#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AGAP2-AS1	100130776	genome.wustl.edu	37	12	58121452	58121452	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:58121452C>T	ENST00000542466.2	+	2	813	c.677C>T	c.(676-678)tCc>tTc	p.S226F	AGAP2_ENST00000547588.1_Intron|RP11-571M6.8_ENST00000548410.2_RNA|AGAP2_ENST00000257897.3_Intron					AGAP2 antisense RNA 1																		TCCGCTGCCTCCTGGCACTCA	0.682																																																	0								ENSG00000255737						36.0	37.0	37.0					12																	58121452		2201	4298	6499	AGAP2-AS1	SO:0001583	missense	0			-	HGNC	BC039697, BC069024		12q14.1	2013-05-30			ENSG00000255737	ENSG00000255737		"""Long non-coding RNAs"""	48633	non-coding RNA	RNA, long non-coding							Standard	NR_027032		Approved				OTTHUMG00000170286	ENST00000542466.2:c.677C>T	12.37:g.58121452C>T	ENSP00000437523:p.Ser226Phe	Somatic	0	50	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	305	17.96		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S226F	ENST00000542466.2	37	c.677		12	.	.	.	.	.	.	.	.	.	.	C	0.098	-1.156059	0.01686	.	.	ENSG00000255737	ENST00000542466	.	.	.	4.47	-0.896	0.10557	.	.	.	.	.	T	0.28699	0.0711	.	.	.	0.09310	N	0.999993	B	0.26483	0.15	B	0.21546	0.035	T	0.24764	-1.0151	7	0.87932	D	0	.	5.5487	0.17079	0.0:0.3104:0.4326:0.257	.	226	B7Z718	.	F	226	.	ENSP00000437523:S226F	S	+	2	0	RP11-571M6.6	56407719	0.000000	0.05858	0.012000	0.15200	0.157000	0.22087	-0.044000	0.12023	-0.270000	0.09285	-0.150000	0.13652	TCC	-	NULL		0.682	AGAP2-AS1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	AGAP2-AS1	protein_coding	OTTHUMT00000408368.1	C		-		58121452	+1	no_errors	ENST00000542466	ensembl	human	putative	74_37	missense	SNP	0.004	T
DKC1	1736	genome.wustl.edu	37	X	154005089	154005091	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chrX:154005089_154005091delAAG	ENST00000369550.5	+	15	1702_1704	c.1492_1494delAAG	c.(1492-1494)aagdel	p.K505del	SNORA56_ENST00000383966.1_RNA	NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	505	Nuclear and nucleolar localization.				cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGATACCACCaagaagaagaaga	0.409									Congenital Dyskeratosis																																								0								ENSG00000130826																																			DKC1	SO:0001651	inframe_deletion	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita		HGNC	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.1492_1494delAAG	X.37:g.154005098_154005100delAAG	ENSP00000358563:p.Lys505del	Somatic	0	26	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	F5BSB3|O43845|Q96G67|Q9Y505	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Dyskerin-like,pfam_PsdUridine_synth,pfam_PUA,superfamily_PsdUridine_synth_cat_dom,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,tigrfam_tRNA_PsdUridine_synth_B_fam,tigrfam_Uncharacterised_CHP00451	p.K501in_frame_del	ENST00000369550.5	37	c.1492_1494	CCDS14761.1	X																																																																																			-	NULL		0.409	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKC1	protein_coding	OTTHUMT00000061180.5	AAG	NM_001363			154005091	+1	no_errors	ENST00000369550	ensembl	human	known	74_37	in_frame_del	DEL	0.284:0.284:0.273	-
UNC80	285175	genome.wustl.edu	37	2	210642248	210642248	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr2:210642248G>A	ENST00000439458.1	+	4	645	c.565G>A	c.(565-567)Gtg>Atg	p.V189M	UNC80_ENST00000478701.1_3'UTR|UNC80_ENST00000272845.6_Missense_Mutation_p.V189M	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	189					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V189M(2)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GGAGCTCTTCGTGTTTCTGTT	0.502																																																	2	Substitution - Missense(2)	large_intestine(2)						ENSG00000144406						105.0	109.0	108.0					2																	210642248		2203	4300	6503	UNC80	SO:0001583	missense	0			-	HGNC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.565G>A	2.37:g.210642248G>A	ENSP00000391088:p.Val189Met	Somatic	0	46	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	21	34.38	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V189M	ENST00000439458.1	37	c.565	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.075077	0.94000	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	T;T	0.53423	0.62;0.63	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.70710	0.3255	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.71427	-0.4596	10	0.87932	D	0	.	20.3248	0.98698	0.0:0.0:1.0:0.0	.	189;189	Q8N2C7;Q8N2C7-3	UNC80_HUMAN;.	M	189	ENSP00000391088:V189M;ENSP00000272845:V189M	ENSP00000272845:V189M	V	+	1	0	UNC80	210350493	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.609000	0.98334	2.818000	0.97014	0.655000	0.94253	GTG	-	NULL		0.502	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	protein_coding		G	NM_182587	-		210642248	+1	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	SNP	1.000	A
MORF4L1	10933	genome.wustl.edu	37	15	79189587	79189588	+	3'UTR	INS	-	-	T	rs540204037|rs199814291	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr15:79189587_79189588insT	ENST00000331268.5	+	0	1471_1472				MORF4L1_ENST00000379535.4_3'UTR|MORF4L1_ENST00000561171.1_3'UTR|MORF4L1_ENST00000426013.2_3'UTR|MORF4L1_ENST00000559345.1_3'UTR|RNU6-415P_ENST00000516252.1_RNA	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1						cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						TTTCTTCTTTCTTTTTTTTTTT	0.317																																																	0								ENSG00000185787																																			MORF4L1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.*179->T	15.37:g.79189598_79189598dupT		Somatic	0	17	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	21	27.59	B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000331268.5	37	NULL	CCDS10307.1	15																																																																																			-	-		0.317	MORF4L1-001	KNOWN	basic|CCDS	protein_coding	MORF4L1	protein_coding	OTTHUMT00000290131.4	-	NM_006791			79189588	+1	no_errors	ENST00000561171	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
PPP2R1B	5519	genome.wustl.edu	37	11	111631590	111631590	+	Missense_Mutation	SNP	G	G	T	rs186368063		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr11:111631590G>T	ENST00000527614.1	-	4	557	c.492C>A	c.(490-492)agC>agA	p.S164R	PPP2R1B_ENST00000393055.2_Intron|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.S164R|PPP2R1B_ENST00000427203.2_Intron|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.S164R|PPP2R1B_ENST00000426998.2_Missense_Mutation_p.S100R	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	164					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		GATAGCAAACGCTGAACAAAC	0.433																																																	0								ENSG00000137713						91.0	82.0	85.0					11																	111631590		2201	4297	6498	PPP2R1B	SO:0001583	missense	0			-	HGNC	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.492C>A	11.37:g.111631590G>T	ENSP00000437193:p.Ser164Arg	Somatic	0	34	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.S164R	ENST00000527614.1	37	c.492	CCDS8349.1	11	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355337	0.61293	.	.	ENSG00000137713	ENST00000311129;ENST00000426998;ENST00000527614;ENST00000341980	T;T;T;T	0.06528	3.29;3.29;3.29;3.29	5.96	0.338	0.15974	Armadillo-like helical (1);Armadillo-type fold (1);	0.037215	0.85682	D	0.000000	T	0.18800	0.0451	M	0.90977	3.165	0.80722	D	1	B;D;P;D	0.61697	0.296;0.99;0.464;0.983	B;P;P;P	0.52066	0.225;0.491;0.497;0.689	T	0.08166	-1.0735	10	0.62326	D	0.03	-11.6753	9.4798	0.38893	0.4711:0.0:0.5289:0.0	.	164;100;164;164	F8W8G1;B4DWW5;P30154;P30154-2	.;.;2AAB_HUMAN;.	R	164;100;164;164	ENSP00000311344:S164R;ENSP00000410671:S100R;ENSP00000437193:S164R;ENSP00000343317:S164R	ENSP00000311344:S164R	S	-	3	2	PPP2R1B	111136800	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	1.774000	0.38573	0.141000	0.18875	-0.126000	0.14955	AGC	-	superfamily_ARM-type_fold		0.433	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PPP2R1B	protein_coding	OTTHUMT00000391298.1	G	NM_002716	-		111631590	-1	no_errors	ENST00000311129	ensembl	human	known	74_37	missense	SNP	0.988	T
KIF26B	55083	genome.wustl.edu	37	1	245850889	245850889	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:245850889G>T	ENST00000407071.2	+	12	5044	c.4604G>T	c.(4603-4605)aGc>aTc	p.S1535I	KIF26B_ENST00000366518.4_Missense_Mutation_p.S1154I	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1535					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GTCAAGTCCAGCAGCCTTCCC	0.632																																																	0								ENSG00000162849						19.0	23.0	22.0					1																	245850889		2018	4140	6158	KIF26B	SO:0001583	missense	0			-	HGNC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4604G>T	1.37:g.245850889G>T	ENSP00000385545:p.Ser1535Ile	Somatic	0	40	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1535I	ENST00000407071.2	37	c.4604	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752543	0.31046	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.78595	-1.19;-1.19	5.68	5.68	0.88126	.	.	.	.	.	T	0.76033	0.3931	M	0.63428	1.95	0.35165	D	0.771007	P;P	0.45902	0.868;0.868	B;B	0.36666	0.23;0.168	D	0.84426	0.0574	9	0.66056	D	0.02	.	19.8454	0.96706	0.0:0.0:1.0:0.0	.	1154;1535	B7WPD9;Q2KJY2	.;KI26B_HUMAN	I	1535;1154;1151	ENSP00000385545:S1535I;ENSP00000355475:S1154I	ENSP00000355475:S1154I	S	+	2	0	KIF26B	243917512	1.000000	0.71417	0.998000	0.56505	0.108000	0.19459	6.018000	0.70811	2.695000	0.91970	0.555000	0.69702	AGC	-	NULL		0.632	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	protein_coding	OTTHUMT00000381037.1	G	XM_371354	-		245850889	+1	no_errors	ENST00000407071	ensembl	human	known	74_37	missense	SNP	0.999	T
FZD6	8323	genome.wustl.edu	37	8	104336784	104336784	+	Silent	SNP	A	A	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr8:104336784A>G	ENST00000358755.4	+	4	767	c.450A>G	c.(448-450)acA>acG	p.T150T	FZD6_ENST00000540287.1_Intron|FZD6_ENST00000522566.1_Silent_p.T150T|FZD6_ENST00000523739.1_Silent_p.T118T	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	150					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			AGAAGAAAACAGAACAAGTCC	0.383																																																	0								ENSG00000164930						56.0	61.0	59.0					8																	104336784		2203	4300	6503	FZD6	SO:0001819	synonymous_variant	0			-	HGNC	AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.450A>G	8.37:g.104336784A>G		Somatic	0	43	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	75	23.47	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.T150	ENST00000358755.4	37	c.450	CCDS6298.1	8																																																																																			-	NULL		0.383	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	protein_coding	OTTHUMT00000380560.1	A	NM_003506	-		104336784	+1	no_errors	ENST00000358755	ensembl	human	known	74_37	silent	SNP	0.991	G
IFNG	3458	genome.wustl.edu	37	12	68551748	68551748	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:68551748A>T	ENST00000229135.3	-	3	442	c.311T>A	c.(310-312)tTt>tAt	p.F104Y	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	104					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	GCTATTGAAAAACTTGACATT	0.353																																																	0								ENSG00000111537						157.0	157.0	157.0					12																	68551748		2203	4300	6503	IFNG	SO:0001583	missense	0			-	HGNC		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.311T>A	12.37:g.68551748A>T	ENSP00000229135:p.Phe104Tyr	Somatic	0	42	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	46	34.29	B5BU88|Q53ZV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_gamma,superfamily_4_helix_cytokine-like_core,pirsf_Interferon_gamma	p.F104Y	ENST00000229135.3	37	c.311	CCDS8980.1	12	.	.	.	.	.	.	.	.	.	.	A	18.29	3.592236	0.66219	.	.	ENSG00000111537	ENST00000229135	T	0.54279	0.58	5.38	4.16	0.48862	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.636531	0.17197	N	0.183271	T	0.70798	0.3265	M	0.84511	2.7	0.09310	N	1	D	0.76494	0.999	D	0.69307	0.963	T	0.62310	-0.6881	9	.	.	.	-8.4815	8.1574	0.31178	0.8216:0.0:0.0:0.1784	.	104	P01579	IFNG_HUMAN	Y	104	ENSP00000229135:F104Y	.	F	-	2	0	IFNG	66838015	0.965000	0.33210	0.654000	0.29608	0.046000	0.14306	2.427000	0.44740	2.171000	0.68590	0.533000	0.62120	TTT	-	pfam_Interferon_gamma,superfamily_4_helix_cytokine-like_core,pirsf_Interferon_gamma		0.353	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNG	protein_coding	OTTHUMT00000402301.1	A		-		68551748	-1	no_errors	ENST00000229135	ensembl	human	known	74_37	missense	SNP	0.086	T
UBR2	23304	genome.wustl.edu	37	6	42583771	42583771	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr6:42583771G>A	ENST00000372899.1	+	10	1383	c.1125G>A	c.(1123-1125)atG>atA	p.M375I	UBR2_ENST00000372883.3_5'Flank|UBR2_ENST00000372901.1_Missense_Mutation_p.M375I|UBR2_ENST00000372903.2_Missense_Mutation_p.M375I	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	375					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AGTTGTTCATGAGCAGTCTGC	0.338																																																	0								ENSG00000024048						211.0	203.0	206.0					6																	42583771		2203	4300	6503	UBR2	SO:0001583	missense	0			-	HGNC	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1125G>A	6.37:g.42583771G>A	ENSP00000361990:p.Met375Ile	Somatic	0	43	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	102	8.11	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.M375I	ENST00000372899.1	37	c.1125	CCDS4870.1	6	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120963	0.56613	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.71103	-0.54;0.55;0.55	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.33792	1.035	0.80722	D	1	D;B;B	0.63046	0.992;0.02;0.328	D;B;B	0.71656	0.974;0.034;0.111	T	0.62234	-0.6897	10	0.13108	T	0.6	7.4134	19.6467	0.95778	0.0:0.0:1.0:0.0	.	375;375;375	Q8IWV8-4;Q8IWV8;Q8IWV8-2	.;UBR2_HUMAN;.	I	375	ENSP00000361994:M375I;ENSP00000361990:M375I;ENSP00000361992:M375I	ENSP00000361990:M375I	M	+	3	0	UBR2	42691749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.020000	0.93667	2.716000	0.92895	0.655000	0.94253	ATG	-	NULL		0.338	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	protein_coding	OTTHUMT00000040558.2	G	NM_015255	-		42583771	+1	no_errors	ENST00000372899	ensembl	human	known	74_37	missense	SNP	1.000	A
BEND3P1	644459	genome.wustl.edu	37	10	52419299	52419299	+	RNA	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:52419299C>T	ENST00000449695.1	+	0	2033																											GCTACAACTCCTCCAGCCTGC	0.622																																																	0								ENSG00000231345																																			RP11-564C4.6			0			-	Clone_based_vega_gene																													10.37:g.52419299C>T		Somatic	0	18	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	7	50.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000449695.1	37	NULL		10																																																																																			-	-		0.622	RP11-564C4.6-002	KNOWN	basic	processed_transcript	ENSG00000231345	pseudogene	OTTHUMT00000048079.1	C		-		52419299	+1	no_errors	ENST00000449695	ensembl	human	known	74_37	rna	SNP	0.814	T
ANTXR2	118429	genome.wustl.edu	37	4	80828146	80828146	+	3'UTR	SNP	A	A	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr4:80828146A>C	ENST00000403729.2	-	0	2429				ANTXR2_ENST00000482406.1_5'UTR	NM_058172.5	NP_477520.2	P58335	ANTR2_HUMAN	anthrax toxin receptor 2						reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						ATGGATAAAGATCTTGCCACA	0.403									Juvenile Hyaline Fibromatosis																																								0								ENSG00000163297																																			ANTXR2	SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	-	HGNC	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000403729.2:c.*437T>G	4.37:g.80828146A>C		Somatic	0	11	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	15	42.31	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000403729.2	37	NULL	CCDS47085.1	4																																																																																			-	-		0.403	ANTXR2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ANTXR2	protein_coding	OTTHUMT00000324666.2	A	NM_058172	-		80828146	-1	no_errors	ENST00000482406	ensembl	human	known	74_37	rna	SNP	0.407	C
WNK1	65125	genome.wustl.edu	37	12	970296	970297	+	Frame_Shift_Ins	INS	-	-	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:970296_970297insA	ENST00000315939.6	+	7	2381_2382	c.1738_1739insA	c.(1738-1740)gaafs	p.E580fs	WNK1_ENST00000535572.1_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000340908.4_Frame_Shift_Ins_p.E173fs|WNK1_ENST00000530271.2_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000537687.1_Frame_Shift_Ins_p.E580fs	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	580					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GGAGGAGCAAGAAAAAAAAAAG	0.47																																					Colon(19;451 567 6672 12618 28860)												1	Unknown(1)	skin(1)						ENSG00000060237																																			WNK1	SO:0001589	frameshift_variant	0				HGNC	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1748dupA	12.37:g.970306_970306dupA	ENSP00000313059:p.Glu580fs	Somatic	0	17	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K584fs	ENST00000315939.6	37	c.1738_1739	CCDS8506.1	12																																																																																			-	NULL		0.470	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	-	NM_018979			970297	+1	no_errors	ENST00000530271	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
FHOD3	80206	genome.wustl.edu	37	18	34297864	34297864	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr18:34297864G>T	ENST00000359247.4	+	15	2027	c.2027G>T	c.(2026-2028)cGg>cTg	p.R676L	FHOD3_ENST00000587493.1_3'UTR|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000257209.4_Missense_Mutation_p.R693L|FHOD3_ENST00000590592.1_Missense_Mutation_p.R868L|FHOD3_ENST00000592128.1_5'Flank|FHOD3_ENST00000445677.1_Missense_Mutation_p.R655L	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	676					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACCAACAAACGGTTCATGCTT	0.542																																																	0								ENSG00000134775						124.0	105.0	112.0					18																	34297864		2203	4300	6503	FHOD3	SO:0001583	missense	0			-	HGNC	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2027G>T	18.37:g.34297864G>T	ENSP00000352186:p.Arg676Leu	Somatic	0	26	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	49	43.68	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.R693L	ENST00000359247.4	37	c.2078		18	.	.	.	.	.	.	.	.	.	.	G	16.89	3.247908	0.59103	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.32753	1.44;1.46;1.44	5.24	5.24	0.73138	.	0.249780	0.40469	N	0.001093	T	0.47764	0.1463	L	0.48642	1.525	0.49915	D	0.999831	B;D;B	0.67145	0.011;0.996;0.03	B;D;B	0.72338	0.011;0.977;0.02	T	0.28267	-1.0049	10	0.36615	T	0.2	.	15.5657	0.76290	0.0:0.0:1.0:0.0	.	655;676;693	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	L	693;676;655	ENSP00000257209:R693L;ENSP00000352186:R676L;ENSP00000411430:R655L	ENSP00000257209:R693L	R	+	2	0	FHOD3	32551862	1.000000	0.71417	0.988000	0.46212	0.964000	0.63967	6.394000	0.73223	2.458000	0.83093	0.455000	0.32223	CGG	-	NULL		0.542	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	protein_coding	OTTHUMT00000460884.1	G	XM_371114	-		34297864	+1	no_errors	ENST00000257209	ensembl	human	known	74_37	missense	SNP	1.000	T
KRT3	3850	genome.wustl.edu	37	12	53185508	53185508	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:53185508C>A	ENST00000417996.2	-	6	1355	c.1281G>T	c.(1279-1281)agG>agT	p.R427S	KRT3_ENST00000309505.3_Missense_Mutation_p.R427S	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	427	Coil 2.|Rod.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						CTGCCCGCAGCCTCTGGATCA	0.567																																																	0								ENSG00000186442						116.0	117.0	117.0					12																	53185508		2203	4300	6503	KRT3	SO:0001583	missense	0			-	HGNC		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.1281G>T	12.37:g.53185508C>A	ENSP00000413479:p.Arg427Ser	Somatic	0	78	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A6NIS2|Q701L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.R427S	ENST00000417996.2	37	c.1281	CCDS44895.1	12	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977374	0.53720	.	.	ENSG00000186442	ENST00000417996;ENST00000309505	T;T	0.78126	-1.15;-1.15	4.02	3.11	0.35812	Filament (1);	0.000000	0.50627	D	0.000113	D	0.84410	0.5466	M	0.72353	2.195	0.38129	D	0.938082	D	0.89917	1.0	D	0.70935	0.971	D	0.85752	0.1344	10	0.87932	D	0	.	8.858	0.35240	0.0:0.8225:0.0:0.1775	.	427	P12035	K2C3_HUMAN	S	427	ENSP00000413479:R427S;ENSP00000312206:R427S	ENSP00000312206:R427S	R	-	3	2	KRT3	51471775	0.298000	0.24417	1.000000	0.80357	0.761000	0.43186	-0.097000	0.11042	1.016000	0.39470	0.462000	0.41574	AGG	-	pfam_IF,superfamily_Prefoldin		0.567	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRT3	protein_coding	OTTHUMT00000405930.1	C	NM_057088	-		53185508	-1	no_errors	ENST00000309505	ensembl	human	known	74_37	missense	SNP	0.998	A
MYH4	4622	genome.wustl.edu	37	17	10367818	10367818	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:10367818T>C	ENST00000255381.2	-	7	729	c.619A>G	c.(619-621)Aaa>Gaa	p.K207E	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	207	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GGTTCCTCTTTTTTCTTCTCT	0.423																																																	0								ENSG00000264424						79.0	77.0	78.0					17																	10367818		2203	4300	6503	MYH4	SO:0001583	missense	0			-	HGNC		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.619A>G	17.37:g.10367818T>C	ENSP00000255381:p.Lys207Glu	Somatic	0	28	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	37	24.49		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K207E	ENST00000255381.2	37	c.619	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	T	18.09	3.546147	0.65198	.	.	ENSG00000141048	ENST00000255381	T	0.71579	-0.58	5.12	5.12	0.69794	Myosin head, motor domain (2);	0.000000	0.39020	U	0.001492	T	0.58438	0.2122	N	0.25060	0.705	0.48452	D	0.999654	B	0.02656	0.0	B	0.14578	0.011	T	0.54529	-0.8280	10	0.37606	T	0.19	.	15.1975	0.73104	0.0:0.0:0.0:1.0	.	207	Q9Y623	MYH4_HUMAN	E	207	ENSP00000255381:K207E	ENSP00000255381:K207E	K	-	1	0	MYH4	10308543	1.000000	0.71417	0.922000	0.36590	0.711000	0.40976	3.490000	0.53245	2.043000	0.60533	0.528000	0.53228	AAA	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.423	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	T	NM_017533	-		10367818	-1	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC22A15	55356	genome.wustl.edu	37	1	116574007	116574007	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:116574007G>A	ENST00000369503.4	+	6	879	c.749G>A	c.(748-750)cGt>cAt	p.R250H	SLC22A15_ENST00000369502.1_Intron	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	250					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GAATCACCTCGTTGGTTATAC	0.468																																																	0								ENSG00000163393						64.0	63.0	63.0					1																	116574007		1963	4142	6105	SLC22A15	SO:0001583	missense	0			-	HGNC	AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.749G>A	1.37:g.116574007G>A	ENSP00000358515:p.Arg250His	Somatic	0	21	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	25	32.43	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R250H	ENST00000369503.4	37	c.749	CCDS44198.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.196417	0.94960	.	.	ENSG00000163393	ENST00000369503	T	0.79653	-1.29	4.81	4.81	0.61882	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.91922	0.7442	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.93947	0.7228	10	0.87932	D	0	.	18.0583	0.89369	0.0:0.0:1.0:0.0	.	250	Q8IZD6	S22AF_HUMAN	H	250	ENSP00000358515:R250H	ENSP00000358515:R250H	R	+	2	0	SLC22A15	116375530	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.973000	0.93428	2.498000	0.84270	0.655000	0.94253	CGT	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.468	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A15	protein_coding	OTTHUMT00000033220.2	G	NM_018420	-		116574007	+1	no_errors	ENST00000369503	ensembl	human	known	74_37	missense	SNP	1.000	A
CREBBP	1387	genome.wustl.edu	37	16	3779184	3779184	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:3779184G>A	ENST00000262367.5	-	31	6673	c.5864C>T	c.(5863-5865)gCg>gTg	p.A1955V	CREBBP_ENST00000382070.3_Missense_Mutation_p.A1917V	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1955					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CGCTTCCACCGCTGCAGGAGG	0.711			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0								ENSG00000005339						3.0	4.0	4.0					16																	3779184		1794	3661	5455	CREBBP	SO:0001583	missense	0			-	HGNC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5864C>T	16.37:g.3779184G>A	ENSP00000262367:p.Ala1955Val	Somatic	0	29	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.A1955V	ENST00000262367.5	37	c.5864	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	g	11.53	1.666462	0.29604	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.84516	-1.86;-1.79	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000009	D	0.84392	0.5462	L	0.49126	1.545	0.80722	D	1	D;D	0.56746	0.977;0.977	P;P	0.46940	0.532;0.532	T	0.82202	-0.0574	10	0.21540	T	0.41	-12.7463	18.6472	0.91415	0.0:0.0:1.0:0.0	.	1985;1955	Q4LE28;Q92793	.;CBP_HUMAN	V	1955;1985;1917;490	ENSP00000262367:A1955V;ENSP00000371502:A1917V	ENSP00000262367:A1955V	A	-	2	0	CREBBP	3719185	1.000000	0.71417	0.104000	0.21259	0.611000	0.37282	7.258000	0.78371	2.419000	0.82065	0.655000	0.94253	GCG	-	NULL		0.711	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	protein_coding	OTTHUMT00000251591.2	G	NM_004380	-		3779184	-1	no_errors	ENST00000262367	ensembl	human	known	74_37	missense	SNP	0.998	A
POTEM	641455	genome.wustl.edu	37	14	20010310	20010310	+	Intron	SNP	A	A	G	rs199892710		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr14:20010310A>G	ENST00000551509.1	-	5	969				RP11-244H18.1_ENST00000547584.1_lincRNA|RNU6-1268P_ENST00000391214.1_RNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						TTACCAATTTAACATCTTGCC	0.333																																																	0								ENSG00000258276																																			RP11-244H18.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-70T>C	14.37:g.20010310A>G		Somatic	0	9	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			-	-		0.333	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	protein_coding	OTTHUMT00000409490.3	A	NM_001145442	rs199892710		20010310	+1	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	SNP	0.005	G
ABTB1	80325	genome.wustl.edu	37	3	127395830	127395830	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:127395830G>T	ENST00000232744.8	+	7	633	c.547G>T	c.(547-549)Gag>Tag	p.E183*	ABTB1_ENST00000468137.1_Nonsense_Mutation_p.E41*|ABTB1_ENST00000453791.2_Nonsense_Mutation_p.E41*|ABTB1_ENST00000393363.3_Nonsense_Mutation_p.E41*					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						CATTGGCGTAGAGCATGTGAG	0.627																																																	0								ENSG00000114626						50.0	47.0	48.0					3																	127395830		2203	4300	6503	ABTB1	SO:0001587	stop_gained	0			-	HGNC	AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.547G>T	3.37:g.127395830G>T	ENSP00000232744:p.Glu183*	Somatic	0	50	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.E183*	ENST00000232744.8	37	c.547	CCDS3045.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.098844	0.97281	.	.	ENSG00000114626	ENST00000393363;ENST00000232744;ENST00000453791;ENST00000468137	.	.	.	4.8	3.92	0.45320	.	0.380184	0.30365	N	0.009791	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-22.3617	12.5472	0.56206	0.0825:0.0:0.9175:0.0	.	.	.	.	X	41;183;41;41	.	ENSP00000232744:E183X	E	+	1	0	ABTB1	128878520	1.000000	0.71417	0.386000	0.26170	0.143000	0.21401	5.786000	0.69006	1.024000	0.39682	-0.218000	0.12543	GAG	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like		0.627	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB1	protein_coding	OTTHUMT00000356595.1	G	NM_172027	-		127395830	+1	no_errors	ENST00000232744	ensembl	human	known	74_37	nonsense	SNP	0.996	T
POGZ	23126	genome.wustl.edu	37	1	151384810	151384810	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:151384810C>T	ENST00000271715.2	-	11	2055	c.1741G>A	c.(1741-1743)Gat>Aat	p.D581N	POGZ_ENST00000368863.2_Missense_Mutation_p.D486N|POGZ_ENST00000409503.1_Missense_Mutation_p.D572N|POGZ_ENST00000361398.3_Missense_Mutation_p.D528N|POGZ_ENST00000491586.1_Missense_Mutation_p.D528N|POGZ_ENST00000540984.1_5'UTR|POGZ_ENST00000531094.1_Missense_Mutation_p.D519N|POGZ_ENST00000392723.1_Missense_Mutation_p.D528N	NM_001194937.1|NM_015100.3	NP_001181866.1|NP_055915.2	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	581					kinetochore assembly (GO:0051382)|mitotic sister chromatid cohesion (GO:0007064)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(10)|kidney(3)|large_intestine(10)|liver(2)|lung(11)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	47	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTATGAGTATCCTTCATATGC	0.398																																																	0								ENSG00000143442						96.0	89.0	91.0					1																	151384810		2203	4300	6503	POGZ	SO:0001583	missense	0			-	HGNC	AB007930	CCDS997.1, CCDS998.1, CCDS44222.1, CCDS44222.2, CCDS53365.1, CCDS53366.1	1q21.1	2013-07-22			ENSG00000143442	ENSG00000143442			18801	protein-coding gene	gene with protein product	"""zinc finger protein 280E"", ""putative protein product of Nbla00003"""	614787				10976766	Standard	NM_015100		Approved	KIAA0461, ZNF635m, ZNF280E	uc001eyd.2	Q7Z3K3	OTTHUMG00000012499	ENST00000271715.2:c.1741G>A	1.37:g.151384810C>T	ENSP00000271715:p.Asp581Asn	Somatic	0	19	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	37	38.33	B4DTP8|B4DYL9|B7ZBY5|E9PM80|O75049|Q3LIC4|Q5SZS1|Q5SZS2|Q5SZS3|Q5SZS4|Q8TDZ7|Q9Y4X7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_Znf_C2H2	p.D581N	ENST00000271715.2	37	c.1741	CCDS997.1	1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.866000	0.71949	.	.	ENSG00000143442	ENST00000392723;ENST00000271715;ENST00000361398;ENST00000368863;ENST00000409503;ENST00000531094;ENST00000491586;ENST00000529669	T;T;T;T;T;T;T;T	0.14766	5.88;5.91;5.88;5.87;5.9;5.9;5.34;2.48	5.1	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.64402	D	0.000003	T	0.16342	0.0393	N	0.25245	0.725	0.80722	D	1	P;D;P;D;D;P	0.71674	0.473;0.993;0.607;0.998;0.998;0.473	B;D;B;D;D;B	0.75484	0.13;0.971;0.3;0.986;0.986;0.158	T	0.05099	-1.0906	10	0.40728	T	0.16	-17.9801	17.2582	0.87063	0.0:1.0:0.0:0.0	.	519;572;486;528;528;581	E9PM80;B7ZBY5;Q7Z3K3-5;Q7Z3K3-3;Q7Z3K3-2;Q7Z3K3	.;.;.;.;.;POGZ_HUMAN	N	528;581;528;486;572;519;528;30	ENSP00000376484:D528N;ENSP00000271715:D581N;ENSP00000354467:D528N;ENSP00000357856:D486N;ENSP00000386836:D572N;ENSP00000431259:D519N;ENSP00000418408:D528N;ENSP00000432295:D30N	ENSP00000271715:D581N	D	-	1	0	POGZ	149651434	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.055000	0.49916	2.656000	0.90262	0.557000	0.71058	GAT	-	smart_Znf_C2H2-like		0.398	POGZ-001	KNOWN	basic|CCDS	protein_coding	POGZ	protein_coding	OTTHUMT00000034915.2	C	NM_207171	-		151384810	-1	no_errors	ENST00000271715	ensembl	human	known	74_37	missense	SNP	1.000	T
OR10T2	128360	genome.wustl.edu	37	1	158368481	158368481	+	Missense_Mutation	SNP	T	T	C	rs139047952		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:158368481T>C	ENST00000334438.1	-	1	775	c.776A>G	c.(775-777)tAt>tGt	p.Y259C		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					GGGCCGCAGATAGATGATAGA	0.512																																																	0								ENSG00000186306	T	CYS/TYR	0,4406		0,0,2203	103.0	90.0	94.0		776	3.4	1.0	1	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR10T2	NM_001004475.1	194	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	259/315	158368481	1,13005	2203	4300	6503	OR10T2	SO:0001583	missense	0			-	HGNC	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.776A>G	1.37:g.158368481T>C	ENSP00000334115:p.Tyr259Cys	Somatic	0	19	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	30	42.31	Q6IF98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y259C	ENST00000334438.1	37	c.776	CCDS30895.1	1	.	.	.	.	.	.	.	.	.	.	T	14.61	2.587180	0.46110	0.0	1.16E-4	ENSG00000186306	ENST00000334438	T	0.00295	8.25	4.57	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38164	N	0.001795	T	0.00440	0.0014	M	0.94142	3.5	0.26885	N	0.96746	D	0.89917	1.0	D	0.97110	1.0	T	0.19063	-1.0317	10	0.87932	D	0	.	10.6412	0.45594	0.0:0.0:0.1616:0.8384	.	259	Q8NGX3	O10T2_HUMAN	C	259	ENSP00000334115:Y259C	ENSP00000334115:Y259C	Y	-	2	0	OR10T2	156635105	0.997000	0.39634	0.968000	0.41197	0.834000	0.47266	2.316000	0.43761	0.780000	0.33566	-0.258000	0.10820	TAT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10T2	protein_coding	OTTHUMT00000046371.1	T	NM_001004475	rs139047952		158368481	-1	no_errors	ENST00000334438	ensembl	human	known	74_37	missense	SNP	0.989	C
TTC29	83894	genome.wustl.edu	37	4	147628647	147628647	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr4:147628647C>T	ENST00000325106.4	-	12	1613	c.1387G>A	c.(1387-1389)Gaa>Aaa	p.E463K	TTC29_ENST00000513335.1_Missense_Mutation_p.E489K|TTC29_ENST00000398886.4_Missense_Mutation_p.E489K	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	463										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					CTACTGAGTTCTTCCAAACGT	0.328																																																	0								ENSG00000137473						126.0	121.0	123.0					4																	147628647		1819	4075	5894	TTC29	SO:0001583	missense	0			-	HGNC	AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1387G>A	4.37:g.147628647C>T	ENSP00000316740:p.Glu463Lys	Somatic	0	31	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	67	27.17	A4GU95|Q9BXB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat,pfscan_TPR-contain_dom	p.E489K	ENST00000325106.4	37	c.1465	CCDS47141.1	4	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893006	0.33442	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000504425	T;T;T;T	0.28069	1.63;1.63;1.69;1.68	3.56	0.871	0.19107	.	0.280190	0.27130	N	0.020792	T	0.25195	0.0612	L	0.56769	1.78	0.09310	N	1	B;B;B	0.13594	0.001;0.008;0.001	B;B;B	0.12156	0.002;0.007;0.002	T	0.21690	-1.0238	10	0.59425	D	0.04	-7.5989	5.306	0.15803	0.0:0.618:0.0:0.382	.	462;489;463	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	K	489;489;463;462	ENSP00000423505:E489K;ENSP00000381861:E489K;ENSP00000316740:E463K;ENSP00000425778:E462K	ENSP00000316740:E463K	E	-	1	0	TTC29	147848097	0.001000	0.12720	0.095000	0.20976	0.314000	0.28054	0.317000	0.19487	0.153000	0.19213	0.650000	0.86243	GAA	-	NULL		0.328	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC29	protein_coding		C	NM_031956	-		147628647	-1	no_errors	ENST00000398886	ensembl	human	known	74_37	missense	SNP	0.128	T
SNORA75	654321	genome.wustl.edu	37	12	9439294	9439294	+	RNA	SNP	T	T	C	rs200340789		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:9439294T>C	ENST00000391138.1	-	0	124									small nucleolar RNA, H/ACA box 75																		CAGCCAAATATACCTCTGTAA	0.343																																																	0								ENSG00000212440																																			SNORA75			0			-	RFAM	AJ007015		2q37.1	2013-09-05			ENSG00000206885	ENSG00000206885		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32661	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_002921		Approved	U23	uc021quo.1				12.37:g.9439294T>C		Somatic	0	9	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	5	68.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391138.1	37	NULL		12																																																																																			-	-		0.343	SNORA75.3-201	NOVEL	basic	snoRNA	ENSG00000212440	snoRNA		T	NR_002921	rs200340789		9439294	-1	no_errors	ENST00000391138	ensembl	human	novel	74_37	rna	SNP	0.012	C
TBC1D3P3	653017	genome.wustl.edu	37	17	20450947	20450947	+	lincRNA	SNP	T	T	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:20450947T>A	ENST00000591705.1	+	0	2264																											TGGTGCCGGCTGCTCCCTGGG	0.607																																																	0								ENSG00000267075																																			RP11-434D2.3			0			-	Clone_based_vega_gene																													17.37:g.20450947T>A		Somatic	0	41	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			-	-		0.607	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	lincRNA	OTTHUMT00000441761.2	T		-		20450947	+1	no_errors	ENST00000591705	ensembl	human	known	74_37	rna	SNP	0.025	A
MYO16	23026	genome.wustl.edu	37	13	109438081	109438081	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr13:109438081G>A	ENST00000357550.2	+	4	581	c.540G>A	c.(538-540)ctG>ctA	p.L180L	MYO16_ENST00000356711.2_Silent_p.L180L|MYO16_ENST00000467639.1_3'UTR|MYO16_ENST00000251041.5_Silent_p.L180L	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGACCTATCTGGATGAAAATG	0.378																																																	0								ENSG00000041515						76.0	71.0	73.0					13																	109438081		2203	4300	6503	MYO16	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.540G>A	13.37:g.109438081G>A		Somatic	0	13	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	26	44.68		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L180	ENST00000357550.2	37	c.540	CCDS32008.1	13																																																																																			-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.378	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	protein_coding	OTTHUMT00000045746.1	G	NM_015011	-		109438081	+1	no_errors	ENST00000356711	ensembl	human	known	74_37	silent	SNP	1.000	A
GTF2H1	2965	genome.wustl.edu	37	11	18369142	18369142	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr11:18369142G>C	ENST00000265963.4	+	8	1005	c.845G>C	c.(844-846)gGc>gCc	p.G282A	GTF2H1_ENST00000524753.4_Missense_Mutation_p.G78A|GTF2H1_ENST00000530496.2_5'UTR|GTF2H1_ENST00000453096.2_Missense_Mutation_p.G282A|GTF2H1_ENST00000534641.1_Missense_Mutation_p.G166A	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	282					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						CAGGGCTATGGCATTTCCTCT	0.363								Nucleotide excision repair (NER)																																									0								ENSG00000110768						39.0	37.0	38.0					11																	18369142		2199	4293	6492	GTF2H1	SO:0001583	missense	0			-	HGNC		CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.845G>C	11.37:g.18369142G>C	ENSP00000265963:p.Gly282Ala	Somatic	0	26	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00	B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BSD,pfam_TFIIH_BTF_p62_N,smart_BSD,pfscan_BSD	p.G282A	ENST00000265963.4	37	c.845	CCDS7838.1	11	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362036	0.82353	.	.	ENSG00000110768	ENST00000453096;ENST00000534641;ENST00000265963;ENST00000524753	T;T;T;T	0.34275	1.68;1.64;1.68;1.37	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.56046	0.1959	M	0.68317	2.08	0.80722	D	1	D	0.65815	0.995	P	0.59761	0.863	T	0.46665	-0.9175	10	0.29301	T	0.29	-8.6112	19.8506	0.96738	0.0:0.0:1.0:0.0	.	282	P32780	TF2H1_HUMAN	A	282;166;282;78	ENSP00000393638:G282A;ENSP00000435375:G166A;ENSP00000265963:G282A;ENSP00000436575:G78A	ENSP00000265963:G282A	G	+	2	0	GTF2H1	18325718	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.882000	0.92420	2.686000	0.91538	0.655000	0.94253	GGC	-	NULL		0.363	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2H1	protein_coding	OTTHUMT00000395627.2	G	NM_005316	-		18369142	+1	no_errors	ENST00000265963	ensembl	human	known	74_37	missense	SNP	1.000	C
GPR98	84059	genome.wustl.edu	37	5	90106134	90106134	+	Silent	SNP	T	T	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr5:90106134T>C	ENST00000405460.2	+	74	15153	c.15057T>C	c.(15055-15057)gaT>gaC	p.D5019D	GPR98_ENST00000425867.2_Silent_p.D680D	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5019	Calx-beta 33. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGTCAGAAGATACACAGATGA	0.393																																																	0								ENSG00000164199						43.0	41.0	41.0					5																	90106134		1844	4095	5939	GPR98	SO:0001819	synonymous_variant	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15057T>C	5.37:g.90106134T>C		Somatic	0	39	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	46	28.12	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D5019	ENST00000405460.2	37	c.15057	CCDS47246.1	5																																																																																			-	pfam_Calx_beta,smart_Calx_beta		0.393	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	T	NM_032119	-		90106134	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	silent	SNP	0.010	C
INPP5F	22876	genome.wustl.edu	37	10	121565903	121565903	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:121565903G>A	ENST00000361976.2	+	12	1517	c.1351G>A	c.(1351-1353)Gaa>Aaa	p.E451K		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	753	5-phosphatase.		D -> G (in OCRL; dbSNP:rs137853850). {ECO:0000269|PubMed:9199559}.|D -> N (in OCRL; dbSNP:rs137853838). {ECO:0000269|PubMed:21031565}.		cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ATGTAAGCAGGAAGGGATTTT	0.383																																																	0								ENSG00000198825						120.0	116.0	118.0					10																	121565903		2203	4300	6503	INPP5F	SO:0001583	missense	0			-	HGNC	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1351G>A	10.37:g.121565903G>A	ENSP00000354519:p.Glu451Lys	Somatic	0	30	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	50	16.67	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Syja_N,pfam_Inositol_phosphatase,pfscan_Syja_N	p.E451K	ENST00000361976.2	37	c.1351	CCDS7616.1	10	.	.	.	.	.	.	.	.	.	.	G	9.984	1.228905	0.22542	.	.	ENSG00000198825	ENST00000361976	T	0.21543	2.0	5.5	5.5	0.81552	Synaptojanin, N-terminal (1);	0.111092	0.64402	D	0.000012	T	0.08714	0.0216	N	0.02247	-0.625	0.80722	D	1	B	0.30193	0.272	B	0.23419	0.046	T	0.19614	-1.0300	10	0.05833	T	0.94	-28.7048	19.425	0.94737	0.0:0.0:1.0:0.0	.	451	Q9Y2H2	SAC2_HUMAN	K	451	ENSP00000354519:E451K	ENSP00000354519:E451K	E	+	1	0	INPP5F	121555893	1.000000	0.71417	0.998000	0.56505	0.920000	0.55202	7.696000	0.84270	2.584000	0.87258	0.563000	0.77884	GAA	-	pfscan_Syja_N		0.383	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5F	protein_coding	OTTHUMT00000050679.1	G	NM_014937	-		121565903	+1	no_errors	ENST00000361976	ensembl	human	known	74_37	missense	SNP	1.000	A
AGAP2	116986	genome.wustl.edu	37	12	58121737	58121737	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:58121737C>T	ENST00000547588.1	-	15	2748	c.2749G>A	c.(2749-2751)Gag>Aag	p.E917K	AGAP2-AS1_ENST00000542466.2_3'UTR|RP11-571M6.8_ENST00000548410.2_RNA|AGAP2_ENST00000257897.3_Missense_Mutation_p.E561K	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	917					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						TTGCTGCTCTCACAGCATTGC	0.592																																																	0								ENSG00000135439						232.0	215.0	221.0					12																	58121737		2203	4300	6503	AGAP2	SO:0001583	missense	0			-	HGNC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2749G>A	12.37:g.58121737C>T	ENSP00000449241:p.Glu917Lys	Somatic	0	39	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	194	19.17	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.E917K	ENST00000547588.1	37	c.2749	CCDS44932.1	12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425230	0.83667	.	.	ENSG00000135439	ENST00000257897;ENST00000547588	T;T	0.16743	2.32;2.32	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.26412	0.0645	M	0.64080	1.96	0.80722	D	1	P;B;B	0.45957	0.869;0.199;0.126	P;B;B	0.44696	0.458;0.144;0.068	T	0.03413	-1.1039	10	0.66056	D	0.02	.	17.4429	0.87570	0.0:1.0:0.0:0.0	.	561;917;917	Q99490-2;F8VVT9;Q99490	.;.;AGAP2_HUMAN	K	561;917	ENSP00000257897:E561K;ENSP00000449241:E917K	ENSP00000257897:E561K	E	-	1	0	AGAP2	56408004	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.878000	0.63093	2.480000	0.83734	0.655000	0.94253	GAG	-	NULL		0.592	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	protein_coding	OTTHUMT00000408367.1	C	NM_014770	-		58121737	-1	no_errors	ENST00000547588	ensembl	human	known	74_37	missense	SNP	1.000	T
DSCR3	10311	genome.wustl.edu	37	21	38639762	38639763	+	5'UTR	INS	-	-	C	rs35672675|rs397760805		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr21:38639762_38639763insC	ENST00000309117.6	-	0	70_71				DSCR3_ENST00000398998.1_5'UTR|DSCR3_ENST00000539844.1_5'Flank|DSCR3_ENST00000288304.5_5'UTR|DSCR3_ENST00000476950.1_5'Flank|DSCR3_ENST00000399000.3_5'UTR|AP001412.1_ENST00000608405.1_RNA|DSCR3_ENST00000399001.1_5'Flank	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3							nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						GAGGGGCGAATGCCCACGCCTT	0.693																																																	0								ENSG00000157538																																			DSCR3	SO:0001623	5_prime_UTR_variant	0				HGNC	D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.-168->G	21.37:g.38639762_38639763insC		Somatic	0	17	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000309117.6	37	NULL	CCDS33553.1	21																																																																																			-	-		0.693	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR3	protein_coding	OTTHUMT00000194807.1	-				38639763	-1	no_errors	ENST00000399000	ensembl	human	known	74_37	rna	INS	0.001:0.001	C
HSD17B1	3292	genome.wustl.edu	37	17	40705302	40705302	+	Silent	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:40705302C>T	ENST00000585807.1	+	2	3978	c.258C>T	c.(256-258)gaC>gaT	p.D86D	RP11-400F19.8_ENST00000585572.1_RNA|RP11-400F19.6_ENST00000590513.1_RNA|HSD17B1_ENST00000225929.5_Silent_p.D86D	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	86					bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	GCCGCGTGGACGTGCTGGGTG	0.642																																																	0								ENSG00000108786						28.0	32.0	31.0					17																	40705302		2203	4299	6502	HSD17B1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.258C>T	17.37:g.40705302C>T		Somatic	1	112	0.88		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	51	43.96	B3KXS1|Q2M2L8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pirsf_17beta_DH,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR	p.D86	ENST00000585807.1	37	c.258	CCDS11428.1	17																																																																																			-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pirsf_17beta_DH,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR		0.642	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD17B1	protein_coding	OTTHUMT00000450392.1	C	NM_000413	-		40705302	+1	no_errors	ENST00000585807	ensembl	human	known	74_37	silent	SNP	0.997	T
EARS2	124454	genome.wustl.edu	37	16	23540873	23540873	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:23540873C>A	ENST00000563459.1	-	7	1308	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H	EARS2_ENST00000564987.1_5'UTR|EARS2_ENST00000564501.1_Missense_Mutation_p.Q434H|EARS2_ENST00000449606.1_Missense_Mutation_p.Q434H|EARS2_ENST00000563232.1_Missense_Mutation_p.Q434H			Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2, mitochondrial	434					gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|tRNA aminoacylation for mitochondrial protein translation (GO:0070127)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|glutamate-tRNA(Gln) ligase activity (GO:0050561)|tRNA binding (GO:0000049)			central_nervous_system(1)|endometrium(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(48;0.0353)		TGGCGTCCAGCTGTGCTCGAC	0.597																																																	0								ENSG00000103356						48.0	50.0	49.0					16																	23540873		2093	4238	6331	EARS2	SO:0001583	missense	0			-	HGNC	AB075850	CCDS42132.1	16p12.2	2014-05-06	2012-10-26		ENSG00000103356	ENSG00000103356	6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"""	29419	protein-coding gene	gene with protein product	"""glutamate tRNA ligase 2, mitochondrial"""	612799	"""glutamyl-tRNA synthetase 2, mitochondrial (putative)"""			15779907, 19805282, 22492562	Standard	NM_001083614		Approved	KIAA1970, MSE1	uc002dlt.4	Q5JPH6	OTTHUMG00000177018	ENST00000563459.1:c.1302G>T	16.37:g.23540873C>A	ENSP00000456467:p.Gln434His	Somatic	0	29	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	42	20.75	B3KTT2|D3DWF1|Q86YH3|Q8TF31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,superfamily_aa-tRNA-synth_I_codon-bd,prints_Glu/Gln-tRNA-synth,tigrfam_Glu-tRNA-ligase_bac/mito	p.Q434H	ENST00000563459.1	37	c.1302	CCDS42132.1	16	.	.	.	.	.	.	.	.	.	.	C	9.663	1.144631	0.21288	.	.	ENSG00000103356	ENST00000449606;ENST00000341597	T	0.44881	0.91	5.61	2.55	0.30701	Aminoacyl-tRNA synthetase, class I, anticodon-binding (1);	0.053464	0.85682	D	0.000000	T	0.40094	0.1103	M	0.72894	2.215	0.45490	D	0.998456	B;B	0.24533	0.105;0.004	B;B	0.22880	0.042;0.009	T	0.19516	-1.0303	10	0.37606	T	0.19	-3.1148	10.298	0.43635	0.0:0.7834:0.0:0.2166	.	434;434	Q86YH3;Q5JPH6	.;SYEM_HUMAN	H	434	ENSP00000395196:Q434H	ENSP00000343488:Q434H	Q	-	3	2	EARS2	23448374	0.996000	0.38824	0.357000	0.25798	0.017000	0.09413	0.401000	0.20948	0.303000	0.22785	0.563000	0.77884	CAG	-	superfamily_aa-tRNA-synth_I_codon-bd,tigrfam_Glu-tRNA-ligase_bac/mito		0.597	EARS2-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	EARS2	protein_coding	OTTHUMT00000434844.1	C	NM_133451	-		23540873	-1	no_errors	ENST00000449606	ensembl	human	known	74_37	missense	SNP	1.000	A
ATP13A4	84239	genome.wustl.edu	37	3	193272443	193272450	+	Intron	DEL	GTGTGTGT	GTGTGTGT	-	rs71879254|rs62287169|rs66654564|rs61326289|rs113367741|rs58073069|rs544456636	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	GTGTGTGT	GTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:193272443_193272450delGTGTGTGT	ENST00000342695.4	-	1	383				ATP13A4_ENST00000392443.3_Intron|ATP13A4_ENST00000295548.3_Intron|ATP13A4-AS1_ENST00000431512.1_RNA|ATP13A4-AS1_ENST00000426459.1_RNA	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		tgatgcgtgcgtgtgtgtgtgtgtgtgt	0.433																																																	0								ENSG00000225473																																			ATP13A4-AS1	SO:0001627	intron_variant	0				HGNC	AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.60+78ACACACAC>-	3.37:g.193272451_193272458delGTGTGTGT		Somatic	NA	NA	NA		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000342695.4	37	NULL	CCDS3304.2	3																																																																																			-	-		0.433	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4-AS1	protein_coding	OTTHUMT00000157244.4	GTGTGTGT	NM_032279			193272450	+1	no_errors	ENST00000426459	ensembl	human	known	74_37	rna	DEL	0.004:0.003:0.002:0.001:0.019:0.004:0.002:0.000	-
KIAA1161	57462	genome.wustl.edu	37	9	34371506	34371506	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr9:34371506G>A	ENST00000297625.7	-	2	1559	c.1334C>T	c.(1333-1335)cCg>cTg	p.P445L		NM_020702.3	NP_065753.2	Q6NSJ0	K1161_HUMAN	KIAA1161	479					carbohydrate metabolic process (GO:0005975)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|skeletal muscle fiber development (GO:0048741)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		GTCCGGCAGCGGCCGGTAGGT	0.672																																																	0								ENSG00000164976						11.0	15.0	14.0					9																	34371506		2078	4185	6263	KIAA1161	SO:0001583	missense	0			-	HGNC	AB032987		9p11.2	2009-11-06			ENSG00000164976	ENSG00000164976			19918	protein-coding gene	gene with protein product						10574461	Standard	XM_006716808		Approved	NET37	uc003zue.4	Q6NSJ0	OTTHUMG00000019816	ENST00000297625.7:c.1334C>T	9.37:g.34371506G>A	ENSP00000297625:p.Pro445Leu	Somatic	0	28	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	6	62.50	Q5T587|Q5T588|Q9ULQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	p.P445L	ENST00000297625.7	37	c.1334		9	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536143	0.64972	.	.	ENSG00000164976	ENST00000297625	D	0.91011	-2.77	5.27	4.36	0.52297	Glycoside hydrolase, superfamily (1);	0.109422	0.64402	D	0.000005	D	0.93959	0.8066	M	0.77616	2.38	0.58432	D	0.999992	D	0.76494	0.999	P	0.59948	0.866	D	0.93806	0.7105	10	0.51188	T	0.08	-17.2791	14.0966	0.65027	0.0:0.0:0.8488:0.1512	.	479	Q6NSJ0	K1161_HUMAN	L	445	ENSP00000297625:P445L	ENSP00000297625:P445L	P	-	2	0	KIAA1161	34361506	1.000000	0.71417	0.945000	0.38365	0.989000	0.77384	4.409000	0.59768	1.193000	0.43086	0.462000	0.41574	CCG	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF		0.672	KIAA1161-001	KNOWN	basic|appris_principal	protein_coding	KIAA1161	protein_coding	OTTHUMT00000052158.1	G	XM_351807	-		34371506	-1	no_errors	ENST00000297625	ensembl	human	known	74_37	missense	SNP	0.994	A
MAP9	79884	genome.wustl.edu	37	4	156289996	156289996	+	Intron	DEL	A	A	-			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr4:156289996delA	ENST00000311277.4	-	5	745				MAP9_ENST00000379248.2_Intron|MAP9_ENST00000515654.1_Intron|AC097467.2_ENST00000598890.1_RNA|AC097467.2_ENST00000596165.1_RNA|AC097467.2_ENST00000600928.1_RNA|AC097467.2_ENST00000597831.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9						cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		GTGTGTGTATAAAAAAATGAC	0.418																																																	0								ENSG00000250910						36.0	36.0	36.0					4																	156289996		2203	4300	6503	AC097467.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.482-32T>-	4.37:g.156289996delA		Somatic	0	31	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000311277.4	37	NULL	CCDS35493.1	4																																																																																			-	-		0.418	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000250910	protein_coding	OTTHUMT00000257771.3	A	NM_001039580			156289996	+1	no_errors	ENST00000597831	ensembl	human	known	74_37	rna	DEL	0.000	-
ATP11B	23200	genome.wustl.edu	37	3	182583358	182583358	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:182583358G>A	ENST00000323116.5	+	13	1575	c.1315G>A	c.(1315-1317)Gaa>Aaa	p.E439K		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	439					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			ACTTGTACCCGAAGGACCAAC	0.373																																																	0								ENSG00000058063						125.0	125.0	125.0					3																	182583358		2203	4300	6503	ATP11B	SO:0001583	missense	0			-	HGNC	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.1315G>A	3.37:g.182583358G>A	ENSP00000321195:p.Glu439Lys	Somatic	0	20	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	77	16.30	Q96FN1|Q9UKK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E439K	ENST00000323116.5	37	c.1315	CCDS33896.1	3	.	.	.	.	.	.	.	.	.	.	G	22.9	4.352910	0.82132	.	.	ENSG00000058063	ENST00000323116	T	0.69685	-0.42	5.82	5.82	0.92795	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.803616	0.11588	N	0.549050	T	0.78052	0.4223	L	0.37466	1.105	0.80722	D	1	D;P	0.89917	1.0;0.694	D;B	0.75484	0.986;0.227	T	0.74780	-0.3549	10	0.48119	T	0.1	.	20.0915	0.97822	0.0:0.0:1.0:0.0	.	13;439	B3KSJ2;Q9Y2G3	.;AT11B_HUMAN	K	439	ENSP00000321195:E439K	ENSP00000321195:E439K	E	+	1	0	ATP11B	184066052	1.000000	0.71417	0.985000	0.45067	0.832000	0.47134	9.209000	0.95087	2.736000	0.93811	0.650000	0.86243	GAA	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.373	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	protein_coding	OTTHUMT00000350598.1	G	NM_014616	-		182583358	+1	no_errors	ENST00000323116	ensembl	human	known	74_37	missense	SNP	1.000	A
FLG2	388698	genome.wustl.edu	37	1	152327667	152327667	+	Silent	SNP	C	C	T	rs12738471	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:152327667C>T	ENST00000388718.5	-	3	2667	c.2595G>A	c.(2593-2595)tcG>tcA	p.S865S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	865	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGTCTGTCCCGAACTTGACC	0.502													c|||	787	0.157149	0.0091	0.2565	5008	,	,		24019	0.3373		0.0696	False		,,,				2504	0.1912																0								ENSG00000143520						377.0	328.0	344.0					1																	152327667		2203	4294	6497	FLG2	SO:0001819	synonymous_variant	0			-	HGNC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2595G>A	1.37:g.152327667C>T		Somatic	0	23	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	40	14.89	Q9H4U1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S865	ENST00000388718.5	37	c.2595	CCDS30861.1	1																																																																																			-	NULL		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	C	NM_001014342	rs12738471		152327667	-1	no_errors	ENST00000388718	ensembl	human	known	74_37	silent	SNP	0.012	T
DMXL1	1657	genome.wustl.edu	37	5	118539113	118539113	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr5:118539113G>A	ENST00000311085.8	+	33	7925	c.7845G>A	c.(7843-7845)aaG>aaA	p.K2615K	DMXL1_ENST00000539542.1_Silent_p.K2615K	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2615										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TATTCACAAAGAAACGGTGTC	0.323																																																	0								ENSG00000172869						75.0	78.0	77.0					5																	118539113		2202	4300	6502	DMXL1	SO:0001819	synonymous_variant	0			-	HGNC	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.7845G>A	5.37:g.118539113G>A		Somatic	0	29	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	121	18.24		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K2615	ENST00000311085.8	37	c.7845	CCDS4125.1	5																																																																																			-	NULL		0.323	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	protein_coding	OTTHUMT00000250862.1	G	NM_005509	-		118539113	+1	no_errors	ENST00000539542	ensembl	human	known	74_37	silent	SNP	1.000	A
MYO5C	55930	genome.wustl.edu	37	15	52497276	52497276	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr15:52497276G>A	ENST00000261839.7	-	38	4767	c.4606C>T	c.(4606-4608)Cgc>Tgc	p.R1536C	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1536	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		CTAGAGGAGCGCTTCCGGAAG	0.602																																																	0								ENSG00000128833						68.0	75.0	73.0					15																	52497276		2004	4147	6151	MYO5C	SO:0001583	missense	0			-	HGNC	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4606C>T	15.37:g.52497276G>A	ENSP00000261839:p.Arg1536Cys	Somatic	0	17	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	23	41.03	Q6P1W8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1536C	ENST00000261839.7	37	c.4606	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943843	0.92593	.	.	ENSG00000128833	ENST00000261839	D	0.90504	-2.68	4.66	4.66	0.58398	Dilute (1);	0.000000	0.85682	D	0.000000	D	0.95503	0.8539	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.96041	0.9024	10	0.87932	D	0	.	18.0881	0.89464	0.0:0.0:1.0:0.0	.	1536	Q9NQX4	MYO5C_HUMAN	C	1536	ENSP00000261839:R1536C	ENSP00000261839:R1536C	R	-	1	0	MYO5C	50284568	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.601000	0.98297	2.583000	0.87209	0.462000	0.41574	CGC	-	pfscan_Dilute		0.602	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	protein_coding	OTTHUMT00000419562.1	G	NM_018728	-		52497276	-1	no_errors	ENST00000261839	ensembl	human	known	74_37	missense	SNP	1.000	A
C14orf37	145407	genome.wustl.edu	37	14	58604835	58604835	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr14:58604835C>G	ENST00000267485.7	-	2	1436	c.1242G>C	c.(1240-1242)ttG>ttC	p.L414F	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	414						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						TACTTTGGAGCAAGTTCACAA	0.443																																																	0								ENSG00000139971						90.0	87.0	88.0					14																	58604835		2203	4300	6503	C14orf37	SO:0001583	missense	0			-	HGNC		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1242G>C	14.37:g.58604835C>G	ENSP00000267485:p.Leu414Phe	Somatic	0	44	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	49	19.67	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L414F	ENST00000267485.7	37	c.1242	CCDS32089.1	14	.	.	.	.	.	.	.	.	.	.	C	17.70	3.454245	0.63290	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.21734	1.99	5.75	2.39	0.29439	.	1.012730	0.07919	N	0.975556	T	0.39384	0.1076	M	0.64997	1.995	0.09310	N	1	D;D;D;D	0.63046	0.977;0.992;0.977;0.977	P;P;P;P	0.62813	0.803;0.907;0.803;0.803	T	0.13791	-1.0496	10	0.59425	D	0.04	0.3821	8.0285	0.30451	0.0:0.579:0.327:0.094	.	452;414;414;414	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	F	414;452	ENSP00000267485:L414F	ENSP00000267485:L414F	L	-	3	2	C14orf37	57674588	0.000000	0.05858	0.016000	0.15963	0.430000	0.31655	-0.539000	0.06113	0.722000	0.32252	0.655000	0.94253	TTG	-	NULL		0.443	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	protein_coding	OTTHUMT00000412059.1	C	NM_001001872	-		58604835	-1	no_errors	ENST00000267485	ensembl	human	known	74_37	missense	SNP	0.002	G
UBR2	23304	genome.wustl.edu	37	6	42583801	42583801	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr6:42583801G>A	ENST00000372899.1	+	10	1413	c.1155G>A	c.(1153-1155)aaG>aaA	p.K385K	UBR2_ENST00000372883.3_5'Flank|UBR2_ENST00000372901.1_Silent_p.K385K|UBR2_ENST00000372903.2_Silent_p.K385K	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	385					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGAAATACAAGAAACTATTTG	0.343																																																	0								ENSG00000024048						194.0	187.0	189.0					6																	42583801		2203	4300	6503	UBR2	SO:0001819	synonymous_variant	0			-	HGNC	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1155G>A	6.37:g.42583801G>A		Somatic	0	44	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	91	10.78	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.K385	ENST00000372899.1	37	c.1155	CCDS4870.1	6																																																																																			-	NULL		0.343	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	protein_coding	OTTHUMT00000040558.2	G	NM_015255	-		42583801	+1	no_errors	ENST00000372899	ensembl	human	known	74_37	silent	SNP	1.000	A
UBR2	23304	genome.wustl.edu	37	6	42583818	42583818	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr6:42583818G>A	ENST00000372899.1	+	10	1430	c.1172G>A	c.(1171-1173)cGa>cAa	p.R391Q	UBR2_ENST00000372883.3_5'Flank|UBR2_ENST00000372901.1_Missense_Mutation_p.R391Q|UBR2_ENST00000372903.2_Missense_Mutation_p.R391Q	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	391					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R391P(1)		breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TTTGCTGTTCGATTTGCAAAA	0.313																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000024048						166.0	160.0	162.0					6																	42583818		2203	4300	6503	UBR2	SO:0001583	missense	0			-	HGNC	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1172G>A	6.37:g.42583818G>A	ENSP00000361990:p.Arg391Gln	Somatic	0	40	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	80	13.04	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R391Q	ENST00000372899.1	37	c.1172	CCDS4870.1	6	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454776	0.43634	.	.	ENSG00000024048	ENST00000372903;ENST00000372899;ENST00000372901	T;T;T	0.71222	-0.55;0.45;0.45	5.45	5.45	0.79879	.	0.062532	0.64402	D	0.000002	T	0.40322	0.1112	N	0.20401	0.57	0.80722	D	1	B;B;B	0.19583	0.037;0.002;0.02	B;B;B	0.14023	0.01;0.001;0.006	T	0.46498	-0.9187	10	0.07990	T	0.79	-12.8367	19.6467	0.95778	0.0:0.0:1.0:0.0	.	391;391;391	Q8IWV8-4;Q8IWV8;Q8IWV8-2	.;UBR2_HUMAN;.	Q	391	ENSP00000361994:R391Q;ENSP00000361990:R391Q;ENSP00000361992:R391Q	ENSP00000361990:R391Q	R	+	2	0	UBR2	42691796	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.755000	0.68750	2.716000	0.92895	0.655000	0.94253	CGA	-	NULL		0.313	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	protein_coding	OTTHUMT00000040558.2	G	NM_015255	-		42583818	+1	no_errors	ENST00000372899	ensembl	human	known	74_37	missense	SNP	1.000	A
CADM4	199731	genome.wustl.edu	37	19	44130154	44130154	+	Splice_Site	SNP	C	C	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr19:44130154C>G	ENST00000222374.2	-	6	713		c.e6-1		CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4						cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				GTGGGGGAGTCTGTTAGGCAA	0.617																																																	0								ENSG00000105767						51.0	50.0	50.0					19																	44130154		2203	4300	6503	CADM4	SO:0001630	splice_region_variant	0			-	HGNC	AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.665-1G>C	19.37:g.44130154C>G		Somatic	0	43	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	B2R7L5|Q9Y4A4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-1	ENST00000222374.2	37	c.665-1	CCDS12627.1	19	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038872	0.55003	.	.	ENSG00000105767	ENST00000222374	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6608	0.85240	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CADM4	48821994	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	5.014000	0.64029	2.538000	0.85594	0.491000	0.48974	.	-	-		0.617	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM4	protein_coding	OTTHUMT00000463352.1	C	NM_145296	-	Intron	44130154	-1	no_errors	ENST00000222374	ensembl	human	known	74_37	splice_site	SNP	1.000	G
OR11H12	440153	genome.wustl.edu	37	14	19378189	19378189	+	Missense_Mutation	SNP	G	G	T	rs2212201		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr14:19378189G>T	ENST00000550708.1	+	1	668	c.596G>T	c.(595-597)cGa>cTa	p.R199L		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCAGGGCCACGATTTGCATTG	0.433																																																	0								ENSG00000257115						4.0	4.0	4.0					14																	19378189		1326	2875	4201	OR11H12	SO:0001583	missense	0			-	HGNC		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.596G>T	14.37:g.19378189G>T	ENSP00000449002:p.Arg199Leu	Somatic	0	17	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R199L	ENST00000550708.1	37	c.596	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	g	0	-2.644232	0.00111	.	.	ENSG00000257115	ENST00000550708	T	0.00021	9.03	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	0.245959	0.20320	N	0.094649	T	0.00012	0.0000	N	0.00000	-4.185	0.22142	N	0.999331	B	0.02656	0.0	B	0.01281	0.0	T	0.54977	-0.8212	9	0.02654	T	1	.	4.8306	0.13437	0.0:0.0:0.3122:0.6878	.	199	B2RN74	O11HC_HUMAN	L	199	ENSP00000449002:R199L	ENSP00000449002:R199L	R	+	2	0	CR383656.1	18448189	0.000000	0.05858	0.203000	0.23512	0.050000	0.14768	0.578000	0.23773	-1.737000	0.01350	-2.446000	0.00210	CGA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.433	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	protein_coding	OTTHUMT00000408402.1	G	NM_001013354	rs201806505		19378189	+1	no_errors	ENST00000550708	ensembl	human	known	74_37	missense	SNP	0.000	T
MAPK8IP2	23542	genome.wustl.edu	37	22	51041769	51041771	+	In_Frame_Del	DEL	GAG	GAG	-	rs572434194	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr22:51041769_51041771delGAG	ENST00000329492.3	+	3	406_408	c.289_291delGAG	c.(289-291)gagdel	p.E103del	MAPK8IP2_ENST00000399912.1_5'UTR|MAPK8IP2_ENST00000399908.2_5'UTR|CHKB_ENST00000463053.1_5'Flank|MAPK8IP2_ENST00000341339.4_Intron|MAPK8IP2_ENST00000008876.5_In_Frame_Del_p.E76del|MAPK8IP2_ENST00000442429.2_In_Frame_Del_p.E103del	NM_012324.3	NP_036456.1	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting protein 2	103	Asp/Glu-rich (acidic).				behavioral fear response (GO:0001662)|dendrite morphogenesis (GO:0048813)|MAPK cascade (GO:0000165)|nonassociative learning (GO:0046958)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of signal transduction (GO:0009967)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of JNK cascade (GO:0046328)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of receptor activity (GO:0010469)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal complex assembly (GO:0007172)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|neuronal postsynaptic density (GO:0097481)	beta-amyloid binding (GO:0001540)|kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)	p.E97delE(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ggacgaggaagaggaggaggagg	0.631														10	0.00199681	0.003	0.0014	5008	,	,		18122	0.001		0.0	False		,,,				2504	0.0041																1	Deletion - In frame(1)	prostate(1)						ENSG00000008735		,	17,100,3819		3,0,11,9,82,1863					,	-7.2	0.1			25	5,202,7773		0,0,5,21,160,3804	no	codingComplex,codingComplex	MAPK8IP2	NM_016431.3,NM_012324.3	,	3,0,16,30,242,5667	A1A1,A1A2,A1R,A2A2,A2R,RR		2.594,2.9726,2.719	,	,		22,302,11592				MAPK8IP2	SO:0001651	inframe_deletion	0				HGNC	AL021708	CCDS74886.1	22q13.33	2010-04-06			ENSG00000008735	ENSG00000008735			6883	protein-coding gene	gene with protein product	"""islet-brain 2"", ""JNK-interacting protein 2"""	607755	"""PRKM8 interacting protein-like"""	PRKM8IPL		10490659	Standard	NM_012324		Approved	IB2, JIP2	uc003bmy.3	Q13387	OTTHUMG00000150181	ENST00000329492.3:c.289_291delGAG	22.37:g.51041778_51041780delGAG	ENSP00000330572:p.Glu103del	Somatic	0	23	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q96G62|Q99771|Q9NZ59|Q9UKQ4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SH3_domain	p.E100in_frame_del	ENST00000329492.3	37	c.289_291		22																																																																																			-	NULL		0.631	MAPK8IP2-202	KNOWN	basic|appris_principal	protein_coding	MAPK8IP2	protein_coding		GAG	NM_012324			51041771	+1	no_errors	ENST00000329492	ensembl	human	known	74_37	in_frame_del	DEL	0.996:0.991:0.021	-
SSPO	23145	genome.wustl.edu	37	7	149493130	149493130	+	RNA	SNP	G	G	A	rs566756129		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr7:149493130G>A	ENST00000378016.2	+	0	6534							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GAGACAAACCGCACGAAGCGG	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20086	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000197558																																			SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149493130G>A		Somatic	0	30	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	36	30.77	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.627	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		G		-		149493130	+1	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	SNP	0.004	A
FKBP10	60681	genome.wustl.edu	37	17	39973444	39973444	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:39973444G>T	ENST00000321562.4	+	2	484	c.380G>T	c.(379-381)aGc>aTc	p.S127I	FKBP10_ENST00000544340.1_5'Flank	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	127	PPIase FKBP-type 1. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		GGCTATGGGAGCATCGGCCTG	0.642																																																	0								ENSG00000141756						66.0	65.0	66.0					17																	39973444		2203	4300	6503	FKBP10	SO:0001583	missense	0			-	HGNC	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.380G>T	17.37:g.39973444G>T	ENSP00000317232:p.Ser127Ile	Somatic	0	16	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	8	46.67	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.S127I	ENST00000321562.4	37	c.380	CCDS11409.1	17	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072909	0.76415	.	.	ENSG00000141756	ENST00000269598;ENST00000429461;ENST00000321562;ENST00000414352	D;D	0.86366	-2.11;-2.11	5.35	5.35	0.76521	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.000000	0.85682	D	0.000000	D	0.90380	0.6989	M	0.64404	1.975	0.80722	D	1	P	0.49090	0.919	P	0.55749	0.783	D	0.91118	0.4927	10	0.72032	D	0.01	-10.7618	14.3574	0.66748	0.0732:0.0:0.9268:0.0	.	127	Q96AY3	FKB10_HUMAN	I	127;67;127;127	ENSP00000408232:S67I;ENSP00000317232:S127I	ENSP00000269598:S127I	S	+	2	0	FKBP10	37226970	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.550000	0.67268	2.526000	0.85167	0.561000	0.74099	AGC	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom		0.642	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	protein_coding	OTTHUMT00000257410.2	G	NM_021939	-		39973444	+1	no_errors	ENST00000321562	ensembl	human	known	74_37	missense	SNP	1.000	T
CILP	8483	genome.wustl.edu	37	15	65499236	65499236	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr15:65499236C>A	ENST00000261883.4	-	4	474	c.308G>T	c.(307-309)gGc>gTc	p.G103V		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	103					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						GCCAGTGCTGCCCGCAGGTGT	0.622																																																	0								ENSG00000138615						36.0	34.0	35.0					15																	65499236		2201	4299	6500	CILP	SO:0001583	missense	0			-	HGNC	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.308G>T	15.37:g.65499236C>A	ENSP00000261883:p.Gly103Val	Somatic	0	20	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.G103V	ENST00000261883.4	37	c.308	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703091	0.48412	.	.	ENSG00000138615	ENST00000261883	T	0.16743	2.32	5.58	1.19	0.21007	.	0.334287	0.35903	N	0.002905	T	0.13030	0.0316	L	0.39898	1.24	0.20307	N	0.999916	P	0.42871	0.792	P	0.44860	0.462	T	0.13229	-1.0517	10	0.18710	T	0.47	0.2513	5.1895	0.15203	0.1295:0.5084:0.2805:0.0817	.	103	O75339	CILP1_HUMAN	V	103	ENSP00000261883:G103V	ENSP00000261883:G103V	G	-	2	0	CILP	63286289	0.010000	0.17322	0.719000	0.30619	0.721000	0.41392	1.543000	0.36147	0.663000	0.31027	0.561000	0.74099	GGC	-	NULL		0.622	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	protein_coding	OTTHUMT00000256829.1	C	NM_003613	-		65499236	-1	no_errors	ENST00000261883	ensembl	human	known	74_37	missense	SNP	0.001	A
TTN	7273	genome.wustl.edu	37	2	179429737	179429737	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr2:179429737G>A	ENST00000591111.1	-	276	76423	c.76199C>T	c.(76198-76200)aCg>aTg	p.T25400M	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T24473M|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T18101M|TTN_ENST00000342175.6_Missense_Mutation_p.T18168M|TTN_ENST00000460472.2_Missense_Mutation_p.T17976M|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T27041M|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25400	Fibronectin type-III 84. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGGTACTCCGTGCCTGTTTT	0.393																																																	0								ENSG00000155657						136.0	134.0	134.0					2																	179429737		1884	4097	5981	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76199C>T	2.37:g.179429737G>A	ENSP00000465570:p.Thr25400Met	Somatic	0	29	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	39	32.76	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T24473M	ENST00000591111.1	37	c.73418		2	.	.	.	.	.	.	.	.	.	.	G	7.656	0.683867	0.14907	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	5.88	-0.83	0.10792	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67021	0.2849	M	0.65677	2.01	0.09310	N	1	P;P;P;P	0.40083	0.702;0.702;0.702;0.702	B;B;B;B	0.41813	0.231;0.231;0.367;0.367	T	0.68029	-0.5517	9	0.87932	D	0	.	21.8457	0.99962	0.0:0.5919:0.4081:0.0	.	17976;18101;18168;25400	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	M	24473;17976;18168;18101;17974	ENSP00000343764:T24473M;ENSP00000434586:T17976M;ENSP00000340554:T18168M;ENSP00000352154:T18101M	ENSP00000340554:T18168M	T	-	2	0	TTN	179137983	0.577000	0.26708	0.264000	0.24511	0.990000	0.78478	0.901000	0.28445	-0.135000	0.11495	0.555000	0.69702	ACG	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179429737	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	0.209	A
C1orf43	25912	genome.wustl.edu	37	1	154185146	154185146	+	Intron	DEL	T	T	-			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:154185146delT	ENST00000368521.5	-	5	539				C1orf43_ENST00000350592.3_Intron|C1orf43_ENST00000368518.1_Intron|C1orf43_ENST00000368519.1_Intron|C1orf43_ENST00000362076.4_Intron|C1orf43_ENST00000368516.1_Intron	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43							integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					TTCTTTAGTCtttttttttga	0.473																																																	0								ENSG00000143612		,,	42,65,4117		0,0,42,1,63,2006	20.0	21.0	21.0		,,	-2.2	0.0	1		22	69,146,8019		0,1,68,1,143,3904	no	intron,intron,intron	C1orf43	NM_138740.2,NM_015449.2,NM_001098616.1	,,	0,1,110,2,206,5910	A1A1,A1A2,A1R,A2A2,A2R,RR		2.6111,2.5331,2.5847	,,	,,	154185146	111,211,12136	2194	4299	6493	C1orf43	SO:0001627	intron_variant	0				HGNC	AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.341-46A>-	1.37:g.154185146delT		Somatic	0	12	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368521.5	37	NULL	CCDS41404.1	1																																																																																			-	-		0.473	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf43	protein_coding	OTTHUMT00000087664.2	T	NM_015449			154185146	-1	no_errors	ENST00000493814	ensembl	human	known	74_37	rna	DEL	0.025	-
LGR5	8549	genome.wustl.edu	37	12	71955560	71955560	+	Splice_Site	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:71955560G>C	ENST00000266674.5	+	8	1096		c.e8-1		LGR5_ENST00000536515.1_Splice_Site|LGR5_ENST00000540815.2_Intron			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5						G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TCTCTTTCTAGAGGATTTCAT	0.368																																																	0								ENSG00000139292						52.0	47.0	49.0					12																	71955560		2203	4300	6503	LGR5	SO:0001630	splice_region_variant	0			-	HGNC	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.786-1G>C	12.37:g.71955560G>C		Somatic	0	33	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	384	117	76.49	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8-1	ENST00000266674.5	37	c.786-1	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874737	0.91664	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LGR5	70241827	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.623000	0.98386	2.937000	0.99478	0.650000	0.86243	.	-	-		0.368	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	protein_coding	OTTHUMT00000404744.1	G	NM_003667	-	Intron	71955560	+1	no_errors	ENST00000266674	ensembl	human	known	74_37	splice_site	SNP	1.000	C
ATRX	546	genome.wustl.edu	37	X	76890194	76890194	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chrX:76890194C>T	ENST00000373344.5	-	17	4914	c.4700G>A	c.(4699-4701)gGt>gAt	p.G1567D	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Splice_Site_p.G1529D	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1567					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAACTGAACACCTAAAAATAA	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						115.0	115.0	115.0					X																	76890194		2203	4296	6499	ATRX	SO:0001630	splice_region_variant	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.4700-1G>A	X.37:g.76890194C>T		Somatic	0	15	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	14	70.83	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G1567D	ENST00000373344.5	37	c.4700	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	19.64	3.866043	0.71949	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.94457	-3.43;-3.43	5.77	5.77	0.91146	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.85682	U	0.000000	D	0.98592	0.9529	H	0.98314	4.2	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99694	1.1002	10	0.87932	D	0	.	18.913	0.92493	0.0:1.0:0.0:0.0	.	1529;1567	P46100-4;P46100	.;ATRX_HUMAN	D	1567;1529	ENSP00000362441:G1567D;ENSP00000378967:G1529D	ENSP00000362441:G1567D	G	-	2	0	ATRX	76776850	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.463000	0.80869	2.414000	0.81942	0.600000	0.82982	GGT	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	C	NM_000489	-	Missense_Mutation	76890194	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	SNP	1.000	T
UBTF	7343	genome.wustl.edu	37	17	42290278	42290278	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:42290278G>A	ENST00000302904.4	-	7	1061	c.569C>T	c.(568-570)gCc>gTc	p.A190V	UBTF_ENST00000533177.1_Missense_Mutation_p.A190V|UBTF_ENST00000393606.3_Missense_Mutation_p.A190V|UBTF_ENST00000537550.1_5'Flank|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Missense_Mutation_p.A190V|UBTF_ENST00000529383.1_Missense_Mutation_p.A190V|UBTF_ENST00000343638.5_Missense_Mutation_p.A190V|UBTF_ENST00000527034.1_Missense_Mutation_p.A190V|UBTF_ENST00000436088.1_Missense_Mutation_p.A190V			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	190					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CGATTTCTTGGCATTCTGGAT	0.587																																																	0								ENSG00000108312						161.0	155.0	157.0					17																	42290278		2203	4300	6503	UBTF	SO:0001583	missense	0			-	HGNC	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.569C>T	17.37:g.42290278G>A	ENSP00000302640:p.Ala190Val	Somatic	0	59	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	35	42.62	A8K6R8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_ARM-type_fold,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A190V	ENST00000302904.4	37	c.569	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	g	15.09	2.730484	0.48939	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383	D;D;D;D;D;D;D;D	0.98329	-4.84;-4.11;-4.87;-4.84;-4.11;-4.84;-4.84;-4.11	5.0	5.0	0.66597	High mobility group, HMG1/HMG2 (1);	0.265763	0.38720	N	0.001587	D	0.93933	0.8058	N	0.03608	-0.345	0.31864	N	0.62057	P;P;B	0.41643	0.629;0.758;0.021	B;B;B	0.41646	0.199;0.362;0.015	D	0.93192	0.6584	10	0.30854	T	0.27	-23.7501	17.5755	0.87947	0.0:0.0:1.0:0.0	.	190;190;190	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	V	190	ENSP00000345297:A190V;ENSP00000302640:A190V;ENSP00000431539:A190V;ENSP00000437180:A190V;ENSP00000390669:A190V;ENSP00000377231:A190V;ENSP00000432925:A190V;ENSP00000435708:A190V	ENSP00000302640:A190V	A	-	2	0	UBTF	39645804	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.618000	0.67722	2.757000	0.94681	0.655000	0.94253	GCC	-	superfamily_ARM-type_fold		0.587	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	protein_coding	OTTHUMT00000395205.1	G	NM_014233	-		42290278	-1	no_errors	ENST00000302904	ensembl	human	known	74_37	missense	SNP	1.000	A
MPZL1	9019	genome.wustl.edu	37	1	167691169	167691169	+	5'Flank	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:167691169G>C	ENST00000359523.2	+	0	0				MPZL1_ENST00000474859.1_5'Flank|MPZL1_ENST00000392121.3_5'Flank	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1						cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					AAGGGTGCGGGCAGGCCAATG	0.716																																																	0								ENSG00000197965																																			MPZL1	SO:0001631	upstream_gene_variant	0			-	HGNC	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571		1.37:g.167691169G>C	Exception_encountered	Somatic	0	33	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	13	43.48	B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359523.2	37	NULL	CCDS1264.1	1																																																																																			-	-		0.716	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPZL1	protein_coding	OTTHUMT00000083655.2	G	NM_024569	-		167691169	+1	no_errors	ENST00000487858	ensembl	human	putative	74_37	rna	SNP	0.000	C
TMPRSS3	64699	genome.wustl.edu	37	21	43815480	43815480	+	Missense_Mutation	SNP	C	C	T	rs369418733		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr21:43815480C>T	ENST00000291532.3	-	2	1002	c.47G>A	c.(46-48)cGa>cAa	p.R16Q	TMPRSS3_ENST00000433957.2_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.R16Q|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.R100Q|TMPRSS3_ENST00000398397.3_Missense_Mutation_p.R16Q	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	16					cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						AAAAAGCGATCGGAATGAGAA	0.517																																																	0								ENSG00000160183	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	117.0	102.0	107.0		47,47	4.5	1.0	21		107	0,8600		0,0,4300	no	missense,missense	TMPRSS3	NM_024022.2,NM_032405.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	16/455,16/345	43815480	1,13005	2203	4300	6503	TMPRSS3	SO:0001583	missense	0			-	HGNC	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.47G>A	21.37:g.43815480C>T	ENSP00000291532:p.Arg16Gln	Somatic	0	32	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	47	22.95	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_SRCR,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_LDrepeatLR_classA_rpt,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R100Q	ENST00000291532.3	37	c.299	CCDS13686.1	21	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916630	0.73098	2.27E-4	0.0	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399;ENST00000398397	D;D;D;D;D	0.88354	-2.33;-2.33;-2.33;-2.37;-2.33	5.39	4.5	0.54988	.	0.132141	0.36628	N	0.002499	T	0.80276	0.4593	N	0.19112	0.55	0.28577	N	0.910325	D;P;P	0.57899	0.981;0.948;0.913	B;B;B	0.43916	0.436;0.237;0.12	T	0.74551	-0.3628	9	.	.	.	.	9.3585	0.38182	0.0:0.904:0.0:0.096	.	16;16;16	P57727-3;P57727-5;P57727	.;.;TMPS3_HUMAN	Q	16;16;16;100;16	ENSP00000291532:R16Q;ENSP00000411013:R16Q;ENSP00000381442:R16Q;ENSP00000369762:R100Q;ENSP00000381434:R16Q	.	R	-	2	0	TMPRSS3	42688549	0.993000	0.37304	0.956000	0.39512	0.959000	0.62525	1.712000	0.37940	2.691000	0.91804	0.655000	0.94253	CGA	-	NULL		0.517	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS3	protein_coding	OTTHUMT00000195347.1	C		-		43815480	-1	no_errors	ENST00000380399	ensembl	human	known	74_37	missense	SNP	0.958	T
ABCF1	23	genome.wustl.edu	37	6	30545854	30545854	+	Splice_Site	DEL	A	A	-	rs555740367		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr6:30545854delA	ENST00000326195.8	+	4	330	c.218delA	c.(217-219)caa>ca	p.Q73fs	ABCF1_ENST00000396515.4_Splice_Site_p.Q73fs|ABCF1_ENST00000376545.3_Splice_Site_p.Q73fs	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	73					inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TCTCAGCAGCAAAAAAAAAAG	0.493																																																	0								ENSG00000204574		,	66,405,3793		0,0,66,1,403,1662	64.0	70.0	68.0		,	5.5	1.0	6		71	105,634,7515		0,1,104,0,633,3389	no	codingComplex-near-splice,codingComplex-near-splice	ABCF1	NM_001090.2,NM_001025091.1	,	0,1,170,1,1036,5051	A1A1,A1A2,A1R,A2A2,A2R,RR		8.9532,11.046,9.6661	,	,	30545854	171,1039,11308	2203	4300	6503	ABCF1	SO:0001630	splice_region_variant	0				HGNC	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.217-1A>-	6.37:g.30545854delA		Somatic	0	29	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	A2BF75|O14897|Q69YP6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K76fs	ENST00000326195.8	37	c.218	CCDS34380.1	6																																																																																			-	NULL		0.493	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABCF1	protein_coding	OTTHUMT00000076137.3	A			Frame_Shift_Del	30545854	+1	no_errors	ENST00000326195	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PHTF1	10745	genome.wustl.edu	37	1	114281367	114281367	+	Missense_Mutation	SNP	C	C	T	rs376636226		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:114281367C>T	ENST00000369604.1	-	4	640	c.157G>A	c.(157-159)Gtt>Att	p.V53I	PHTF1_ENST00000393357.2_Missense_Mutation_p.V53I|PHTF1_ENST00000369596.2_Missense_Mutation_p.V53I|PHTF1_ENST00000369600.1_Missense_Mutation_p.V53I|PHTF1_ENST00000447664.2_Missense_Mutation_p.V53I|PHTF1_ENST00000357783.2_Missense_Mutation_p.V53I|PHTF1_ENST00000369598.1_Missense_Mutation_p.V53I			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	53					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTAAGTCAACGTCAATCAAG	0.294																																																	0								ENSG00000116793	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	149.0	156.0	153.0		157	4.8	1.0	1		153	0,8600		0,0,4300	no	missense	PHTF1	NM_006608.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	53/763	114281367	1,13005	2203	4300	6503	PHTF1	SO:0001583	missense	0			-	HGNC	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.157G>A	1.37:g.114281367C>T	ENSP00000358617:p.Val53Ile	Somatic	0	61	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	84	38.69	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_homeodomain_male	p.V53I	ENST00000369604.1	37	c.157	CCDS861.1	1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.080172	0.55753	2.27E-4	0.0	ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783;ENST00000447664;ENST00000446739	.	.	.	5.68	4.77	0.60923	Transcription factor homeodomain, male germ-cell (1);	0.000000	0.85682	D	0.000000	T	0.65698	0.2716	M	0.85542	2.76	0.80722	D	1	D;D;D;D	0.63880	0.964;0.964;0.993;0.982	P;B;P;P	0.51945	0.477;0.437;0.62;0.685	T	0.71272	-0.4642	9	0.46703	T	0.11	-19.2185	12.9872	0.58598	0.0:0.9254:0.0:0.0746	.	53;53;53;53	F5H7M5;Q9UMS5;B4DGS8;Q9UMS5-2	.;PHTF1_HUMAN;.;.	I	53	.	ENSP00000350428:V53I	V	-	1	0	PHTF1	114082890	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	7.645000	0.83430	1.413000	0.46997	-0.145000	0.13849	GTT	-	pfam_TF_homeodomain_male		0.294	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	protein_coding	OTTHUMT00000032666.1	C	NM_006608	-		114281367	-1	no_errors	ENST00000369604	ensembl	human	known	74_37	missense	SNP	1.000	T
STAG3L1	54441	genome.wustl.edu	37	7	74988500	74988500	+	RNA	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr7:74988500C>T	ENST00000402225.5	+	0	53							P0CL83	ST3L1_HUMAN	stromal antigen 3-like 1 (pseudogene)							nucleus (GO:0005634)											CGCCCTCCGTCGTGGTCTGGC	0.612																																																	0								ENSG00000205583																																			STAG3L1			0			-	HGNC			7q11.23	2013-06-26	2013-06-26		ENSG00000205583	ENSG00000205583			33852	pseudogene	pseudogene			"""stromal antigen 3-like 1"""				Standard	NR_040583		Approved	DKFZP434A0131, STAG3L1P	uc022agf.1	P0CL83	OTTHUMG00000155940		7.37:g.74988500C>T		Somatic	0	35	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	A6NMT8|A8K0A1|Q32NE4|Q6NXR2|Q7L5M5|Q7Z5K6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402225.5	37	NULL		7																																																																																			-	-		0.612	STAG3L1-012	KNOWN	basic	processed_transcript	STAG3L1	pseudogene	OTTHUMT00000437242.1	C	NM_001002840	-		74988500	+1	no_errors	ENST00000402225	ensembl	human	known	74_37	rna	SNP	0.000	T
AC018755.1	0	genome.wustl.edu	37	19	52097498	52097498	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr19:52097498T>G	ENST00000301439.3	-	1	132	c.77A>C	c.(76-78)aAt>aCt	p.N26T	AC018755.16_ENST00000598755.1_RNA																							CCTTTTCACATTCCCAATCTC	0.537																																																	0								ENSG00000167765																																			AC018755.1	SO:0001583	missense	0			-	Clone_based_ensembl_gene																												ENST00000301439.3:c.77A>C	19.37:g.52097498T>G	ENSP00000301439:p.Asn26Thr	Somatic	0	53	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	16	50.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N26T	ENST00000301439.3	37	c.77		19	.	.	.	.	.	.	.	.	.	.	T	2.919	-0.223557	0.06061	.	.	ENSG00000167765	ENST00000301439	.	.	.	2.1	-0.317	0.12736	.	.	.	.	.	T	0.29061	0.0722	.	.	.	0.09310	N	1	B	0.27823	0.19	B	0.30716	0.119	T	0.34800	-0.9814	7	0.87932	D	0	.	2.656	0.05012	0.2805:0.5488:0.0:0.1707	.	26	Q96NP5	.	T	26	.	ENSP00000301439:N26T	N	-	2	0	AC018755.11	56789310	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.656000	0.05342	0.037000	0.15575	-0.558000	0.04189	AAT	-	NULL		0.537	AC018755.1-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ENSG00000167765	protein_coding		T		-		52097498	-1	no_errors	ENST00000301439	ensembl	human	known	74_37	missense	SNP	0.002	G
CFAP43	80217	genome.wustl.edu	37	10	105944776	105944776	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:105944776C>T	ENST00000278064.2	-	16	2257	c.1932G>A	c.(1930-1932)tgG>tgA	p.W644*	WDR96_ENST00000357060.3_Nonsense_Mutation_p.W713*|WDR96_ENST00000428666.1_Nonsense_Mutation_p.W714*																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTACGTACTTCCACTTTAGGT	0.403																																																	0								ENSG00000197748						200.0	172.0	182.0					10																	105944776		2203	4300	6503	WDR96	SO:0001587	stop_gained	0			-	HGNC																												ENST00000278064.2:c.1932G>A	10.37:g.105944776C>T	ENSP00000278064:p.Trp644*	Somatic	0	34	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu	p.W713*	ENST00000278064.2	37	c.2139		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.536514|8.536514	0.98854|0.98854	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000434629|ENST00000357060;ENST00000428666;ENST00000278064	.|.	.|.	.|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	.|0.260238	.|0.32703	.|N	.|0.005760	T|.	0.69967|.	0.3170|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71457|.	-0.4587|.	3|.	.|0.33141	.|T	.|0.24	.|.	16.1676|16.1676	0.81782|0.81782	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	E|X	74|713;714;644	.|.	.|ENSP00000278064:W644X	G|W	-|-	2|3	0|0	WDR96|WDR96	105934766|105934766	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.638000|0.638000	0.38207|0.38207	4.369000|4.369000	0.59511|0.59511	2.403000|2.403000	0.81681|0.81681	0.655000|0.655000	0.94253|0.94253	GGA|TGG	-	superfamily_WD40_repeat_dom		0.403	WDR96-003	KNOWN	basic	protein_coding	WDR96	protein_coding	OTTHUMT00000050200.1	C		-		105944776	-1	no_errors	ENST00000357060	ensembl	human	known	74_37	nonsense	SNP	1.000	T
SOAT2	8435	genome.wustl.edu	37	12	53516922	53516922	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:53516922G>T	ENST00000301466.3	+	13	1354	c.1294G>T	c.(1294-1296)Gtg>Ttg	p.V432L		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	432					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	GGTCTCCGCAGTGGCCCATGA	0.572																																																	0								ENSG00000167780						243.0	186.0	205.0					12																	53516922		2203	4300	6503	SOAT2	SO:0001583	missense	0			-	HGNC	AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	ENST00000301466.3:c.1294G>T	12.37:g.53516922G>T	ENSP00000301466:p.Val432Leu	Somatic	0	77	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MBOAT_fam	p.V432L	ENST00000301466.3	37	c.1294	CCDS8847.1	12	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920952	0.33908	.	.	ENSG00000167780	ENST00000301466	T	0.75589	-0.95	4.98	2.09	0.27110	.	0.438295	0.24412	N	0.038760	T	0.53286	0.1787	N	0.20401	0.57	0.34962	D	0.752253	B	0.13594	0.008	B	0.17722	0.019	T	0.48547	-0.9026	10	0.41790	T	0.15	-14.228	3.3201	0.07047	0.1551:0.1354:0.5701:0.1394	.	432	O75908	SOAT2_HUMAN	L	432	ENSP00000301466:V432L	ENSP00000301466:V432L	V	+	1	0	SOAT2	51803189	0.028000	0.19301	0.380000	0.26093	0.931000	0.56810	0.255000	0.18333	0.357000	0.24183	0.561000	0.74099	GTG	-	pfam_MBOAT_fam		0.572	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOAT2	protein_coding	OTTHUMT00000405817.1	G		-		53516922	+1	no_errors	ENST00000301466	ensembl	human	known	74_37	missense	SNP	0.649	T
HELZ2	85441	genome.wustl.edu	37	20	62196976	62196976	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr20:62196976delC	ENST00000467148.1	-	8	3268	c.3199delG	c.(3199-3201)gagfs	p.E1067fs	HELZ2_ENST00000427522.2_Frame_Shift_Del_p.E498fs	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1067					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCGTTGAGCTCCCCGTCCCAC	0.687																																																	0								ENSG00000130589						39.0	31.0	34.0					20																	62196976		2196	4298	6494	HELZ2	SO:0001589	frameshift_variant	0				HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3199delG	20.37:g.62196976delC	ENSP00000417401:p.Glu1067fs	Somatic	0	18	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.E1067fs	ENST00000467148.1	37	c.3199	CCDS33508.1	20																																																																																			-	NULL		0.687	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	C	NM_001037335			62196976	-1	no_errors	ENST00000467148	ensembl	human	known	74_37	frame_shift_del	DEL	0.991	-
EMX2	2018	genome.wustl.edu	37	10	119307608	119307608	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:119307608G>T	ENST00000553456.3	+	3	1448	c.624G>T	c.(622-624)aaG>aaT	p.K208N	EMX2_ENST00000546446.1_3'UTR|EMX2_ENST00000442245.4_Missense_Mutation_p.V147F	NM_004098.3	NP_004089.1	Q04743	EMX2_HUMAN	empty spiracles homeobox 2	208					anterior/posterior pattern specification (GO:0009952)|cell proliferation in forebrain (GO:0021846)|cerebral cortex regionalization (GO:0021796)|dentate gyrus development (GO:0021542)|forebrain cell migration (GO:0021885)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|response to drug (GO:0042493)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|prostate(2)	12		Colorectal(252;0.109)|Lung NSC(174;0.179)|all_lung(145;0.22)		all cancers(201;0.0133)		GAAGAACAAAGTTCAAAAGGC	0.488																																																	0								ENSG00000170370						56.0	51.0	53.0					10																	119307608		2203	4300	6503	EMX2	SO:0001583	missense	0			-	HGNC	AF301598	CCDS7601.1, CCDS53583.1	10q26.11	2011-06-20	2007-02-15		ENSG00000170370	ENSG00000170370		"""Homeoboxes / ANTP class : NKL subclass"""	3341	protein-coding gene	gene with protein product		600035	"""empty spiracles homolog 2 (Drosophila)"""			7959790	Standard	NM_004098		Approved		uc001ldh.4	Q04743	OTTHUMG00000019123	ENST00000553456.3:c.624G>T	10.37:g.119307608G>T	ENSP00000450962:p.Lys208Asn	Somatic	0	34	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	G3V305|Q96NN8|Q9BQF4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_HTH_motif	p.K208N	ENST00000553456.3	37	c.624	CCDS7601.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.545742|4.545742	0.86022|0.86022	.|.	.|.	ENSG00000170370|ENSG00000258614	ENST00000369201|ENST00000553456	.|.	.|.	.|.	5.31|5.31	2.38|2.38	0.29361|0.29361	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64327|0.64327	0.2588|0.2588	M|M	0.93898|0.93898	3.47|3.47	0.28467|0.28467	N|N	0.915583|0.915583	D|P	0.89917|0.39250	1.0|0.665	D|B	0.97110|0.41088	1.0|0.347	T|T	0.63051|0.63051	-0.6723|-0.6723	9|7	0.87932|.	D|.	0|.	-18.7931|-18.7931	9.8207|9.8207	0.40880|0.40880	0.2285:0.0:0.7715:0.0|0.2285:0.0:0.7715:0.0	.|.	208|147	Q04743|G3V305	EMX2_HUMAN|.	N|F	208|147	.|.	ENSP00000358202:K208N|.	K|V	+|+	3|1	2|0	EMX2|AC005871.1	119297598|119297598	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.399000|2.399000	0.44495|0.44495	0.597000|0.597000	0.29811|0.29811	0.549000|0.549000	0.68633|0.68633	AAG|GTT	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_HTH_motif		0.488	EMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMX2	protein_coding	OTTHUMT00000050569.4	G	NM_004098	-		119307608	+1	no_errors	ENST00000553456	ensembl	human	known	74_37	missense	SNP	1.000	T
SRRM1	10250	genome.wustl.edu	37	1	24981479	24981479	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:24981479G>T	ENST00000323848.9	+	9	1489	c.1174G>T	c.(1174-1176)Gca>Tca	p.A392S	SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000537199.1_Missense_Mutation_p.Q273H|SRRM1_ENST00000374389.4_Missense_Mutation_p.A387S|SRRM1_ENST00000447431.2_Missense_Mutation_p.A392S	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	392	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ATCTCCTTCAGCAAGTCCTCC	0.542																																					Ovarian(68;897 1494 3282 17478)												0								ENSG00000133226						109.0	103.0	105.0					1																	24981479		2203	4300	6503	SRRM1	SO:0001583	missense	0			-	HGNC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1174G>T	1.37:g.24981479G>T	ENSP00000326261:p.Ala392Ser	Somatic	0	30	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	O60585|Q5VVN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PWI_dom,superfamily_PWI_dom,smart_PWI_dom	p.A392S	ENST00000323848.9	37	c.1174	CCDS255.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.25|14.25	2.480801|2.480801	0.44044|0.44044	.|.	.|.	ENSG00000133226|ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389|ENST00000537199	T;T;T|T	0.44881|0.52526	0.91;0.94;0.91|0.66	5.84|5.84	3.79|3.79	0.43588|0.43588	.|.	0.210029|.	0.32785|.	N|.	0.005643|.	T|T	0.26448|0.26448	0.0646|0.0646	N|N	0.02315|0.02315	-0.6|-0.6	0.18873|0.18873	N|N	0.999981|0.999981	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.04013|.	0.0;0.001|.	T|T	0.22836|0.22836	-1.0205|-1.0205	10|7	0.17832|0.87932	T|D	0.49|0	-2.9176|-2.9176	10.4443|10.4443	0.44483|0.44483	0.07:0.0:0.7115:0.2185|0.07:0.0:0.7115:0.2185	.|.	392;392|.	E9PCT1;Q8IYB3|.	.;SRRM1_HUMAN|.	S|H	392;392;387|273	ENSP00000326261:A392S;ENSP00000391430:A392S;ENSP00000363510:A387S|ENSP00000441776:Q273H	ENSP00000326261:A392S|ENSP00000441776:Q273H	A|Q	+|+	1|3	0|2	SRRM1|SRRM1	24854066|24854066	0.968000|0.968000	0.33430|0.33430	0.996000|0.996000	0.52242|0.52242	0.999000|0.999000	0.98932|0.98932	2.828000|2.828000	0.48120|0.48120	1.471000|1.471000	0.48121|0.48121	0.650000|0.650000	0.86243|0.86243	GCA|CAG	-	NULL		0.542	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	protein_coding	OTTHUMT00000009292.2	G	NM_005839	-		24981479	+1	no_errors	ENST00000447431	ensembl	human	known	74_37	missense	SNP	0.678	T
NR2C1	7181	genome.wustl.edu	37	12	95434360	95434360	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:95434360G>C	ENST00000333003.5	-	10	1475	c.1145C>G	c.(1144-1146)tCt>tGt	p.S382C	NR2C1_ENST00000330677.7_Missense_Mutation_p.S382C|NR2C1_ENST00000393101.3_Missense_Mutation_p.S382C|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	382					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S382F(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						AGGCATAGGAGAAGGCATGGT	0.398																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000120798						131.0	113.0	119.0					12																	95434360		2203	4300	6503	NR2C1	SO:0001583	missense	0			-	HGNC	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1145C>G	12.37:g.95434360G>C	ENSP00000333275:p.Ser382Cys	Somatic	0	59	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	112	32.93	A8K5K4|Q15625|Q15626	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.S382C	ENST00000333003.5	37	c.1145	CCDS9051.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.31|16.31	3.086795|3.086795	0.55861|0.55861	.|.	.|.	ENSG00000120798|ENSG00000120798	ENST00000551647|ENST00000333003;ENST00000393101;ENST00000330677	.|D;D;D	.|0.96967	.|-4.19;-4.19;-4.19	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	.|0.171825	.|0.53938	.|D	.|0.000049	D|D	0.98160|0.98160	0.9392|0.9392	M|M	0.79475|0.79475	2.455|2.455	0.47511|0.47511	D|D	0.999441|0.999441	.|D;D;D;D	.|0.76494	.|0.999;0.999;0.999;0.999	.|D;P;D;D	.|0.79784	.|0.993;0.89;0.926;0.933	D|D	0.98214|0.98214	1.0474|1.0474	5|10	.|0.66056	.|D	.|0.02	.|.	20.6208|20.6208	0.99490|0.99490	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|382;382;382;382	.|B6ZGT7;P13056-3;P13056-2;P13056	.|.;.;.;NR2C1_HUMAN	L|C	5|382	.|ENSP00000333275:S382C;ENSP00000376813:S382C;ENSP00000328843:S382C	.|ENSP00000328843:S382C	F|S	-|-	3|2	2|0	NR2C1|NR2C1	93958491|93958491	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	4.782000|4.782000	0.62396|0.62396	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	TTC|TCT	-	superfamily_Nucl_hormone_rcpt_ligand-bd		0.398	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	protein_coding	OTTHUMT00000407565.2	G	NM_003297	-		95434360	-1	no_errors	ENST00000333003	ensembl	human	known	74_37	missense	SNP	1.000	C
JUP	3728	genome.wustl.edu	37	17	39794955	39794955	+	Intron	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr17:39794955G>T	ENST00000540235.1	-	5	909							P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CTGGTTTCCAGGAACTGTCAG	0.612																																					Colon(16;42 520 6044 17852 28530)												0								ENSG00000214514																																			KRT42P	SO:0001627	intron_variant	0			-	HGNC	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000540235.1:c.910-15671C>A	17.37:g.39794955G>T		Somatic	0	30	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000540235.1	37	NULL		17																																																																																			-	-		0.612	JUP-201	KNOWN	basic	protein_coding	KRT42P	protein_coding		G		-		39794955	-1	no_errors	ENST00000398469	ensembl	human	known	74_37	rna	SNP	0.992	T
PRAMEF2	65122	genome.wustl.edu	37	1	12919081	12919081	+	Missense_Mutation	SNP	C	C	A	rs45443899	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:12919081C>A	ENST00000240189.2	+	2	304	c.217C>A	c.(217-219)Ctt>Att	p.L73I		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	73					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GATGAAGACGCTTCATCTGGA	0.557																																																	0								ENSG00000120952						154.0	164.0	161.0					1																	12919081		2201	4296	6497	PRAMEF2	SO:0001583	missense	0			-	HGNC		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.217C>A	1.37:g.12919081C>A	ENSP00000240189:p.Leu73Ile	Somatic	0	54	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	64	31.91		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L73I	ENST00000240189.2	37	c.217	CCDS149.1	1	.	.	.	.	.	.	.	.	.	.	C	9.162	1.019047	0.19355	.	.	ENSG00000120952	ENST00000240189	T	0.16324	2.35	0.842	0.842	0.18927	.	0.886493	0.09599	N	0.780473	T	0.19327	0.0464	L	0.49126	1.545	0.09310	N	1	P	0.48503	0.911	P	0.47430	0.547	T	0.18272	-1.0342	10	0.56958	D	0.05	.	5.0452	0.14480	0.0:1.0:0.0:0.0	.	73	O60811	PRAM2_HUMAN	I	73	ENSP00000240189:L73I	ENSP00000240189:L73I	L	+	1	0	PRAMEF2	12841668	0.000000	0.05858	0.055000	0.19348	0.048000	0.14542	0.446000	0.21694	0.759000	0.33084	0.194000	0.17425	CTT	-	NULL		0.557	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	protein_coding	OTTHUMT00000005517.1	C	NM_023014	-		12919081	+1	no_errors	ENST00000240189	ensembl	human	known	74_37	missense	SNP	0.084	A
LOC150776	150776	genome.wustl.edu	37	2	132258153	132258154	+	RNA	INS	-	-	ACCTGCTACCTACCTGCTACCTGCTACCTG	rs367841035|rs112252782	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr2:132258153_132258154insACCTGCTACCTACCTGCTACCTGCTACCTG	ENST00000438378.2	+	0	717_718					NR_026922.1																						TCCTACCTGCCTGTAAGTAAAC	0.49														452	0.0902556	0.1861	0.0749	5008	,	,		19618	0.003		0.0994	False		,,,				2504	0.0521																0								ENSG00000152117																																			AC093838.4			0				Clone_based_vega_gene																													2.37:g.132258153_132258154insACCTGCTACCTACCTGCTACCTGCTACCTG		Somatic	NA	NA	NA		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438378.2	37	NULL		2																																																																																			-	-		0.490	AC093838.4-001	KNOWN	basic	processed_transcript	LOC150776	pseudogene	OTTHUMT00000331819.7	-				132258154	+1	no_errors	ENST00000438378	ensembl	human	known	74_37	rna	INS	1.000:0.997	ACCTGCTACCTACCTGCTACCTGCTACCTG
CD58	965	genome.wustl.edu	37	1	117087035	117087035	+	Missense_Mutation	SNP	C	C	T	rs369159196		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:117087035C>T	ENST00000369489.5	-	2	328	c.262G>A	c.(262-264)Ggt>Agt	p.G88S	CD58_ENST00000457047.2_Missense_Mutation_p.G88S|CD58_ENST00000369487.3_Missense_Mutation_p.G88S	NM_001779.2	NP_001770.1	P19256	LFA3_HUMAN	CD58 molecule	88	Ig-like.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interferon-gamma (GO:0071346)|cellular response to tumor necrosis factor (GO:0071356)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|positive regulation of interleukin-8 secretion (GO:2000484)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)		GTGAGGCTACCTGACACAGTG	0.338																																																	0								ENSG00000116815						97.0	99.0	98.0					1																	117087035		2202	4300	6502	CD58	SO:0001583	missense	0			-	HGNC	BC005930	CCDS888.1, CCDS44199.1	1p13	2008-02-05	2006-03-28		ENSG00000116815	ENSG00000116815		"""CD molecules"""	1688	protein-coding gene	gene with protein product		153420	"""CD58 antigen, (lymphocyte function-associated antigen 3)"""	LFA3		9510189	Standard	NM_001144822		Approved		uc001egm.3	P19256	OTTHUMG00000022749	ENST00000369489.5:c.262G>A	1.37:g.117087035C>T	ENSP00000358501:p.Gly88Ser	Somatic	0	31	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	50	31.51	A8K7G5|Q5U053|Q6IB65|Q96KI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G88S	ENST00000369489.5	37	c.262	CCDS888.1	1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069261	0.55539	.	.	ENSG00000116815	ENST00000369489;ENST00000457047;ENST00000526981;ENST00000369487	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	3.71	3.71	0.42584	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.094859	0.39475	N	0.001346	T	0.23886	0.0578	L	0.58810	1.83	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.03545	-1.1026	10	0.22706	T	0.39	-21.9633	11.1519	0.48464	0.0:1.0:0.0:0.0	.	88;88;88	P19256-3;B1AMW1;P19256	.;.;LFA3_HUMAN	S	88;88;60;88	ENSP00000358501:G88S;ENSP00000409080:G88S;ENSP00000433648:G60S;ENSP00000358499:G88S	ENSP00000358499:G88S	G	-	1	0	CD58	116888558	0.012000	0.17670	0.031000	0.17742	0.004000	0.04260	1.412000	0.34714	2.063000	0.61619	0.561000	0.74099	GGT	-	NULL		0.338	CD58-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD58	protein_coding	OTTHUMT00000059036.1	C	NM_001779	-		117087035	-1	no_errors	ENST00000369489	ensembl	human	known	74_37	missense	SNP	0.056	T
TMEM40	55287	genome.wustl.edu	37	3	12778114	12778114	+	Silent	SNP	G	G	A	rs199796616	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:12778114G>A	ENST00000314124.7	-	10	938	c.582C>T	c.(580-582)ttC>ttT	p.F194F	TMEM40_ENST00000435575.1_Silent_p.F118F|TMEM40_ENST00000476331.1_5'UTR|TMEM40_ENST00000264728.8_Silent_p.F194F|TMEM40_ENST00000435218.2_Silent_p.F164F|TMEM40_ENST00000431022.2_Silent_p.F210F	NM_001284406.1|NM_018306.2	NP_001271335.1|NP_060776.2	Q8WWA1	TMM40_HUMAN	transmembrane protein 40	194						integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(5)|urinary_tract(1)	10						CCAGGGAGGCGAAGGTGAGCA	0.597													G|||	2	0.000399361	0.0008	0.0	5008	,	,		15525	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000088726						85.0	50.0	62.0					3																	12778114		2194	4288	6482	TMEM40	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	BC020658	CCDS2613.1, CCDS68347.1, CCDS68348.1	3p25.2	2005-01-10			ENSG00000088726	ENSG00000088726			25620	protein-coding gene	gene with protein product						12477932	Standard	NM_018306		Approved	FLJ11036	uc003bxg.1	Q8WWA1	OTTHUMG00000129801	ENST00000314124.7:c.582C>T	3.37:g.12778114G>A		Somatic	0	55	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	55	32.93	C9JID5|Q8NAL4|Q9NUZ4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F210	ENST00000314124.7	37	c.630	CCDS2613.1	3																																																																																			-	NULL		0.597	TMEM40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM40	protein_coding	OTTHUMT00000252029.2	G	NM_018306	rs199796616		12778114	-1	no_errors	ENST00000431022	ensembl	human	known	74_37	silent	SNP	0.899	A
TTLL5	23093	genome.wustl.edu	37	14	76330059	76330059	+	Missense_Mutation	SNP	G	G	A	rs542956518		TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr14:76330059G>A	ENST00000298832.9	+	29	3581	c.3376G>A	c.(3376-3378)Gtg>Atg	p.V1126M	TTLL5_ENST00000557636.1_Missense_Mutation_p.V1141M|TTLL5_ENST00000556893.1_Missense_Mutation_p.V677M|TTLL5_ENST00000554510.1_Missense_Mutation_p.V635M	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	1126					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		AGAAAACAACGTGTACAGCCA	0.502																																																	0								ENSG00000119685						104.0	101.0	102.0					14																	76330059		2203	4300	6503	TTLL5	SO:0001583	missense	0			-	HGNC	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.3376G>A	14.37:g.76330059G>A	ENSP00000298832:p.Val1126Met	Somatic	0	33	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	32	38.46	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.V1126M	ENST00000298832.9	37	c.3376	CCDS32124.1	14	.	.	.	.	.	.	.	.	.	.	G	12.62	1.993627	0.35131	.	.	ENSG00000119685	ENST00000286653;ENST00000557636;ENST00000298832;ENST00000393826;ENST00000556893;ENST00000554510	T;T;T;T	0.25085	3.92;4.0;1.82;1.83	5.78	3.97	0.46021	.	0.633514	0.16692	N	0.203500	T	0.18467	0.0443	N	0.14661	0.345	0.21933	N	0.999466	P;P;P;P	0.52170	0.951;0.945;0.951;0.71	P;B;P;B	0.47251	0.542;0.36;0.542;0.181	T	0.05022	-1.0911	10	0.66056	D	0.02	.	7.3064	0.26451	0.1404:0.0:0.7241:0.1355	.	1141;200;677;1126	G3V2J9;F8W7N3;Q6EMB2-2;Q6EMB2	.;.;.;TTLL5_HUMAN	M	200;1141;1126;677;677;635	ENSP00000450713:V1141M;ENSP00000298832:V1126M;ENSP00000452524:V677M;ENSP00000451946:V635M	ENSP00000286653:V200M	V	+	1	0	TTLL5	75399812	0.961000	0.32948	0.983000	0.44433	0.398000	0.30690	3.112000	0.50368	0.924000	0.37069	-0.119000	0.15052	GTG	-	NULL		0.502	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	protein_coding	OTTHUMT00000414453.1	G	NM_015072	-		76330059	+1	no_errors	ENST00000298832	ensembl	human	known	74_37	missense	SNP	0.839	A
TBC1D30	23329	genome.wustl.edu	37	12	65175020	65175020	+	Silent	SNP	G	G	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr12:65175020G>A	ENST00000229088.6	+	1	432	c.432G>A	c.(430-432)caG>caA	p.Q144Q	RP11-629N8.3_ENST00000434563.3_RNA|TBC1D30_ENST00000456757.2_3'UTR			Q9Y2I9	TBC30_HUMAN	TBC1 domain family, member 30	144					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)	ciliary basal body (GO:0036064)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			NS(3)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	5						AGGAGCTGCAGGAGCGACCGA	0.731																																																	0								ENSG00000111490																																			TBC1D30	SO:0001819	synonymous_variant	0			-	HGNC	AB023201	CCDS53813.1	12q14.3	2013-07-10			ENSG00000111490	ENSG00000111490			29164	protein-coding gene	gene with protein product		615077				12618308, 17646400	Standard	NM_015279		Approved	KIAA0984	uc010sst.2	Q9Y2I9	OTTHUMG00000168824	ENST00000229088.6:c.432G>A	12.37:g.65175020G>A		Somatic	0	11	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	3	62.50	B3KP01|B9A6M9|E7EMW4|F5GYJ9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q144	ENST00000229088.6	37	c.432		12																																																																																			-	NULL		0.731	TBC1D30-201	KNOWN	basic	protein_coding	TBC1D30	protein_coding		G	XM_037557	-		65175020	+1	no_errors	ENST00000229088	ensembl	human	known	74_37	silent	SNP	1.000	A
PTCH1	5727	genome.wustl.edu	37	9	98239127	98239127	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr9:98239127G>C	ENST00000331920.6	-	11	1815	c.1516C>G	c.(1516-1518)Ctc>Gtc	p.L506V	PTCH1_ENST00000437951.1_Missense_Mutation_p.L440V|PTCH1_ENST00000429896.2_Missense_Mutation_p.L355V|PTCH1_ENST00000430669.2_Missense_Mutation_p.L440V|PTCH1_ENST00000375274.2_Missense_Mutation_p.L505V|PTCH1_ENST00000418258.1_Missense_Mutation_p.L355V|PTCH1_ENST00000421141.1_Missense_Mutation_p.L355V	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	506	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.		FL -> LR (in BCNS).		brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CCAAGAGCGAGAAATGGCAAA	0.438																																																	0								ENSG00000185920						140.0	108.0	119.0					9																	98239127		2203	4300	6503	PTCH1	SO:0001583	missense	0			-	HGNC	AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.1516C>G	9.37:g.98239127G>C	ENSP00000332353:p.Leu506Val	Somatic	0	21	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	50	35.06	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.L506V	ENST00000331920.6	37	c.1516	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199427	0.58126	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274;ENST00000375271	D;D;D;D;D;D;D;D	0.97772	-4.53;-4.53;-4.53;-4.53;-4.53;-4.53;-4.53;-4.53	5.54	4.64	0.57946	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.98573	0.9523	M	0.78801	2.425	0.58432	D	0.999991	D;D;P;D	0.89917	1.0;0.966;0.938;0.972	D;P;P;P	0.87578	0.998;0.747;0.801;0.836	D	0.99609	1.0980	10	0.62326	D	0.03	-22.7339	16.6136	0.84901	0.0:0.13:0.87:0.0	.	355;440;505;506	Q13635-4;Q13635-3;Q13635-2;Q13635	.;.;.;PTC1_HUMAN	V	506;440;355;355;440;355;505;171	ENSP00000332353:L506V;ENSP00000389744:L440V;ENSP00000399981:L355V;ENSP00000396135:L355V;ENSP00000410287:L440V;ENSP00000414823:L355V;ENSP00000364423:L505V;ENSP00000364420:L171V	ENSP00000332353:L506V	L	-	1	0	PTCH1	97278948	1.000000	0.71417	0.934000	0.37439	0.531000	0.34715	4.271000	0.58902	1.562000	0.49601	0.655000	0.94253	CTC	-	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched		0.438	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	protein_coding	OTTHUMT00000053229.2	G	NM_000264	-		98239127	-1	no_errors	ENST00000331920	ensembl	human	known	74_37	missense	SNP	1.000	C
ANTXRLP1	100996567	genome.wustl.edu	37	10	47640774	47640792	+	RNA	DEL	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG	-	rs144049238|rs139997534|rs59150445|rs59784451	byFrequency	TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr10:47640774_47640792delAAGCTGAGTGTTGGGAGAG	ENST00000454837.1	-	0	17_35					NR_103827.1				anthrax toxin receptor-like pseudogene 1																		ATtgggagaaaagctgagtgttgggagagaagctgaggc	0.493														2692	0.53754	0.5303	0.6484	5008	,	,		21433	0.2996		0.6461	False		,,,				2504	0.6022																0								ENSG00000243536																																			ANTXRLP1			0				HGNC			10q11.22	2014-05-06			ENSG00000243536	ENSG00000263482			45004	pseudogene	pseudogene							Standard	NR_103827		Approved				OTTHUMG00000188317		10.37:g.47640774_47640792delAAGCTGAGTGTTGGGAGAG		Somatic	NA	NA	NA		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000454837.1	37	NULL		10																																																																																			-	-		0.493	ANTXRLP1-001	KNOWN	basic	processed_transcript	ANTXRLP1	pseudogene	OTTHUMT00000047859.2	AAGCTGAGTGTTGGGAGAG				47640792	-1	no_errors	ENST00000454837	ensembl	human	known	74_37	rna	DEL	0.069:0.070:0.070:0.070:0.068:0.065:0.062:0.057:0.052:0.046:0.038:0.038:0.038:0.036:0.034:0.031:0.027:0.022:0.016	-
S100A1	6271	genome.wustl.edu	37	1	153603048	153603048	+	Silent	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr1:153603048C>T	ENST00000292169.1	+	2	164	c.51C>T	c.(49-51)caC>caT	p.H17H	S100A13_ENST00000368699.1_Intron|S100A13_ENST00000440685.2_5'Flank|RP1-178F15.4_ENST00000607839.1_RNA|S100A13_ENST00000339556.4_5'Flank|RP1-178F15.5_ENST00000497086.1_RNA|S100A1_ENST00000368696.3_Silent_p.H17H|S100A1_ENST00000469893.1_3'UTR|S100A13_ENST00000491177.1_5'UTR|S100A1_ENST00000368698.3_Silent_p.H70H|RP1-178F15.4_ENST00000469931.2_RNA	NM_006271.1	NP_006262.1	P23297	S10A1_HUMAN	S100 calcium binding protein A1	17	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|regulation of heart contraction (GO:0008016)|substantia nigra development (GO:0021762)	M band (GO:0031430)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)			breast(1)|cervix(1)|lung(2)	4	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	ACGTGTTCCACGCCCACTCGG	0.582																																					Ovarian(74;601 1703 10548 31787)												0								ENSG00000160678						88.0	79.0	82.0					1																	153603048		2203	4300	6503	S100A1	SO:0001819	synonymous_variant	0			-	HGNC	BC014392	CCDS1047.1	1q21	2013-01-10	2001-11-28		ENSG00000160678	ENSG00000160678		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10486	protein-coding gene	gene with protein product		176940	"""S100 calcium-binding protein A1"""	S100A		1998503	Standard	NM_006271		Approved	S100-alpha	uc001fck.1	P23297	OTTHUMG00000037041	ENST00000292169.1:c.51C>T	1.37:g.153603048C>T		Somatic	0	38	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B2R5D9|Q5T7Y3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,smart_EF_hand_dom,pfscan_EF_hand_dom	p.H70	ENST00000292169.1	37	c.210	CCDS1047.1	1																																																																																			-	pfam_S100_Ca-bd_sub		0.582	S100A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A1	protein_coding	OTTHUMT00000089933.1	C	NM_006271	-		153603048	+1	no_errors	ENST00000368698	ensembl	human	known	74_37	silent	SNP	0.997	T
ZNF133	7692	genome.wustl.edu	37	20	18296821	18296821	+	Silent	SNP	G	G	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr20:18296821G>T	ENST00000316358.4	+	4	1423	c.1326G>T	c.(1324-1326)gtG>gtT	p.V442V	ZNF133_ENST00000535822.1_Silent_p.V347V|ZNF133_ENST00000401790.1_Silent_p.V442V|ZNF133_ENST00000462170.1_3'UTR|RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000377671.3_Silent_p.V441V|ZNF133_ENST00000538547.1_Silent_p.V347V|ZNF133_ENST00000396026.3_Silent_p.V445V|ZNF133_ENST00000402618.2_Silent_p.V379V	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	442					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						TTTGTGGGGTGTGTGGGCGAG	0.557																																																	0								ENSG00000125846						63.0	63.0	63.0					20																	18296821		2203	4300	6503	ZNF133	SO:0001819	synonymous_variant	0			-	HGNC	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.1326G>T	20.37:g.18296821G>T		Somatic	0	38	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V445	ENST00000316358.4	37	c.1335		20																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.557	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	ZNF133	protein_coding	OTTHUMT00000127616.1	G	NM_003434	-		18296821	+1	no_errors	ENST00000396026	ensembl	human	known	74_37	silent	SNP	0.987	T
DYNC1LI2	1783	genome.wustl.edu	37	16	66785214	66785214	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:66785214C>A	ENST00000258198.2	-	2	349	c.143G>T	c.(142-144)aGg>aTg	p.R48M	DYNC1LI2_ENST00000379482.2_Missense_Mutation_p.R48M|RP11-61A14.4_ENST00000501143.1_lincRNA|DYNC1LI2_ENST00000443351.2_Missense_Mutation_p.R48M|DYNC1LI2_ENST00000440564.2_Missense_Mutation_p.R48M	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	48					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		CAGCTTGGACCTGGCGCGGGT	0.726																																																	0								ENSG00000135720						37.0	39.0	38.0					16																	66785214		2200	4300	6500	DYNC1LI2	SO:0001583	missense	0			-	HGNC	AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.143G>T	16.37:g.66785214C>A	ENSP00000258198:p.Arg48Met	Somatic	0	107	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	100	18.70	A8K6V1|B4DZP4|Q8TAT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	p.R48M	ENST00000258198.2	37	c.143	CCDS10818.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.411794	0.96072	.	.	ENSG00000135720	ENST00000258198;ENST00000379482;ENST00000443351;ENST00000440564	T;T;T;T	0.30981	2.13;2.13;1.51;2.13	4.82	4.82	0.62117	.	0.088348	0.85682	D	0.000000	T	0.53690	0.1812	M	0.70275	2.135	0.50813	D	0.999896	D;B;P;D	0.61080	0.989;0.372;0.642;0.961	D;B;P;P	0.63113	0.911;0.309;0.478;0.907	T	0.57900	-0.7731	10	0.66056	D	0.02	-7.1182	17.7036	0.88302	0.0:1.0:0.0:0.0	.	48;48;48;48	B4E2E0;B4DHD8;B4DZP4;O43237	.;.;.;DC1L2_HUMAN	M	48	ENSP00000258198:R48M;ENSP00000368795:R48M;ENSP00000394289:R48M;ENSP00000408566:R48M	ENSP00000258198:R48M	R	-	2	0	DYNC1LI2	65342715	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.432000	0.80349	2.505000	0.84491	0.557000	0.71058	AGG	-	pfam_Dynein_light_int_chain		0.726	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1LI2	protein_coding	OTTHUMT00000268846.1	C	NM_006141	-		66785214	-1	no_errors	ENST00000258198	ensembl	human	known	74_37	missense	SNP	1.000	A
NEUROG1	4762	genome.wustl.edu	37	5	134871035	134871035	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr5:134871035G>C	ENST00000314744.4	-	1	604	c.346C>G	c.(346-348)Cgc>Ggc	p.R116G		NM_006161.2	NP_006152.2	Q92886	NGN1_HUMAN	neurogenin 1	116	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell fate commitment (GO:0045165)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perikaryon (GO:0043204)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			endometrium(1)|liver(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGCACGCTGCGCAGTGCGTCC	0.657																																																	0								ENSG00000181965						38.0	41.0	40.0					5																	134871035		2203	4300	6503	NEUROG1	SO:0001583	missense	0			-	HGNC	U63842	CCDS4187.1	5q23-q31	2013-05-21			ENSG00000181965	ENSG00000181965		"""Basic helix-loop-helix proteins"""	7764	protein-coding gene	gene with protein product	"""neurogenic differentiation 3"""	601726		NEUROD3		9119405	Standard	NM_006161		Approved	AKA, Math4C, ngn1, bHLHa6	uc003lax.3	Q92886	OTTHUMG00000129138	ENST00000314744.4:c.346C>G	5.37:g.134871035G>C	ENSP00000317580:p.Arg116Gly	Somatic	0	70	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	29	49.12	Q5U0Q9|Q96HE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R116G	ENST00000314744.4	37	c.346	CCDS4187.1	5	.	.	.	.	.	.	.	.	.	.	g	17.08	3.297503	0.60086	.	.	ENSG00000181965	ENST00000314744	D	0.98701	-5.08	4.98	4.98	0.66077	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99349	1.0914	10	0.87932	D	0	-7.746	12.0798	0.53665	0.0:0.0:0.6986:0.3014	.	116	Q92886	NGN1_HUMAN	G	116	ENSP00000317580:R116G	ENSP00000317580:R116G	R	-	1	0	NEUROG1	134898934	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.546000	0.53656	2.284000	0.76573	0.651000	0.88453	CGC	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom		0.657	NEUROG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROG1	protein_coding	OTTHUMT00000251192.1	G	NM_006161	-		134871035	-1	no_errors	ENST00000314744	ensembl	human	known	74_37	missense	SNP	1.000	C
FBLN2	2199	genome.wustl.edu	37	3	13612954	13612954	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr3:13612954C>T	ENST00000295760.7	+	2	1168	c.1099C>T	c.(1099-1101)Ctc>Ttc	p.L367F	FBLN2_ENST00000535798.1_Missense_Mutation_p.L393F|FBLN2_ENST00000492059.1_Missense_Mutation_p.L367F|FBLN2_ENST00000404922.3_Missense_Mutation_p.L367F	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	367	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CAAGGCTGCTCTCGTCCCAAC	0.657																																																	0								ENSG00000163520						36.0	47.0	43.0					3																	13612954		2144	4236	6380	FBLN2	SO:0001583	missense	0			-	HGNC	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1099C>T	3.37:g.13612954C>T	ENSP00000295760:p.Leu367Phe	Somatic	0	53	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	25	37.50	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.L367F	ENST00000295760.7	37	c.1099	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	C	2.956	-0.215625	0.06101	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.79845	-1.31;-1.28;-1.22;-1.28	4.82	-2.08	0.07254	.	1.746520	0.02894	N	0.134492	T	0.65647	0.2711	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.002	T	0.51655	-0.8678	10	0.31617	T	0.26	.	8.0595	0.30625	0.4261:0.2017:0.3722:0.0	.	367;367;393	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	F	393;367;367;367	ENSP00000445705:L393F;ENSP00000384169:L367F;ENSP00000295760:L367F;ENSP00000420042:L367F	ENSP00000295760:L367F	L	+	1	0	FBLN2	13587955	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.415000	0.02469	-0.291000	0.09012	-0.155000	0.13514	CTC	-	NULL		0.657	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	protein_coding	OTTHUMT00000340083.3	C	NM_001004019	-		13612954	+1	no_errors	ENST00000404922	ensembl	human	known	74_37	missense	SNP	0.000	T
CBFA2T3	863	genome.wustl.edu	37	16	88952543	88952543	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3B-A9HL-01A-11D-A387-09	TCGA-3B-A9HL-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2df266d0-ca15-4a97-9700-785c81b14aba	ff026b1d-93bb-4334-9949-690d71a376ed	g.chr16:88952543delA	ENST00000268679.4	-	6	1115	c.719delT	c.(718-720)ctgfs	p.L240fs	CBFA2T3_ENST00000448839.1_Frame_Shift_Del_p.L164fs|RP11-830F9.5_ENST00000562405.1_RNA|RP11-830F9.5_ENST00000569249.1_RNA|CBFA2T3_ENST00000436887.2_Frame_Shift_Del_p.L215fs|CBFA2T3_ENST00000360302.2_Frame_Shift_Del_p.L154fs|RP11-830F9.5_ENST00000565053.1_RNA|RP11-830F9.5_ENST00000562574.1_RNA|CBFA2T3_ENST00000327483.5_Frame_Shift_Del_p.L154fs	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	240	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CAGCAAGGGCAGGTTTGCCTG	0.687			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0								ENSG00000129993						30.0	30.0	30.0					16																	88952543		2181	4283	6464	CBFA2T3	SO:0001589	frameshift_variant	0				HGNC	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.719delT	16.37:g.88952543delA	ENSP00000268679:p.Leu240fs	Somatic	0	86	0.00		0.6617647522093512	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG16	p.L240fs	ENST00000268679.4	37	c.719	CCDS10972.1	16																																																																																			-	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1		0.687	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CBFA2T3	protein_coding	OTTHUMT00000269545.2	A	NM_005187			88952543	-1	no_errors	ENST00000268679	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
