#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TTLL2	83887	genome.wustl.edu	37	6	167754992	167754992	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr6:167754992C>A	ENST00000239587.5	+	3	1692	c.1604C>A	c.(1603-1605)aCc>aAc	p.T535N		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	535					cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TCCTGCAAGACCAAGACCTCC	0.547																																																	0								ENSG00000120440						135.0	116.0	122.0					6																	167754992		2203	4300	6503	TTLL2	SO:0001583	missense	0			-	HGNC	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.1604C>A	6.37:g.167754992C>A	ENSP00000239587:p.Thr535Asn	Somatic	0	42	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	37	19.57	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.T535N	ENST00000239587.5	37	c.1604	CCDS5301.1	6	.	.	.	.	.	.	.	.	.	.	C	9.086	1.000450	0.19121	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.02682	4.2	4.04	-2.25	0.06888	.	1.118960	0.06840	N	0.795439	T	0.00468	0.0015	N	0.24115	0.695	0.09310	N	1	P	0.38978	0.652	B	0.30943	0.122	T	0.45702	-0.9243	10	0.16420	T	0.52	.	1.4426	0.02357	0.2516:0.3563:0.226:0.1661	.	535	Q9BWV7	TTLL2_HUMAN	N	535;462	ENSP00000239587:T535N	ENSP00000239587:T535N	T	+	2	0	TTLL2	167674982	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.991000	0.03728	-0.245000	0.09625	-0.326000	0.08463	ACC	-	NULL		0.547	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL2	protein_coding	OTTHUMT00000043127.3	C	NM_031949	-		167754992	+1	no_errors	ENST00000239587	ensembl	human	known	74_37	missense	SNP	0.000	A
ACAD10	80724	genome.wustl.edu	37	12	112167686	112167686	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:112167686G>A	ENST00000313698.4	+	10	1475	c.1320G>A	c.(1318-1320)atG>atA	p.M440I	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000549590.1_Missense_Mutation_p.M440I|ACAD10_ENST00000455480.2_Missense_Mutation_p.M471I|ACAD10_ENST00000392636.2_Missense_Mutation_p.M42I	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	440						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						TCCCAGCCATGGAGAGGCTGA	0.557																																																	0								ENSG00000111271						75.0	65.0	68.0					12																	112167686		2203	4300	6503	ACAD10	SO:0001583	missense	0			-	HGNC	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1320G>A	12.37:g.112167686G>A	ENSP00000325137:p.Met440Ile	Somatic	0	35	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	735	9.69	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminoglycoside_PTrfase,pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_HAD-like_dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_Kinase-like_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_HAD-like_dom,prints_HAD-SF_hydro_IA,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA	p.M471I	ENST00000313698.4	37	c.1413	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065215	0.76187	.	.	ENSG00000111271	ENST00000392636;ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698	T;T;T;T	0.27720	1.65;1.65;1.65;1.65	5.37	5.37	0.77165	Aminoglycoside phosphotransferase (1);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.54951	0.1890	M	0.62088	1.915	0.51012	D	0.999904	P;D;D	0.76494	0.869;0.999;0.996	P;D;D	0.85130	0.563;0.997;0.917	T	0.53308	-0.8457	10	0.49607	T	0.09	.	18.6848	0.91559	0.0:0.0:1.0:0.0	.	471;440;440	G3XAJ0;Q6JQN1;Q6JQN1-2	.;ACD10_HUMAN;.	I	42;440;440;471;440	ENSP00000376411:M42I;ENSP00000446959:M440I;ENSP00000389813:M471I;ENSP00000325137:M440I	ENSP00000325137:M440I	M	+	3	0	ACAD10	110652069	1.000000	0.71417	1.000000	0.80357	0.179000	0.23085	7.095000	0.76952	2.499000	0.84300	0.655000	0.94253	ATG	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom		0.557	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	protein_coding	OTTHUMT00000368307.1	G	NM_025247	-		112167686	+1	no_errors	ENST00000455480	ensembl	human	known	74_37	missense	SNP	1.000	A
PES1P1	345016	genome.wustl.edu	37	4	135248568	135248568	+	lincRNA	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr4:135248568C>T	ENST00000515491.1	-	0	36																											ACAAACATGACCACATCATCA	0.577																																																	0								ENSG00000251199																																			RP11-400D2.2			0			-	Clone_based_vega_gene																													4.37:g.135248568C>T		Somatic	0	38	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515491.1	37	NULL		4																																																																																			-	-		0.577	RP11-400D2.2-002	KNOWN	basic	lincRNA	ENSG00000251199	lincRNA	OTTHUMT00000365046.1	C		-		135248568	-1	no_errors	ENST00000504728	ensembl	human	known	74_37	rna	SNP	1.000	T
ZC3H14	79882	genome.wustl.edu	37	14	89069266	89069266	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr14:89069266G>A	ENST00000251038.5	+	12	1834	c.1609G>A	c.(1609-1611)Gag>Aag	p.E537K	ZC3H14_ENST00000555755.1_Missense_Mutation_p.E537K|ZC3H14_ENST00000359301.3_Intron|ZC3H14_ENST00000393514.5_Missense_Mutation_p.E512K|ZC3H14_ENST00000406216.3_Intron|ZC3H14_ENST00000302216.8_Intron|ZC3H14_ENST00000555900.1_Missense_Mutation_p.E239K|ZC3H14_ENST00000556945.1_Intron|ZC3H14_ENST00000557607.1_Intron|ZC3H14_ENST00000336693.4_Intron|ZC3H14_ENST00000318308.6_Intron	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	537						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						AGATCAAGAGGAGGACATGTG	0.507																																																	0								ENSG00000100722						126.0	104.0	112.0					14																	89069266		2203	4300	6503	ZC3H14	SO:0001583	missense	0			-	HGNC	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.1609G>A	14.37:g.89069266G>A	ENSP00000251038:p.Glu537Lys	Somatic	0	30	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	50	18.03	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_CCCH	p.E537K	ENST00000251038.5	37	c.1609	CCDS32133.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.235869	0.95240	.	.	ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000555755;ENST00000393514;ENST00000555900	.	.	.	5.97	5.97	0.96955	.	0.246350	0.41605	D	0.000848	T	0.77157	0.4089	M	0.64997	1.995	0.80722	D	1	D;D;D	0.71674	0.998;0.974;0.974	D;P;P	0.78314	0.991;0.647;0.647	T	0.69316	-0.5177	9	0.20046	T	0.44	-19.6729	20.4387	0.99107	0.0:0.0:1.0:0.0	.	537;537;537	G3V5R4;Q6PJT7-2;Q6PJT7	.;.;ZC3HE_HUMAN	K	537;512;537;537;512;239	.	ENSP00000251038:E537K	E	+	1	0	ZC3H14	88139019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.759000	0.74934	2.836000	0.97738	0.655000	0.94253	GAG	-	NULL		0.507	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	ZC3H14	protein_coding	OTTHUMT00000410387.1	G	NM_024824	-		89069266	+1	no_errors	ENST00000251038	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC9A3	6550	genome.wustl.edu	37	5	475338	475355	+	Intron	DEL	GGAAAGTTAGGGTCACCG	GGAAAGTTAGGGTCACCG	-	rs527309103|rs371054000|rs56093108|rs200907923|rs2247107	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	GGAAAGTTAGGGTCACCG	GGAAAGTTAGGGTCACCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr5:475338_475355delGGAAAGTTAGGGTCACCG	ENST00000264938.3	-	16	2261				CTD-2228K2.5_ENST00000510714.1_5'Flank|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000606288.1_RNA|SLC9A3_ENST00000514375.1_Intron	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3						ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TGGGTGCCTTGGAAAGTTAGGGTCACCGGGAAGGTTAG	0.633														966	0.192891	0.1687	0.2349	5008	,	,		16601	0.1339		0.2634	False		,,,				2504	0.184																0								ENSG00000225138																																			CTD-2228K2.7	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2252-91CGGTGACCCTAACTTTCC>-	5.37:g.475338_475355delGGAAAGTTAGGGTCACCG		Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7ZKR2|E9PF67|Q3MIW3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264938.3	37	NULL	CCDS3855.1	5																																																																																			-	-		0.633	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100288152	protein_coding	OTTHUMT00000206677.2	GGAAAGTTAGGGTCACCG	NM_004174			475355	+1	no_errors	ENST00000607286	ensembl	human	known	74_37	rna	DEL	0.005:0.003:0.004:0.003:0.002:0.001:0.001:0.000:0.000:0.000:0.000:0.001:0.002:0.002:0.003:0.010:0.018:0.018	-
PGLYRP2	114770	genome.wustl.edu	37	19	15580569	15580569	+	Silent	SNP	A	A	G	rs375779333		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr19:15580569A>G	ENST00000340880.4	-	4	1995	c.1515T>C	c.(1513-1515)agT>agC	p.S505S	PGLYRP2_ENST00000292609.4_Silent_p.S505S	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	505					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						GCACCGCACAACTCGGGAGCG	0.741																																																	0								ENSG00000161031						5.0	6.0	6.0					19																	15580569		1993	3934	5927	PGLYRP2	SO:0001819	synonymous_variant	0			-	HGNC	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.1515T>C	19.37:g.15580569A>G		Somatic	0	11	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	8	43.75	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.S505	ENST00000340880.4	37	c.1515	CCDS12330.2	19																																																																																			-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain		0.741	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP2	protein_coding	OTTHUMT00000319626.1	A	NM_052890	-		15580569	-1	no_errors	ENST00000292609	ensembl	human	known	74_37	silent	SNP	0.283	G
FEZF1	389549	genome.wustl.edu	37	7	121944152	121944152	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr7:121944152C>T	ENST00000442488.2	-	1	407	c.340G>A	c.(340-342)Gca>Aca	p.A114T	FEZF1_ENST00000427185.2_Missense_Mutation_p.A114T|FEZF1-AS1_ENST00000424404.1_RNA|FEZF1_ENST00000331178.4_Missense_Mutation_p.A114T|FEZF1-AS1_ENST00000437317.1_RNA|FEZF1-AS1_ENST00000428449.1_RNA	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	114					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						CAGCTGAATGCGGGAGCCGAG	0.721																																																	0								ENSG00000128610						8.0	9.0	8.0					7																	121944152		2169	4213	6382	FEZF1	SO:0001583	missense	0			-	HGNC	AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.340G>A	7.37:g.121944152C>T	ENSP00000411145:p.Ala114Thr	Somatic	0	33	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.00	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A114T	ENST00000442488.2	37	c.340	CCDS34741.2	7	.	.	.	.	.	.	.	.	.	.	C	8.904	0.956981	0.18507	.	.	ENSG00000128610	ENST00000442488;ENST00000331178;ENST00000427185	T;T;T	0.07567	3.18;3.31;3.26	4.09	4.09	0.47781	.	0.218458	0.39985	N	0.001205	T	0.03564	0.0102	N	0.08118	0	0.36561	D	0.872457	P;P	0.46706	0.702;0.883	B;B	0.34180	0.059;0.177	T	0.45160	-0.9280	10	0.49607	T	0.09	-16.1391	9.3943	0.38392	0.1668:0.6902:0.143:0.0	.	114;114	A0PJY2;A0PJY2-2	FEZF1_HUMAN;.	T	114	ENSP00000411145:A114T;ENSP00000332777:A114T;ENSP00000392727:A114T	ENSP00000332777:A114T	A	-	1	0	FEZF1	121731388	0.756000	0.28383	0.996000	0.52242	0.173000	0.22820	0.989000	0.29629	2.560000	0.86352	0.555000	0.69702	GCA	-	NULL		0.721	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF1	protein_coding	OTTHUMT00000347410.1	C	NM_001024613	-		121944152	-1	no_errors	ENST00000442488	ensembl	human	known	74_37	missense	SNP	1.000	T
FCGR2A	2212	genome.wustl.edu	37	1	161476328	161476328	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr1:161476328G>A	ENST00000271450.6	+	3	349	c.311G>A	c.(310-312)tGc>tAc	p.C104Y	FCGR2A_ENST00000367972.4_Missense_Mutation_p.C103Y	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	104	Ig-like C2-type 1.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GAGTACACGTGCCAGACTGGC	0.602																																																	0								ENSG00000143226						64.0	59.0	61.0					1																	161476328		2203	4297	6500	FCGR2A	SO:0001583	missense	0			-	HGNC	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.311G>A	1.37:g.161476328G>A	ENSP00000271450:p.Cys104Tyr	Somatic	0	55	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	77	194	28.41	Q8WUN1|Q8WW64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.C104Y	ENST00000271450.6	37	c.311	CCDS44264.1	1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323563	0.81580	.	.	ENSG00000143226	ENST00000367972;ENST00000271450	T;T	0.58940	0.3;0.3	3.66	3.66	0.41972	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000007	T	0.77184	0.4093	H	0.95114	3.625	0.46279	D	0.998965	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83375	0.0009	9	0.87932	D	0	.	11.05	0.47880	0.0:0.0:1.0:0.0	.	104;103	P12318;P12318-2	FCG2A_HUMAN;.	Y	103;104	ENSP00000356949:C103Y;ENSP00000271450:C104Y	ENSP00000271450:C104Y	C	+	2	0	FCGR2A	159742952	0.989000	0.36119	0.859000	0.33776	0.229000	0.25112	3.604000	0.54081	2.033000	0.60031	0.561000	0.74099	TGC	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.602	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCGR2A	protein_coding	OTTHUMT00000083318.3	G	NM_021642	-		161476328	+1	no_errors	ENST00000271450	ensembl	human	known	74_37	missense	SNP	0.966	A
ZNF25	219749	genome.wustl.edu	37	10	38239494	38239495	+	3'UTR	INS	-	-	T	rs397780266|rs35754665|rs397845420|rs369819631|rs34503699|rs397846670	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr10:38239494_38239495insT	ENST00000302609.7	-	0	3143_3144				ZNF25_ENST00000374633.1_Intron	NM_145011.2	NP_659448.1	P17030	ZNF25_HUMAN	zinc finger protein 25						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				GGTAGCCAACATTTTTTTTTTT	0.361																																																	0								ENSG00000175395																																			ZNF25	SO:0001624	3_prime_UTR_variant	0				HGNC	AK056452	CCDS7195.1	10p11.2	2013-01-08	2006-05-10		ENSG00000175395	ENSG00000175395		"""Zinc fingers, C2H2-type"", ""-"""	13043	protein-coding gene	gene with protein product		194528	"""zinc finger protein 25 (KOX 19)"""			1639412, 8464732	Standard	NM_145011		Approved	KOX19, FLJ31890, Zfp9	uc001ize.1	P17030	OTTHUMG00000019344	ENST00000302609.7:c.*1561->A	10.37:g.38239505_38239505dupT		Somatic	0	19	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	A9Z1X5|Q8IYE3|Q8NDD6|Q96MU2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000302609.7	37	NULL	CCDS7195.1	10																																																																																			-	-		0.361	ZNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF25	protein_coding	OTTHUMT00000051214.1	-	NM_145011, NM_006966			38239495	-1	no_errors	ENST00000374633	ensembl	human	known	74_37	rna	INS	0.004:0.003	T
PRB4	5545	genome.wustl.edu	37	12	11461420	11461420	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:11461420G>A	ENST00000535904.1	-	3	530	c.497C>T	c.(496-498)cCc>cTc	p.P166L	PRB4_ENST00000445719.2_Intron|PRB4_ENST00000279575.1_Missense_Mutation_p.P166L			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	187	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.		Missing (in allele S).	Missing (in Ref. 7; CAA30542). {ECO:0000305}.		extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						TTCCTGTGGGGGTGGTCCTTC	0.597										HNSCC(22;0.051)																																							0								ENSG00000230657						188.0	206.0	200.0					12																	11461420		2203	4299	6502	PRB4	SO:0001583	missense	0			-	HGNC		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.497C>T	12.37:g.11461420G>A	ENSP00000442834:p.Pro166Leu	Somatic	0	54	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	76	24.00	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P166L	ENST00000535904.1	37	c.497	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	6.591	0.477358	0.12521	.	.	ENSG00000230657	ENST00000279575;ENST00000535904	T;T	0.27402	1.67;1.67	1.05	-0.00985	0.13999	.	.	.	.	.	T	0.45657	0.1353	M	0.81497	2.545	0.09310	N	1	D	0.71674	0.998	P	0.58454	0.839	T	0.29822	-0.9999	9	0.66056	D	0.02	.	4.7736	0.13167	0.0:0.4011:0.5989:0.0	.	166	E9PAL0	.	L	166	ENSP00000279575:P166L;ENSP00000442834:P166L	ENSP00000279575:P166L	P	-	2	0	PRB4	11352687	0.007000	0.16637	0.000000	0.03702	0.003000	0.03518	2.399000	0.44495	-0.012000	0.14223	0.508000	0.49915	CCC	-	NULL		0.597	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	protein_coding	OTTHUMT00000402308.1	G	NM_002723	-		11461420	-1	no_errors	ENST00000279575	ensembl	human	known	74_37	missense	SNP	0.002	A
OOEP	441161	genome.wustl.edu	37	6	74078539	74078539	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr6:74078539C>G	ENST00000370359.5	-	3	417	c.418G>C	c.(418-420)Gac>Cac	p.D140H	OOEP_ENST00000370363.1_Missense_Mutation_p.D85H|OOEP-AS1_ENST00000445350.2_RNA	NM_001080507.2	NP_001073976.1	A6NGQ2	OOEP_HUMAN	oocyte expressed protein	140					cellular protein complex assembly (GO:0043623)|embryo implantation (GO:0007566)|embryonic pattern specification (GO:0009880)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|protein phosphorylation (GO:0006468)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|protein complex (GO:0043234)	RNA binding (GO:0003723)			large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8						GAGTGGGGGTCTGATGCATGG	0.433																																																	0								ENSG00000203907						92.0	96.0	95.0					6																	74078539		1923	4122	6045	OOEP	SO:0001583	missense	0			-	HGNC	BC024931	CCDS47451.1	6q13	2012-02-22	2012-02-22	2007-11-13	ENSG00000203907	ENSG00000203907			21382	protein-coding gene	gene with protein product	"""KH homology domain containing 2"""	611689	"""chromosome 6 open reading frame 156"", ""oocyte expressed protein homolog (dog)"""	C6orf156		17913455	Standard	NM_001080507		Approved	Em:AC019205.2, KHDC2	uc003pgu.4	A6NGQ2	OTTHUMG00000150057	ENST00000370359.5:c.418G>C	6.37:g.74078539C>G	ENSP00000359384:p.Asp140His	Somatic	0	71	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	94	10.48	A6NIN5|A9UIB7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D140H	ENST00000370359.5	37	c.418	CCDS47451.1	6	.	.	.	.	.	.	.	.	.	.	C	8.510	0.866227	0.17250	.	.	ENSG00000203907	ENST00000370363;ENST00000370359	T;T	0.11385	2.78;2.78	3.8	-1.98	0.07480	.	1.366340	0.04969	N	0.463382	T	0.01489	0.0048	N	0.08118	0	0.09310	N	1	P;P	0.49447	0.699;0.924	B;B	0.41764	0.263;0.366	T	0.21724	-1.0237	10	0.51188	T	0.08	1.0973	0.9399	0.01353	0.2067:0.3055:0.2917:0.196	.	85;140	F2Z364;A6NGQ2	.;OOEP_HUMAN	H	85;140	ENSP00000359388:D85H;ENSP00000359384:D140H	ENSP00000359384:D140H	D	-	1	0	OOEP	74135260	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.969000	0.03813	-0.429000	0.07329	-0.251000	0.11542	GAC	-	NULL		0.433	OOEP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OOEP	protein_coding	OTTHUMT00000108414.2	C	NM_001080507	-		74078539	-1	no_errors	ENST00000370359	ensembl	human	known	74_37	missense	SNP	0.000	G
GRAMD1A	57655	genome.wustl.edu	37	19	35491326	35491327	+	5'UTR	INS	-	-	GCCCT	rs71165697|rs3072398|rs34397853	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr19:35491326_35491327insGCCCT	ENST00000317991.5	+	0	136_137				GRAMD1A_ENST00000599564.1_Intron|GRAMD1A_ENST00000424536.2_5'Flank|GRAMD1A_ENST00000411896.2_5'Flank|GRAMD1A_ENST00000504615.2_5'UTR|CTD-2527I21.7_ENST00000600959.1_RNA	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A							integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			cgcgcagcccagccctgccctg	0.782														4907	0.979832	0.9561	0.9885	5008	,	,		4111	0.998		0.994	False		,,,				2504	0.9724																0								ENSG00000089351		,	616,100		305,6,47					,	0.6	1.0		dbSNP_102	1	1569,189		780,9,90	no	utr-5,utr-5	GRAMD1A	NM_020895.3,NM_001136199.1	,	1085,15,137	A1A1,A1R,RR		10.7509,13.9665,11.6815	,	,		2185,289				GRAMD1A	SO:0001623	5_prime_UTR_variant	0				HGNC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.-56->GCCCT	19.37:g.35491332_35491336dupGCCCT		Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NKY7|Q8NC77|Q9P1Z5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000317991.5	37	NULL	CCDS42546.1	19																																																																																			-	-		0.782	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	GRAMD1A	protein_coding	OTTHUMT00000461557.1	-	NM_020895			35491327	+1	no_errors	ENST00000603669	ensembl	human	known	74_37	rna	INS	0.780:0.776	GCCCT
CNPY2	10330	genome.wustl.edu	37	12	56712911	56712911	+	5'Flank	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:56712911G>A	ENST00000273308.4	-	0	0				PAN2_ENST00000440411.3_Nonsense_Mutation_p.R1109*|PAN2_ENST00000548043.1_Nonsense_Mutation_p.R1113*|PAN2_ENST00000425394.2_Nonsense_Mutation_p.R1113*|PAN2_ENST00000257931.5_Nonsense_Mutation_p.R1112*|PAN2_ENST00000549090.1_Intron	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2						negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						GAAATCATTCGTTTTCGGGGC	0.478																																																	0								ENSG00000135473						105.0	95.0	99.0					12																	56712911		2203	4300	6503	PAN2	SO:0001631	upstream_gene_variant	0			-	HGNC	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330		12.37:g.56712911G>A	Exception_encountered	Somatic	0	42	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.33	B2R7B9|Q9UHE9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19/C67,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19/C67	p.R1113*	ENST00000273308.4	37	c.3337	CCDS8914.1	12	.	.	.	.	.	.	.	.	.	.	G	44	10.649212	0.99444	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0887	11.9769	0.53098	0.0:0.0:0.7239:0.276	.	.	.	.	X	1113;1109;1112;1113	.	ENSP00000257931:R1112X	R	-	1	2	PAN2	54999178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.489000	0.66875	2.715000	0.92844	0.655000	0.94253	CGA	-	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease		0.478	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAN2	protein_coding	OTTHUMT00000408546.1	G	NM_014255	-		56712911	-1	no_errors	ENST00000425394	ensembl	human	known	74_37	nonsense	SNP	1.000	A
PXDNL	137902	genome.wustl.edu	37	8	52321402	52321402	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52321402G>C	ENST00000356297.4	-	17	2882	c.2782C>G	c.(2782-2784)Ccc>Gcc	p.P928A	PXDNL_ENST00000543296.1_Missense_Mutation_p.P928A	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	928					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.P127S(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TTTCCGGAGGGAGGCCAAGGA	0.647																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000147485						23.0	26.0	25.0					8																	52321402		1946	4138	6084	PXDNL	SO:0001583	missense	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2782C>G	8.37:g.52321402G>C	ENSP00000348645:p.Pro928Ala	Somatic	0	40	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	48	52.94	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.P928A	ENST00000356297.4	37	c.2782	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	g	0.005	-2.148519	0.00328	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.69040	-0.37;-0.37	3.8	-5.61	0.02489	.	0.283161	0.25076	N	0.033340	T	0.44603	0.1301	L	0.55990	1.75	0.09310	N	1	B	0.14012	0.009	B	0.17979	0.02	T	0.38001	-0.9681	10	0.11794	T	0.64	.	1.1746	0.01832	0.2274:0.3713:0.1556:0.2457	.	928	A1KZ92	PXDNL_HUMAN	A	928	ENSP00000348645:P928A;ENSP00000444865:P928A	ENSP00000348645:P928A	P	-	1	0	PXDNL	52483955	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.139000	0.10358	-0.579000	0.05952	-0.121000	0.15023	CCC	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.647	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52321402	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	SNP	0.001	C
EEA1	8411	genome.wustl.edu	37	12	93246049	93246049	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:93246049C>T	ENST00000322349.8	-	8	808	c.544G>A	c.(544-546)Gaa>Aaa	p.E182K		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	182					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						AGACTCCTTTCTTCATCATAC	0.328																																																	0								ENSG00000102189						94.0	90.0	91.0					12																	93246049		2202	4299	6501	EEA1	SO:0001583	missense	0			-	HGNC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.544G>A	12.37:g.93246049C>T	ENSP00000317955:p.Glu182Lys	Somatic	0	52	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	189	307	38.10	Q14221	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.E182K	ENST00000322349.8	37	c.544	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.127836	0.94473	.	.	ENSG00000102189	ENST00000322349;ENST00000540777	T	0.64803	-0.12	5.67	5.67	0.87782	.	0.000000	0.53938	D	0.000041	T	0.69415	0.3108	L	0.34521	1.04	0.58432	D	0.999999	D	0.69078	0.997	D	0.73380	0.98	T	0.61068	-0.7137	10	0.11485	T	0.65	.	19.7627	0.96329	0.0:1.0:0.0:0.0	.	182	Q15075	EEA1_HUMAN	K	182;181	ENSP00000317955:E182K	ENSP00000317955:E182K	E	-	1	0	EEA1	91770180	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.718000	0.74713	2.660000	0.90430	0.643000	0.83706	GAA	-	NULL		0.328	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	protein_coding	OTTHUMT00000407304.1	C	NM_003566	-		93246049	-1	no_errors	ENST00000322349	ensembl	human	known	74_37	missense	SNP	1.000	T
KANK3	256949	genome.wustl.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	TCGCTGTCGCCA	TCGCTGTCGCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374																2	Deletion - In frame(2)	large_intestine(1)|breast(1)						ENSG00000186994			958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				KANK3	SO:0001651	inframe_deletion	0				HGNC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.DGDS489in_frame_del	ENST00000593649.1	37	c.1478_1467		19																																																																																			-	NULL		0.717	KANK3-002	KNOWN	basic	protein_coding	KANK3	protein_coding	OTTHUMT00000461379.1	TCGCTGTCGCCA	NM_198471			8398961	-1	no_errors	ENST00000593649	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.046:0.028:0.025:0.017:0.004:0.003:0.002:0.000:0.001:0.003:0.001	-
ARID3A	1820	genome.wustl.edu	37	19	929874	929874	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr19:929874G>T	ENST00000263620.3	+	2	673	c.346G>T	c.(346-348)Gac>Tac	p.D116Y	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	116	Glu-rich.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACTTTGAGGACATGGCCTC	0.667																																					Pancreas(29;54 1022 32760 50921)												0								ENSG00000116017						16.0	22.0	20.0					19																	929874		1940	3865	5805	ARID3A	SO:0001583	missense	0			-	HGNC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.346G>T	19.37:g.929874G>T	ENSP00000263620:p.Asp116Tyr	Somatic	0	57	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	31	22.50	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.D116Y	ENST00000263620.3	37	c.346	CCDS12050.1	19	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706456	0.48412	.	.	ENSG00000116017	ENST00000263620	T	0.09538	2.97	3.03	3.03	0.35002	.	7739.210000	0.00166	N	0.000000	T	0.14570	0.0352	L	0.29908	0.895	0.22127	N	0.999345	P	0.50943	0.94	P	0.44860	0.462	T	0.45220	-0.9276	10	0.87932	D	0	.	12.735	0.57218	0.0:0.0:1.0:0.0	.	116	Q99856	ARI3A_HUMAN	Y	116	ENSP00000263620:D116Y	ENSP00000263620:D116Y	D	+	1	0	ARID3A	880874	1.000000	0.71417	0.016000	0.15963	0.063000	0.16089	3.109000	0.50345	1.549000	0.49425	0.491000	0.48974	GAC	-	NULL		0.667	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3A	protein_coding	OTTHUMT00000458219.1	G	NM_005224	-		929874	+1	no_errors	ENST00000263620	ensembl	human	known	74_37	missense	SNP	0.290	T
SMTNL2	342527	genome.wustl.edu	37	17	4513974	4513975	+	IGR	INS	-	-	AAAG	rs35639596|rs111699059|rs67485004	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr17:4513974_4513975insAAAG	ENST00000389313.4	+	0	2280				RP11-141J13.5_ENST00000573270.1_lincRNA	NM_001114974.1	NP_001108446.1	Q2TAL5	SMTL2_HUMAN	smoothelin-like 2											breast(1)|endometrium(9)|kidney(1)|lung(1)|skin(1)	13				READ - Rectum adenocarcinoma(115;0.0325)		cctgtctcaaaaaagaaagaaa	0.49														1701	0.339657	0.2027	0.4035	5008	,	,		25694	0.3006		0.4304	False		,,,				2504	0.4264																0								ENSG00000261863																																			RP11-141J13.5	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	AK124452	CCDS11048.1, CCDS45583.1	17p13.2	2006-04-26			ENSG00000188176	ENSG00000188176			24764	protein-coding gene	gene with protein product							Standard	NM_001114974		Approved	FLJ42461	uc002fyf.1	Q2TAL5	OTTHUMG00000132938		17.37:g.4513979_4513982dupAAAG		Somatic	0	10	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	7	53.33	Q6ZVK6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389313.4	37	NULL	CCDS45583.1	17																																																																																			-	-		0.490	SMTNL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261863	protein_coding	OTTHUMT00000439129.1	-	NM_198501			4513975	+1	no_errors	ENST00000573270	ensembl	human	known	74_37	rna	INS	0.006:0.005	AAAG
PXDNL	137902	genome.wustl.edu	37	8	52321291	52321291	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52321291G>C	ENST00000356297.4	-	17	2993	c.2893C>G	c.(2893-2895)Ctg>Gtg	p.L965V	PXDNL_ENST00000543296.1_Missense_Mutation_p.L965V	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	965					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCCAGAGCCAGATGCTCGTTG	0.647																																																	0								ENSG00000147485						13.0	15.0	14.0					8																	52321291		1981	4148	6129	PXDNL	SO:0001583	missense	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2893C>G	8.37:g.52321291G>C	ENSP00000348645:p.Leu965Val	Somatic	0	42	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	52	50.48	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.L965V	ENST00000356297.4	37	c.2893	CCDS47855.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.494|0.494	-0.873872|-0.873872	0.02570|0.02570	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000522933|ENST00000356297;ENST00000543296	.|T;T	.|0.69306	.|-0.39;-0.39	3.85|3.85	1.86|1.86	0.25419|0.25419	.|.	.|0.568658	.|0.14351	.|N	.|0.325094	T|T	0.53769|0.53769	0.1817|0.1817	L|L	0.31120|0.31120	0.905|0.905	0.28204|0.28204	N|N	0.927222|0.927222	.|P	.|0.35700	.|0.516	.|P	.|0.44647	.|0.456	T|T	0.46105|0.46105	-0.9215|-0.9215	5|10	.|0.09338	.|T	.|0.73	.|.	6.0113|6.0113	0.19578|0.19578	0.1092:0.3771:0.5138:0.0|0.1092:0.3771:0.5138:0.0	.|.	.|965	.|A1KZ92	.|PXDNL_HUMAN	M|V	83|965	.|ENSP00000348645:L965V;ENSP00000444865:L965V	.|ENSP00000348645:L965V	I|L	-|-	3|1	3|2	PXDNL|PXDNL	52483844|52483844	0.915000|0.915000	0.31059|0.31059	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	1.196000|1.196000	0.32198|0.32198	0.576000|0.576000	0.29452|0.29452	-0.176000|-0.176000	0.13171|0.13171	ATC|CTG	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,prints_Haem_peroxidase_animal_subgr,pfscan_Haem_peroxidase_animal		0.647	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52321291	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	SNP	0.921	C
CISH	1154	genome.wustl.edu	37	3	50645149	50645149	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr3:50645149G>T	ENST00000348721.3	-	3	846	c.666C>A	c.(664-666)agC>agA	p.S222R	CISH_ENST00000443053.2_Missense_Mutation_p.S239R	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	222	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GGTGTTGCAGGCTGCGGGCAC	0.632																																																	0								ENSG00000114737						96.0	96.0	96.0					3																	50645149		2203	4300	6503	CISH	SO:0001583	missense	0			-	HGNC	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.666C>A	3.37:g.50645149G>T	ENSP00000294173:p.Ser222Arg	Somatic	0	50	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.86	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_SOCS_C,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2,prints_SH2	p.S239R	ENST00000348721.3	37	c.717	CCDS2831.1	3	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988093	0.74589	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.62498	0.02;0.02	5.73	3.93	0.45458	SOCS protein, C-terminal (4);	0.181590	0.64402	D	0.000019	T	0.79633	0.4479	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.81777	-0.0777	10	0.87932	D	0	-4.0114	8.9602	0.35842	0.2252:0.0:0.7748:0.0	.	239;222	G5E9R1;Q9NSE2	.;CISH_HUMAN	R	239;222	ENSP00000409346:S239R;ENSP00000294173:S222R	ENSP00000294173:S222R	S	-	3	2	CISH	50620153	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	0.921000	0.28718	1.409000	0.46915	0.655000	0.94253	AGC	-	pfam_SOCS_C,smart_SOCS_C,pfscan_SOCS_C		0.632	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CISH	protein_coding	OTTHUMT00000346245.1	G	NM_145071	-		50645149	-1	no_errors	ENST00000443053	ensembl	human	known	74_37	missense	SNP	1.000	T
PXDNL	137902	genome.wustl.edu	37	8	52321892	52321892	+	Silent	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52321892G>A	ENST00000356297.4	-	17	2392	c.2292C>T	c.(2290-2292)ccC>ccT	p.P764P	PXDNL_ENST00000543296.1_Silent_p.P764P	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	764					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CGAGCCCGCGGGGCGCGCGGA	0.781																																																	0								ENSG00000147485						3.0	4.0	4.0					8																	52321892		1336	3034	4370	PXDNL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2292C>T	8.37:g.52321892G>A		Somatic	0	8	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	6	57.14	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.P764	ENST00000356297.4	37	c.2292	CCDS47855.1	8																																																																																			-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.781	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52321892	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	silent	SNP	0.218	A
RAB3GAP1	22930	genome.wustl.edu	37	2	135884187	135884188	+	Frame_Shift_Ins	INS	-	-	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr2:135884187_135884188insT	ENST00000264158.8	+	11	977_978	c.934_935insT	c.(934-936)gttfs	p.V312fs	RAB3GAP1_ENST00000539493.1_Frame_Shift_Ins_p.V268fs|RAB3GAP1_ENST00000487003.1_3'UTR|RAB3GAP1_ENST00000442034.1_Frame_Shift_Ins_p.V312fs	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	312					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		ACATTGGTCTGTTAGAGTTCGA	0.356																																																	0								ENSG00000115839																																			RAB3GAP1	SO:0001589	frameshift_variant	0				HGNC	D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.936dupT	2.37:g.135884189_135884189dupT	ENSP00000264158:p.Val312fs	Somatic	0	69	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	79	26.17	A6H8Z3|C9J837|Q659F5|Q8TBB4	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.R313fs	ENST00000264158.8	37	c.934_935	CCDS33294.1	2																																																																																			-	NULL		0.356	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP1	protein_coding	OTTHUMT00000337514.2	-	NM_012233			135884188	+1	no_errors	ENST00000264158	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
PXDNL	137902	genome.wustl.edu	37	8	52322097	52322097	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52322097G>A	ENST00000356297.4	-	17	2187	c.2087C>T	c.(2086-2088)tCc>tTc	p.S696F	PXDNL_ENST00000543296.1_Missense_Mutation_p.S696F	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	696					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGAGCGCGGGGACACCAAGTC	0.612																																																	0								ENSG00000147485						29.0	34.0	32.0					8																	52322097		2092	4212	6304	PXDNL	SO:0001583	missense	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2087C>T	8.37:g.52322097G>A	ENSP00000348645:p.Ser696Phe	Somatic	0	77	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	46	57.41	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.S696F	ENST00000356297.4	37	c.2087	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	11.73	1.727054	0.30593	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.67698	-0.28;-0.27	3.72	0.812	0.18744	.	.	.	.	.	T	0.79251	0.4414	M	0.83953	2.67	0.28852	N	0.895987	D	0.89917	1.0	D	0.72075	0.976	T	0.69359	-0.5166	8	.	.	.	.	7.3829	0.26866	0.3182:0.0:0.6818:0.0	.	696	A1KZ92	PXDNL_HUMAN	F	696	ENSP00000348645:S696F;ENSP00000444865:S696F	.	S	-	2	0	PXDNL	52484650	1.000000	0.71417	0.044000	0.18714	0.057000	0.15508	5.423000	0.66458	-0.080000	0.12685	-0.258000	0.10820	TCC	-	NULL		0.612	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52322097	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	SNP	0.996	A
TRPM2	7226	genome.wustl.edu	37	21	45821738	45821738	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr21:45821738C>G	ENST00000397928.1	+	16	2941	c.2496C>G	c.(2494-2496)atC>atG	p.I832M	TRPM2_ENST00000300482.5_Missense_Mutation_p.I832M|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Missense_Mutation_p.I832M|TRPM2_ENST00000300481.9_Missense_Mutation_p.I812M	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	832					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						AGTGTGCCATCTACCTCTGGC	0.622																																																	0								ENSG00000142185						366.0	307.0	327.0					21																	45821738		2203	4300	6503	TRPM2	SO:0001583	missense	0			-	HGNC	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2496C>G	21.37:g.45821738C>G	ENSP00000381023:p.Ile832Met	Somatic	0	75	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	158	305	34.05	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.I832M	ENST00000397928.1	37	c.2496	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886397	0.51908	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	4.76	0.802	0.18686	Ion transport (1);	0.075655	0.53938	D	0.000049	T	0.67135	0.2861	M	0.69823	2.125	0.41332	D	0.987246	D;D;P	0.56746	0.977;0.96;0.922	P;P;P	0.61003	0.882;0.844;0.844	T	0.63853	-0.6543	10	0.66056	D	0.02	-16.2775	1.9927	0.03450	0.1387:0.4971:0.1346:0.2297	.	832;618;832	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	M	832;832;812;832	ENSP00000300482:I832M;ENSP00000381023:I832M;ENSP00000300481:I812M;ENSP00000381026:I832M	ENSP00000300481:I812M	I	+	3	3	TRPM2	44646166	0.960000	0.32886	0.356000	0.25785	0.823000	0.46562	0.031000	0.13710	-0.048000	0.13401	0.423000	0.28283	ATC	-	pfam_Ion_trans_dom		0.622	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	protein_coding	OTTHUMT00000098086.1	C	NM_003307	-		45821738	+1	no_errors	ENST00000300482	ensembl	human	known	74_37	missense	SNP	0.999	G
UGGT2	55757	genome.wustl.edu	37	13	96511890	96511890	+	Silent	SNP	T	T	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr13:96511890T>A	ENST00000376747.3	-	33	3850	c.3780A>T	c.(3778-3780)ccA>ccT	p.P1260P		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1260	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						AGAATTTCACTGGTGTTTTGG	0.279																																																	0								ENSG00000102595						58.0	59.0	59.0					13																	96511890		2203	4280	6483	UGGT2	SO:0001819	synonymous_variant	0			-	HGNC	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3780A>T	13.37:g.96511890T>A		Somatic	0	59	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	121	19.33	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.P1260	ENST00000376747.3	37	c.3780	CCDS9480.1	13																																																																																			-	pfam_Glyco_trans_8		0.279	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	protein_coding	OTTHUMT00000045507.1	T	NM_020121	-		96511890	-1	no_errors	ENST00000376747	ensembl	human	known	74_37	silent	SNP	0.656	A
MARCH9	92979	genome.wustl.edu	37	12	58150839	58150839	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:58150839T>A	ENST00000266643.5	+	2	916	c.485T>A	c.(484-486)cTg>cAg	p.L162Q	MARCH9_ENST00000548358.1_5'Flank	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	162					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			TACCAGGTCCTGGCGATCAGC	0.602											OREG0021952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000139266						28.0	23.0	25.0					12																	58150839		2190	4276	6466	MARCH9	SO:0001583	missense	0			-	HGNC	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.485T>A	12.37:g.58150839T>A	ENSP00000266643:p.Leu162Gln	Somatic	0	91	0.00	1028	0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	156	91	62.90	B2R9U9|Q86VN5|Q96GG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.L162Q	ENST00000266643.5	37	c.485	CCDS31847.1	12	.	.	.	.	.	.	.	.	.	.	T	28.6	4.934920	0.92458	.	.	ENSG00000139266	ENST00000266643	T	0.57595	0.39	5.27	5.27	0.74061	Zinc finger, RING-CH-type (1);	0.000000	0.64402	D	0.000002	T	0.52709	0.1751	N	0.16368	0.405	0.80722	D	1	D	0.58620	0.983	P	0.57960	0.83	T	0.59778	-0.7390	10	0.87932	D	0	.	14.3038	0.66373	0.0:0.0:0.0:1.0	.	162	Q86YJ5	MARH9_HUMAN	Q	162	ENSP00000266643:L162Q	ENSP00000266643:L162Q	L	+	2	0	MARCH9	56437106	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.017000	0.70805	2.212000	0.71576	0.459000	0.35465	CTG	-	NULL		0.602	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH9	protein_coding	OTTHUMT00000409244.1	T	NM_138396	-		58150839	+1	no_errors	ENST00000266643	ensembl	human	known	74_37	missense	SNP	1.000	A
PXDNL	137902	genome.wustl.edu	37	8	52321601	52321601	+	Silent	SNP	G	G	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52321601G>C	ENST00000356297.4	-	17	2683	c.2583C>G	c.(2581-2583)ctC>ctG	p.L861L	PXDNL_ENST00000543296.1_Silent_p.L861L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	861					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGCGCGCGAAGAGCATGCAGG	0.667																																																	0								ENSG00000147485						22.0	26.0	24.0					8																	52321601		2024	4151	6175	PXDNL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2583C>G	8.37:g.52321601G>C		Somatic	0	62	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	41	58.59	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.L861	ENST00000356297.4	37	c.2583	CCDS47855.1	8																																																																																			-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.667	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52321601	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	silent	SNP	1.000	C
LOC441666	441666	genome.wustl.edu	37	10	42832380	42832380	+	RNA	SNP	A	A	G	rs140179806		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr10:42832380A>G	ENST00000609841.1	-	0	1523					NR_024380.1																						AAGCTTTGCCACATTCTTCAC	0.368																																																	0								ENSG00000215146																																			RP11-313J2.1			0			-	Clone_based_vega_gene																													10.37:g.42832380A>G		Somatic	0	55	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	102	11.30		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			-	-		0.368	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	pseudogene	OTTHUMT00000472483.1	A		rs140179806		42832380	-1	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	SNP	1.000	G
FARP1	10160	genome.wustl.edu	37	13	99043120	99043120	+	Silent	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr13:99043120G>A	ENST00000319562.6	+	11	1339	c.1074G>A	c.(1072-1074)aaG>aaA	p.K358K	FARP1_ENST00000595437.1_Silent_p.K358K|FARP1_ENST00000376586.2_Silent_p.K358K	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	358					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GACATAAGAAGGTGCAGTTTG	0.448																																																	0								ENSG00000152767						155.0	141.0	146.0					13																	99043120		2203	4300	6503	FARP1	SO:0001819	synonymous_variant	0			-	HGNC	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1074G>A	13.37:g.99043120G>A		Somatic	0	41	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	73	15.12	Q5JVI9|Q6IQ29	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.K358	ENST00000319562.6	37	c.1074	CCDS9487.1	13																																																																																			-	pfam_FERM-adjacent		0.448	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	protein_coding	OTTHUMT00000045541.3	G	NM_005766	-		99043120	+1	no_errors	ENST00000376586	ensembl	human	known	74_37	silent	SNP	0.994	A
RXRA	6256	genome.wustl.edu	37	9	137331937	137331938	+	3'UTR	INS	-	-	A	rs566764357|rs374539428|rs369993354	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr9:137331937_137331938insA	ENST00000356384.4	+	0	5276_5277							P19793	RXRA_HUMAN	retinoid X receptor, alpha						camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	TCTGGAAAGGTAAAAAAAAAAA	0.381													|||unknown(HR)	330	0.0658946	0.0741	0.0216	5008	,	,		18574	0.0605		0.0109	False		,,,				2504	0.1483																0								ENSG00000186350																																			RXRA	SO:0001624	3_prime_UTR_variant	0				HGNC	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000356384.4:c.*5274->A	9.37:g.137331948_137331948dupA		Somatic	0	31	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	B3KY83|Q2NL52|Q2V504	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356384.4	37	NULL		9																																																																																			-	-		0.381	RXRA-001	KNOWN	basic	processed_transcript	RXRA	protein_coding	OTTHUMT00000054948.1	-	NM_002957			137331938	+1	no_errors	ENST00000356384	ensembl	human	known	74_37	rna	INS	1.000:0.998	A
NOS1	4842	genome.wustl.edu	37	12	117662836	117662836	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:117662836C>G	ENST00000338101.4	-	25	3917	c.3913G>C	c.(3913-3915)Gat>Cat	p.D1305H	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.D1271H			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TGTTGGATATCAAATTGCCGC	0.602																																					Esophageal Squamous(162;1748 2599 51982 52956)												0								ENSG00000089250						153.0	166.0	162.0					12																	117662836		1954	4148	6102	NOS1	SO:0001583	missense	0			-	HGNC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3913G>C	12.37:g.117662836C>G	ENSP00000337459:p.Asp1305His	Somatic	0	35	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	197	8.80		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.D1271H	ENST00000338101.4	37	c.3811	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923064	0.73213	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	D;D	0.87887	-2.31;-2.31	4.93	4.93	0.64822	Oxidoreductase FAD/NAD(P)-binding (1);	0.094549	0.64402	D	0.000001	D	0.92506	0.7620	M	0.63208	1.945	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.93199	0.6590	10	0.87932	D	0	-36.1556	18.3244	0.90248	0.0:1.0:0.0:0.0	.	1271	P29475	NOS1_HUMAN	H	1166;1271;1305	ENSP00000320758:D1271H;ENSP00000337459:D1305H	ENSP00000320758:D1271H	D	-	1	0	NOS1	116147219	1.000000	0.71417	0.998000	0.56505	0.744000	0.42396	5.896000	0.69822	2.555000	0.86185	0.561000	0.74099	GAT	-	pfam_OxRdtase_FAD/NAD-bd,pirsf_NOS_euk		0.602	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	protein_coding	OTTHUMT00000268053.1	C		-		117662836	-1	no_errors	ENST00000317775	ensembl	human	known	74_37	missense	SNP	1.000	G
KDM4B	23030	genome.wustl.edu	37	19	5082456	5082456	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr19:5082456G>A	ENST00000159111.4	+	9	1077	c.859G>A	c.(859-861)Gca>Aca	p.A287T	KDM4B_ENST00000381759.4_Missense_Mutation_p.A287T|KDM4B_ENST00000536461.1_Missense_Mutation_p.A287T	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	287	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GTTCAACTGCGCAGAATCTAC	0.587																																																	0								ENSG00000127663						70.0	62.0	64.0					19																	5082456		2202	4300	6502	KDM4B	SO:0001583	missense	0			-	HGNC	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.859G>A	19.37:g.5082456G>A	ENSP00000159111:p.Ala287Thr	Somatic	1	113	0.88		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	100	18.70	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.A287T	ENST00000159111.4	37	c.859	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	G	27.2	4.805192	0.90623	.	.	ENSG00000127663	ENST00000159111;ENST00000381759;ENST00000536461	T;T;T	0.71579	-0.58;-0.58;-0.58	4.95	4.95	0.65309	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.86155	0.5865	M	0.90814	3.15	0.80722	D	1	D;D;D	0.71674	0.985;0.998;0.998	P;P;P	0.62885	0.673;0.904;0.908	D	0.89310	0.3632	10	0.66056	D	0.02	-20.4475	18.1627	0.89714	0.0:0.0:1.0:0.0	.	287;287;287	F5GX28;O94953-2;O94953	.;.;KDM4B_HUMAN	T	287	ENSP00000159111:A287T;ENSP00000371178:A287T;ENSP00000440495:A287T	ENSP00000159111:A287T	A	+	1	0	KDM4B	5033456	1.000000	0.71417	0.122000	0.21767	0.625000	0.37756	9.808000	0.99193	2.304000	0.77564	0.462000	0.41574	GCA	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom		0.587	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	protein_coding	OTTHUMT00000450558.1	G	NM_015015	-		5082456	+1	no_errors	ENST00000159111	ensembl	human	known	74_37	missense	SNP	1.000	A
FCGR2A	2212	genome.wustl.edu	37	1	161476426	161476426	+	Intron	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr1:161476426G>A	ENST00000271450.6	+	3	402				FCGR2A_ENST00000367972.4_Intron	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GGGCCAGGACGGATGAAATCT	0.567																																																	0								ENSG00000143226						40.0	39.0	39.0					1																	161476426		2203	4300	6503	FCGR2A	SO:0001627	intron_variant	0			-	HGNC	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.364+45G>A	1.37:g.161476426G>A		Somatic	0	38	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	119	31.82	Q8WUN1|Q8WW64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,pfscan_Ig-like_dom	p.G137R	ENST00000271450.6	37	c.409	CCDS44264.1	1																																																																																			-	NULL		0.567	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCGR2A	protein_coding	OTTHUMT00000083318.3	G	NM_021642	-		161476426	+1	no_errors	ENST00000536731	ensembl	human	known	74_37	missense	SNP	0.000	A
KRTAP6-1	337966	genome.wustl.edu	37	21	31986098	31986098	+	Silent	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr21:31986098G>A	ENST00000329122.2	-	1	151	c.126C>T	c.(124-126)ttC>ttT	p.F42F	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	42						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						CCAGTCTGCGGAAGCCACAGC	0.597																																																	0								ENSG00000184724						124.0	129.0	127.0					21																	31986098		2203	4300	6503	KRTAP6-1	SO:0001819	synonymous_variant	0			-	HGNC	AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.126C>T	21.37:g.31986098G>A		Somatic	0	36	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	85	25.44		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F42	ENST00000329122.2	37	c.126	CCDS13602.1	21																																																																																			-	NULL		0.597	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP6-1	protein_coding	OTTHUMT00000128240.2	G	NM_181602	-		31986098	-1	no_errors	ENST00000329122	ensembl	human	known	74_37	silent	SNP	0.000	A
FCGR2A	2212	genome.wustl.edu	37	1	161476226	161476226	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr1:161476226G>A	ENST00000271450.6	+	3	247	c.209G>A	c.(208-210)aGc>aAc	p.S70N	FCGR2A_ENST00000367972.4_Missense_Mutation_p.S69N	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	70	Ig-like C2-type 1.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGCCCTGAGAGCGACTCCATT	0.587																																																	0								ENSG00000143226						99.0	93.0	95.0					1																	161476226		2203	4300	6503	FCGR2A	SO:0001583	missense	0			-	HGNC	J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.209G>A	1.37:g.161476226G>A	ENSP00000271450:p.Ser70Asn	Somatic	0	62	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	84	216	27.91	Q8WUN1|Q8WW64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S70N	ENST00000271450.6	37	c.209	CCDS44264.1	1	.	.	.	.	.	.	.	.	.	.	G	0.144	-1.099371	0.01843	.	.	ENSG00000143226	ENST00000367972;ENST00000271450	T;T	0.09350	2.99;2.99	3.66	1.33	0.21861	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.664590	0.03105	N	0.161634	T	0.00875	0.0029	N	0.02225	-0.63	0.25568	N	0.986922	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.33292	-0.9874	9	0.02654	T	1	.	4.9737	0.14129	0.7212:0.0:0.2788:0.0	.	70;69	P12318;P12318-2	FCG2A_HUMAN;.	N	69;70	ENSP00000356949:S69N;ENSP00000271450:S70N	ENSP00000271450:S70N	S	+	2	0	FCGR2A	159742850	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.352000	0.20113	0.148000	0.19059	-0.367000	0.07326	AGC	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.587	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCGR2A	protein_coding	OTTHUMT00000083318.3	G	NM_021642	-		161476226	+1	no_errors	ENST00000271450	ensembl	human	known	74_37	missense	SNP	0.000	A
GGT1	2678	genome.wustl.edu	37	22	25019094	25019094	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr22:25019094G>C	ENST00000400382.1	+	10	1509	c.754G>C	c.(754-756)Gac>Cac	p.D252H	GGT1_ENST00000400380.1_Missense_Mutation_p.D252H|GGT1_ENST00000406383.2_Missense_Mutation_p.D252H|GGT1_ENST00000400383.1_Missense_Mutation_p.D252H|GGT1_ENST00000248923.4_Missense_Mutation_p.D252H|GGT1_ENST00000466310.1_3'UTR			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	252					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	GACAGCTGAGGACCTGAACAA	0.622																																																	0								ENSG00000100031						24.0	27.0	26.0					22																	25019094		1982	4173	6155	GGT1	SO:0001583	missense	0			-	HGNC	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.754G>C	22.37:g.25019094G>C	ENSP00000383232:p.Asp252His	Somatic	0	60	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	115	12.88	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GGT_peptidase,prints_GGT_peptidase,tigrfam_GGT_peptidase	p.D252H	ENST00000400382.1	37	c.754	CCDS42992.1	22	.	.	.	.	.	.	.	.	.	.	.	16.64	3.179027	0.57692	.	.	ENSG00000100031	ENST00000248923;ENST00000412658;ENST00000400382;ENST00000400383;ENST00000400380;ENST00000406383	T;T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19;0.19	3.67	3.67	0.42095	.	0.000000	0.85682	U	0.000000	D	0.85978	0.5823	H	0.99535	4.615	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	D	0.92236	0.5796	10	0.87932	D	0	-46.2489	14.8316	0.70153	0.0:0.0:1.0:0.0	.	252	P19440	GGT1_HUMAN	H	252	ENSP00000248923:D252H;ENSP00000393537:D252H;ENSP00000383232:D252H;ENSP00000383233:D252H;ENSP00000383231:D252H;ENSP00000385975:D252H	ENSP00000248923:D252H	D	+	1	0	GGT1	23349094	1.000000	0.71417	0.990000	0.47175	0.222000	0.24845	9.149000	0.94659	1.779000	0.52309	0.549000	0.68633	GAC	-	pfam_GGT_peptidase,prints_GGT_peptidase,tigrfam_GGT_peptidase		0.622	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GGT1	protein_coding	OTTHUMT00000250797.1	G	NM_013430	-		25019094	+1	no_errors	ENST00000248923	ensembl	human	known	74_37	missense	SNP	1.000	C
MTAP	4507	genome.wustl.edu	37	9	21861902	21861903	+	Intron	INS	-	-	T	rs11356405|rs67222036	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr9:21861902_21861903insT	ENST00000460874.2	+	8	1089				MTAP_ENST00000380172.4_Intron|RP11-145E5.5_ENST00000404796.2_Intron|MTAP_ENST00000580900.1_Intron|RP11-70L8.4_ENST00000581788.1_RNA					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		ATCAAAATCTGTTTTTTTTTTT	0.332																																																	2	Whole gene deletion(2)	lung(2)						ENSG00000265194																																			RP11-70L8.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.865-72->T	9.37:g.21861913_21861913dupT		Somatic	0	10	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000460874.2	37	NULL		9																																																																																			-	-		0.332	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000265194	protein_coding	OTTHUMT00000051929.2	-	NM_002451			21861903	-1	no_errors	ENST00000581788	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
ATP1A3	478	genome.wustl.edu	37	19	42482338	42482338	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr19:42482338C>T	ENST00000302102.5	-	13	1921	c.1771G>A	c.(1771-1773)Gac>Aac	p.D591N	ATP1A3_ENST00000545399.1_Missense_Mutation_p.D604N|ATP1A3_ENST00000543770.1_Missense_Mutation_p.D602N|ATP1A3_ENST00000602133.1_Missense_Mutation_p.D561N	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	591					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						CCCACCGCGTCAGGGACGGCT	0.632																																																	0								ENSG00000105409						61.0	60.0	60.0					19																	42482338		2203	4300	6503	ATP1A3	SO:0001583	missense	0			-	HGNC		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.1771G>A	19.37:g.42482338C>T	ENSP00000302397:p.Asp591Asn	Somatic	0	51	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	68	49	58.12	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.D591N	ENST00000302102.5	37	c.1771	CCDS12594.1	19	.	.	.	.	.	.	.	.	.	.	C	31	5.061985	0.93846	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	4.44	4.44	0.53790	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.86188	0.5873	L	0.55103	1.725	0.80722	D	1	B;P;P;P	0.52842	0.059;0.904;0.956;0.922	B;P;D;P	0.64687	0.044;0.78;0.928;0.86	D	0.87418	0.2380	10	0.72032	D	0.01	.	14.9849	0.71339	0.0:1.0:0.0:0.0	.	604;602;591;591	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	N	591;591;604;561;335;602	ENSP00000302397:D591N;ENSP00000411503:D591N;ENSP00000444688:D604N;ENSP00000437577:D602N	ENSP00000302397:D591N	D	-	1	0	ATP1A3	47174178	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	7.554000	0.82212	2.478000	0.83669	0.561000	0.74099	GAC	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC		0.632	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	protein_coding	OTTHUMT00000268107.1	C	NM_152296	-		42482338	-1	no_errors	ENST00000302102	ensembl	human	known	74_37	missense	SNP	1.000	T
ANAPC4	29945	genome.wustl.edu	37	4	25384985	25384985	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr4:25384985T>A	ENST00000315368.3	+	4	480	c.338T>A	c.(337-339)aTg>aAg	p.M113K	ANAPC4_ENST00000510092.1_Missense_Mutation_p.M113K	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	113					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				GTTTCCTGTATGCATTGGATG	0.363																																																	0								ENSG00000053900						104.0	102.0	102.0					4																	25384985		2203	4300	6503	ANAPC4	SO:0001583	missense	0			-	HGNC	AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.338T>A	4.37:g.25384985T>A	ENSP00000318775:p.Met113Lys	Somatic	0	31	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom,pirsf_APC4_metazoa	p.M113K	ENST00000315368.3	37	c.338	CCDS3434.1	4	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463261	0.84425	.	.	ENSG00000053900	ENST00000315368;ENST00000510092;ENST00000505991	T;T;T	0.30981	1.51;1.51;1.51	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53997	0.1831	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.66084	0.941	T	0.56318	-0.7999	10	0.56958	D	0.05	-29.2284	15.9279	0.79635	0.0:0.0:0.0:1.0	.	113	Q9UJX5	APC4_HUMAN	K	113	ENSP00000318775:M113K;ENSP00000426654:M113K;ENSP00000421840:M113K	ENSP00000318775:M113K	M	+	2	0	ANAPC4	24994083	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.563000	0.82314	2.165000	0.68154	0.482000	0.46254	ATG	-	superfamily_WD40_repeat_dom,pirsf_APC4_metazoa		0.363	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANAPC4	protein_coding	OTTHUMT00000214986.1	T	NM_013367	-		25384985	+1	no_errors	ENST00000510092	ensembl	human	known	74_37	missense	SNP	1.000	A
PTPRVP	148713	genome.wustl.edu	37	1	202156135	202156136	+	RNA	INS	-	-	CCTCGCT	rs369231344|rs139095833|rs78957599|rs368169635	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr1:202156135_202156136insCCTCGCT	ENST00000482597.1	+	0	3411_3412					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CTGCAGGCCCCcctcgctcctc	0.639														3092	0.617412	0.3094	0.6816	5008	,	,		20478	0.6835		0.7137	False		,,,				2504	0.8211																0								ENSG00000243323																																			PTPRVP			0				HGNC	AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202156136_202156142dupCCTCGCT		Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			-	-		0.639	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	pseudogene	OTTHUMT00000334021.1	-	XM_086287			202156136	+1	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	INS	0.022:0.016	CCTCGCT
KIF19	124602	genome.wustl.edu	37	17	72347018	72347018	+	Missense_Mutation	SNP	G	G	A	rs143225781		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr17:72347018G>A	ENST00000389916.4	+	12	1699	c.1561G>A	c.(1561-1563)Gag>Aag	p.E521K	AC103809.2_ENST00000599136.1_Missense_Mutation_p.S98L	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	521					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CCTGGTGGACGAGCAGAAGCA	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18179	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000196169	G	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	106.0	107.0	107.0		1561	3.6	0.6	17	dbSNP_134	107	0,8600		0,0,4300	yes	missense	KIF19	NM_153209.3	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	521/999	72347018	1,13005	2203	4300	6503	KIF19	SO:0001583	missense	0			GMAF=0	HGNC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1561G>A	17.37:g.72347018G>A	ENSP00000374566:p.Glu521Lys	Somatic	0	64	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	48	17.24	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.E521K	ENST00000389916.4	37	c.1561	CCDS32718.2	17	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	17.32	3.360760	0.61403	2.27E-4	0.0	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.75589	-0.95;-0.69	5.62	3.62	0.41486	.	.	.	.	.	T	0.82075	0.4958	M	0.71206	2.165	0.46901	D	0.999242	D;D;D;D	0.76494	0.999;0.999;0.999;0.991	P;D;D;P	0.68621	0.866;0.959;0.909;0.79	T	0.79067	-0.1955	9	0.31617	T	0.26	.	10.4404	0.44462	0.074:0.135:0.791:0.0	.	521;479;479;521	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	K	479;521	ENSP00000449134:E479K;ENSP00000374566:E521K	ENSP00000374566:E521K	E	+	1	0	KIF19	69858613	1.000000	0.71417	0.645000	0.29479	0.015000	0.08874	4.563000	0.60823	0.730000	0.32425	0.650000	0.86243	GAG	-	NULL		0.617	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	protein_coding	OTTHUMT00000319644.2	G	NM_153209	rs143225781		72347018	+1	no_errors	ENST00000389916	ensembl	human	known	74_37	missense	SNP	0.991	A
PXDNL	137902	genome.wustl.edu	37	8	52321309	52321309	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52321309G>A	ENST00000356297.4	-	17	2975	c.2875C>T	c.(2875-2877)Cac>Tac	p.H959Y	PXDNL_ENST00000543296.1_Missense_Mutation_p.H959Y	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	959					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TTGGCCCGGTGGTCCCCGGCC	0.657																																																	0								ENSG00000147485						12.0	14.0	13.0					8																	52321309		1974	4142	6116	PXDNL	SO:0001583	missense	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2875C>T	8.37:g.52321309G>A	ENSP00000348645:p.His959Tyr	Somatic	0	53	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	56	49.55	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.H959Y	ENST00000356297.4	37	c.2875	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.098901	0.00360	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.68765	-0.35;-0.35	4.16	1.31	0.21738	.	0.504438	0.17961	N	0.156177	T	0.48822	0.1521	L	0.43598	1.365	0.26305	N	0.977916	B	0.13594	0.008	B	0.16722	0.016	T	0.37267	-0.9713	10	0.02654	T	1	.	7.3525	0.26700	0.3094:0.0:0.6906:0.0	.	959	A1KZ92	PXDNL_HUMAN	Y	959	ENSP00000348645:H959Y;ENSP00000444865:H959Y	ENSP00000348645:H959Y	H	-	1	0	PXDNL	52483862	1.000000	0.71417	0.000000	0.03702	0.014000	0.08584	3.116000	0.50399	-0.049000	0.13379	0.655000	0.94253	CAC	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,prints_Haem_peroxidase_animal_subgr,pfscan_Haem_peroxidase_animal		0.657	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52321309	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	SNP	0.997	A
PTGES	9536	genome.wustl.edu	37	9	132501706	132501707	+	3'UTR	INS	-	-	ACACAT	rs1134680|rs137962222|rs35042232|rs3884098|rs367837009		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr9:132501706_132501707insACACAT	ENST00000340607.4	-	0	676_677				PTGES_ENST00000481476.1_De_novo_Start_OutOfFrame	NM_004878.4	NP_004869.1	O14684	PTGES_HUMAN	prostaglandin E synthase						acute inflammatory response (GO:0002526)|arachidonic acid metabolic process (GO:0019369)|chronic inflammatory response (GO:0002544)|cyclooxygenase pathway (GO:0019371)|negative regulation of cell proliferation (GO:0008285)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|response to calcium ion (GO:0051592)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)	glutathione binding (GO:0043295)|prostaglandin-E synthase activity (GO:0050220)			lung(1)|skin(1)	2		Ovarian(14;0.00556)				Aacatacacacacacatacaca	0.525																																																	0								ENSG00000148344																																			PTGES	SO:0001624	3_prime_UTR_variant	0				HGNC	AF010316	CCDS6927.1	9q34.3	2008-07-21			ENSG00000148344	ENSG00000148344			9599	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase 1-like 1"", ""tumor protein p53 inducible protein 12"", ""p53-induced gene 12"", ""microsomal prostaglandin E synthase-1"", ""glutathione S-transferase 1-like 1"", ""MGST1-like 1"""	605172		MGST1L1		9305847, 10091672	Standard	NM_004878		Approved	MGST-IV, PIG12, MGST1-L1, TP53I12	uc004byi.3	O14684	OTTHUMG00000020791	ENST00000340607.4:c.*184->ATGTGT	9.37:g.132501707_132501712dupACACAT		Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14900|Q5SZC0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340607.4	37	NULL	CCDS6927.1	9																																																																																			-	-		0.525	PTGES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES	protein_coding	OTTHUMT00000054599.2	-	NM_004878			132501707	-1	no_errors	ENST00000481476	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACACAT
EEA1	8411	genome.wustl.edu	37	12	93244995	93244995	+	Silent	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:93244995C>T	ENST00000322349.8	-	9	954	c.690G>A	c.(688-690)ctG>ctA	p.L230L		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	230					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						GAACTTGGACCAGTTCTTTCT	0.338																																																	0								ENSG00000102189						110.0	95.0	100.0					12																	93244995		2203	4300	6503	EEA1	SO:0001819	synonymous_variant	0			-	HGNC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.690G>A	12.37:g.93244995C>T		Somatic	0	63	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	234	321	42.16	Q14221	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.L230	ENST00000322349.8	37	c.690	CCDS31874.1	12																																																																																			-	NULL		0.338	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	protein_coding	OTTHUMT00000407304.1	C	NM_003566	-		93244995	-1	no_errors	ENST00000322349	ensembl	human	known	74_37	silent	SNP	1.000	T
GOLGA8M	653720	genome.wustl.edu	37	15	28951305	28951305	+	Silent	SNP	T	T	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr15:28951305T>C	ENST00000563027.1	-	11	830	c.831A>G	c.(829-831)gtA>gtG	p.V277V	GOLGA8M_ENST00000340249.3_Silent_p.V196V|RN7SL719P_ENST00000487967.2_RNA					golgin A8 family, member M																		CCAGCTTCTCTACCCGACGCA	0.552																																																	0								ENSG00000188626																																			GOLGA8M	SO:0001819	synonymous_variant	0			-	HGNC		CCDS61572.1	15q13.1	2014-03-21			ENSG00000188626	ENSG00000188626			44404	protein-coding gene	gene with protein product							Standard	NM_001282468		Approved			H3BSY2	OTTHUMG00000176338	ENST00000563027.1:c.831A>G	15.37:g.28951305T>C		Somatic	0	12	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	26.32		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V196	ENST00000563027.1	37	c.588		15																																																																																			-	NULL		0.552	GOLGA8M-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8M	protein_coding	OTTHUMT00000431777.1	T		-		28951305	-1	no_errors	ENST00000340249	ensembl	human	known	74_37	silent	SNP	0.572	C
PRPF4B	8899	genome.wustl.edu	37	6	4059123	4059124	+	Intron	INS	-	-	A	rs575197055		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr6:4059123_4059124insA	ENST00000337659.6	+	14	2920				PRPF4B_ENST00000494674.1_Intron|PRPF4B_ENST00000538861.1_Intron	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B						mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				GCTGGTGAATTAAAAAAAAAAC	0.312																																																	0								ENSG00000112739																																			PRPF4B	SO:0001627	intron_variant	0				HGNC	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.2820+75->A	6.37:g.4059133_4059133dupA		Somatic	0	14	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337659.6	37	NULL	CCDS4488.1	6																																																																																			-	-		0.312	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	protein_coding	OTTHUMT00000314018.2	-				4059124	+1	no_errors	ENST00000466185	ensembl	human	known	74_37	rna	INS	0.000:0.004	A
OR4F6	390648	genome.wustl.edu	37	15	102346298	102346298	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr15:102346298A>T	ENST00000328882.4	+	1	397	c.376A>T	c.(376-378)Ata>Tta	p.I126L		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			ATATGTGGCCATATGTAAGCC	0.438																																																	0								ENSG00000184140						249.0	221.0	231.0					15																	102346298		2203	4300	6503	OR4F6	SO:0001583	missense	0			-	HGNC	AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.376A>T	15.37:g.102346298A>T	ENSP00000327525:p.Ile126Leu	Somatic	0	50	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	146	14.62	B9EH28|Q6IF95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I126L	ENST00000328882.4	37	c.376	CCDS32341.1	15	.	.	.	.	.	.	.	.	.	.	.	18.19	3.569578	0.65765	.	.	ENSG00000184140	ENST00000328882	T	0.57595	0.39	4.78	4.78	0.61160	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000012	T	0.72598	0.3480	H	0.99498	4.595	0.41121	D	0.985811	B	0.31752	0.338	B	0.33620	0.167	T	0.80828	-0.1208	10	0.72032	D	0.01	.	12.5721	0.56342	1.0:0.0:0.0:0.0	.	126	Q8NGB9	OR4F6_HUMAN	L	126	ENSP00000327525:I126L	ENSP00000327525:I126L	I	+	1	0	OR4F6	100163821	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	5.489000	0.66875	2.139000	0.66308	0.482000	0.46254	ATA	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.438	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F6	protein_coding	OTTHUMT00000417593.1	A		-		102346298	+1	no_errors	ENST00000328882	ensembl	human	known	74_37	missense	SNP	1.000	T
CXADRP3	440224	genome.wustl.edu	37	18	14478406	14478406	+	lincRNA	SNP	G	G	A	rs541907399		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr18:14478406G>A	ENST00000581457.1	-	0	1502					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		GCGGACGTACGGCTCTTTGGA	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		20199	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000265766																																			CXADRP3			0			-	HGNC			18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14478406G>A		Somatic	0	41	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			-	-		0.448	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	lincRNA	OTTHUMT00000443008.1	G	NR_024076	-		14478406	-1	no_errors	ENST00000581457	ensembl	human	known	74_37	rna	SNP	1.000	A
DPPA3P2	400206	genome.wustl.edu	37	14	36840954	36840954	+	RNA	SNP	A	A	G			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr14:36840954A>G	ENST00000557188.1	+	0	585									developmental pluripotency associated 3 pseudogene 2																		CGCATGAAAGAAGACCAACAA	0.453																																																	0								ENSG00000188831																																			DPPA3P2			0			-	HGNC			14q13.3	2012-07-04			ENSG00000188831	ENSG00000188831			20417	pseudogene	pseudogene							Standard	NG_023379		Approved	STELLAR			OTTHUMG00000170728		14.37:g.36840954A>G		Somatic	0	54	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	133	15.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557188.1	37	NULL		14																																																																																			-	-		0.453	DPPA3P2-002	KNOWN	basic	processed_transcript	DPPA3P2	pseudogene	OTTHUMT00000410122.1	A		-		36840954	+1	no_errors	ENST00000557188	ensembl	human	known	74_37	rna	SNP	0.005	G
MARCH9	92979	genome.wustl.edu	37	12	58150836	58150836	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:58150836T>C	ENST00000266643.5	+	2	913	c.482T>C	c.(481-483)gTc>gCc	p.V161A	MARCH9_ENST00000548358.1_5'Flank	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	161					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			AAGTACCAGGTCCTGGCGATC	0.602											OREG0021952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000139266						28.0	23.0	24.0					12																	58150836		2189	4277	6466	MARCH9	SO:0001583	missense	0			-	HGNC	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.482T>C	12.37:g.58150836T>C	ENSP00000266643:p.Val161Ala	Somatic	0	90	0.00	1028	0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	167	88	65.23	B2R9U9|Q86VN5|Q96GG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.V161A	ENST00000266643.5	37	c.482	CCDS31847.1	12	.	.	.	.	.	.	.	.	.	.	T	35	5.563164	0.96527	.	.	ENSG00000139266	ENST00000266643	T	0.57752	0.38	5.27	5.27	0.74061	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-CH-type (1);	0.000000	0.85682	D	0.000000	T	0.58438	0.2122	L	0.44542	1.39	0.80722	D	1	D	0.69078	0.997	P	0.54924	0.764	T	0.62751	-0.6788	10	0.87932	D	0	.	14.3038	0.66373	0.0:0.0:0.0:1.0	.	161	Q86YJ5	MARH9_HUMAN	A	161	ENSP00000266643:V161A	ENSP00000266643:V161A	V	+	2	0	MARCH9	56437103	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.868000	0.87116	2.212000	0.71576	0.459000	0.35465	GTC	-	NULL		0.602	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH9	protein_coding	OTTHUMT00000409244.1	T	NM_138396	-		58150836	+1	no_errors	ENST00000266643	ensembl	human	known	74_37	missense	SNP	1.000	C
LOC642361	642361	genome.wustl.edu	37	10	81586763	81586764	+	lincRNA	INS	-	-	TCGCCTCGCC	rs376141844|rs564141310|rs57348880	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr10:81586763_81586764insTCGCCTCGCC	ENST00000605920.1	+	0	1106_1107				RP11-773D16.1_ENST00000495430.1_lincRNA	NR_029407.1|NR_029408.1																						CCTCGCTCACGTCGCCTCGCCT	0.708														3577	0.714257	0.5431	0.732	5008	,	,		8252	0.8155		0.8698	False		,,,				2504	0.6687																0								ENSG00000272447																																			RP11-182L21.6			0				Clone_based_vega_gene																													10.37:g.81586764_81586773dupTCGCCTCGCC		Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000605920.1	37	NULL		10																																																																																			-	-		0.708	RP11-182L21.6-001	KNOWN	basic	lincRNA	LOC642361	lincRNA	OTTHUMT00000470940.1	-				81586764	+1	no_errors	ENST00000605920	ensembl	human	known	74_37	rna	INS	0.302:0.319	TCGCCTCGCC
LYPD8	646627	genome.wustl.edu	37	1	248885201	248885218	+	lincRNA	DEL	TGAAAACAATCACAAAGT	TGAAAACAATCACAAAGT	-	rs138484056|rs374052536|rs6660979	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	TGAAAACAATCACAAAGT	TGAAAACAATCACAAAGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr1:248885201_248885218delTGAAAACAATCACAAAGT	ENST00000436484.1	-	0	288_305																											TGGGGGACACTGAAAACAATCACAAAGTTGGTGTCATT	0.541																																																	0								ENSG00000232694																																			XX-CR54.3			0				Clone_based_vega_gene																													1.37:g.248885201_248885218delTGAAAACAATCACAAAGT		Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436484.1	37	NULL		1																																																																																			-	-		0.541	XX-CR54.3-001	KNOWN	basic|exp_conf	lincRNA	LYPD8	lincRNA	OTTHUMT00000171434.1	TGAAAACAATCACAAAGT				248885218	-1	no_errors	ENST00000436484	ensembl	human	known	74_37	rna	DEL	0.058:0.046:0.026:0.024:0.016:0.010:0.006:0.002:0.001:0.002:0.002:0.003:0.011:0.024:0.029:0.029:0.025:0.028	-
HMGB1P5	10354	genome.wustl.edu	37	3	22424338	22424338	+	RNA	DEL	A	A	-			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr3:22424338delA	ENST00000451497.1	+	0	903									high mobility group box 1 pseudogene 5																		CTGTAATTGCAAAAAAAAAAA	0.299																																																	0								ENSG00000132967																																			HMGB1P5			0				HGNC	AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424338delA		Somatic	0	12	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			-	-		0.299	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	pseudogene	OTTHUMT00000340803.1	A	NG_000897			22424338	+1	no_errors	ENST00000451497	ensembl	human	known	74_37	rna	DEL	1.000	-
PXDNL	137902	genome.wustl.edu	37	8	52321339	52321339	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52321339G>A	ENST00000356297.4	-	17	2945	c.2845C>T	c.(2845-2847)Cag>Tag	p.Q949*	PXDNL_ENST00000543296.1_Nonsense_Mutation_p.Q949*	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	949					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGGCTCTCCTGCTCCTGTCGC	0.647																																																	0								ENSG00000147485						13.0	15.0	15.0					8																	52321339		1967	4143	6110	PXDNL	SO:0001587	stop_gained	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2845C>T	8.37:g.52321339G>A	ENSP00000348645:p.Gln949*	Somatic	0	53	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	53	53.51	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.Q949*	ENST00000356297.4	37	c.2845	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.338466	0.98221	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	.	.	.	4.02	3.01	0.34805	.	1.317580	0.05660	N	0.586776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	7.9115	0.29793	0.0:0.0:0.5577:0.4423	.	.	.	.	X	949	.	ENSP00000348645:Q949X	Q	-	1	0	PXDNL	52483892	1.000000	0.71417	0.002000	0.10522	0.003000	0.03518	5.658000	0.68003	1.775000	0.52247	0.655000	0.94253	CAG	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.647	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52321339	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	nonsense	SNP	0.880	A
PXDNL	137902	genome.wustl.edu	37	8	52321456	52321456	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:52321456G>A	ENST00000356297.4	-	17	2828	c.2728C>T	c.(2728-2730)Ctc>Ttc	p.L910F	PXDNL_ENST00000543296.1_Missense_Mutation_p.L910F	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	910					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGGTCTCTGAGAGCCTGGGAT	0.582																																																	0								ENSG00000147485						35.0	40.0	39.0					8																	52321456		1962	4137	6099	PXDNL	SO:0001583	missense	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2728C>T	8.37:g.52321456G>A	ENSP00000348645:p.Leu910Phe	Somatic	0	40	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	42	53.33	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.L910F	ENST00000356297.4	37	c.2728	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	11.25	1.583892	0.28268	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	D;D	0.85088	-1.94;-1.94	4.17	4.17	0.49024	.	0.000000	0.44483	D	0.000441	D	0.92740	0.7692	M	0.90977	3.165	0.36020	D	0.838664	D	0.89917	1.0	D	0.83275	0.996	D	0.95016	0.8156	10	0.87932	D	0	.	9.4023	0.38440	0.0:0.0:0.7868:0.2132	.	910	A1KZ92	PXDNL_HUMAN	F	910	ENSP00000348645:L910F;ENSP00000444865:L910F	ENSP00000348645:L910F	L	-	1	0	PXDNL	52484009	0.017000	0.18338	0.037000	0.18230	0.010000	0.07245	0.214000	0.17541	1.859000	0.53934	0.655000	0.94253	CTC	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.582	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52321456	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	SNP	0.845	A
CISH	1154	genome.wustl.edu	37	3	50645127	50645127	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr3:50645127C>T	ENST00000348721.3	-	3	868	c.688G>A	c.(688-690)Gtc>Atc	p.V230I	CISH_ENST00000443053.2_Missense_Mutation_p.V247I	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	230	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CGGTTGATGACAAGGCGGCAC	0.632																																																	0								ENSG00000114737						87.0	88.0	88.0					3																	50645127		2203	4300	6503	CISH	SO:0001583	missense	0			-	HGNC	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.688G>A	3.37:g.50645127C>T	ENSP00000294173:p.Val230Ile	Somatic	0	56	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_SOCS_C,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2,prints_SH2	p.V247I	ENST00000348721.3	37	c.739	CCDS2831.1	3	.	.	.	.	.	.	.	.	.	.	C	14.66	2.603181	0.46423	.	.	ENSG00000114737	ENST00000443053;ENST00000348721	T;T	0.46063	0.88;0.88	5.58	3.49	0.39957	SOCS protein, C-terminal (4);	0.931962	0.09219	N	0.832212	T	0.33147	0.0853	L	0.34521	1.04	0.09310	N	0.999993	B;B	0.20550	0.046;0.033	B;B	0.26517	0.067;0.07	T	0.25222	-1.0138	10	0.36615	T	0.2	-1.2499	7.5863	0.27995	0.0:0.3335:0.5534:0.113	.	247;230	G5E9R1;Q9NSE2	.;CISH_HUMAN	I	247;230	ENSP00000409346:V247I;ENSP00000294173:V230I	ENSP00000294173:V230I	V	-	1	0	CISH	50620131	0.030000	0.19436	0.878000	0.34440	0.988000	0.76386	1.413000	0.34725	1.316000	0.45131	0.655000	0.94253	GTC	-	pfam_SOCS_C,smart_SOCS_C,pfscan_SOCS_C		0.632	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CISH	protein_coding	OTTHUMT00000346245.1	C	NM_145071	-		50645127	-1	no_errors	ENST00000443053	ensembl	human	known	74_37	missense	SNP	0.151	T
TTN	7273	genome.wustl.edu	37	2	179474099	179474099	+	Missense_Mutation	SNP	G	G	T	rs372927085		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr2:179474099G>T	ENST00000591111.1	-	223	47239	c.47015C>A	c.(47014-47016)cCa>cAa	p.P15672Q	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P14745Q|TTN_ENST00000589042.1_Missense_Mutation_p.P17313Q|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P8248Q|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P8440Q|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P8373Q			Q8WZ42	TITIN_HUMAN	titin	15672	Ig-like 98.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGACAAATGGTTCTTCTTC	0.458																																																	0								ENSG00000155657						125.0	125.0	125.0					2																	179474099		1974	4155	6129	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.47015C>A	2.37:g.179474099G>T	ENSP00000465570:p.Pro15672Gln	Somatic	0	20	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	60	15.49	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P14745Q	ENST00000591111.1	37	c.44234		2	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827792	0.32329	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63744	-0.06;0.18;0.15;0.14	5.72	4.84	0.62591	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62356	0.2421	L	0.29908	0.895	0.44834	D	0.997845	P;P;P;P	0.46512	0.879;0.879;0.879;0.879	P;P;P;P	0.51742	0.557;0.557;0.557;0.678	T	0.66885	-0.5810	9	0.87932	D	0	.	14.584	0.68310	0.0701:0.0:0.9299:0.0	.	8248;8373;8440;15672	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	14745;8248;8440;8373;8248	ENSP00000343764:P14745Q;ENSP00000434586:P8248Q;ENSP00000340554:P8440Q;ENSP00000352154:P8373Q	ENSP00000340554:P8440Q	P	-	2	0	TTN	179182344	1.000000	0.71417	0.155000	0.22561	0.976000	0.68499	5.347000	0.65998	1.396000	0.46663	0.563000	0.77884	CCA	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179474099	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619761	+	IGR	DEL	TGTG	TGTG	-	rs563268698	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	TGTG	TGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr2:201619758_201619761delTGTG								AC007163.3 (19858 upstream) : AOX2P (7269 downstream)																							CCTTTCAAATtgtgtgtgtgtgtg	0.407																																																	0								ENSG00000243478																																			AOX2P	SO:0001628	intergenic_variant	0				HGNC																													2.37:g.201619766_201619769delTGTG		Somatic	0	8	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		2																																																																																			-	-	0	0.407					AOX2P			TGTG				201619761	+1	no_errors	ENST00000472376	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.002:0.002	-
SECISBP2	79048	genome.wustl.edu	37	9	91964806	91964806	+	Silent	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr9:91964806C>T	ENST00000375807.3	+	13	1925	c.1854C>T	c.(1852-1854)caC>caT	p.H618H	SECISBP2_ENST00000339901.4_Silent_p.H545H|SECISBP2_ENST00000534113.2_Silent_p.H550H	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	618					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						CTCCCAATCACACCACCTTCC	0.577																																																	0								ENSG00000187742						136.0	112.0	120.0					9																	91964806		2203	4300	6503	SECISBP2	SO:0001819	synonymous_variant	0			-	HGNC	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.1854C>T	9.37:g.91964806C>T		Somatic	0	33	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	54	23.94	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.H618	ENST00000375807.3	37	c.1854	CCDS6683.1	9																																																																																			-	NULL		0.577	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECISBP2	protein_coding	OTTHUMT00000052990.3	C	NM_024077	-		91964806	+1	no_errors	ENST00000375807	ensembl	human	known	74_37	silent	SNP	0.000	T
MUC2	4583	genome.wustl.edu	37	11	1098695	1098695	+	Silent	SNP	C	C	T	rs370421370		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr11:1098695C>T	ENST00000441003.2	+	37	7092	c.7065C>T	c.(7063-7065)tgC>tgT	p.C2355C	MUC2_ENST00000361558.6_3'UTR	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4717					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACGATGCCTGCGTGTTCGACA	0.647																																																	0								ENSG00000198788	C		1,4237		0,1,2118	23.0	28.0	26.0		7050	3.1	0.4	11		26	0,8478		0,0,4239	no	coding-synonymous	MUC2	NM_002457.2		0,1,6357	TT,TC,CC		0.0,0.0236,0.0079		2350/2813	1098695	1,12715	2119	4239	6358	MUC2	SO:0001819	synonymous_variant	0			-	HGNC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7065C>T	11.37:g.1098695C>T		Somatic	0	92	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	74	13.95	Q14878	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.C2355	ENST00000441003.2	37	c.7065		11																																																																																			-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	C	NM_002457	-		1098695	+1	no_errors	ENST00000441003	ensembl	human	known	74_37	silent	SNP	0.647	T
COBL	23242	genome.wustl.edu	37	7	51096630	51096630	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr7:51096630G>T	ENST00000265136.7	-	10	2328	c.2163C>A	c.(2161-2163)gaC>gaA	p.D721E	COBL_ENST00000395542.2_Missense_Mutation_p.D803E	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	721					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					ACACATCTCTGTCGTAACATC	0.517																																					NSCLC(189;2119 2138 12223 30818 34679)												0								ENSG00000106078						113.0	94.0	101.0					7																	51096630		2203	4300	6503	COBL	SO:0001583	missense	0			-	HGNC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2163C>A	7.37:g.51096630G>T	ENSP00000265136:p.Asp721Glu	Somatic	0	25	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cordon-bleu_ubiquitin_domain,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.D803E	ENST00000265136.7	37	c.2409	CCDS34637.1	7	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969750	0.53614	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.15372	2.44;2.43;2.48;2.49	5.83	3.04	0.35103	.	0.000000	0.49305	D	0.000141	T	0.32852	0.0843	L	0.55990	1.75	0.27383	N	0.955367	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.939;0.996;0.999	T	0.03957	-1.0989	10	0.66056	D	0.02	.	9.3039	0.37863	0.3059:0.0:0.6941:0.0	.	721;778;721;803;263	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	E	721;613;606;803	ENSP00000265136:D721E;ENSP00000401204:D613E;ENSP00000413498:D606E;ENSP00000378912:D803E	ENSP00000265136:D721E	D	-	3	2	COBL	51064124	1.000000	0.71417	0.197000	0.23402	0.305000	0.27757	1.589000	0.36644	0.810000	0.34279	0.655000	0.94253	GAC	-	NULL		0.517	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	protein_coding	OTTHUMT00000342682.1	G	NM_015198	-		51096630	-1	no_errors	ENST00000395542	ensembl	human	known	74_37	missense	SNP	0.807	T
SEMA5B	54437	genome.wustl.edu	37	3	122631054	122631054	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr3:122631054G>A	ENST00000357599.3	-	19	3247	c.2861C>T	c.(2860-2862)aCg>aTg	p.T954M	SEMA5B_ENST00000451055.2_Missense_Mutation_p.T1008M|SEMA5B_ENST00000195173.4_Missense_Mutation_p.T953M	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	954	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TGCCTCCTCCGTGTGCAGCCC	0.652																																																	0								ENSG00000082684						59.0	49.0	53.0					3																	122631054		2203	4300	6503	SEMA5B	SO:0001583	missense	0			-	HGNC	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2861C>T	3.37:g.122631054G>A	ENSP00000350215:p.Thr954Met	Somatic	0	44	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.T1008M	ENST00000357599.3	37	c.3023	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196653	0.79015	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	4.55	4.55	0.56014	.	0.055650	0.64402	D	0.000001	T	0.66479	0.2793	L	0.52206	1.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.989	T	0.64028	-0.6503	10	0.33940	T	0.23	.	16.4825	0.84161	0.0:0.0:1.0:0.0	.	860;954	D3YTI7;Q9P283	.;SEM5B_HUMAN	M	954;953;860;1008;954	ENSP00000350215:T954M;ENSP00000195173:T953M;ENSP00000389588:T1008M;ENSP00000377208:T954M	ENSP00000195173:T953M	T	-	2	0	SEMA5B	124113744	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.640000	0.98453	2.365000	0.80145	0.511000	0.50034	ACG	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.652	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	protein_coding	OTTHUMT00000277165.1	G	NM_001031702	-		122631054	-1	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	SNP	1.000	A
EEA1	8411	genome.wustl.edu	37	12	93246073	93246073	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:93246073C>T	ENST00000322349.8	-	8	785		c.e8-1			NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1						early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						GACTTTATATCTAATTAAAGA	0.303																																																	0								ENSG00000102189						49.0	49.0	49.0					12																	93246073		2203	4300	6503	EEA1	SO:0001630	splice_region_variant	0			-	HGNC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.521-1G>A	12.37:g.93246073C>T		Somatic	0	37	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	159	262	37.68	Q14221	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8-1	ENST00000322349.8	37	c.521-1	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154306	0.78114	.	.	ENSG00000102189	ENST00000322349;ENST00000540777	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7627	0.96329	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EEA1	91770204	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.940000	0.75917	2.660000	0.90430	0.643000	0.83706	.	-	-		0.303	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	protein_coding	OTTHUMT00000407304.1	C	NM_003566	-	Intron	93246073	-1	no_errors	ENST00000322349	ensembl	human	known	74_37	splice_site	SNP	1.000	T
SHC3	53358	genome.wustl.edu	37	9	91690129	91690129	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr9:91690129C>A	ENST00000375835.4	-	4	930	c.624G>T	c.(622-624)atG>atT	p.M208I	SHC3_ENST00000375830.1_5'UTR	NM_016848.5	NP_058544.3	Q92529	SHC3_HUMAN	SHC (Src homology 2 domain containing) transforming protein 3	208	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|insulin receptor signaling pathway (GO:0008286)|learning or memory (GO:0007611)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	signal transducer activity (GO:0004871)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|skin(3)	28						TGCTGGACAGCATTTTGCTTG	0.493																																																	0								ENSG00000148082						136.0	124.0	128.0					9																	91690129		2203	4300	6503	SHC3	SO:0001583	missense	0			-	HGNC	D84361	CCDS6681.1	9q22.1	2013-02-14	2005-05-24		ENSG00000148082	ENSG00000148082		"""SH2 domain containing"""	18181	protein-coding gene	gene with protein product		605263	"""src homology 2 domain containing transforming protein C3"""			8808684	Standard	NM_016848		Approved	N-Shc, NSHC, SHCC	uc004aqf.2	Q92529	OTTHUMG00000020179	ENST00000375835.4:c.624G>T	9.37:g.91690129C>A	ENSP00000364995:p.Met208Ile	Somatic	0	41	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	70	13.58	Q5T7I7|Q8TAP2|Q9UCX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,pfam_SH2,smart_PTB/PI_dom,smart_SH2,pfscan_PTB/PI_dom,pfscan_SH2,prints_PID_Shc-like,prints_SH2	p.M208I	ENST00000375835.4	37	c.624	CCDS6681.1	9	.	.	.	.	.	.	.	.	.	.	C	6.651	0.488574	0.12641	.	.	ENSG00000148082	ENST00000375835	T	0.19250	2.16	4.82	3.88	0.44766	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.514704	0.23746	N	0.044975	T	0.06872	0.0175	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.29274	-1.0017	10	0.20519	T	0.43	-18.662	7.0315	0.24970	0.2875:0.5439:0.1687:0.0	.	208	Q92529	SHC3_HUMAN	I	208	ENSP00000364995:M208I	ENSP00000364995:M208I	M	-	3	0	SHC3	90879949	0.998000	0.40836	1.000000	0.80357	0.856000	0.48823	0.782000	0.26788	2.497000	0.84241	0.563000	0.77884	ATG	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.493	SHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC3	protein_coding	OTTHUMT00000052986.1	C	NM_016848	-		91690129	-1	no_errors	ENST00000375835	ensembl	human	known	74_37	missense	SNP	0.989	A
ACVR1B	91	genome.wustl.edu	37	12	52385793	52385793	+	Intron	SNP	C	C	T	rs368192679		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:52385793C>T	ENST00000257963.4	+	8	1469				ACVR1B_ENST00000542485.1_Intron|ACVR1B_ENST00000541224.1_Intron|ACVR1B_ENST00000426655.2_Missense_Mutation_p.P470S	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB						activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	AAGCTGGCCTCCTGCGGCTTT	0.512																																																	0								ENSG00000135503	C	,,	0,4406		0,0,2203	96.0	84.0	88.0		,,	2.2	0.0	12		88	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,intron	ACVR1B	NM_004302.4,NM_020327.3,NM_020328.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	,,	52385793	1,13005	2203	4300	6503	ACVR1B	SO:0001627	intron_variant	0			-	HGNC		CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.1392+16C>T	12.37:g.52385793C>T		Somatic	0	35	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	52	25.71	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P470S	ENST00000257963.4	37	c.1408	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	C	5.829	0.337288	0.11013	0.0	1.16E-4	ENSG00000135503	ENST00000426655	D	0.83837	-1.77	4.05	2.17	0.27698	.	.	.	.	.	T	0.68778	0.3038	.	.	.	0.09310	N	0.999999	B	0.15473	0.013	B	0.17098	0.017	T	0.53085	-0.8488	7	.	.	.	.	6.4755	0.22033	0.0:0.7086:0.1862:0.1053	.	470	P36896-2	.	S	470	ENSP00000390477:P470S	.	P	+	1	0	ACVR1B	50672060	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.045000	0.12003	0.629000	0.30376	0.462000	0.41574	CCT	-	pfscan_Prot_kinase_dom		0.512	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	protein_coding	OTTHUMT00000397000.1	C	NM_020328	-		52385793	+1	no_errors	ENST00000426655	ensembl	human	known	74_37	missense	SNP	0.002	T
PCDHA6	56142	genome.wustl.edu	37	5	140209016	140209016	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr5:140209016A>C	ENST00000529310.1	+	1	1454	c.1340A>C	c.(1339-1341)gAc>gCc	p.D447A	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.D447A	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	447	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGTGGCCGACATGAATGAC	0.647																																																	0								ENSG00000081842						63.0	69.0	67.0					5																	140209016		2203	4300	6503	PCDHA6	SO:0001583	missense	0			-	HGNC	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1340A>C	5.37:g.140209016A>C	ENSP00000433378:p.Asp447Ala	Somatic	0	204	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	133	21.30	O75283|Q9NRT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D447A	ENST00000529310.1	37	c.1340	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	A	11.75	1.733169	0.30684	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.74526	-0.85;-0.85	3.55	3.55	0.40652	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.38436	U	0.001690	D	0.92169	0.7517	H	0.99811	4.8	0.36340	D	0.859445	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96032	0.9017	10	0.87932	D	0	.	12.5335	0.56128	1.0:0.0:0.0:0.0	.	447;447;447	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	A	447	ENSP00000433378:D447A;ENSP00000434113:D447A	ENSP00000434113:D447A	D	+	2	0	PCDHA6	140189200	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	5.929000	0.70096	1.607000	0.50170	0.260000	0.18958	GAC	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.647	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	protein_coding	OTTHUMT00000372829.3	A	NM_018909	-		140209016	+1	no_errors	ENST00000529310	ensembl	human	known	74_37	missense	SNP	1.000	C
PRR5L	79899	genome.wustl.edu	37	11	36472837	36472837	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr11:36472837C>A	ENST00000378867.3	+	9	1019	c.664C>A	c.(664-666)Ctc>Atc	p.L222I	PRR5L_ENST00000527487.1_Intron|PRR5L_ENST00000311599.5_Missense_Mutation_p.L149I|PRR5L_ENST00000530639.1_Missense_Mutation_p.L222I|PRR5L_ENST00000389693.3_3'UTR	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	222					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TTCTCCTTTCCTCGGCATCAG	0.537																																																	0								ENSG00000135362						167.0	137.0	147.0					11																	36472837		2202	4298	6500	PRR5L	SO:0001583	missense	0			-	HGNC		CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.664C>A	11.37:g.36472837C>A	ENSP00000368144:p.Leu222Ile	Somatic	0	52	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	91	12.50	A4QN22|E9PKY1|Q96H46|Q9H7V4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HbrB	p.L222I	ENST00000378867.3	37	c.664	CCDS31463.1	11	.	.	.	.	.	.	.	.	.	.	C	13.40	2.224609	0.39300	.	.	ENSG00000135362	ENST00000530639;ENST00000311599;ENST00000378867	D;D;D	0.87256	-2.23;-2.23;-2.23	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000002	D	0.91968	0.7456	M	0.78049	2.395	0.42021	D	0.990988	D;P	0.67145	0.996;0.842	D;B	0.75484	0.986;0.254	D	0.91817	0.5464	10	0.52906	T	0.07	-50.471	8.8158	0.34996	0.0:0.7655:0.1527:0.0818	.	94;222	Q6MZQ0-3;Q6MZQ0	.;PRR5L_HUMAN	I	222;149;222	ENSP00000435050:L222I;ENSP00000310103:L149I;ENSP00000368144:L222I	ENSP00000310103:L149I	L	+	1	0	PRR5L	36429413	1.000000	0.71417	0.966000	0.40874	0.512000	0.34134	2.253000	0.43205	2.417000	0.82017	0.313000	0.20887	CTC	-	NULL		0.537	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	protein_coding	OTTHUMT00000389209.1	C	NM_024841	-		36472837	+1	no_errors	ENST00000378867	ensembl	human	known	74_37	missense	SNP	0.998	A
MAGEB18	286514	genome.wustl.edu	37	X	26158106	26158106	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chrX:26158106C>T	ENST00000325250.1	+	2	1191	c.1004C>T	c.(1003-1005)aCg>aTg	p.T335M		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	335	Interaction with LNX1.					cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						TCCAGAACCACGTCTAGCAGC	0.502																																																	0								ENSG00000176774						42.0	24.0	30.0					X																	26158106		2201	4300	6501	MAGEB18	SO:0001583	missense	0			-	HGNC	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.1004C>T	X.37:g.26158106C>T	ENSP00000314543:p.Thr335Met	Somatic	0	19	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	11	66.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.T335M	ENST00000325250.1	37	c.1004	CCDS14216.1	X	.	.	.	.	.	.	.	.	.	.	C	2.191	-0.385281	0.04966	.	.	ENSG00000176774	ENST00000325250	T	0.01918	4.56	3.67	-7.33	0.01431	.	3.081050	0.01017	N	0.003935	T	0.01254	0.0041	N	0.11313	0.125	0.09310	N	1	B	0.18610	0.029	B	0.06405	0.002	T	0.42599	-0.9442	10	0.36615	T	0.2	.	2.0014	0.03468	0.1072:0.2796:0.2129:0.4004	.	335	Q96M61	MAGBI_HUMAN	M	335	ENSP00000314543:T335M	ENSP00000314543:T335M	T	+	2	0	MAGEB18	26068027	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.678000	0.00839	-2.726000	0.00386	-0.281000	0.10026	ACG	-	NULL		0.502	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB18	protein_coding	OTTHUMT00000056120.1	C	NM_173699	-		26158106	+1	no_errors	ENST00000325250	ensembl	human	known	74_37	missense	SNP	0.000	T
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000382968.5_Intron|RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
PREX2	80243	genome.wustl.edu	37	8	68992747	68992747	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr8:68992747G>A	ENST00000288368.4	+	16	1989	c.1712G>A	c.(1711-1713)gGa>gAa	p.G571E	PREX2_ENST00000529398.1_3'UTR|RP11-403D15.2_ENST00000526901.1_RNA	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	571					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GAAATGGAGGGATCAAATATG	0.308																																																	0								ENSG00000046889						80.0	79.0	80.0					8																	68992747		2203	4300	6503	PREX2	SO:0001583	missense	0			-	HGNC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1712G>A	8.37:g.68992747G>A	ENSP00000288368:p.Gly571Glu	Somatic	0	51	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	326	12.60	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.G571E	ENST00000288368.4	37	c.1712	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804555	0.90623	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.13538	2.58	5.59	5.59	0.84812	Winged helix-turn-helix transcription repressor DNA-binding (1);PDZ/DHR/GLGF (1);	0.121024	0.56097	D	0.000034	T	0.37210	0.0995	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;0.99;0.972	D;P;P	0.87578	0.998;0.893;0.868	T	0.03587	-1.1022	10	0.72032	D	0.01	.	19.5815	0.95469	0.0:0.0:1.0:0.0	.	571;571;571	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	E	571	ENSP00000288368:G571E	ENSP00000288368:G571E	G	+	2	0	PREX2	69155301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.429000	0.97481	2.626000	0.88956	0.650000	0.86243	GGA	-	superfamily_PDZ		0.308	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	protein_coding	OTTHUMT00000378620.1	G	NM_025170	-		68992747	+1	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	SNP	1.000	A
SEMA5A	9037	genome.wustl.edu	37	5	9202171	9202171	+	Silent	SNP	C	C	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr5:9202171C>A	ENST00000382496.5	-	9	1493	c.828G>T	c.(826-828)ctG>ctT	p.L276L		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	276	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GGGAGCAGTTCAGGCGAGCCT	0.522																																																	0								ENSG00000112902						89.0	82.0	84.0					5																	9202171		2203	4300	6503	SEMA5A	SO:0001819	synonymous_variant	0			-	HGNC	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.828G>T	5.37:g.9202171C>A		Somatic	0	17	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	77	18.75	D3DTC6|O60408|Q1RLL9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.L276	ENST00000382496.5	37	c.828	CCDS3875.1	5																																																																																			-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.522	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	protein_coding	OTTHUMT00000206989.2	C		-		9202171	-1	no_errors	ENST00000382496	ensembl	human	known	74_37	silent	SNP	0.821	A
DUSP10	11221	genome.wustl.edu	37	1	221875157	221875158	+	3'UTR	DEL	AA	AA	-			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr1:221875157_221875158delAA	ENST00000366899.3	-	0	2283_2284				DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCAGAGAAGGAAAAAAAAAAAA	0.356																																																	0								ENSG00000143507																																			DUSP10	SO:0001624	3_prime_UTR_variant	0				HGNC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*597TT>-	1.37:g.221875167_221875168delAA		Somatic	0	16	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			-	-		0.356	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	protein_coding	OTTHUMT00000090716.1	AA	NM_007207			221875158	-1	no_errors	ENST00000468085	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
PRSS1	5644	genome.wustl.edu	37	7	142460394	142460394	+	Silent	SNP	T	T	C	rs377124851	byFrequency	TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr7:142460394T>C	ENST00000311737.7	+	4	573	c.567T>C	c.(565-567)ctT>ctC	p.L189L	PRSS1_ENST00000486171.1_Silent_p.L203L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	189	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TGGGCTTCCTTGAGGGAGGCA	0.537													T|||	16	0.00319489	0.0121	0.0	5008	,	,		19902	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000204983						188.0	181.0	183.0					7																	142460394		2203	4300	6503	PRSS1	SO:0001819	synonymous_variant	0			-	HGNC	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.567T>C	7.37:g.142460394T>C		Somatic	0	53	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	86	18.52	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L189	ENST00000311737.7	37	c.567	CCDS5872.1	7																																																																																			-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.537	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	protein_coding	OTTHUMT00000352538.2	T		-		142460394	+1	no_errors	ENST00000311737	ensembl	human	known	74_37	silent	SNP	0.939	C
ZFPM1	161882	genome.wustl.edu	37	16	88594452	88594452	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr16:88594452G>T	ENST00000319555.3	+	6	840	c.518G>T	c.(517-519)tGg>tTg	p.W173L	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	173					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GACGCACTCTGGTGCAGGGTC	0.642																																					Pancreas(49;850 1106 29641 32847 38344)												0								ENSG00000179588						11.0	16.0	14.0					16																	88594452		2135	4220	6355	ZFPM1	SO:0001583	missense	0			-	HGNC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.518G>T	16.37:g.88594452G>T	ENSP00000326630:p.Trp173Leu	Somatic	0	70	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	41	26.79		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.W173L	ENST00000319555.3	37	c.518	CCDS32502.1	16	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530353	0.27387	.	.	ENSG00000179588	ENST00000319555	T	0.11495	2.77	4.43	4.43	0.53597	.	0.545840	0.18661	U	0.134709	T	0.21801	0.0525	M	0.65975	2.015	0.34181	D	0.670878	D	0.52996	0.957	P	0.50537	0.643	T	0.36915	-0.9728	10	0.87932	D	0	-12.8927	14.1851	0.65601	0.0:0.0:1.0:0.0	.	173	Q8IX07	FOG1_HUMAN	L	173	ENSP00000326630:W173L	ENSP00000326630:W173L	W	+	2	0	ZFPM1	87121953	1.000000	0.71417	0.998000	0.56505	0.018000	0.09664	2.991000	0.49409	2.025000	0.59659	0.313000	0.20887	TGG	-	NULL		0.642	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM1	protein_coding	OTTHUMT00000422270.2	G		-		88594452	+1	no_errors	ENST00000319555	ensembl	human	known	74_37	missense	SNP	1.000	T
MDGA2	161357	genome.wustl.edu	37	14	48143965	48143965	+	5'UTR	SNP	G	G	T	rs549653182		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr14:48143965G>T	ENST00000399232.2	-	0	192				MDGA2_ENST00000439988.3_Missense_Mutation_p.A12D	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2						pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						GCGGCGGCGAGCGGAGCGCAG	0.677																																																	0								ENSG00000272781																																			MDGA2	SO:0001623	5_prime_UTR_variant	0			-	Uniprot_gn	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.-173C>A	14.37:g.48143965G>T		Somatic	0	50	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	F6W3S7|J3KPX6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.A12D	ENST00000399232.2	37	c.35		14	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910913	0.52439	.	.	ENSG00000139915	ENST00000399232	T	0.65916	-0.18	4.75	3.84	0.44239	.	.	.	.	.	T	0.66187	0.2764	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63817	-0.6551	5	.	.	.	.	11.1983	0.48726	0.0:0.1862:0.8138:0.0	.	.	.	.	D	12	ENSP00000382178:A12D	.	A	-	2	0	MDGA2	47213715	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.274000	0.65569	1.112000	0.41740	0.561000	0.74099	GCT	-	NULL		0.677	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	protein_coding	OTTHUMT00000073352.5	G	NM_182830	-		48143965	-1	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	SNP	1.000	T
GLIPR2	152007	genome.wustl.edu	37	9	36162776	36162777	+	3'UTR	INS	-	-	T	rs74320217		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr9:36162776_36162777insT	ENST00000377960.4	+	0	756_757				GLIPR2_ENST00000396613.3_3'UTR|GLIPR2_ENST00000377959.1_3'UTR|GLIPR2_ENST00000474050.1_3'UTR	NM_022343.2	NP_071738.1	Q9H4G4	GAPR1_HUMAN	GLI pathogenesis-related 2						positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(3)	10						GGGGGGATCCGTTTTTTTTTTT	0.381																																																	0								ENSG00000122694																																			GLIPR2	SO:0001624	3_prime_UTR_variant	0				HGNC	AY039756	CCDS6598.1, CCDS69595.1, CCDS75832.1, CCDS75833.1	9p13.3	2008-08-15	2008-08-15	2008-08-15	ENSG00000122694	ENSG00000122694			18007	protein-coding gene	gene with protein product		607141	"""chromosome 9 open reading frame 19"""	C9orf19		12137952, 11865038	Standard	NM_022343		Approved	GAPR-1	uc003zyz.3	Q9H4G4	OTTHUMG00000019900	ENST00000377960.4:c.*258->T	9.37:g.36162787_36162787dupT		Somatic	0	19	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q5VZR1|Q8N2S6|Q8WWC9|Q8WX36	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377960.4	37	NULL	CCDS6598.1	9																																																																																			-	-		0.381	GLIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR2	protein_coding	OTTHUMT00000052414.1	-	NM_022343			36162777	+1	no_errors	ENST00000474050	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
ULK1	8408	genome.wustl.edu	37	12	132399938	132399938	+	Silent	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:132399938G>A	ENST00000321867.4	+	18	1932	c.1581G>A	c.(1579-1581)gaG>gaA	p.E527E	ULK1_ENST00000540647.1_5'Flank	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	527					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		AGGGAGCTGAGATGCGGGGTG	0.647																																																	0								ENSG00000177169						34.0	40.0	38.0					12																	132399938		2199	4299	6498	ULK1	SO:0001819	synonymous_variant	0			-	HGNC	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.1581G>A	12.37:g.132399938G>A		Somatic	0	105	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	147	828	15.06	Q9UQ28	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E527	ENST00000321867.4	37	c.1581	CCDS9274.1	12	.	.	.	.	.	.	.	.	.	.	G	8.586	0.883459	0.17467	.	.	ENSG00000177169	ENST00000538444	.	.	.	4.61	2.69	0.31865	.	.	.	.	.	T	0.37100	0.0991	.	.	.	0.24886	N	0.992194	.	.	.	.	.	.	T	0.37407	-0.9707	5	0.87932	D	0	-27.5352	3.386	0.07272	0.1862:0.0:0.5772:0.2366	.	.	.	.	K	42	.	ENSP00000439648:R42K	R	+	2	0	ULK1	130965891	0.189000	0.23263	0.584000	0.28653	0.045000	0.14185	0.392000	0.20801	0.872000	0.35775	0.462000	0.41574	AGA	-	pirsf_Ser/Thr_kin_STPK_Ulk-1/2		0.647	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK1	protein_coding	OTTHUMT00000397769.3	G		-		132399938	+1	no_errors	ENST00000321867	ensembl	human	known	74_37	silent	SNP	0.312	A
COBLL1	22837	genome.wustl.edu	37	2	165551295	165551296	+	Frame_Shift_Ins	INS	-	-	A	rs374805044		TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr2:165551295_165551296insA	ENST00000392717.2	-	13	2838_2839	c.2834_2835insT	c.(2833-2835)ttgfs	p.L945fs	COBLL1_ENST00000194871.6_Frame_Shift_Ins_p.L974fs|COBLL1_ENST00000342193.4_Frame_Shift_Ins_p.L907fs|COBLL1_ENST00000375458.2_Frame_Shift_Ins_p.L869fs|COBLL1_ENST00000409184.3_Frame_Shift_Ins_p.L907fs			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	945						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TCTGCATCTGCAAAAAAAAAGA	0.421																																																	0								ENSG00000082438																																			COBLL1	SO:0001589	frameshift_variant	0				HGNC	AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.2835dupT	2.37:g.165551304_165551304dupA	ENSP00000376478:p.Leu945fs	Somatic	0	24	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	43	12.24	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cordon-bleu_ubiquitin_domain,pfscan_WH2_dom	p.L974fs	ENST00000392717.2	37	c.2922_2921		2																																																																																			-	NULL		0.421	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	protein_coding		-	NM_014900			165551296	-1	no_errors	ENST00000194871	ensembl	human	known	74_37	frame_shift_ins	INS	0.958:0.972	A
PITPNM3	83394	genome.wustl.edu	37	17	6381307	6381307	+	Silent	SNP	G	G	A			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr17:6381307G>A	ENST00000262483.8	-	8	975	c.888C>T	c.(886-888)atC>atT	p.I296I	PITPNM3_ENST00000421306.3_Silent_p.I260I	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	296	Ser-rich.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GGGTGCTGCTGATGCTCCCCT	0.682																																																	0								ENSG00000091622						73.0	81.0	78.0					17																	6381307		2203	4300	6503	PITPNM3	SO:0001819	synonymous_variant	0			-	HGNC	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.888C>T	17.37:g.6381307G>A		Somatic	0	79	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	82	15.31	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD	p.I296	ENST00000262483.8	37	c.888	CCDS11076.1	17																																																																																			-	NULL		0.682	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNM3	protein_coding	OTTHUMT00000219824.2	G	NM_031220	-		6381307	-1	no_errors	ENST00000262483	ensembl	human	known	74_37	silent	SNP	1.000	A
EEA1	8411	genome.wustl.edu	37	12	93246699	93246699	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr12:93246699G>C	ENST00000322349.8	-	7	773	c.509C>G	c.(508-510)aCt>aGt	p.T170S		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	170					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						TGCAATTTCAGTAGCAAGTTG	0.303																																																	0								ENSG00000102189						128.0	141.0	137.0					12																	93246699		2203	4297	6500	EEA1	SO:0001583	missense	0			-	HGNC	L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.509C>G	12.37:g.93246699G>C	ENSP00000317955:p.Thr170Ser	Somatic	0	49	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	213	366	36.79	Q14221	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.T170S	ENST00000322349.8	37	c.509	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083556	0.76642	.	.	ENSG00000102189	ENST00000322349;ENST00000540777	T	0.67345	-0.26	4.8	4.8	0.61643	.	0.000000	0.51477	D	0.000087	T	0.71134	0.3304	L	0.34521	1.04	0.58432	D	0.999999	D	0.69078	0.997	D	0.70716	0.97	T	0.64984	-0.6278	10	0.09843	T	0.71	.	17.8704	0.88808	0.0:0.0:1.0:0.0	.	170	Q15075	EEA1_HUMAN	S	170;169	ENSP00000317955:T170S	ENSP00000317955:T170S	T	-	2	0	EEA1	91770830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.056000	0.93881	2.190000	0.69967	0.563000	0.77884	ACT	-	NULL		0.303	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	protein_coding	OTTHUMT00000407304.1	G	NM_003566	-		93246699	-1	no_errors	ENST00000322349	ensembl	human	known	74_37	missense	SNP	1.000	C
ABTB2	25841	genome.wustl.edu	37	11	34175853	34175853	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr11:34175853G>T	ENST00000435224.2	-	16	3263	c.2839C>A	c.(2839-2841)Ctc>Atc	p.L947I	ABTB2_ENST00000298992.2_Missense_Mutation_p.L761I	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	947					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TCCATGCTGAGGGTCTGGGAG	0.627																																																	0								ENSG00000166016						110.0	80.0	90.0					11																	34175853		2202	4298	6500	ABTB2	SO:0001583	missense	0			-	HGNC	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.2839C>A	11.37:g.34175853G>T	ENSP00000410157:p.Leu947Ile	Somatic	0	35	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.L947I	ENST00000435224.2	37	c.2839	CCDS7890.2	11	.	.	.	.	.	.	.	.	.	.	G	1.036	-0.680469	0.03353	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.57436	0.4;0.41	4.63	3.63	0.41609	BTB/POZ-like (1);BTB/POZ fold (1);	0.261873	0.32175	N	0.006473	T	0.14917	0.0360	N	0.00303	-1.675	0.35608	D	0.808406	B	0.02656	0.0	B	0.06405	0.002	T	0.34129	-0.9841	10	0.02654	T	1	-3.8017	10.1487	0.42780	0.0:0.0:0.3585:0.6415	.	761	Q8N961	ABTB2_HUMAN	I	947;761	ENSP00000410157:L947I;ENSP00000298992:L761I	ENSP00000298992:L761I	L	-	1	0	ABTB2	34132429	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	6.683000	0.74533	0.855000	0.35359	0.313000	0.20887	CTC	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like		0.627	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	protein_coding	OTTHUMT00000388703.3	G	NM_145804	-		34175853	-1	no_errors	ENST00000435224	ensembl	human	known	74_37	missense	SNP	1.000	T
FTMT	94033	genome.wustl.edu	37	5	121188023	121188023	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr5:121188023A>T	ENST00000321339.1	+	1	374	c.365A>T	c.(364-366)gAg>gTg	p.E122V		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	122	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TCCCGGGAGGAGACCGAGCAC	0.577																																																	0								ENSG00000181867						60.0	58.0	59.0					5																	121188023		2203	4300	6503	FTMT	SO:0001583	missense	0			-	HGNC	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.365A>T	5.37:g.121188023A>T	ENSP00000313691:p.Glu122Val	Somatic	0	74	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	63	12.50		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron	p.E122V	ENST00000321339.1	37	c.365	CCDS4128.1	5	.	.	.	.	.	.	.	.	.	.	A	21.3	4.129628	0.77549	.	.	ENSG00000181867	ENST00000321339	T	0.73152	-0.72	3.6	3.6	0.41247	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.000000	0.85682	D	0.000000	D	0.88654	0.6495	H	0.97896	4.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91069	0.4891	10	0.72032	D	0.01	.	10.8199	0.46599	1.0:0.0:0.0:0.0	.	122	Q8N4E7	FTMT_HUMAN	V	122	ENSP00000313691:E122V	ENSP00000313691:E122V	E	+	2	0	FTMT	121215922	1.000000	0.71417	0.786000	0.31890	0.958000	0.62258	8.508000	0.90525	1.868000	0.54150	0.533000	0.62120	GAG	-	pfam_Ferritin_DPS_dom,superfamily_Ferritin-like_SF,pfscan_Ferritin-like_diiron		0.577	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTMT	protein_coding	OTTHUMT00000250884.1	A	NM_177478	-		121188023	+1	no_errors	ENST00000321339	ensembl	human	known	74_37	missense	SNP	1.000	T
AFAP1L2	84632	genome.wustl.edu	37	10	116064626	116064626	+	Frame_Shift_Del	DEL	T	T	-			TCGA-3B-A9HO-01A-11D-A387-09	TCGA-3B-A9HO-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	90f9cecc-40c1-4294-b6d8-29c0874a1228	3d9eb4b8-91f4-43d2-aaea-3a72e603ca41	g.chr10:116064626delT	ENST00000304129.4	-	11	1165	c.1136delA	c.(1135-1137)cacfs	p.H379fs	AFAP1L2_ENST00000545353.1_Frame_Shift_Del_p.H432fs|AFAP1L2_ENST00000491814.1_5'Flank|AFAP1L2_ENST00000369271.3_Frame_Shift_Del_p.H379fs			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	379	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GAAGTGCAGGTGATTGTCCCT	0.637																																																	0								ENSG00000169129						77.0	69.0	72.0					10																	116064626		2202	4299	6501	AFAP1L2	SO:0001589	frameshift_variant	0				HGNC	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.1136delA	10.37:g.116064626delT	ENSP00000303042:p.His379fs	Somatic	0	66	0.00		0.5973408782764661	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.H432fs	ENST00000304129.4	37	c.1295	CCDS31286.1	10																																																																																			-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.637	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFAP1L2	protein_coding	OTTHUMT00000050462.1	T	NM_032550			116064626	-1	no_errors	ENST00000545353	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
