0023441	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S4S		.											.	ISG20	90	0			c.C12T						.						26.0	25.0	25.0					15																	89182609		2199	4298	6497	SO:0001819	synonymous_variant	3669	exon2			TGGGAGCCGTGAG	X89773	CCDS10345.1	15q26	2006-02-22	2002-08-29		ENSG00000172183	ENSG00000172183			6130	protein-coding gene	gene with protein product		604533	"""interferon stimulated gene (20kD)"""			9235947, 9605874	Standard	NM_002201		Approved	HEM45, CD25	uc002bmv.1	Q96AZ6	OTTHUMG00000148679	ENST00000306072.5:c.12C>T	15.37:g.89182609C>T		Somatic	52.0	0.0	1265	WXS	Illumina HiSeq	Phase_I	41.0	29.0	NM_002201	O00441|O00586	Silent	SNP	ENST00000306072.5	37	CCDS10345.1																																																																																			.		0.662	ISG20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309069.2	NM_002201	
KANSL1	284058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	44109414	44109414	+	Splice_Site	SNP	T	T	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr17:44109414T>C	ENST00000262419.6	-	14	3559	c.3089A>G	c.(3088-3090)cAg>cGg	p.Q1030R	KANSL1_ENST00000432791.1_Splice_Site_p.Q1030R|KANSL1_ENST00000575318.1_Splice_Site_p.Q966R|KANSL1_ENST00000572904.1_Splice_Site_p.Q1030R|KANSL1_ENST00000393476.3_Splice_Site_p.Q324R|KANSL1_ENST00000574590.1_Splice_Site_p.Q1030R	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	1030	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GTCCCTTACCTGTTCATCCAG	0.622																																					p.Q1030R		.											.	.	.	0			c.A3089G						.						55.0	49.0	51.0					17																	44109414		2203	4300	6503	SO:0001630	splice_region_variant	284058	exon14			CTTACCTGTTCAT	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.3090+1A>G	17.37:g.44109414T>C		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	30.0	NM_001193466	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	37	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.149417	0.78001	.	.	ENSG00000120071	ENST00000262419;ENST00000432791;ENST00000393476	T;T;T	0.24538	2.64;2.64;1.85	5.72	5.72	0.89469	.	0.130718	0.53938	D	0.000059	T	0.17789	0.0427	L	0.27053	0.805	0.33088	D	0.537555	B;B;B;B	0.15141	0.01;0.01;0.012;0.012	B;B;B;B	0.13407	0.009;0.009;0.006;0.006	T	0.16571	-1.0398	10	0.29301	T	0.29	-9.9329	10.1399	0.42730	0.1491:0.0:0.0:0.8509	.	298;361;1030;1030	B3KT49;Q7Z3B3-2;C9JHY2;Q7Z3B3	.;.;.;K1267_HUMAN	R	1030;1030;324	ENSP00000262419:Q1030R;ENSP00000387393:Q1030R;ENSP00000377117:Q324R	ENSP00000262419:Q1030R	Q	-	2	0	KIAA1267	41465261	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	2.838000	0.48199	2.185000	0.69588	0.459000	0.35465	CAG	.		0.622	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	Missense_Mutation
LCE1F	353137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152748923	152748923	+	Missense_Mutation	SNP	A	A	G	rs554010131	byFrequency	TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:152748923A>G	ENST00000334371.2	+	1	76	c.76A>G	c.(76-78)Aca>Gca	p.T26A		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	26	Pro-rich.				keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			caagtgccccacaccgaagtg	0.657																																					p.T26A		.											.	LCE1F	68	0			c.A76G						.						57.0	60.0	59.0					1																	152748923		2203	4300	6503	SO:0001583	missense	353137	exon1			TGCCCCACACCGA		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.76A>G	1.37:g.152748923A>G	ENSP00000334187:p.Thr26Ala	Somatic	481.0	0.0		WXS	Illumina HiSeq	Phase_I	695.0	114.0	NM_178354		Missense_Mutation	SNP	ENST00000334371.2	37	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	A	0.058	-1.230932	0.01518	.	.	ENSG00000240386	ENST00000334371	T	0.03553	3.89	3.56	-7.12	0.01537	.	.	.	.	.	T	0.00906	0.0030	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43032	-0.9416	9	0.87932	D	0	.	12.1466	0.54026	0.571:0.0:0.429:0.0	.	26	Q5T754	LCE1F_HUMAN	A	26	ENSP00000334187:T26A	ENSP00000334187:T26A	T	+	1	0	LCE1F	151015547	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.225000	0.01212	-2.384000	0.00591	-1.259000	0.01468	ACA	.		0.657	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
LTK	4058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41800366	41800366	+	Missense_Mutation	SNP	A	A	G	rs55683312	byFrequency	TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr15:41800366A>G	ENST00000263800.6	-	9	1246	c.1150T>C	c.(1150-1152)Tgc>Cgc	p.C384R	LTK_ENST00000355166.5_Missense_Mutation_p.C323R|LTK_ENST00000561619.1_Missense_Mutation_p.C66R|LTK_ENST00000453182.2_Missense_Mutation_p.C323R	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	384			C -> R (in dbSNP:rs55683312). {ECO:0000269|PubMed:17344846}.		cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CTCAAAGGGCAGTGACTGCAG	0.542										TSP Lung(18;0.14)			A|||	2	0.000399361	0.0	0.0	5008	,	,		21567	0.002		0.0	False		,,,				2504	0.0				p.C384R		.											.	LTK	1377	0			c.T1150C						.						158.0	133.0	141.0					15																	41800366		2203	4300	6503	SO:0001583	missense	4058	exon9			AAGGGCAGTGACT	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1150T>C	15.37:g.41800366A>G	ENSP00000263800:p.Cys384Arg	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	22.0	NM_002344	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	ENST00000263800.6	37	CCDS10077.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	A	18.24	3.581267	0.65992	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;D	0.85013	-1.4;-1.19;-1.93	5.18	4.06	0.47325	.	0.000000	0.37577	U	0.002036	D	0.90208	0.6939	M	0.69823	2.125	0.49389	D	0.999783	D;D;D;D	0.89917	0.994;1.0;1.0;1.0	D;D;D;D	0.97110	0.916;0.95;1.0;0.999	D	0.90506	0.4477	10	0.87932	D	0	.	9.3538	0.38153	0.9152:0.0:0.0848:0.0	rs55683312	323;323;323;384	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	R	384;323;384;323	ENSP00000347293:C323R;ENSP00000263800:C384R;ENSP00000392196:C323R	ENSP00000263800:C384R	C	-	1	0	LTK	39587658	1.000000	0.71417	0.992000	0.48379	0.734000	0.41952	4.964000	0.63701	1.957000	0.56846	0.459000	0.35465	TGC	A|0.999;G|0.001		0.542	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
MLLT4	4301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168314939	168314939	+	Missense_Mutation	SNP	G	G	A	rs149079362	byFrequency	TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr6:168314939G>A	ENST00000447894.2	+	16	2129	c.2129G>A	c.(2128-2130)cGg>cAg	p.R710Q	MLLT4_ENST00000366806.2_Missense_Mutation_p.R710Q|MLLT4_ENST00000392112.1_Missense_Mutation_p.R694Q|MLLT4_ENST00000400822.3_Missense_Mutation_p.R709Q|MLLT4_ENST00000344191.4_Missense_Mutation_p.R710Q|MLLT4_ENST00000351017.4_Missense_Mutation_p.R717Q|MLLT4_ENST00000392108.3_Missense_Mutation_p.R710Q			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	710	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GACCTTAGTCGGATCACACTG	0.403			T	MLL	AL								G|||	7	0.00139776	0.0038	0.0	5008	,	,		18059	0.0		0.002	False		,,,				2504	0.0				p.R710Q		.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	685	0			c.G2129A						.	G	GLN/ARG,GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	90.0	84.0	86.0		2129,2081	6.1	0.6	6	dbSNP_134	86	8,8592	6.4+/-24.3	0,8,4292	yes	missense,missense	MLLT4	NM_001040000.2,NM_001207008.1	43,43	0,11,6492	AA,AG,GG		0.093,0.0681,0.0846	possibly-damaging,possibly-damaging	710/1652,694/1744	168314939	11,12995	2203	4300	6503	SO:0001583	missense	4301	exon16			TTAGTCGGATCAC	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.2129G>A	6.37:g.168314939G>A	ENSP00000404595:p.Arg710Gln	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	63.0	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	ENST00000447894.2	37		4	0.0018315018315018315	2	0.0040650406504065045	0	0.0	0	0.0	2	0.002638522427440633	G	23.1	4.377960	0.82682	6.81E-4	9.3E-4	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04758	3.77;3.67;3.77;3.76;3.56;3.67;3.66	6.07	6.07	0.98685	Dilute (1);	0.000000	0.85682	D	0.000000	T	0.06416	0.0165	L	0.28115	0.83	0.80722	D	1	P;D;D;P	0.67145	0.771;0.991;0.996;0.85	B;P;P;B	0.62649	0.222;0.905;0.852;0.25	T	0.55566	-0.8121	10	0.16420	T	0.52	-23.6197	20.6525	0.99598	0.0:0.0:1.0:0.0	.	710;709;710;694	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	Q	710;717;710;710;694;710;709;710	ENSP00000341118:R710Q;ENSP00000252692:R717Q;ENSP00000375956:R710Q;ENSP00000355771:R710Q;ENSP00000375960:R694Q;ENSP00000383623:R709Q;ENSP00000404595:R710Q	ENSP00000345834:R710Q	R	+	2	0	MLLT4	168057788	1.000000	0.71417	0.646000	0.29493	0.991000	0.79684	7.682000	0.84083	2.890000	0.99128	0.585000	0.79938	CGG	G|0.999;A|0.001		0.403	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
MROH8	140699	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35769604	35769604	+	Silent	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr20:35769604C>T	ENST00000400441.3	-	12	1448	c.1449G>A	c.(1447-1449)ctG>ctA	p.L483L	MROH8_ENST00000217333.8_Intron|MROH8_ENST00000441008.2_Silent_p.L469L			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	368																	CCAAAGTTAGCAGTAATTCTC	0.413																																					.		.											.	.	.	0			.						.						102.0	91.0	94.0					20																	35769604		1860	4101	5961	SO:0001819	synonymous_variant	140699	.			AGTTAGCAGTAAT	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1449G>A	20.37:g.35769604C>T		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	25.0	.	Q5JYQ6	Silent	SNP	ENST00000400441.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.765|4.765	0.142306|0.142306	0.09083|0.09083	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000421643|ENST00000343811;ENST00000400440	.|.	.|.	.|.	6.01|6.01	3.03|3.03	0.35002|0.35002	.|.	.|.	.|.	.|.	.|.	T|T	0.58308|0.58308	0.2113|0.2113	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.51442|0.51442	-0.8705|-0.8705	4|4	.|.	.|.	.|.	-9.6161|-9.6161	9.1073|9.1073	0.36705|0.36705	0.0:0.8096:0.0:0.1904|0.0:0.8096:0.0:0.1904	.|.	.|.	.|.	.|.	T|Y	485|510;514	.|.	.|.	A|C	-|-	1|2	0|0	C20orf132|C20orf132	35203018|35203018	0.485000|0.485000	0.25972|0.25972	0.962000|0.962000	0.40283|0.40283	0.568000|0.568000	0.35870|0.35870	0.183000|0.183000	0.16919|0.16919	0.426000|0.426000	0.26116|0.26116	0.655000|0.655000	0.94253|0.94253	GCT|TGC	.		0.413	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503	
MYO16	23026	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	109707405	109707405	+	Silent	SNP	G	G	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr13:109707405G>A	ENST00000357550.2	+	25	3035	c.2994G>A	c.(2992-2994)aaG>aaA	p.K998K	MYO16_ENST00000457511.2_Silent_p.K510K|MYO16_ENST00000356711.2_Silent_p.K998K	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TATTAAAAAAGAAAGGAACTT	0.378																																					p.K1020K		.											.	MYO16	142	0			c.G3060A						.						45.0	46.0	46.0					13																	109707405		2203	4299	6502	SO:0001819	synonymous_variant	23026	exon26			AAAAAAGAAAGGA		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.2994G>A	13.37:g.109707405G>A		Somatic	336.0	0.0		WXS	Illumina HiSeq	Phase_I	570.0	349.0	NM_001198950		Silent	SNP	ENST00000357550.2	37	CCDS32008.1																																																																																			.		0.378	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
NCOA3	8202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	46265070	46265070	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr20:46265070A>G	ENST00000371998.3	+	12	2131	c.1940A>G	c.(1939-1941)aAa>aGa	p.K647R	NCOA3_ENST00000341724.6_Missense_Mutation_p.K657R|NCOA3_ENST00000372004.3_Missense_Mutation_p.K647R|NCOA3_ENST00000371997.3_Missense_Mutation_p.K657R			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	647	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TCAAGTTGTAAAGAATCTTCT	0.453																																					p.K657R		.											.	NCOA3	229	0			c.A1970G						.						80.0	75.0	77.0					20																	46265070		2203	4300	6503	SO:0001583	missense	8202	exon12			GTTGTAAAGAATC	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1940A>G	20.37:g.46265070A>G	ENSP00000361066:p.Lys647Arg	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	58.0	NM_001174088	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	A	17.55	3.418007	0.62622	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.4	5.4	0.78164	Steroid receptor coactivator (1);	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	L	0.58428	1.81	0.43803	D	0.996352	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;0.999;1.0	T	0.70483	-0.4859	10	0.52906	T	0.07	-29.9474	15.7123	0.77641	1.0:0.0:0.0:0.0	.	647;657;651;647;647;647	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	R	647;657;647;647;657	ENSP00000342123:K657R;ENSP00000361073:K647R;ENSP00000361066:K647R;ENSP00000361065:K657R	ENSP00000345671:K647R	K	+	2	0	NCOA3	45698477	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.678000	0.91211	2.165000	0.68154	0.459000	0.35465	AAA	.		0.453	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
NTRK1	4914	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156849827	156849827	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:156849827C>T	ENST00000524377.1	+	16	2124	c.2083C>T	c.(2083-2085)Ccg>Tcg	p.P695S	NTRK1_ENST00000531606.1_3'UTR|NTRK1_ENST00000392302.2_Missense_Mutation_p.P659S|NTRK1_ENST00000358660.3_Missense_Mutation_p.P692S|NTRK1_ENST00000368196.3_Missense_Mutation_p.P689S	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	695	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		P -> L (in CIPA). {ECO:0000269|PubMed:10861667}.		activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P695S(3)|p.P659S(2)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	TCGCTGGATGCCGCCCGAGAG	0.647			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.P695S		.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1	1393	5	Substitution - Missense(5)	prostate(3)|kidney(2)	c.C2083T						.						62.0	60.0	61.0					1																	156849827		2203	4300	6503	SO:0001583	missense	4914	exon16			TGGATGCCGCCCG	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.2083C>T	1.37:g.156849827C>T	ENSP00000431418:p.Pro695Ser	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	12.0	NM_002529	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817037	0.90790	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	4.23	4.23	0.50019	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000034	T	0.82226	0.4991	N	0.04275	-0.24	0.80722	D	1	D;D;D;D	0.89917	0.995;0.972;0.998;1.0	D;B;P;D	0.78314	0.946;0.29;0.852;0.991	D	0.88267	0.2927	10	0.87932	D	0	.	15.7052	0.77573	0.0:1.0:0.0:0.0	.	692;689;695;659	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	S	659;689;695;692	ENSP00000376120:P659S;ENSP00000357179:P689S;ENSP00000431418:P695S;ENSP00000351486:P692S	ENSP00000351486:P692S	P	+	1	0	NTRK1	155116451	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	7.388000	0.79795	2.362000	0.80069	0.561000	0.74099	CCG	.		0.647	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
NUP88	4927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	5290351	5290351	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr17:5290351G>T	ENST00000573584.1	-	15	2505	c.1996C>A	c.(1996-1998)Cag>Aag	p.Q666K	NUP88_ENST00000573169.1_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	666					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						GGTATCAGCTGTAATTCTTTC	0.378																																					p.Q666K		.											.	NUP88	204	0			c.C1996A						.						107.0	107.0	107.0					17																	5290351		2203	4300	6503	SO:0001583	missense	4927	exon15			TCAGCTGTAATTC	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.1996C>A	17.37:g.5290351G>T	ENSP00000458954:p.Gln666Lys	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	43.0	NM_002532	D3DTM2|Q9BWE5	Missense_Mutation	SNP	ENST00000573584.1	37	CCDS11070.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.353546	0.61293	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	4.63	3.64	0.41730	.	0.121851	0.56097	D	0.000024	T	0.49457	0.1558	L	0.45137	1.4	0.44214	D	0.997046	B;B	0.31125	0.067;0.309	B;B	0.31946	0.044;0.138	T	0.47142	-0.9140	9	0.31617	T	0.26	-10.4131	14.1283	0.65235	0.0:0.1512:0.8488:0.0	.	551;666	B4DP20;Q99567	.;NUP88_HUMAN	K	666;551	.	ENSP00000225696:Q666K	Q	-	1	0	NUP88	5231075	1.000000	0.71417	0.981000	0.43875	0.994000	0.84299	5.248000	0.65421	1.284000	0.44531	0.557000	0.71058	CAG	.		0.378	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228494331	228494331	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:228494331C>T	ENST00000422127.1	+	44	11962	c.11918C>T	c.(11917-11919)aCt>aTt	p.T3973I	OBSCN_ENST00000366707.4_Missense_Mutation_p.T1607I|OBSCN_ENST00000366709.4_Missense_Mutation_p.T1092I|OBSCN_ENST00000570156.2_Missense_Mutation_p.T4930I|OBSCN_ENST00000284548.11_Missense_Mutation_p.T3973I	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3973	Ig-like 40.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCCACCCTCACTGTCACAGGT	0.632																																					p.T4930I		.											.	OBSCN	403	0			c.C14789T						.						19.0	22.0	21.0					1																	228494331		2104	4213	6317	SO:0001583	missense	84033	exon55			CCCTCACTGTCAC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11918C>T	1.37:g.228494331C>T	ENSP00000409493:p.Thr3973Ile	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	50.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	13.04	2.119446	0.37436	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.22	3.33	0.38152	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.711645	0.13144	N	0.410406	T	0.75671	0.3881	L	0.60904	1.88	0.09310	N	1	D;P	0.89917	1.0;0.798	D;P	0.91635	0.999;0.454	T	0.62464	-0.6849	10	0.22109	T	0.4	.	10.0964	0.42478	0.0:0.771:0.0:0.229	.	3973;3973	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	I	3973;3973;1607;1092	ENSP00000284548:T3973I;ENSP00000409493:T3973I;ENSP00000355668:T1607I;ENSP00000355670:T1092I	ENSP00000284548:T3973I	T	+	2	0	OBSCN	226560954	0.000000	0.05858	0.017000	0.16124	0.293000	0.27360	-0.227000	0.09126	0.582000	0.29556	0.407000	0.27541	ACT	.		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR4M1	441670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	20249255	20249255	+	Nonsense_Mutation	SNP	C	C	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr14:20249255C>A	ENST00000315957.4	+	1	855	c.774C>A	c.(772-774)taC>taA	p.Y258*		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATCCATCTACATTTATGCTC	0.408																																					p.Y258X		.											.	OR4M1	68	0			c.C774A						.						223.0	210.0	214.0					14																	20249255		2203	4300	6503	SO:0001587	stop_gained	441670	exon1			CATCTACATTTAT		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.774C>A	14.37:g.20249255C>A	ENSP00000319654:p.Tyr258*	Somatic	355.0	0.0		WXS	Illumina HiSeq	Phase_I	368.0	82.0	NM_001005500	B9EH18|Q6IFA3	Nonsense_Mutation	SNP	ENST00000315957.4	37	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	24.2	4.503729	0.85176	.	.	ENSG00000176299	ENST00000315957	.	.	.	4.42	1.6	0.23607	.	0.000000	0.45126	D	0.000398	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-12.9251	7.8655	0.29535	0.0:0.7092:0.0:0.2908	.	.	.	.	X	258	.	ENSP00000319654:Y258X	Y	+	3	2	OR4M1	19319095	0.595000	0.26857	1.000000	0.80357	0.979000	0.70002	0.075000	0.14686	0.616000	0.30141	0.506000	0.49869	TAC	.		0.408	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
OSR1	130497	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	19553505	19553505	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr2:19553505T>C	ENST00000272223.2	-	2	406	c.62A>G	c.(61-63)tAc>tGc	p.Y21C	OSR1_ENST00000536433.1_Missense_Mutation_p.Y21C	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	21					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				AAGGAAGGAGTAGTTGGTGAG	0.582																																					p.Y21C		.											.	OSR1	257	0			c.A62G						.						56.0	53.0	54.0					2																	19553505		2203	4300	6503	SO:0001583	missense	130497	exon2			AAGGAGTAGTTGG	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.62A>G	2.37:g.19553505T>C	ENSP00000272223:p.Tyr21Cys	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	16.0	NM_145260	B3KV97|D6W521	Missense_Mutation	SNP	ENST00000272223.2	37	CCDS1694.1	.	.	.	.	.	.	.	.	.	.	T	15.08	2.727856	0.48833	.	.	ENSG00000143867	ENST00000272223;ENST00000536433	T;T	0.08807	3.05;3.05	5.5	5.5	0.81552	.	0.054794	0.85682	D	0.000000	T	0.11196	0.0273	L	0.59436	1.845	0.50171	D	0.999853	B	0.21520	0.057	B	0.15870	0.014	T	0.07083	-1.0791	9	.	.	.	-30.654	15.6005	0.76620	0.0:0.0:0.0:1.0	.	21	Q8TAX0	OSR1_HUMAN	C	21	ENSP00000272223:Y21C;ENSP00000441801:Y21C	.	Y	-	2	0	OSR1	19416986	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.176000	0.58269	2.223000	0.72356	0.454000	0.30748	TAC	.		0.582	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	NM_145260	
OTOP2	92736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72926856	72926856	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr17:72926856G>C	ENST00000580223.1	+	5	1156	c.1126G>C	c.(1126-1128)Gcc>Ccc	p.A376P	OTOP2_ENST00000331427.4_Missense_Mutation_p.A376P			Q7RTS6	OTOP2_HUMAN	otopetrin 2	376						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					GATGGGTGCCGCCCTGGGTCA	0.637																																					p.A376P		.											.	OTOP2	134	0			c.G1126C						.						76.0	67.0	70.0					17																	72926856		2203	4300	6503	SO:0001583	missense	92736	exon6			GGTGCCGCCCTGG	BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1126G>C	17.37:g.72926856G>C	ENSP00000463837:p.Ala376Pro	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	68.0	NM_178160		Missense_Mutation	SNP	ENST00000580223.1	37	CCDS11708.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449374	0.84101	.	.	ENSG00000183034	ENST00000331427	T	0.25250	1.81	5.47	5.47	0.80525	.	0.062767	0.64402	D	0.000003	T	0.54532	0.1864	M	0.79011	2.435	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	T	0.52170	-0.8611	10	0.40728	T	0.16	-18.7953	19.3792	0.94525	0.0:0.0:1.0:0.0	.	376	Q7RTS6	OTOP2_HUMAN	P	376	ENSP00000332528:A376P	ENSP00000332528:A376P	A	+	1	0	OTOP2	70438451	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	6.164000	0.71885	2.581000	0.87130	0.456000	0.33151	GCC	.		0.637	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160	
PCCA	5095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	100925472	100925472	+	Silent	SNP	C	C	A	rs138149179		TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr13:100925472C>A	ENST00000376285.1	+	12	975	c.937C>A	c.(937-939)Cga>Aga	p.R313R	PCCA_ENST00000376286.4_Silent_p.R287R|PCCA_ENST00000376279.3_Silent_p.R313R	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	313	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TGCGGAGACTCGAAGAGCGAT	0.378																																					p.R313R		.											.	PCCA	227	0			c.C937A	GRCh37	CM991019	PCCA	M	rs138149179	.						80.0	83.0	82.0					13																	100925472		2203	4300	6503	SO:0001819	synonymous_variant	5095	exon12			GAGACTCGAAGAG	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.937C>A	13.37:g.100925472C>A		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	57.0	NM_001178004	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Silent	SNP	ENST00000376285.1	37	CCDS9496.2																																																																																			C|0.999;T|0.000		0.378	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		
PCDHA1	56147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140167835	140167835	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr5:140167835C>G	ENST00000504120.2	+	1	1960	c.1960C>G	c.(1960-1962)Cac>Gac	p.H654D	PCDHA1_ENST00000378133.3_Missense_Mutation_p.H654D|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	654	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTGAAGGATCACGGTGAGCC	0.662																																					p.H654D		.											.	PCDHA1	23	0			c.C1960G						.						50.0	56.0	54.0					5																	140167835		2203	4300	6503	SO:0001583	missense	56147	exon1			AAGGATCACGGTG	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1960C>G	5.37:g.140167835C>G	ENSP00000420840:p.His654Asp	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	38.0	NM_031410	O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	c	12.01	1.810365	0.32053	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.51817	0.69;0.69	3.89	3.89	0.44902	Cadherin (4);Cadherin-like (1);	0.000000	0.41396	U	0.000888	T	0.67202	0.2868	M	0.78456	2.415	0.29879	N	0.826163	D;D	0.76494	0.999;0.985	D;D	0.73380	0.98;0.92	T	0.67945	-0.5539	10	0.87932	D	0	.	13.2056	0.59793	0.0:0.8261:0.1739:0.0	.	654;654	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	D	654	ENSP00000420840:H654D;ENSP00000367373:H654D	ENSP00000367373:H654D	H	+	1	0	PCDHA1	140148019	0.000000	0.05858	1.000000	0.80357	0.122000	0.20287	0.064000	0.14437	1.876000	0.54355	0.650000	0.86243	CAC	.		0.662	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
PCDHB16	57717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140562669	140562669	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr5:140562669C>T	ENST00000361016.2	+	1	1690	c.535C>T	c.(535-537)Cgg>Tgg	p.R179W		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCTCATTTCCGGGTTCTAAT	0.448																																					p.R179W		.											.	PCDHB16	92	0			c.C535T						.						45.0	48.0	47.0					5																	140562669		2202	4300	6502	SO:0001583	missense	57717	exon1			CATTTCCGGGTTC	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.535C>T	5.37:g.140562669C>T	ENSP00000354293:p.Arg179Trp	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	16.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795997	0.50208	.	.	ENSG00000196963	ENST00000361016	T	0.20598	2.06	4.69	0.829	0.18847	Cadherin (4);Cadherin-like (1);	1.494410	0.04967	N	0.463091	T	0.35508	0.0934	M	0.84433	2.695	0.09310	N	1	P	0.47191	0.891	P	0.48488	0.579	T	0.19549	-1.0302	10	0.72032	D	0.01	.	3.0352	0.06119	0.2003:0.4988:0.103:0.1979	.	179	Q9NRJ7	PCDBG_HUMAN	W	179	ENSP00000354293:R179W	ENSP00000354293:R179W	R	+	1	2	PCDHB16	140542853	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-1.712000	0.01885	0.085000	0.17107	-0.789000	0.03336	CGG	.		0.448	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PDRG1	81572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	30538175	30538175	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr20:30538175T>C	ENST00000202017.4	-	2	233	c.103A>G	c.(103-105)Act>Gct	p.T35A		NM_030815.2	NP_110442.1	Q9NUG6	PDRG1_HUMAN	p53 and DNA-damage regulated 1	35					protein folding (GO:0006457)	cytoplasm (GO:0005737)|prefoldin complex (GO:0016272)				endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	8			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TTCCTTTTAGTGTCCAGGTCC	0.522																																					p.T35A		.											.	PDRG1	90	0			c.A103G						.						82.0	81.0	81.0					20																	30538175		2203	4300	6503	SO:0001583	missense	81572	exon2			TTTTAGTGTCCAG	AL031658	CCDS13194.1	20q11.21	2009-06-12	2009-06-12	2004-10-07	ENSG00000088356	ENSG00000088356			16119	protein-coding gene	gene with protein product		610789	"""chromosome 20 open reading frame 126"""	C20orf126		14562055	Standard	NM_030815		Approved	dJ310O13.3	uc002wxd.3	Q9NUG6	OTTHUMG00000032196	ENST00000202017.4:c.103A>G	20.37:g.30538175T>C	ENSP00000202017:p.Thr35Ala	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	44.0	NM_030815	B2R511|Q96GP3|Q9BUW8	Missense_Mutation	SNP	ENST00000202017.4	37	CCDS13194.1	.	.	.	.	.	.	.	.	.	.	T	2.667	-0.278482	0.05679	.	.	ENSG00000088356	ENST00000202017	T	0.42131	0.98	4.18	1.74	0.24563	Prefoldin beta-like (1);	0.936195	0.09135	N	0.843835	T	0.27866	0.0686	L	0.36672	1.1	0.25358	N	0.988807	B	0.06786	0.001	B	0.09377	0.004	T	0.24190	-1.0167	10	0.23891	T	0.37	-5.0751	2.9713	0.05924	0.2145:0.1161:0.0:0.6694	.	35	Q9NUG6	PDRG1_HUMAN	A	35	ENSP00000202017:T35A	ENSP00000202017:T35A	T	-	1	0	PDRG1	30001836	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.529000	0.23019	0.758000	0.33059	0.460000	0.39030	ACT	.		0.522	PDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078593.2	NM_030815	
PHF2	5253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	96416768	96416768	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr9:96416768C>G	ENST00000359246.4	+	7	1230	c.863C>G	c.(862-864)tCt>tGt	p.S288C	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	288	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CGGTCTGCCTCTAACCACAGC	0.587																																					p.S288C		.											.	PHF2	91	0			c.C863G						.						106.0	95.0	98.0					9																	96416768		2203	4300	6503	SO:0001583	missense	5253	exon7			CTGCCTCTAACCA	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.863C>G	9.37:g.96416768C>G	ENSP00000352185:p.Ser288Cys	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	40.0	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	37	CCDS35069.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490545	0.84962	.	.	ENSG00000197724	ENST00000359246	T	0.72282	-0.64	5.12	5.12	0.69794	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.186594	0.47852	D	0.000203	T	0.75946	0.3919	M	0.82923	2.615	0.80722	D	1	P	0.44986	0.847	B	0.41510	0.359	T	0.81193	-0.1044	10	0.59425	D	0.04	-10.5597	18.7374	0.91761	0.0:1.0:0.0:0.0	.	288	O75151	PHF2_HUMAN	C	288	ENSP00000352185:S288C	ENSP00000352185:S288C	S	+	2	0	PHF2	95456589	1.000000	0.71417	0.588000	0.28705	0.994000	0.84299	7.543000	0.82106	2.644000	0.89710	0.585000	0.79938	TCT	.		0.587	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
PHF3	23469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	64401788	64401788	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr6:64401788C>G	ENST00000262043.3	+	5	2691	c.2351C>G	c.(2350-2352)aCt>aGt	p.T784S	PHF3_ENST00000393387.1_Missense_Mutation_p.T784S			Q92576	PHF3_HUMAN	PHD finger protein 3	784					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GATCCAGATACTTTGGAAAAC	0.368																																					p.T784S	GBM(135;136 1820 29512 34071 46235)	.											.	PHF3	229	0			c.C2351G						.						109.0	107.0	107.0					6																	64401788		2203	4300	6503	SO:0001583	missense	23469	exon4			CAGATACTTTGGA	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.2351C>G	6.37:g.64401788C>G	ENSP00000262043:p.Thr784Ser	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	104.0	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	37	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	C	9.361	1.068130	0.20067	.	.	ENSG00000118482	ENST00000506783;ENST00000481385;ENST00000515594;ENST00000262043;ENST00000494284;ENST00000393387	T;T;T;T;T;T	0.45668	2.22;1.91;0.89;2.25;1.91;2.25	4.96	-3.18	0.05186	.	1.105820	0.07078	N	0.836602	T	0.08358	0.0208	N	0.22421	0.69	0.09310	N	0.99999	B	0.15141	0.012	B	0.12156	0.007	T	0.30387	-0.9980	10	0.20519	T	0.43	0.007	5.5428	0.17047	0.1153:0.2751:0.0:0.6096	.	784	Q92576	PHF3_HUMAN	S	598;696;53;784;737;784	ENSP00000424694:T598S;ENSP00000425227:T696S;ENSP00000425338:T53S;ENSP00000262043:T784S;ENSP00000424078:T737S;ENSP00000377048:T784S	ENSP00000262043:T784S	T	+	2	0	PHF3	64459747	0.083000	0.21467	0.675000	0.29917	0.963000	0.63663	0.288000	0.18939	-0.631000	0.05560	-0.438000	0.05819	ACT	.		0.368	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
PIPOX	51268	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27380528	27380528	+	Missense_Mutation	SNP	G	G	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr17:27380528G>A	ENST00000323372.4	+	4	901	c.575G>A	c.(574-576)aGc>aAc	p.S192N	PIPOX_ENST00000583215.1_3'UTR	NM_016518.2	NP_057602.2	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase	192					L-lysine catabolic process to acetyl-CoA via L-pipecolate (GO:0033514)|oxidation-reduction process (GO:0055114)|tetrahydrofolate metabolic process (GO:0046653)	peroxisome (GO:0005777)	L-pipecolate oxidase activity (GO:0050031)|receptor binding (GO:0005102)|sarcosine oxidase activity (GO:0008115)			endometrium(2)|large_intestine(4)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	ACCTCCAGGAGCTACCAAGCT	0.562																																					p.S192N		.											.	PIPOX	90	0			c.G575A						.						116.0	105.0	109.0					17																	27380528		2203	4300	6503	SO:0001583	missense	51268	exon4			CCAGGAGCTACCA	AF134593	CCDS11248.1	17p13.2	2008-07-18			ENSG00000179761	ENSG00000179761			17804	protein-coding gene	gene with protein product	"""L-pipecolic acid oxidase"""					10772957, 10642506	Standard	NM_016518		Approved	LPIPOX	uc002hdr.1	Q9P0Z9	OTTHUMG00000132679	ENST00000323372.4:c.575G>A	17.37:g.27380528G>A	ENSP00000317721:p.Ser192Asn	Somatic	185.0	1.0		WXS	Illumina HiSeq	Phase_I	216.0	103.0	NM_016518	B3KNH0|Q96H28|Q9C070	Missense_Mutation	SNP	ENST00000323372.4	37	CCDS11248.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.520665	0.27211	.	.	ENSG00000179761	ENST00000323372;ENST00000419875	D	0.85556	-2.0	5.77	4.73	0.59995	FAD dependent oxidoreductase (1);	0.191804	0.64402	D	0.000018	T	0.72495	0.3467	L	0.35542	1.07	0.29053	N	0.884393	B	0.13594	0.008	B	0.17979	0.02	T	0.55522	-0.8128	10	0.17832	T	0.49	-17.4279	4.0888	0.09960	0.086:0.2001:0.5694:0.1445	.	192	Q9P0Z9	SOX_HUMAN	N	192;123	ENSP00000317721:S192N	ENSP00000317721:S192N	S	+	2	0	PIPOX	24404654	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	1.652000	0.37313	2.884000	0.98904	0.655000	0.94253	AGC	.		0.562	PIPOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255954.1	NM_016518	
PKD1L3	342372	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	71967898	71967898	+	RNA	SNP	T	T	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr16:71967898T>A	ENST00000534738.1	-	0	4739				RP11-498D10.6_ENST00000573861.1_RNA			Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						CTCAGTGTCCTGCTGATGACC	0.587																																					.		.											.	PKD1L3	68	0			.						.						40.0	41.0	41.0					16																	71967898		692	1591	2283			342372	.			GTGTCCTGCTGAT	AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.71967898T>A		Somatic	167.0	1.0		WXS	Illumina HiSeq	Phase_I	136.0	48.0	.		RNA	SNP	ENST00000534738.1	37																																																																																				.		0.587	PKD1L3-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000387876.1	NM_181536	
PLA2G4D	283748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42378519	42378519	+	Silent	SNP	A	A	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr15:42378519A>G	ENST00000290472.3	-	4	373	c.279T>C	c.(277-279)taT>taC	p.Y93Y		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	93	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		AGTCCTCATCATAGATGCTAA	0.488																																					p.Y93Y		.											.	PLA2G4D	136	0			c.T279C						.						118.0	101.0	107.0					15																	42378519		2203	4299	6502	SO:0001819	synonymous_variant	283748	exon4			CTCATCATAGATG	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.279T>C	15.37:g.42378519A>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	30.0	NM_178034	Q8N176	Silent	SNP	ENST00000290472.3	37	CCDS32203.1																																																																																			.		0.488	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034	
POC5	134359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74998430	74998430	+	Splice_Site	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr5:74998430C>T	ENST00000428202.2	-	5	702	c.513G>A	c.(511-513)aaG>aaA	p.K171K	POC5_ENST00000504862.1_5'UTR|POC5_ENST00000514838.2_Splice_Site_p.K143K|POC5_ENST00000380475.2_Splice_Site_p.K54K|POC5_ENST00000510798.1_Splice_Site_p.K54K|POC5_ENST00000446329.2_Splice_Site_p.K146K	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	171					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGTACCGTACCTTAAGACCTG	0.323																																					p.K171K		.											.	POC5	45	0			c.G513A						.						77.0	71.0	73.0					5																	74998430		1868	4092	5960	SO:0001630	splice_region_variant	134359	exon5			CCGTACCTTAAGA	AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.513+1G>A	5.37:g.74998430C>T		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	27.0	NM_001099271	B4DJG7|Q494X7|Q494X9|Q6P085	Silent	SNP	ENST00000428202.2	37	CCDS47236.1																																																																																			.		0.323	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369124.1	NM_152408	Silent
PRAMEF4	400735	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	12942131	12942131	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:12942131C>G	ENST00000235349.5	-	3	489	c.419G>C	c.(418-420)tGt>tCt	p.C140S		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	140					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CATCCTTGGACAGTCCTCCAC	0.502																																					p.C140S		.											.	PRAMEF4	45	0			c.G419C						.						57.0	68.0	64.0					1																	12942131		1385	2632	4017	SO:0001583	missense	400735	exon3			CTTGGACAGTCCT		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.419G>C	1.37:g.12942131C>G	ENSP00000235349:p.Cys140Ser	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	13.0	9.0	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	c	0.412	-0.912648	0.02415	.	.	ENSG00000243073	ENST00000235349	T	0.15372	2.43	1.48	-2.96	0.05547	.	2.951090	0.00993	N	0.003547	T	0.11281	0.0275	L	0.31578	0.945	0.09310	N	1	B	0.19200	0.034	B	0.23574	0.047	T	0.16100	-1.0414	10	0.16420	T	0.52	.	2.8078	0.05432	0.4209:0.401:0.0:0.1781	.	140	O60810	PRAM4_HUMAN	S	140	ENSP00000235349:C140S	ENSP00000235349:C140S	C	-	2	0	PRAMEF4	12864718	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.500000	0.06405	-0.836000	0.04229	0.400000	0.26472	TGT	.		0.502	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
PRNP	5621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	4680289	4680289	+	Silent	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr20:4680289C>T	ENST00000379440.4	+	2	710	c.423C>T	c.(421-423)ttC>ttT	p.F141F	PRNP_ENST00000430350.2_Silent_p.F141F	NM_000311.3|NM_001080121.1|NM_001080122.1|NM_001080123.1|NM_001271561.1|NM_183079.2	NP_000302.1|NP_001073590.1|NP_001073591.1|NP_001073592.1|NP_001258490.1|NP_898902.1	F7VJQ1	APRIO_HUMAN	prion protein	0						integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	14						TCATACATTTCGGCAGTGACT	0.547																																					p.F141F		.											.	PRNP	514	0			c.C423T						.						98.0	73.0	82.0					20																	4680289		2203	4300	6503	SO:0001819	synonymous_variant	5621	exon2			ACATTTCGGCAGT	M13899	CCDS13080.1	20p13	2014-06-05	2008-07-28		ENSG00000171867	ENSG00000171867		"""CD molecules"""	9449	protein-coding gene	gene with protein product	"""Creutzfeldt-Jakob disease"", ""Gerstmann-Strausler-Scheinker syndrome"", ""fatal familial insomnia"", ""p27-30"""	176640	"""prion protein (p27-30)"""	PRIP, GSS, CJD			Standard	NM_000311		Approved	CD230, PRP, AltPrP	uc002wkw.4	F7VJQ1	OTTHUMG00000031786	ENST00000379440.4:c.423C>T	20.37:g.4680289C>T		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	23.0	NM_000311		Silent	SNP	ENST00000379440.4	37	CCDS13080.1																																																																																			.		0.547	PRNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077820.2	NM_000311	
PRRT4	401399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	127999248	127999248	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr7:127999248C>T	ENST00000446477.2	-	4	1025	c.712G>A	c.(712-714)Gaa>Aaa	p.E238K	PRRT4_ENST00000435512.1_Missense_Mutation_p.E238K|PRRT4_ENST00000535159.1_Missense_Mutation_p.E238K|PRRT4_ENST00000489835.2_Missense_Mutation_p.E238K	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	238						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						GATGTAGTTTCACCTGGGGGG	0.527																																					p.E238K		.											.	.	.	0			c.G712A						.						66.0	72.0	70.0					7																	127999248		692	1591	2283	SO:0001583	missense	401399	exon4			TAGTTTCACCTGG	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.712G>A	7.37:g.127999248C>T	ENSP00000415026:p.Glu238Lys	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	71.0	NM_001174164	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	37	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	C	5.942	0.357796	0.11239	.	.	ENSG00000224940	ENST00000489835;ENST00000446477;ENST00000535159;ENST00000435512;ENST00000489517	.	.	.	4.3	0.714	0.18180	.	.	.	.	.	T	0.16557	0.0398	N	0.08118	0	0.09310	N	1	B;B	0.18310	0.017;0.027	B;B	0.18263	0.016;0.021	T	0.19976	-1.0289	8	0.44086	T	0.13	-0.1235	4.0527	0.09803	0.0:0.2428:0.3059:0.4512	.	238;238	C9JH25;C9JH25-2	PRRT4_HUMAN;.	K	238	.	ENSP00000410779:E238K	E	-	1	0	PRRT4	127786484	0.000000	0.05858	0.000000	0.03702	0.225000	0.24961	0.067000	0.14510	0.322000	0.23283	0.585000	0.79938	GAA	.		0.527	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
RASA3	22821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	114751254	114751254	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr13:114751254T>G	ENST00000334062.7	-	23	2382	c.2261A>C	c.(2260-2262)aAa>aCa	p.K754T	RASA3_ENST00000389544.4_Missense_Mutation_p.K722T	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	754					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.K754T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ATACACAGATTTGCTCCCACA	0.642																																					p.K754T		.											.	RASA3	658	1	Substitution - Missense(1)	ovary(1)	c.A2261C						.						78.0	72.0	74.0					13																	114751254		2203	4300	6503	SO:0001583	missense	22821	exon23			ACAGATTTGCTCC		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.2261A>C	13.37:g.114751254T>G	ENSP00000335029:p.Lys754Thr	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	89.0	NM_007368	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	T	5.198	0.222060	0.09863	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	D;D	0.86164	-1.97;-2.08	4.78	2.5	0.30297	.	0.097591	0.64402	D	0.000002	T	0.82185	0.4982	L	0.51422	1.61	0.80722	D	1	B	0.14438	0.01	B	0.31495	0.131	T	0.70174	-0.4944	9	.	.	.	.	6.9812	0.24704	0.0:0.1998:0.0:0.8002	.	754	Q14644	RASA3_HUMAN	T	754;722	ENSP00000335029:K754T;ENSP00000374195:K722T	.	K	-	2	0	RASA3	113769356	1.000000	0.71417	0.973000	0.42090	0.311000	0.27955	2.172000	0.42463	0.276000	0.22118	-0.415000	0.06103	AAA	.		0.642	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
SENP7	57337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	101136470	101136470	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr3:101136470T>C	ENST00000394095.2	-	5	502	c.449A>G	c.(448-450)gAa>gGa	p.E150G	SENP7_ENST00000348610.3_Missense_Mutation_p.E117G|SENP7_ENST00000394091.1_Intron|SENP7_ENST00000394094.2_Missense_Mutation_p.E150G|SENP7_ENST00000314261.7_Intron|SENP7_ENST00000358203.3_Intron	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	150						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GCGAAGAGGTTCTAATTTTTG	0.373																																					p.E150G		.											.	SENP7	661	0			c.A449G						.						180.0	167.0	171.0					3																	101136470		1865	4117	5982	SO:0001583	missense	57337	exon5			AGAGGTTCTAATT		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.449A>G	3.37:g.101136470T>C	ENSP00000377655:p.Glu150Gly	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	34.0	NM_020654	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	ENST00000394095.2	37	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	T	15.38	2.816145	0.50527	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000348610	T;T;T	0.49139	0.79;0.79;0.79	5.67	5.67	0.87782	.	0.387118	0.24922	N	0.034526	T	0.36248	0.0960	L	0.51422	1.61	0.80722	D	1	P;B	0.36837	0.571;0.435	B;B	0.30855	0.121;0.078	T	0.27088	-1.0084	10	0.36615	T	0.2	-6.6264	7.2314	0.26045	0.0:0.1232:0.0:0.8768	.	117;150	Q9BQF6-2;Q9BQF6	.;SENP7_HUMAN	G	150;150;117	ENSP00000377655:E150G;ENSP00000377654:E150G;ENSP00000342159:E117G	ENSP00000342159:E117G	E	-	2	0	SENP7	102619160	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	1.217000	0.32455	2.285000	0.76669	0.528000	0.53228	GAA	.		0.373	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
SERBP1	26135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67895954	67895954	+	Silent	SNP	G	G	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:67895954G>T	ENST00000370995.2	-	1	115	c.30C>A	c.(28-30)ggC>ggA	p.G10G	SERBP1_ENST00000361219.6_Silent_p.G10G|SERBP1_ENST00000370994.4_Silent_p.G10G|SERBP1_ENST00000370990.5_Silent_p.G10G			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	10					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						TGACCACGCAGCCGAAGCCTT	0.617																																					p.G10G		.											.	SERBP1	91	0			c.C30A						.						53.0	59.0	57.0					1																	67895954		2195	4269	6464	SO:0001819	synonymous_variant	26135	exon1			CACGCAGCCGAAG	AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.30C>A	1.37:g.67895954G>T		Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	50.0	NM_001018067	Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Silent	SNP	ENST00000370995.2	37	CCDS30746.1																																																																																			.		0.617	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025984.2	NM_001018067	
SFMBT2	57713	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	7205790	7205790	+	Frame_Shift_Del	DEL	T	T	-			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr10:7205790delT	ENST00000361972.4	-	21	2717	c.2627delA	c.(2626-2628)aagfs	p.K876fs	SFMBT2_ENST00000397167.1_Frame_Shift_Del_p.K876fs	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	876	SAM.				negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GTGGCATAACTTGATGGCAGG	0.572																																					p.K876fs		.											.	SFMBT2	141	0			c.2627delA						.						108.0	90.0	96.0					10																	7205790		2203	4300	6503	SO:0001589	frameshift_variant	57713	exon21			CATAACTTGATGG	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.2627delA	10.37:g.7205790delT	ENSP00000355109:p.Lys876fs	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	37.0	NM_001029880	A7MD09|Q9HCF5	Frame_Shift_Del	DEL	ENST00000361972.4	37	CCDS31138.1																																																																																			.		0.572	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
SLC29A2	3177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66135014	66135014	+	Silent	SNP	A	A	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr11:66135014A>G	ENST00000357440.2	-	7	882	c.654T>C	c.(652-654)ttT>ttC	p.F218F	SLC29A2_ENST00000311161.7_Silent_p.F218F|SLC29A2_ENST00000544554.1_Silent_p.F218F|SLC29A2_ENST00000546034.1_Silent_p.F218F	NM_001532.2	NP_001523.2	Q14542	S29A2_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 2	218					cell proliferation (GO:0008283)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10					Didanosine(DB00900)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Zalcitabine(DB00943)|Zidovudine(DB00495)	AGTAGCGGGCAAACTTCTGCA	0.597																																					p.F218F		.											.	SLC29A2	91	0			c.T654C						.						122.0	110.0	114.0					11																	66135014		2200	4295	6495	SO:0001819	synonymous_variant	3177	exon7			GCGGGCAAACTTC	X86681	CCDS8137.1, CCDS73326.1	11q13	2013-07-17	2013-07-17		ENSG00000174669	ENSG00000174669		"""Solute carriers"""	11004	protein-coding gene	gene with protein product		602110	"""solute carrier family 29 (nucleoside transporters), member 2"""	ENT2, HNP36		9192854, 9478986	Standard	NM_001532		Approved	DER12	uc001oht.3	Q14542	OTTHUMG00000169056	ENST00000357440.2:c.654T>C	11.37:g.66135014A>G		Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	56.0	NM_001532	B3KPY7|O43530|Q52M84|Q96R00|Q9UPE0	Silent	SNP	ENST00000357440.2	37	CCDS8137.1																																																																																			.		0.597	SLC29A2-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402093.1	NM_001532	
SLC30A1	7779	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	211749002	211749002	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:211749002G>T	ENST00000367001.4	-	2	1381	c.1252C>A	c.(1252-1254)Cag>Aag	p.Q418K		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	418					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		AATTCAGGCTGAATGGTAGTA	0.428																																					p.Q418K		.											.	SLC30A1	93	0			c.C1252A						.						112.0	103.0	106.0					1																	211749002		2203	4299	6502	SO:0001583	missense	7779	exon2			CAGGCTGAATGGT	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.1252C>A	1.37:g.211749002G>T	ENSP00000355968:p.Gln418Lys	Somatic	107.0	1.0		WXS	Illumina HiSeq	Phase_I	125.0	120.0	NM_021194	Q0VAK9|Q9BZF6	Missense_Mutation	SNP	ENST00000367001.4	37	CCDS1499.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541156	0.85917	.	.	ENSG00000170385	ENST00000367001	T	0.55413	0.52	5.69	5.69	0.88448	.	0.124150	0.56097	D	0.000022	D	0.84234	0.5427	H	0.98333	4.205	0.80722	D	1	D	0.56521	0.976	D	0.69824	0.966	D	0.90002	0.4115	10	0.87932	D	0	-12.0654	19.8182	0.96579	0.0:0.0:1.0:0.0	.	418	Q9Y6M5	ZNT1_HUMAN	K	418	ENSP00000355968:Q418K	ENSP00000355968:Q418K	Q	-	1	0	SLC30A1	209815625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.502000	0.97981	2.687000	0.91594	0.563000	0.77884	CAG	.		0.428	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
SLC5A8	160728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	101561932	101561932	+	Frame_Shift_Del	DEL	C	C	-			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr12:101561932delC	ENST00000536262.2	-	11	1820	c.1262delG	c.(1261-1263)ggtfs	p.G422fs		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						AAGTGGTCCACCAACCATACC	0.378																																					p.G421fs	GBM(60;420 1056 13605 22380 47675)	.											.	SLC5A8	90	0			c.1262delG						.						93.0	78.0	83.0					12																	101561932		2203	4300	6503	SO:0001589	frameshift_variant	160728	exon11			GGTCCACCAACCA	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.1262delG	12.37:g.101561932delC	ENSP00000445340:p.Gly422fs	Somatic	235.0	0.0		WXS	Illumina HiSeq	Phase_I	207.0	59.0	NM_145913		Frame_Shift_Del	DEL	ENST00000536262.2	37	CCDS9080.1																																																																																			.		0.378	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913	
SLCO1C1	53919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	20858984	20858984	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr12:20858984C>T	ENST00000266509.2	+	4	741	c.373C>T	c.(373-375)Ctc>Ttc	p.L125F	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.L125F|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.L125F|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.L125F|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.L7F	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	125					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TGGAACACTGCTCATTGCAAT	0.393																																					p.L125F		.											.	SLCO1C1	97	0			c.C373T						.						210.0	207.0	208.0					12																	20858984		2203	4300	6503	SO:0001583	missense	53919	exon4			ACACTGCTCATTG	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.373C>T	12.37:g.20858984C>T	ENSP00000266509:p.Leu125Phe	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	19.0	NM_017435	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	CCDS8683.1	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569373	0.65765	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73	5.11	3.26	0.37387	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.167532	0.39985	N	0.001215	T	0.64057	0.2564	M	0.87097	2.86	0.44402	D	0.99731	P;B;P;B	0.48764	0.915;0.434;0.866;0.434	P;P;P;P	0.53549	0.519;0.62;0.729;0.539	T	0.69308	-0.5179	10	0.66056	D	0.02	.	11.75	0.51843	0.0:0.8612:0.0:0.1388	.	7;125;125;125	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	F	125;125;125;125;7	ENSP00000444149:L125F;ENSP00000438665:L125F;ENSP00000266509:L125F;ENSP00000370964:L125F;ENSP00000444527:L7F	ENSP00000266509:L125F	L	+	1	0	SLCO1C1	20750251	0.191000	0.23288	0.928000	0.36995	0.949000	0.60115	0.045000	0.14013	0.714000	0.32081	0.655000	0.94253	CTC	.		0.393	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
SLIT2	9353	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	20490566	20490566	+	Frame_Shift_Del	DEL	A	A	-			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr4:20490566delA	ENST00000504154.1	+	8	988	c.736delA	c.(736-738)aatfs	p.N246fs	SLIT2_ENST00000273739.5_Frame_Shift_Del_p.N246fs|SLIT2_ENST00000503823.1_Frame_Shift_Del_p.N246fs|SLIT2_ENST00000503837.1_Frame_Shift_Del_p.N246fs	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	246	LRRCT 1.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GAGAGGCCATAATGTAGCCGA	0.498																																					p.N246fs		.											.	SLIT2	521	0			c.736delA						.						158.0	155.0	156.0					4																	20490566		2203	4300	6503	SO:0001589	frameshift_variant	9353	exon8			GGCCATAATGTAG	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.736delA	4.37:g.20490566delA	ENSP00000422591:p.Asn246fs	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	38.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Frame_Shift_Del	DEL	ENST00000504154.1	37	CCDS3426.1																																																																																			.		0.498	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
SMUG1	23583	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54576393	54576393	+	Missense_Mutation	SNP	T	T	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr12:54576393T>G	ENST00000508394.2	-	3	362	c.300A>C	c.(298-300)gaA>gaC	p.E100D	SMUG1_ENST00000337581.3_Missense_Mutation_p.E100D|SMUG1_ENST00000514196.1_Missense_Mutation_p.E100D|SMUG1_ENST00000513838.1_Missense_Mutation_p.E100D|SMUG1_ENST00000514685.1_Missense_Mutation_p.E100D|SMUG1_ENST00000401977.2_Missense_Mutation_p.E100D|SMUG1_ENST00000505128.1_3'UTR|SMUG1_ENST00000506595.1_Missense_Mutation_p.E100D|SMUG1_ENST00000505662.1_5'UTR|SMUG1_ENST00000243112.5_Missense_Mutation_p.E100D	NM_001243787.1|NM_001243788.1|NM_014311.2	NP_001230716.1|NP_001230717.1|NP_055126.1	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional uracil-DNA glycosylase 1	100				Missing (in Ref. 3; BAC03670). {ECO:0000305}.	base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA N-glycosylase activity (GO:0019104)|oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703)|single-strand selective uracil DNA N-glycosylase activity (GO:0017065)|uracil DNA N-glycosylase activity (GO:0004844)			kidney(1)|large_intestine(4)|lung(1)	6						CCATGCTTACTTCCCCAAAGG	0.567								Base excision repair (BER), DNA glycosylases																													p.E100D		.											.	SMUG1	227	0			c.A300C						.						80.0	84.0	83.0					12																	54576393		2203	4300	6503	SO:0001583	missense	23583	exon4			GCTTACTTCCCCA	AF125182	CCDS8874.1, CCDS58239.1	12q13.13	2013-10-28			ENSG00000123415	ENSG00000123415			17148	protein-coding gene	gene with protein product		607753				10074426, 11526119	Standard	NM_014311		Approved	UNG3, FDG, HMUDG	uc009znf.2	Q53HV7	OTTHUMG00000160068	ENST00000508394.2:c.300A>C	12.37:g.54576393T>G	ENSP00000424191:p.Glu100Asp	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	20.0	NM_001243790	A8K2K9|O95862|Q0D2M0|Q8NB71|Q9BWC8	Missense_Mutation	SNP	ENST00000508394.2	37	CCDS8874.1	.	.	.	.	.	.	.	.	.	.	T	9.903	1.207332	0.22205	.	.	ENSG00000123415	ENST00000506595;ENST00000514685;ENST00000337581;ENST00000508394;ENST00000513838;ENST00000243112;ENST00000401977;ENST00000514196;ENST00000504338;ENST00000507904	T;T;T;T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	4.13	2.62	0.31277	Uracil-DNA glycosylase-like (3);	0.000000	0.85682	D	0.000000	T	0.54127	0.1839	L	0.37897	1.145	0.80722	D	1	B;D	0.76494	0.195;0.999	B;D	0.66716	0.03;0.946	T	0.49523	-0.8931	10	0.35671	T	0.21	.	5.9245	0.19101	0.0:0.274:0.0:0.726	.	100;100	Q53HV7;Q53HV7-2	SMUG1_HUMAN;.	D	100	ENSP00000421206:E100D;ENSP00000421139:E100D;ENSP00000338606:E100D;ENSP00000424191:E100D;ENSP00000423629:E100D;ENSP00000243112:E100D;ENSP00000384828:E100D;ENSP00000425974:E100D;ENSP00000423083:E100D;ENSP00000423457:E100D	ENSP00000243112:E100D	E	-	3	2	SMUG1	52862660	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	1.483000	0.35497	0.801000	0.34066	0.460000	0.39030	GAA	.		0.567	SMUG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359074.3	NM_014311	
MTCL1	23255	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	8783884	8783884	+	Silent	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr18:8783884C>T	ENST00000306329.11	+	5	1854	c.1854C>T	c.(1852-1854)agC>agT	p.S618S	SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000400050.3_Silent_p.S258S|SOGA2_ENST00000517570.1_Silent_p.S258S|SOGA2_ENST00000359865.3_Silent_p.S258S																							ACGCACCCAGCATTCCTACCT	0.652																																					p.S258S		.											.	.	.	0			c.C774T						.						58.0	61.0	60.0					18																	8783884		2203	4300	6503	SO:0001819	synonymous_variant	23255	exon6			ACCCAGCATTCCT																												ENST00000306329.11:c.1854C>T	18.37:g.8783884C>T		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	22.0	NM_015210		Silent	SNP	ENST00000306329.11	37																																																																																				.		0.652	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
STAB2	55576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104048376	104048376	+	Missense_Mutation	SNP	T	T	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr12:104048376T>C	ENST00000388887.2	+	13	1655	c.1451T>C	c.(1450-1452)gTa>gCa	p.V484A	RP11-341G23.2_ENST00000551905.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						AAAAAGAAGGTAAAAATTATA	0.398																																					p.V484A		.											.	STAB2	104	0			c.T1451C						.						71.0	69.0	69.0					12																	104048376		2203	4300	6503	SO:0001583	missense	55576	exon13			AGAAGGTAAAAAT	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.1451T>C	12.37:g.104048376T>C	ENSP00000373539:p.Val484Ala	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	41.0	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	T	6.830	0.522352	0.13066	.	.	ENSG00000136011	ENST00000388887	D	0.87571	-2.27	5.8	3.52	0.40303	FAS1 domain (5);	0.269718	0.34531	N	0.003884	T	0.74160	0.3680	N	0.16066	0.365	0.35383	D	0.790061	P	0.38617	0.64	B	0.40602	0.334	T	0.72561	-0.4256	10	0.16896	T	0.51	.	7.1107	0.25388	0.0:0.09:0.3474:0.5626	.	484	Q8WWQ8	STAB2_HUMAN	A	484	ENSP00000373539:V484A	ENSP00000373539:V484A	V	+	2	0	STAB2	102572506	1.000000	0.71417	0.951000	0.38953	0.039000	0.13416	1.848000	0.39309	1.027000	0.39758	0.460000	0.39030	GTA	.		0.398	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
STX2	2054	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	131285985	131285985	+	Missense_Mutation	SNP	C	C	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr12:131285985C>G	ENST00000392373.2	-	7	606	c.512G>C	c.(511-513)gGg>gCg	p.G171A	STX2_ENST00000261653.6_Missense_Mutation_p.G171A	NM_194356.2	NP_919337.1	P32856	STX2_HUMAN	syntaxin 2	171					acrosome reaction (GO:0007340)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|intracellular protein transport (GO:0006886)|organ morphogenesis (GO:0009887)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|signal transduction (GO:0007165)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)	calcium-dependent protein binding (GO:0048306)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)	16	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		GGATGGCTTCCCGCTCTCCAG	0.522																																					p.G171A		.											.	STX2	90	0			c.G512C						.						73.0	74.0	74.0					12																	131285985		2203	4300	6503	SO:0001583	missense	2054	exon7			GGCTTCCCGCTCT	D14582	CCDS9269.1, CCDS9270.1	12q24	2008-02-05	2006-04-25	2006-04-25	ENSG00000111450	ENSG00000111450			3403	protein-coding gene	gene with protein product		132350	"""epimorphin"""	STX2B, STX2C, STX2A, EPIM		8938452, 15943887	Standard	NM_001980		Approved	EPM	uc001uio.4	P32856	OTTHUMG00000168365	ENST00000392373.2:c.512G>C	12.37:g.131285985C>G	ENSP00000376178:p.Gly171Ala	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	12.0	NM_194356	Q86VW8	Missense_Mutation	SNP	ENST00000392373.2	37	CCDS9270.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.655577	0.88056	.	.	ENSG00000111450	ENST00000261653;ENST00000392373	T;T	0.27104	1.69;1.69	5.3	5.3	0.74995	t-SNARE (1);	0.000000	0.85682	D	0.000000	T	0.60625	0.2283	M	0.92268	3.29	0.80722	D	1	D;D;D	0.71674	0.997;0.997;0.998	P;P;D	0.65573	0.82;0.82;0.936	T	0.71272	-0.4642	10	0.66056	D	0.02	-27.634	17.9754	0.89126	0.0:1.0:0.0:0.0	.	171;171;171	P32856-3;P32856-2;P32856	.;.;STX2_HUMAN	A	171	ENSP00000261653:G171A;ENSP00000376178:G171A	ENSP00000261653:G171A	G	-	2	0	STX2	129851938	0.999000	0.42202	0.965000	0.40720	0.810000	0.45777	4.154000	0.58125	2.478000	0.83669	0.650000	0.86243	GGG	.		0.522	STX2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399455.2	NM_194356	
TAAR2	9287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	132938951	132938951	+	Missense_Mutation	SNP	A	A	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr6:132938951A>C	ENST00000367931.1	-	2	393	c.394T>G	c.(394-396)Ttt>Gtt	p.F132V	TAAR2_ENST00000537809.1_Missense_Mutation_p.F87V|TAAR2_ENST00000275191.2_Missense_Mutation_p.F87V			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	132					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		CAAAGATGAAAAATGGATGTT	0.333																																					p.F132V		.											.	TAAR2	91	0			c.T394G						.						71.0	70.0	71.0					6																	132938951		2203	4300	6503	SO:0001583	missense	9287	exon2			GATGAAAAATGGA	AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.394T>G	6.37:g.132938951A>C	ENSP00000356908:p.Phe132Val	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	9.0	NM_001033080	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	ENST00000367931.1	37	CCDS34541.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.112965	0.56398	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.40756	1.02;1.02;1.02	6.0	6.0	0.97389	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.60314	0.2259	M	0.77486	2.375	0.39819	D	0.972806	D	0.89917	1.0	D	0.91635	0.999	T	0.66376	-0.5939	10	0.72032	D	0.01	-52.8563	16.5044	0.84266	1.0:0.0:0.0:0.0	.	132	Q9P1P5	TAAR2_HUMAN	V	87;132;87	ENSP00000275191:F87V;ENSP00000356908:F132V;ENSP00000441263:F87V	ENSP00000275191:F87V	F	-	1	0	TAAR2	132980644	0.871000	0.30034	1.000000	0.80357	0.652000	0.38707	1.881000	0.39638	2.295000	0.77249	0.528000	0.53228	TTT	.		0.333	TAAR2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390735.1	NM_014626	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248Q	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,0	TP53	70225	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	c.G743A	GRCh37	CM920675	TP53	M	rs11540652	.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGCCTCCGGTTCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	42.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	C|1.000;|0.000		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
XIRP1	165904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	39226567	39226567	+	Missense_Mutation	SNP	G	G	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr3:39226567G>T	ENST00000340369.3	-	2	4598	c.4370C>A	c.(4369-4371)gCc>gAc	p.A1457D	XIRP1_ENST00000396251.1_3'UTR|XIRP1_ENST00000421646.1_Missense_Mutation_p.A140D	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1457					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GCTCTCAGGGGCCCCTTGGTG	0.632																																					p.A1457D		.											.	XIRP1	158	0			c.C4370A						.						48.0	59.0	55.0					3																	39226567		2199	4300	6499	SO:0001583	missense	165904	exon2			TCAGGGGCCCCTT	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4370C>A	3.37:g.39226567G>T	ENSP00000343140:p.Ala1457Asp	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	23.0	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250691	0.39797	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	T;T	0.25085	3.61;1.82	4.42	0.297	0.15762	.	2.810620	0.01497	N	0.017338	T	0.28034	0.0691	M	0.63843	1.955	0.36424	D	0.864469	B	0.12013	0.005	B	0.12156	0.007	T	0.25813	-1.0121	10	0.62326	D	0.03	.	3.9964	0.09559	0.1882:0.0:0.4896:0.3222	.	1457	Q702N8	XIRP1_HUMAN	D	1457;140	ENSP00000343140:A1457D;ENSP00000391645:A140D	ENSP00000343140:A1457D	A	-	2	0	XIRP1	39201571	0.507000	0.26146	0.000000	0.03702	0.001000	0.01503	1.886000	0.39688	-0.064000	0.13043	-0.181000	0.13052	GCC	.		0.632	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168104195	168104195	+	Missense_Mutation	SNP	C	C	T			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr2:168104195C>T	ENST00000409195.1	+	9	6382	c.6293C>T	c.(6292-6294)tCa>tTa	p.S2098L	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S2098L|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.S1876L|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1923					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ACTAAAGAATCAGACAGGGCA	0.378																																					p.S2098L		.											.	XIRP2	104	0			c.C6293T						.						55.0	51.0	52.0					2																	168104195		1921	4147	6068	SO:0001583	missense	129446	exon9			AAGAATCAGACAG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6293C>T	2.37:g.168104195C>T	ENSP00000386840:p.Ser2098Leu	Somatic	221.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	60.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837223	0.50951	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.20069	2.1;2.1;2.1	5.92	5.92	0.95590	.	0.458938	0.18502	N	0.139318	T	0.27933	0.0688	L	0.60455	1.87	0.50467	D	0.999876	P;P;P	0.45986	0.87;0.649;0.775	B;B;B	0.42282	0.36;0.295;0.382	T	0.01464	-1.1348	10	0.30078	T	0.28	-2.4455	19.1058	0.93294	0.0:1.0:0.0:0.0	.	1923;1923;1876	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	L	2098;2098;1876	ENSP00000386840:S2098L;ENSP00000295237:S2098L;ENSP00000387255:S1876L	ENSP00000295237:S2098L	S	+	2	0	XIRP2	167812441	1.000000	0.71417	0.997000	0.53966	0.259000	0.26198	4.519000	0.60517	2.822000	0.97130	0.650000	0.86243	TCA	.		0.378	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ZBTB8OS	339487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	33087489	33087489	+	Nonsense_Mutation	SNP	C	C	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr1:33087489C>A	ENST00000468695.1	-	7	532	c.514G>T	c.(514-516)Gaa>Taa	p.E172*	ZBTB8OS_ENST00000341885.5_Intron|ZBTB8OS_ENST00000492007.1_5'UTR|ZBTB8OS_ENST00000373501.2_3'UTR	NM_178547.2	NP_848642.1	Q8IWT0	ARCH_HUMAN	zinc finger and BTB domain containing 8 opposite strand	160					tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	extracellular vesicular exosome (GO:0070062)|tRNA-splicing ligase complex (GO:0072669)	metal ion binding (GO:0046872)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ACAAAAACTTCCGGGTTCTCT	0.328																																					p.E172X		.											.	ZBTB8OS	90	0			c.G514T						.						100.0	102.0	101.0					1																	33087489		2203	4299	6502	SO:0001587	stop_gained	339487	exon7			AAACTTCCGGGTT	AY151084	CCDS365.1	1p35.1	2010-09-30			ENSG00000176261	ENSG00000176261			24094	protein-coding gene	gene with protein product	"""archease"""	615891				12477932	Standard	NM_178547		Approved	ARCH	uc001bvp.3	Q8IWT0	OTTHUMG00000007856	ENST00000468695.1:c.514G>T	1.37:g.33087489C>A	ENSP00000417677:p.Glu172*	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	24.0	NM_178547	Q5TGK5|Q6PDA1|Q8IWS9|Q8NEV6|Q8NEV7	Nonsense_Mutation	SNP	ENST00000468695.1	37	CCDS365.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856230	0.71834	.	.	ENSG00000176261	ENST00000468695	.	.	.	5.38	5.38	0.77491	.	0.141058	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-13.4102	18.5807	0.91170	0.0:1.0:0.0:0.0	.	.	.	.	X	172	.	ENSP00000417677:E172X	E	-	1	0	ZBTB8OS	32860076	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.493000	0.66899	2.906000	0.99361	0.655000	0.94253	GAA	.		0.328	ZBTB8OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021669.3	NM_178547	
ZNF518B	85460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	10445315	10445315	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr4:10445315G>C	ENST00000326756.3	-	3	3076	c.2638C>G	c.(2638-2640)Ctt>Gtt	p.L880V		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	880					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						CTTCTGGAAAGCAGTCTCCCT	0.403																																					p.L880V		.											.	ZNF518B	72	0			c.C2638G						.						67.0	71.0	70.0					4																	10445315		2203	4300	6503	SO:0001583	missense	85460	exon3			TGGAAAGCAGTCT	AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2638C>G	4.37:g.10445315G>C	ENSP00000317614:p.Leu880Val	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	5.0	NM_053042	Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	G	0.884	-0.727841	0.03158	.	.	ENSG00000178163	ENST00000326756	T	0.01538	4.79	6.02	0.754	0.18410	.	1.652120	0.03340	N	0.194653	T	0.01061	0.0035	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.47724	-0.9095	10	0.16896	T	0.51	-1.2574	0.2586	0.00215	0.2704:0.2443:0.2593:0.2261	.	880	Q9C0D4	Z518B_HUMAN	V	880	ENSP00000317614:L880V	ENSP00000317614:L880V	L	-	1	0	ZNF518B	10054413	0.000000	0.05858	0.001000	0.08648	0.097000	0.18754	-0.002000	0.12924	0.386000	0.24997	0.655000	0.94253	CTT	.		0.403	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042	
ZNF831	128611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57829551	57829551	+	Missense_Mutation	SNP	A	A	G			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr20:57829551A>G	ENST00000371030.2	+	5	4787	c.4787A>G	c.(4786-4788)tAt>tGt	p.Y1596C		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1596							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AGAGGCCAGTATGGGTGTGGG	0.473																																					p.Y1596C		.											.	ZNF831	126	0			c.A4787G						.						83.0	79.0	80.0					20																	57829551		1906	4130	6036	SO:0001583	missense	128611	exon5			GCCAGTATGGGTG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4787A>G	20.37:g.57829551A>G	ENSP00000360069:p.Tyr1596Cys	Somatic	233.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	62.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	A	9.600	1.128458	0.21041	.	.	ENSG00000124203	ENST00000371030	T	0.07216	3.21	5.66	-0.773	0.10995	.	0.902716	0.09374	N	0.810868	T	0.08179	0.0204	M	0.61703	1.905	0.09310	N	1	B	0.15473	0.013	B	0.12156	0.007	T	0.42481	-0.9449	10	0.41790	T	0.15	0.1695	1.0782	0.01637	0.4309:0.1638:0.2653:0.1399	.	1596	Q5JPB2	ZN831_HUMAN	C	1596	ENSP00000360069:Y1596C	ENSP00000360069:Y1596C	Y	+	2	0	ZNF831	57262946	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.070000	0.11523	-0.427000	0.07350	-0.340000	0.08031	TAT	.		0.473	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
ZSCAN21	7589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99662023	99662023	+	Missense_Mutation	SNP	G	G	C			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr7:99662023G>C	ENST00000292450.4	+	4	1369	c.1205G>C	c.(1204-1206)gGc>gCc	p.G402A	ZSCAN21_ENST00000543588.1_Missense_Mutation_p.A368P|ZNF3_ENST00000413658.2_3'UTR|ZSCAN21_ENST00000456748.2_Missense_Mutation_p.A368P	NM_145914.2	NP_666019.1	Q9Y5A6	ZSC21_HUMAN	zinc finger and SCAN domain containing 21	402					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|skin(1)	21	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CAGCATGCGGGCCTCAGCTCC	0.522																																					p.G402A		.											.	ZSCAN21	93	0			c.G1205C						.						85.0	81.0	82.0					7																	99662023		2203	4300	6503	SO:0001583	missense	7589	exon4			ATGCGGGCCTCAG	AL136865	CCDS5681.1	7q11.1	2013-01-08	2006-10-06	2006-10-06	ENSG00000166529	ENSG00000166529		"""-"", ""Zinc fingers, C2H2-type"""	13104	protein-coding gene	gene with protein product		601261	"""zinc finger protein 38 (KOX 25)"", ""zinc finger protein 38"""	ZNF38		2288909, 2014798	Standard	NM_145914		Approved	DKFZp434L134, NY-REN-21, Zipro1	uc003uso.3	Q9Y5A6	OTTHUMG00000154583	ENST00000292450.4:c.1205G>C	7.37:g.99662023G>C	ENSP00000292450:p.Gly402Ala	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	19.0	NM_145914	A4D2A6|D6W5T9|Q9H0B5	Missense_Mutation	SNP	ENST00000292450.4	37	CCDS5681.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.850|7.850	0.723758|0.723758	0.15439|0.15439	.|.	.|.	ENSG00000166529|ENSG00000166529	ENST00000543588;ENST00000456748|ENST00000292450;ENST00000379635	T;T|T	0.02258|0.06768	4.37;4.37|3.26	4.52|4.52	4.52|4.52	0.55395|0.55395	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|0.000000	.|0.42821	.|D	.|0.000644	T|T	0.05364|0.05364	0.0142|0.0142	N|N	0.02985|0.02985	-0.445|-0.445	0.80722|0.80722	D|D	1|1	D|P	0.56035|0.39094	0.974|0.659	P|P	0.48030|0.45971	0.564|0.499	T|T	0.49943|0.49943	-0.8885|-0.8885	9|10	0.87932|0.07990	D|T	0|0.79	.|.	15.1433|15.1433	0.72626|0.72626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	368|402	G3V1M0|Q9Y5A6	.|ZSC21_HUMAN	P|A	368|402;377	ENSP00000441212:A368P;ENSP00000390960:A368P|ENSP00000292450:G402A	ENSP00000390960:A368P|ENSP00000292450:G402A	A|G	+|+	1|2	0|0	ZSCAN21|ZSCAN21	99499959|99499959	0.000000|0.000000	0.05858|0.05858	0.992000|0.992000	0.48379|0.48379	0.393000|0.393000	0.30537|0.30537	0.238000|0.238000	0.18004|0.18004	2.524000|2.524000	0.85096|0.85096	0.655000|0.655000	0.94253|0.94253	GCC|GGC	.		0.522	ZSCAN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336166.1	NM_145914	
ZSWIM1	90204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44511960	44511960	+	Missense_Mutation	SNP	C	C	A			TCGA-UB-A7MC-01A-11D-A33Q-10	TCGA-UB-A7MC-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7021c007-2dca-4528-a727-24cc186289b5	0856f8bb-d4eb-4f86-9bae-e349845c39dc	g.chr20:44511960C>A	ENST00000372523.1	+	2	824	c.729C>A	c.(727-729)caC>caA	p.H243Q	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.H243Q	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	243						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				GGCTGGCTCACCGCTGGAGAA	0.572																																					p.H243Q		.											.	ZSWIM1	91	0			c.C729A						.						52.0	46.0	48.0					20																	44511960		2203	4300	6503	SO:0001583	missense	90204	exon2			GGCTCACCGCTGG	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.729C>A	20.37:g.44511960C>A	ENSP00000361601:p.His243Gln	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	10.0	NM_080603	Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	ENST00000372523.1	37	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	C	16.89	3.246615	0.59103	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.32753	1.44;1.44	5.26	2.25	0.28309	.	0.000000	0.56097	U	0.000031	T	0.36936	0.0985	L	0.36672	1.1	0.34155	D	0.668035	D	0.63880	0.993	P	0.58721	0.844	T	0.52638	-0.8549	10	0.66056	D	0.02	-22.8742	10.8481	0.46754	0.0:0.7335:0.0:0.2665	.	243	Q9BR11	ZSWM1_HUMAN	Q	243	ENSP00000361601:H243Q;ENSP00000361598:H243Q	ENSP00000361598:H243Q	H	+	3	2	ZSWIM1	43945367	0.963000	0.33076	1.000000	0.80357	0.994000	0.84299	0.056000	0.14256	0.800000	0.34041	0.650000	0.86243	CAC	.		0.572	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603	
