#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SCN1A	6323	genome.wustl.edu	37	2	166866229	166866229	+	Splice_Site	SNP	C	C	G			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr2:166866229C>G	ENST00000303395.4	-	20	4001	c.4002G>C	c.(4000-4002)agG>agC	p.R1334S	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Splice_Site_p.R1323S|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000423058.2_Splice_Site_p.R1334S|SCN1A_ENST00000409050.1_Splice_Site_p.R1306S			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1334					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTTTCTTACCCTCATCCCTT	0.363																																																	0								ENSG00000144285						69.0	70.0	70.0					2																	166866229		2203	4299	6502	SCN1A	SO:0001630	splice_region_variant	0			-	HGNC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4002+1G>C	2.37:g.166866229C>G		Somatic	0	53	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	52	27.78	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.R1334S	ENST00000303395.4	37	c.4002	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.975537	0.92919	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98777	-5.13;-5.13;-5.13;-5.13	5.46	5.46	0.80206	Ion transport (1);	0.074170	0.64402	D	0.000020	D	0.99429	0.9798	H	0.94808	3.585	0.80722	D	1	D;D;D	0.76494	0.983;0.999;0.999	P;D;D	0.85130	0.79;0.997;0.988	D	0.98574	1.0647	9	.	.	.	.	19.3188	0.94229	0.0:1.0:0.0:0.0	.	1323;1306;1334	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	S	1334;1334;1323;1306	ENSP00000407030:R1334S;ENSP00000303540:R1334S;ENSP00000364554:R1323S;ENSP00000386312:R1306S	.	R	-	3	2	SCN1A	166574475	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.621000	0.83083	2.569000	0.86673	0.650000	0.86243	AGG	-	pfam_Ion_trans_dom		0.363	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	C	NM_006920	-	Missense_Mutation	166866229	-1	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	SNP	1.000	G
KIAA1147	57189	genome.wustl.edu	37	7	141385377	141385377	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr7:141385377C>G	ENST00000536163.1	-	3	427	c.428G>C	c.(427-429)aGc>aCc	p.S143T	KIAA1147_ENST00000482493.1_Missense_Mutation_p.S52T	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	143										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					TTCCAGCTCGCTCTCCACGGG	0.557																																																	0								ENSG00000257093						95.0	99.0	98.0					7																	141385377		2095	4208	6303	KIAA1147	SO:0001583	missense	0			-	HGNC	AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.428G>C	7.37:g.141385377C>G	ENSP00000445768:p.Ser143Thr	Somatic	0	37	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	17	45.16	Q9ULS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2347	p.S143T	ENST00000536163.1	37	c.428	CCDS47726.1	7	.	.	.	.	.	.	.	.	.	.	C	22.7	4.326232	0.81580	.	.	ENSG00000257093	ENST00000536163;ENST00000482493	.	.	.	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.67822	0.2934	M	0.73598	2.24	0.58432	D	0.999999	P	0.43578	0.811	B	0.44315	0.446	T	0.72388	-0.4309	9	0.45353	T	0.12	-26.4451	17.3898	0.87427	0.0:1.0:0.0:0.0	.	143	A4D1U4	LCHN_HUMAN	T	143;52	.	ENSP00000297761:S143T	S	-	2	0	KIAA1147	141031846	1.000000	0.71417	0.979000	0.43373	0.901000	0.52897	6.610000	0.74178	2.329000	0.79093	0.591000	0.81541	AGC	-	pfam_DUF2347		0.557	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1147	protein_coding	OTTHUMT00000349104.1	C		-		141385377	-1	no_errors	ENST00000536163	ensembl	human	known	74_37	missense	SNP	1.000	G
SLC8A3	6547	genome.wustl.edu	37	14	70634566	70634566	+	Missense_Mutation	SNP	C	C	T	rs374224410		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr14:70634566C>T	ENST00000381269.2	-	2	1327	c.574G>A	c.(574-576)Gga>Aga	p.G192R	SLC8A3_ENST00000534137.1_Missense_Mutation_p.G192R|SLC8A3_ENST00000357887.3_Missense_Mutation_p.G192R|SLC8A3_ENST00000356921.2_Missense_Mutation_p.G192R|SLC8A3_ENST00000528359.1_Missense_Mutation_p.G192R	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	192					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CGAGTCTCTCCGTCTGGGATC	0.483																																																	0								ENSG00000100678	C	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	87.0	77.0	80.0		574,574,574,574	5.6	1.0	14		80	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SLC8A3	NM_033262.3,NM_058240.2,NM_182932.1,NM_183002.1	125,125,125,125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	192/926,192/925,192/922,192/928	70634566	1,13005	2203	4300	6503	SLC8A3	SO:0001583	missense	0			-	HGNC	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.574G>A	14.37:g.70634566C>T	ENSP00000370669:p.Gly192Arg	Somatic	0	14	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	12	47.83	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.G192R	ENST00000381269.2	37	c.574	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245944	0.59103	0.0	1.16E-4	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.59	5.59	0.84812	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.83464	0.5260	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86179	0.1605	10	0.87932	D	0	.	19.5866	0.95492	0.0:1.0:0.0:0.0	.	192;192;192;192	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	R	192	ENSP00000349392:G192R;ENSP00000370669:G192R;ENSP00000350560:G192R;ENSP00000436688:G192R;ENSP00000433531:G192R	ENSP00000349392:G192R	G	-	1	0	SLC8A3	69704319	1.000000	0.71417	0.976000	0.42696	0.642000	0.38348	7.811000	0.86092	2.620000	0.88729	0.555000	0.69702	GGA	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex		0.483	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	C		-		70634566	-1	no_errors	ENST00000381269	ensembl	human	known	74_37	missense	SNP	1.000	T
HRCT1	646962	genome.wustl.edu	37	9	35906348	35906350	+	In_Frame_Del	DEL	CTG	CTG	-	rs370606246		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr9:35906348_35906350delCTG	ENST00000354323.2	+	1	160_162	c.64_66delCTG	c.(64-66)ctgdel	p.L28del		NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	28						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						TGTGGCGGTCctgctgctgctgc	0.67																																																	0								ENSG00000196196			367,3839		38,291,1774						-8.3	0.0			23	737,7385		88,561,3412	no	coding	HRCT1	NM_001039792.1		126,852,5186	A1A1,A1R,RR		9.0741,8.7256,8.9552				1104,11224				HRCT1	SO:0001651	inframe_deletion	0				HGNC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.64_66delCTG	9.37:g.35906357_35906359delCTG	ENSP00000346283:p.Leu28del	Somatic	0	45	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	B7ZBJ1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.L25in_frame_del	ENST00000354323.2	37	c.64_66	CCDS35012.1	9																																																																																			-	NULL		0.670	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	protein_coding	OTTHUMT00000334099.1	CTG	NM_001039792			35906350	+1	no_errors	ENST00000354323	ensembl	human	known	74_37	in_frame_del	DEL	0.168:0.493:0.516	-
KCNA1	3736	genome.wustl.edu	37	12	5021427	5021427	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr12:5021427C>G	ENST00000382545.3	+	2	1990	c.883C>G	c.(883-885)Cgc>Ggc	p.R295G	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	295					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.R295C(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CAGGGTCATCCGCTTGGTAAG	0.552																																																	1	Substitution - Missense(1)	stomach(1)						ENSG00000111262						61.0	65.0	64.0					12																	5021427		2203	4300	6503	KCNA1	SO:0001583	missense	0			-	HGNC	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.883C>G	12.37:g.5021427C>G	ENSP00000371985:p.Arg295Gly	Somatic	0	11	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00	A6NM83|Q3MIQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.R295G	ENST00000382545.3	37	c.883	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545100	0.45280	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.99226	-5.59	5.08	3.21	0.36854	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99612	0.9859	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98076	1.0401	10	0.87932	D	0	.	12.5675	0.56318	0.5722:0.4278:0.0:0.0	.	295	Q09470	KCNA1_HUMAN	G	295	ENSP00000371985:R295G	ENSP00000228858:R295G	R	+	1	0	KCNA1	4891688	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	2.404000	0.44539	0.805000	0.34159	0.655000	0.94253	CGC	-	pfam_Ion_trans_dom		0.552	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	protein_coding	OTTHUMT00000103343.2	C	NM_000217	-		5021427	+1	no_errors	ENST00000382545	ensembl	human	known	74_37	missense	SNP	1.000	G
EXD2	55218	genome.wustl.edu	37	14	69708329	69708329	+	3'UTR	SNP	C	C	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr14:69708329C>A	ENST00000409018.3	+	0	2506				EXD2_ENST00000409014.1_3'UTR|RP11-363J20.2_ENST00000556316.1_lincRNA|EXD2_ENST00000409675.1_3'UTR|EXD2_ENST00000449989.1_3'UTR|EXD2_ENST00000492815.1_3'UTR	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2								3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						TCTTTGGCTTCATGCTCTCCC	0.423																																																	0								ENSG00000081177																																			EXD2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.*512C>A	14.37:g.69708329C>A		Somatic	0	23	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	B4DIH6|G5E947|Q6AWB6|Q8N3D3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409018.3	37	NULL	CCDS53902.1	14																																																																																			-	-		0.423	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	protein_coding	OTTHUMT00000335504.1	C		-		69708329	+1	no_errors	ENST00000492815	ensembl	human	known	74_37	rna	SNP	0.000	A
NOC2L	26155	genome.wustl.edu	37	1	892517	892517	+	Nonsense_Mutation	SNP	C	C	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:892517C>A	ENST00000327044.6	-	3	365	c.316G>T	c.(316-318)Gaa>Taa	p.E106*	NOC2L_ENST00000487214.1_5'UTR	NM_015658.3	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog (S. cerevisiae)	106	Poly-Glu.				apoptotic process (GO:0006915)|cellular response to UV (GO:0034644)|chromatin assembly (GO:0031497)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of histone acetylation (GO:0035067)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleolus to nucleoplasm transport (GO:0032066)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosome binding (GO:0031491)|poly(A) RNA binding (GO:0044822)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	16	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		GGCCCCTCTTCCTCCTCAGAG	0.592																																																	0								ENSG00000188976						107.0	113.0	111.0					1																	892517		2203	4300	6503	NOC2L	SO:0001587	stop_gained	0			-	HGNC	AL050019	CCDS3.1	1p36.33	2014-06-12			ENSG00000188976	ENSG00000188976			24517	protein-coding gene	gene with protein product	"""novel INHAT repressor"", ""protein phosphatase 1, regulatory subunit 12"""	610770					Standard	NM_015658		Approved	DKFZP564C186, NET7, NET15, NIR, PPP1R112	uc001abz.4	Q9Y3T9	OTTHUMG00000040720	ENST00000327044.6:c.316G>T	1.37:g.892517C>A	ENSP00000317992:p.Glu106*	Somatic	0	47	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q5SVA3|Q9BTN6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Noc2,superfamily_ARM-type_fold	p.E106*	ENST00000327044.6	37	c.316	CCDS3.1	1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589371	0.46214	.	.	ENSG00000188976	ENST00000327044	.	.	.	3.66	3.66	0.41972	.	0.190156	0.44483	D	0.000457	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	11.0413	0.47833	0.0:1.0:0.0:0.0	.	.	.	.	X	106	.	ENSP00000317992:E106X	E	-	1	0	NOC2L	882380	1.000000	0.71417	0.004000	0.12327	0.005000	0.04900	7.225000	0.78051	2.040000	0.60383	0.558000	0.71614	GAA	-	NULL		0.592	NOC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC2L	protein_coding	OTTHUMT00000097869.1	C	NM_015658	-		892517	-1	no_errors	ENST00000327044	ensembl	human	known	74_37	nonsense	SNP	0.085	A
MCM9	254394	genome.wustl.edu	37	6	119137129	119137129	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr6:119137129G>T	ENST00000316316.6	-	13	2576	c.2290C>A	c.(2290-2292)Cat>Aat	p.H764N		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	764					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GTTTTGGGATGAGGAGACACA	0.423																																																	0								ENSG00000111877																																			MCM9	SO:0001583	missense	0			-	HGNC	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.2290C>A	6.37:g.119137129G>T	ENSP00000314505:p.His764Asn	Somatic	0	29	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.36	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,prints_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	p.H764N	ENST00000316316.6	37	c.2290	CCDS56447.1	6	.	.	.	.	.	.	.	.	.	.	G	0.276	-0.989786	0.02162	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	T	0.29655	1.56	5.4	-1.88	0.07713	.	0.716340	0.14139	N	0.338831	T	0.03348	0.0097	N	0.11427	0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39981	-0.9587	10	0.26408	T	0.33	.	1.8574	0.03181	0.1132:0.3478:0.2182:0.3208	.	764	Q9NXL9	MCM9_HUMAN	N	764;383	ENSP00000314505:H764N	ENSP00000243218:H383N	H	-	1	0	MCM9	119243832	0.000000	0.05858	0.015000	0.15790	0.048000	0.14542	-2.122000	0.01321	-0.485000	0.06754	-0.165000	0.13383	CAT	-	NULL		0.423	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	protein_coding	OTTHUMT00000042005.4	G	NM_153255	-		119137129	-1	no_errors	ENST00000316316	ensembl	human	known	74_37	missense	SNP	0.001	T
RP11-945A11.1	0	genome.wustl.edu	37	11	23752351	23752351	+	lincRNA	SNP	A	A	G			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr11:23752351A>G	ENST00000534068.1	+	0	218																											CGAGGAAACGAGGGCCCGGCG	0.627																																																	0								ENSG00000255193																																			RP11-945A11.1			0			-	Clone_based_vega_gene																													11.37:g.23752351A>G		Somatic	0	26	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534068.1	37	NULL		11																																																																																			-	-		0.627	RP11-945A11.1-001	KNOWN	basic	lincRNA	ENSG00000255193	lincRNA	OTTHUMT00000387785.1	A		-		23752351	+1	no_errors	ENST00000534068	ensembl	human	known	74_37	rna	SNP	0.000	G
TMEM255B	348013	genome.wustl.edu	37	13	114514919	114514919	+	IGR	SNP	A	A	T	rs199809562	byFrequency	TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr13:114514919A>T	ENST00000375353.3	+	0	1031				TMEM255B_ENST00000467169.1_3'UTR	NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B							integral component of membrane (GO:0016021)											TTTTTTTTTTAAAAAAAAGGC	0.522													A|||	19	0.00379393	0.0076	0.0014	5008	,	,		13834	0.004		0.001	False		,,,				2504	0.0031																0								ENSG00000184497						24.0	34.0	31.0					13																	114514919		1998	4130	6128	TMEM255B	SO:0001628	intergenic_variant	0			-	HGNC	BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398		13.37:g.114514919A>T		Somatic	0	62	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375353.3	37	NULL	CCDS45071.1	13																																																																																			-	-		0.522	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM255B	protein_coding	OTTHUMT00000045953.4	A	NM_182614	rs199809562		114514919	+1	no_errors	ENST00000467169	ensembl	human	known	74_37	rna	SNP	0.001	T
ATP10A	57194	genome.wustl.edu	37	15	25924869	25924869	+	Silent	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr15:25924869C>T	ENST00000356865.6	-	21	4230	c.4119G>A	c.(4117-4119)gtG>gtA	p.V1373V		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1373					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TGCTCATGTCCACTGTGCTGG	0.672																																																	0								ENSG00000206190						51.0	49.0	50.0					15																	25924869		2203	4300	6503	ATP10A	SO:0001819	synonymous_variant	0			-	HGNC	AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.4119G>A	15.37:g.25924869C>T		Somatic	0	32	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	Q4G0S9|Q969I4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V1373	ENST00000356865.6	37	c.4119	CCDS32178.1	15																																																																																			-	NULL		0.672	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	protein_coding	OTTHUMT00000414830.1	C	NM_024490	-		25924869	-1	no_errors	ENST00000356865	ensembl	human	known	74_37	silent	SNP	0.003	T
GON4L	54856	genome.wustl.edu	37	1	155785777	155785777	+	Intron	DEL	A	A	-			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:155785777delA	ENST00000368331.1	-	8	1114				GON4L_ENST00000361040.5_Intron|GON4L_ENST00000437809.1_Intron|GON4L_ENST00000271883.5_Intron|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGCAGGGCAGAAAAAAAAAAA	0.348																																																	0								ENSG00000116580																																			GON4L	SO:0001627	intron_variant	0				HGNC	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1066-86T>-	1.37:g.155785777delA		Somatic	0	19	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368331.1	37	NULL		1																																																																																			-	-		0.348	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	protein_coding		A	NM_032292			155785777	-1	no_errors	ENST00000471341	ensembl	human	known	74_37	rna	DEL	0.000	-
LAMP3	27074	genome.wustl.edu	37	3	182841970	182841970	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr3:182841970G>T	ENST00000265598.3	-	6	1405	c.1150C>A	c.(1150-1152)Ctt>Att	p.L384I	LAMP3_ENST00000466939.1_Missense_Mutation_p.L360I	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	384					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			ATCACAGGAAGCACAATTGTG	0.458																																																	0								ENSG00000078081						133.0	121.0	125.0					3																	182841970		2203	4300	6503	LAMP3	SO:0001583	missense	0			-	HGNC	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.1150C>A	3.37:g.182841970G>T	ENSP00000265598:p.Leu384Ile	Somatic	0	49	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	D3DNS4|O94781|Q8NEC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.L384I	ENST00000265598.3	37	c.1150	CCDS3242.1	3	.	.	.	.	.	.	.	.	.	.	G	11.69	1.714061	0.30413	.	.	ENSG00000078081	ENST00000265598;ENST00000466939	T;T	0.27256	1.68;1.68	6.06	5.11	0.69529	.	0.130592	0.34067	N	0.004281	T	0.13841	0.0335	N	0.16037	0.36	0.33720	D	0.616859	B	0.10296	0.003	B	0.17722	0.019	T	0.16897	-1.0387	10	0.11794	T	0.64	-12.1799	10.8581	0.46810	0.0:0.0:0.7701:0.2299	.	384	Q9UQV4	LAMP3_HUMAN	I	384;360	ENSP00000265598:L384I;ENSP00000418912:L360I	ENSP00000265598:L384I	L	-	1	0	LAMP3	184324664	0.956000	0.32656	0.999000	0.59377	0.988000	0.76386	0.844000	0.27654	2.882000	0.98803	0.655000	0.94253	CTT	-	pfam_Lysosome-assoc_membr_glycop		0.458	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP3	protein_coding	OTTHUMT00000350863.1	G		-		182841970	-1	no_errors	ENST00000265598	ensembl	human	known	74_37	missense	SNP	0.997	T
SYNGR4	23546	genome.wustl.edu	37	19	48879439	48879439	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr19:48879439T>C	ENST00000344846.2	+	5	819	c.569T>C	c.(568-570)cTc>cCc	p.L190P	SYNGR4_ENST00000595322.1_3'UTR|SYNGR4_ENST00000601610.1_3'UTR	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	190						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		CTGACCACCCTCCCCTTGCCC	0.597																																																	0								ENSG00000105467						168.0	132.0	144.0					19																	48879439		2203	4300	6503	SYNGR4	SO:0001583	missense	0			-	HGNC	AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.569T>C	19.37:g.48879439T>C	ENSP00000344041:p.Leu190Pro	Somatic	0	33	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	59	9.23	Q3KP58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Marvel,pirsf_Synaptogyrin	p.L190P	ENST00000344846.2	37	c.569	CCDS12717.1	19	.	.	.	.	.	.	.	.	.	.	T	14.66	2.602617	0.46423	.	.	ENSG00000105467	ENST00000344846	T	0.47869	0.83	5.51	5.51	0.81932	.	0.235203	0.41294	D	0.000903	T	0.56455	0.1986	L	0.32530	0.975	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	T	0.53251	-0.8465	10	0.33141	T	0.24	-24.4512	13.4458	0.61140	0.0:0.0:0.0:1.0	.	190	O95473	SNG4_HUMAN	P	190	ENSP00000344041:L190P	ENSP00000344041:L190P	L	+	2	0	SYNGR4	53571251	0.998000	0.40836	1.000000	0.80357	0.108000	0.19459	4.226000	0.58606	2.231000	0.72958	0.454000	0.30748	CTC	-	pirsf_Synaptogyrin		0.597	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR4	protein_coding	OTTHUMT00000465704.1	T		-		48879439	+1	no_errors	ENST00000344846	ensembl	human	known	74_37	missense	SNP	1.000	C
TJP2	9414	genome.wustl.edu	37	9	71867755	71867755	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr9:71867755G>A	ENST00000377245.4	+	22	3554	c.3346G>A	c.(3346-3348)Gat>Aat	p.D1116N	TJP2_ENST00000535702.1_Missense_Mutation_p.D1083N|TJP2_ENST00000348208.4_Missense_Mutation_p.D969N|TJP2_ENST00000539225.1_Missense_Mutation_p.D1147N|TJP2_ENST00000453658.2_Missense_Mutation_p.D946N	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	1116					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GAAGCATCCTGATATCTATGC	0.498																																																	0								ENSG00000119139						64.0	58.0	60.0					9																	71867755		2203	4300	6503	TJP2	SO:0001583	missense	0			-	HGNC	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.3346G>A	9.37:g.71867755G>A	ENSP00000366453:p.Asp1116Asn	Somatic	0	67	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	80	11.11	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS2,prints_ZonOcculdens	p.D1147N	ENST00000377245.4	37	c.3439	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694815	0.48202	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000535702;ENST00000539225	T;T;T;T;T	0.10382	2.91;2.89;2.91;2.88;2.94	5.16	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.27384	0.0672	M	0.61703	1.905	0.22199	N	0.999293	P;D;P;D;B	0.55800	0.825;0.973;0.804;0.964;0.232	B;P;B;D;B	0.66084	0.367;0.736;0.43;0.941;0.077	T	0.04065	-1.0980	10	0.41790	T	0.15	.	13.4378	0.61094	0.0752:0.0:0.9248:0.0	.	1147;1083;946;969;1116	F5H301;F5H886;B7Z2R3;Q9UDY2-2;Q9UDY2	.;.;.;.;ZO2_HUMAN	N	946;1116;969;1083;1147	ENSP00000392178:D946N;ENSP00000366453:D1116N;ENSP00000345893:D969N;ENSP00000442090:D1083N;ENSP00000438262:D1147N	ENSP00000345893:D969N	D	+	1	0	TJP2	71057575	1.000000	0.71417	0.971000	0.41717	0.369000	0.29798	7.350000	0.79385	1.164000	0.42652	0.555000	0.69702	GAT	-	NULL		0.498	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	protein_coding	OTTHUMT00000052572.2	G	NM_201629	-		71867755	+1	no_errors	ENST00000539225	ensembl	human	known	74_37	missense	SNP	0.997	A
RB1	5925	genome.wustl.edu	37	13	48947563	48947563	+	Nonsense_Mutation	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr13:48947563C>T	ENST00000267163.4	+	12	1288	c.1150C>T	c.(1150-1152)Caa>Taa	p.Q384*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	384	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CACTATCCAACAATTAATGAT	0.289		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	GRCh37	CM942037	RB1	M		ENSG00000139687						104.0	112.0	109.0					13																	48947563		2202	4288	6490	RB1	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1150C>T	13.37:g.48947563C>T	ENSP00000267163:p.Gln384*	Somatic	0	25	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	17	54.05	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.Q384*	ENST00000267163.4	37	c.1150	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	38	6.853907	0.97889	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.54	5.54	0.83059	.	0.237466	0.44097	D	0.000496	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	19.4822	0.95014	0.0:1.0:0.0:0.0	.	.	.	.	X	363;384	.	ENSP00000267163:Q384X	Q	+	1	0	RB1	47845564	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	5.779000	0.68948	2.612000	0.88384	0.563000	0.77884	CAA	-	pfam_RB_A,superfamily_Cyclin-like		0.289	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C		-		48947563	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	SNP	1.000	T
KRT14	3861	genome.wustl.edu	37	17	39739670	39739670	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr17:39739670delC	ENST00000167586.6	-	6	1177	c.1091delG	c.(1090-1092)ggtfs	p.G364fs		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	364	Coil 2.|Rod.	Stutter.			aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				GCAGTAGCGACCTTTGGTCTC	0.592																																																	0								ENSG00000186847						47.0	48.0	47.0					17																	39739670		2203	4300	6503	KRT14	SO:0001589	frameshift_variant	0				HGNC	BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.1091delG	17.37:g.39739670delC	ENSP00000167586:p.Gly364fs	Somatic	0	75	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	83	13.54	Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.G364fs	ENST00000167586.6	37	c.1091	CCDS11400.1	17																																																																																			-	pfam_IF		0.592	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT14	protein_coding	OTTHUMT00000257289.1	C	NM_000526			39739670	-1	no_errors	ENST00000167586	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
LCE2C	353140	genome.wustl.edu	37	1	152648741	152648741	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:152648741C>T	ENST00000368783.1	+	2	305	c.250C>T	c.(250-252)Cgc>Tgc	p.R84C	LCE2B_ENST00000417924.2_Intron	NM_178429.2	NP_848516.1	Q5TA81	LCE2C_HUMAN	late cornified envelope 2C	84	Cys-rich.				keratinization (GO:0031424)					endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	13	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTCCACCGGCGCCGGCACCA	0.682																																																	0								ENSG00000187180						35.0	44.0	41.0					1																	152648741		2201	4297	6498	LCE2C	SO:0001583	missense	0			-	HGNC		CCDS1019.1	1q21.3	2008-02-05			ENSG00000187180	ENSG00000187180		"""Late cornified envelopes"""	29460	protein-coding gene	gene with protein product		612611				11698679	Standard	NM_178429		Approved	LEP11	uc001fah.4	Q5TA81	OTTHUMG00000012389	ENST00000368783.1:c.250C>T	1.37:g.152648741C>T	ENSP00000357772:p.Arg84Cys	Somatic	0	114	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	115	26.28		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R84C	ENST00000368783.1	37	c.250	CCDS1019.1	1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.602896	0.28534	.	.	ENSG00000187180	ENST00000368783	T	0.03745	3.82	3.15	-0.182	0.13287	.	.	.	.	.	T	0.00666	0.0022	N	0.11131	0.1	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.47623	-0.9103	9	0.87932	D	0	.	3.3006	0.06982	0.0:0.5059:0.219:0.2751	.	84	Q5TA81	LCE2C_HUMAN	C	84	ENSP00000357772:R84C	ENSP00000357772:R84C	R	+	1	0	LCE2C	150915365	0.000000	0.05858	0.000000	0.03702	0.818000	0.46254	-0.668000	0.05268	-0.145000	0.11294	0.563000	0.77884	CGC	-	NULL		0.682	LCE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2C	protein_coding	OTTHUMT00000034509.1	C	NM_178429	-		152648741	+1	no_errors	ENST00000368783	ensembl	human	known	74_37	missense	SNP	0.000	T
SLC4A9	83697	genome.wustl.edu	37	5	139741642	139741642	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr5:139741642A>C	ENST00000230993.6	+	5	709	c.674A>C	c.(673-675)gAg>gCg	p.E225A	SLC4A9_ENST00000432095.2_Missense_Mutation_p.E201A|SLC4A9_ENST00000507527.1_Missense_Mutation_p.E225A|SLC4A9_ENST00000506757.2_Missense_Mutation_p.E201A|SLC4A9_ENST00000506545.1_Missense_Mutation_p.E201A	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	225					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGGAGCTGAGGCAGGGACT	0.567																																																	0								ENSG00000113073						31.0	33.0	32.0					5																	139741642		1935	4126	6061	SLC4A9	SO:0001583	missense	0			-	HGNC	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.674A>C	5.37:g.139741642A>C	ENSP00000230993:p.Glu225Ala	Somatic	0	47	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.E225A	ENST00000230993.6	37	c.674	CCDS58973.1	5	.	.	.	.	.	.	.	.	.	.	A	26.1	4.706278	0.89018	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	4.9	4.9	0.64082	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.64402	D	0.000002	D	0.92577	0.7642	M	0.91249	3.19	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.997;0.997	D	0.94200	0.7449	10	0.87932	D	0	.	14.6822	0.69026	1.0:0.0:0.0:0.0	.	201;225;201;201	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	A	225;201;201;201;225	ENSP00000230993:E225A;ENSP00000424424:E201A;ENSP00000410056:E201A;ENSP00000422855:E201A;ENSP00000427661:E225A	ENSP00000230993:E225A	E	+	2	0	SLC4A9	139721826	1.000000	0.71417	0.994000	0.49952	0.940000	0.58332	8.827000	0.92041	2.063000	0.61619	0.533000	0.62120	GAG	-	pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,tigrfam_HCO3_transpt_euk		0.567	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	SLC4A9	protein_coding	OTTHUMT00000372823.1	A	NM_031467	-		139741642	+1	no_errors	ENST00000230993	ensembl	human	known	74_37	missense	SNP	1.000	C
GATB	5188	genome.wustl.edu	37	4	152600965	152600965	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr4:152600965C>T	ENST00000515812.1	-	10	1303	c.1287G>A	c.(1285-1287)caG>caA	p.Q429Q	RP11-164P12.3_ENST00000514269.1_RNA|PET112_ENST00000507592.1_5'UTR|PET112_ENST00000263985.6_Splice_Site_p.Q470Q																breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						GTGGACATACCTGTTTAGCTG	0.493																																																	0								ENSG00000059691						205.0	200.0	202.0					4																	152600965		2203	4300	6503	PET112	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000515812.1:c.1287+1G>A	4.37:g.152600965C>T		Somatic	0	36	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Asn/Gln-tRNA_Trfase_suB/E_cat,pfam_Asn/Gln_amidotransferase,superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Asn/Gln_amidotransferase,tigrfam_Apn/Gln-ADT_bsu	p.Q470	ENST00000515812.1	37	c.1410		4																																																																																			-	pfam_Asn/Gln_amidotransferase,superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Asn/Gln_amidotransferase,tigrfam_Apn/Gln-ADT_bsu		0.493	PET112-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	PET112	protein_coding	OTTHUMT00000365672.1	C		-	Silent	152600965	-1	no_errors	ENST00000263985	ensembl	human	known	74_37	silent	SNP	1.000	T
CCDC116	164592	genome.wustl.edu	37	22	21989038	21989038	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr22:21989038C>A	ENST00000292779.3	+	4	847	c.686C>A	c.(685-687)aCc>aAc	p.T229N	CCDC116_ENST00000607942.1_Missense_Mutation_p.T229N	NM_152612.2	NP_689825.2	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	229										endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(5)	22	Colorectal(54;0.105)					GGTAGCCAGACCAGCTTTCAG	0.592																																																	0								ENSG00000161180						124.0	130.0	128.0					22																	21989038		2203	4300	6503	CCDC116	SO:0001583	missense	0			-	HGNC	BC033499	CCDS13791.1	22q11.21	2006-06-27			ENSG00000161180	ENSG00000161180			26688	protein-coding gene	gene with protein product						12477932	Standard	NM_152612		Approved	FLJ36046	uc002zve.3	Q8IYX3	OTTHUMG00000150821	ENST00000292779.3:c.686C>A	22.37:g.21989038C>A	ENSP00000292779:p.Thr229Asn	Somatic	0	27	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	Q8N9Y9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T229N	ENST00000292779.3	37	c.686	CCDS13791.1	22	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557190	0.27827	.	.	ENSG00000161180	ENST00000292779	T	0.12672	2.66	4.42	0.887	0.19200	.	1.149140	0.06388	N	0.716474	T	0.19005	0.0456	L	0.29908	0.895	0.09310	N	1	P;D	0.57571	0.782;0.98	B;P	0.51806	0.428;0.68	T	0.44436	-0.9328	10	0.66056	D	0.02	-32.0671	12.2863	0.54793	0.0:0.4937:0.5063:0.0	.	229;229	B7Z7H5;Q8IYX3-2	.;.	N	229	ENSP00000292779:T229N	ENSP00000292779:T229N	T	+	2	0	CCDC116	20319038	0.007000	0.16637	0.158000	0.22627	0.136000	0.21042	0.732000	0.26072	0.181000	0.19994	0.485000	0.47835	ACC	-	NULL		0.592	CCDC116-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC116	protein_coding	OTTHUMT00000320199.1	C	NM_152612	-		21989038	+1	no_errors	ENST00000292779	ensembl	human	known	74_37	missense	SNP	0.054	A
MYO5C	55930	genome.wustl.edu	37	15	52571854	52571854	+	Silent	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr15:52571854G>T	ENST00000261839.7	-	3	317	c.156C>A	c.(154-156)gtC>gtA	p.V52V	MIR1266_ENST00000408125.1_RNA|MYO5C_ENST00000443683.2_5'UTR|MYO5C_ENST00000541028.1_5'UTR	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	52						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		ATTCTGGATTGACAGAATAAT	0.463																																																	0								ENSG00000128833						40.0	40.0	40.0					15																	52571854		1849	4104	5953	MYO5C	SO:0001819	synonymous_variant	0			-	HGNC	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.156C>A	15.37:g.52571854G>T		Somatic	0	28	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q6P1W8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V52	ENST00000261839.7	37	c.156	CCDS42036.1	15																																																																																			-	superfamily_P-loop_NTPase		0.463	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	protein_coding	OTTHUMT00000419562.1	G	NM_018728	-		52571854	-1	no_errors	ENST00000261839	ensembl	human	known	74_37	silent	SNP	0.001	T
CNNM2	54805	genome.wustl.edu	37	10	104679747	104679747	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr10:104679747G>A	ENST00000369878.4	+	1	1698	c.1510G>A	c.(1510-1512)Gat>Aat	p.D504N	CNNM2_ENST00000369875.3_Missense_Mutation_p.D504N|CNNM2_ENST00000433628.2_Missense_Mutation_p.D504N	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	504	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GGCCTTCGTGGATCCCGATGA	0.498																																																	0								ENSG00000148842						125.0	128.0	127.0					10																	104679747		2203	4300	6503	CNNM2	SO:0001583	missense	0			-	HGNC	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1510G>A	10.37:g.104679747G>A	ENSP00000358894:p.Asp504Asn	Somatic	0	77	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	22	55.10	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF21,superfamily_cNMP-bd-like	p.D504N	ENST00000369878.4	37	c.1510	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	19.27	3.796183	0.70567	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	T;T;T	0.76316	-1.01;-1.01;-1.01	5.09	5.09	0.68999	Cystathionine beta-synthase, core (1);	0.091360	0.64402	D	0.000001	D	0.87657	0.6232	M	0.70275	2.135	0.80722	D	1	B;B;D	0.89917	0.224;0.143;1.0	B;B;D	0.91635	0.348;0.189;0.999	D	0.88139	0.2843	10	0.52906	T	0.07	.	18.475	0.90790	0.0:0.0:1.0:0.0	.	504;504;504	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	N	504	ENSP00000392875:D504N;ENSP00000358891:D504N;ENSP00000358894:D504N	ENSP00000286899:D504N	D	+	1	0	CNNM2	104669737	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.852000	0.99516	2.343000	0.79666	0.561000	0.74099	GAT	-	NULL		0.498	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	protein_coding	OTTHUMT00000050113.3	G	NM_017649	-		104679747	+1	no_errors	ENST00000369878	ensembl	human	known	74_37	missense	SNP	1.000	A
RYR1	6261	genome.wustl.edu	37	19	38951109	38951109	+	Nonsense_Mutation	SNP	C	C	T	rs193922774		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr19:38951109C>T	ENST00000359596.3	+	20	2455	c.2455C>T	c.(2455-2457)Cga>Tga	p.R819*	RYR1_ENST00000360985.3_Nonsense_Mutation_p.R819*|RYR1_ENST00000355481.4_Nonsense_Mutation_p.R819*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	819					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCCTCGAGAGCGACTCCATCT	0.642																																																	0			GRCh37	CM081776	RYR1	M		ENSG00000196218						111.0	107.0	108.0					19																	38951109		2203	4300	6503	RYR1	SO:0001587	stop_gained	0			-	HGNC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2455C>T	19.37:g.38951109C>T	ENSP00000352608:p.Arg819*	Somatic	0	42	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	28	40.43	Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R819*	ENST00000359596.3	37	c.2455	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	c	42	9.195647	0.99096	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	4.13	3.05	0.35203	.	0.000000	0.64402	U	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	10.5357	0.45002	0.527:0.473:0.0:0.0	.	.	.	.	X	819	.	ENSP00000347667:R819X	R	+	1	2	RYR1	43642949	0.944000	0.32072	0.995000	0.50966	0.979000	0.70002	0.567000	0.23608	1.042000	0.40150	0.299000	0.19835	CGA	-	NULL		0.642	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	C		rs193922774		38951109	+1	no_errors	ENST00000359596	ensembl	human	known	74_37	nonsense	SNP	0.985	T
CEBPZ	10153	genome.wustl.edu	37	2	37426890	37426890	+	IGR	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr2:37426890G>A	ENST00000234170.5	-	0	3463				AC007390.5_ENST00000397064.2_Missense_Mutation_p.G15R|AC007390.5_ENST00000406711.1_Missense_Mutation_p.G15R|AC007390.5_ENST00000397226.2_Missense_Mutation_p.G15R|AC007390.5_ENST00000392061.2_Missense_Mutation_p.G15R|AC007390.5_ENST00000402297.1_Missense_Mutation_p.G15R	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				GATCTTTAAAGGAGTTTTGGT	0.348																																																	0								ENSG00000218739																																			AC007390.5	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960		2.37:g.37426890G>A		Somatic	0	66	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	45	37.50	Q8NE75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G15R	ENST00000234170.5	37	c.43	CCDS1787.1	2	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587741	0.46110	.	.	ENSG00000218739	ENST00000402297;ENST00000397064;ENST00000406711;ENST00000392061;ENST00000397226	.	.	.	5.33	3.54	0.40534	.	.	.	.	.	T	0.43277	0.1240	.	.	.	.	.	.	B	0.27498	0.18	B	0.28638	0.092	T	0.52845	-0.8521	6	0.51188	T	0.08	3.1494	9.5692	0.39418	0.1653:0.0:0.8347:0.0	.	15	A8MTT3	.	R	15	.	ENSP00000383895:G15R	G	+	1	0	AC007390.5	37280394	1.000000	0.71417	0.988000	0.46212	0.090000	0.18270	4.978000	0.63799	0.750000	0.32877	-0.140000	0.14226	GGA	-	NULL		0.348	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000218739	protein_coding	OTTHUMT00000218569.2	G	NM_005760	-		37426890	+1	no_errors	ENST00000392061	ensembl	human	novel	74_37	missense	SNP	1.000	A
FAM86DP	692099	genome.wustl.edu	37	3	75471410	75471410	+	RNA	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr3:75471410G>A	ENST00000459803.1	-	0	1731					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		CTGAAATGACGGCAGTGGTGC	0.567																																																	0								ENSG00000244026																																			FAM86DP			0			-	HGNC	BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471410G>A		Somatic	0	98	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	98	9.26		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			-	-		0.567	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	pseudogene	OTTHUMT00000352425.1	G	NR_024241	-		75471410	-1	no_errors	ENST00000459803	ensembl	human	known	74_37	rna	SNP	0.001	A
TBKBP1	9755	genome.wustl.edu	37	17	45776002	45776002	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr17:45776002G>T	ENST00000361722.3	+	4	1344	c.495G>T	c.(493-495)ttG>ttT	p.L165F		NM_014726.2	NP_055541.1			TBK1 binding protein 1											endometrium(5)|kidney(1)|lung(1)	7						TCTGTGGTTTGGAGCAGCAGC	0.642											OREG0024498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000198933						23.0	27.0	25.0					17																	45776002		2003	4175	6178	TBKBP1	SO:0001583	missense	0			-	HGNC	AB018318	CCDS45722.1	17q21.32	2012-05-17				ENSG00000198933			30140	protein-coding gene	gene with protein product		608476				14743216, 19481056	Standard	NM_014726		Approved	ProSAPiP2, KIAA0775	uc002ilu.3	A7MCY6		ENST00000361722.3:c.495G>T	17.37:g.45776002G>T	ENSP00000354777:p.Leu165Phe	Somatic	0	50	0.00	934	0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	80	9.09		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L165F	ENST00000361722.3	37	c.495	CCDS45722.1	17	.	.	.	.	.	.	.	.	.	.	G	13.79	2.343681	0.41498	.	.	ENSG00000198933	ENST00000361722;ENST00000537587	T;T	0.46451	0.87;0.87	5.61	3.62	0.41486	.	0.000000	0.64402	D	0.000011	T	0.49167	0.1541	L	0.29908	0.895	0.58432	D	0.999991	D	0.71674	0.998	D	0.83275	0.996	T	0.47898	-0.9081	10	0.72032	D	0.01	-6.4031	9.6856	0.40096	0.0744:0.0:0.7841:0.1415	.	165	A7MCY6	TBKB1_HUMAN	F	165	ENSP00000354777:L165F;ENSP00000446365:L165F	ENSP00000354777:L165F	L	+	3	2	TBKBP1	43131001	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.497000	0.60367	0.721000	0.32231	0.650000	0.86243	TTG	-	NULL		0.642	TBKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBKBP1	protein_coding	OTTHUMT00000441363.1	G	NM_014726	-		45776002	+1	no_errors	ENST00000361722	ensembl	human	known	74_37	missense	SNP	1.000	T
AC108697.1	0	genome.wustl.edu	37	3	96152165	96152165	+	RNA	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr3:96152165G>T	ENST00000401317.1	-	0	89																											TATCTAttaggttggtacaaa	0.294																																																	0								ENSG00000216136																																			AC108697.1			0			-	Clone_based_ensembl_gene																													3.37:g.96152165G>T		Somatic	0	32	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401317.1	37	NULL		3																																																																																			-	-		0.294	AC108697.1-201	NOVEL	basic	miRNA	ENSG00000216136	miRNA		G		-		96152165	-1	no_errors	ENST00000401317	ensembl	human	novel	74_37	rna	SNP	0.014	T
COL4A1	1282	genome.wustl.edu	37	13	110857840	110857840	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr13:110857840C>T	ENST00000375820.4	-	16	1025		c.e16+1		COL4A1_ENST00000543140.1_Splice_Site	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1						axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GAAACACTTACGGGACTCCCT	0.453																																																	0								ENSG00000187498						158.0	183.0	175.0					13																	110857840		2203	4300	6503	COL4A1	SO:0001630	splice_region_variant	0			-	HGNC	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.903+1G>A	13.37:g.110857840C>T		Somatic	0	65	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	51	36.25	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e16+1	ENST00000375820.4	37	c.903+1	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920147	0.33908	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8452	0.88728	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL4A1	109655841	1.000000	0.71417	0.951000	0.38953	0.182000	0.23217	6.037000	0.70956	2.280000	0.76307	0.551000	0.68910	.	-	-		0.453	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	protein_coding	OTTHUMT00000045759.3	C		-	Intron	110857840	-1	no_errors	ENST00000375820	ensembl	human	known	74_37	splice_site	SNP	0.998	T
ZNF511	118472	genome.wustl.edu	37	10	135123312	135123312	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr10:135123312G>A	ENST00000359035.3	+	3	263	c.260G>A	c.(259-261)tGc>tAc	p.C87Y	ZNF511_ENST00000368554.4_Missense_Mutation_p.C22Y|TUBGCP2_ENST00000368563.2_5'Flank|TUBGCP2_ENST00000470829.1_5'Flank|ZNF511_ENST00000361518.5_Missense_Mutation_p.C87Y|TUBGCP2_ENST00000417178.2_5'Flank|ZNF511_ENST00000463816.2_Intron			Q8NB15	ZN511_HUMAN	zinc finger protein 511	87					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		GTGGCCGGCTGCTGCCAGGTG	0.622																																																	0								ENSG00000198546						89.0	73.0	78.0					10																	135123312		2203	4300	6503	ZNF511	SO:0001583	missense	0			-	HGNC	AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.260G>A	10.37:g.135123312G>A	ENSP00000351929:p.Cys87Tyr	Somatic	0	47	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8K8L5|Q8WUP1|Q96BV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like	p.C22Y	ENST00000359035.3	37	c.65		10	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834650	0.91036	.	.	ENSG00000198546	ENST00000361518;ENST00000359035;ENST00000368554	D;D;D	0.88277	-2.36;-2.36;-2.36	5.21	5.21	0.72293	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.092546	0.85682	D	0.000000	D	0.95554	0.8555	M	0.90019	3.08	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96221	0.9160	10	0.87932	D	0	-24.3782	17.699	0.88289	0.0:0.0:1.0:0.0	.	87;22;87	Q8NB15;E1U340;Q8NB15-2	ZN511_HUMAN;.;.	Y	87;87;22	ENSP00000355251:C87Y;ENSP00000351929:C87Y;ENSP00000357542:C22Y	ENSP00000351929:C87Y	C	+	2	0	ZNF511	134973302	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	9.351000	0.97073	2.608000	0.88229	0.655000	0.94253	TGC	-	smart_Znf_C2H2-like		0.622	ZNF511-002	KNOWN	basic	protein_coding	ZNF511	protein_coding	OTTHUMT00000051143.1	G	NM_145806	-		135123312	+1	no_errors	ENST00000368554	ensembl	human	known	74_37	missense	SNP	1.000	A
CPNE7	27132	genome.wustl.edu	37	16	89663123	89663123	+	3'UTR	SNP	T	T	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr16:89663123T>C	ENST00000268720.5	+	0	2126				CPNE7_ENST00000319518.8_3'UTR|CPNE7_ENST00000566398.1_3'UTR	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII						lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		CCCTCCGACCTCCCAGAAGCC	0.652																																																	0								ENSG00000178773																																			CPNE7	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	ENST00000268720.5:c.*94T>C	16.37:g.89663123T>C		Somatic	0	33	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	37	43.94		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000268720.5	37	NULL	CCDS10980.1	16																																																																																			-	-		0.652	CPNE7-002	KNOWN	basic|CCDS	protein_coding	CPNE7	protein_coding	OTTHUMT00000269929.2	T		-		89663123	+1	no_errors	ENST00000564421	ensembl	human	known	74_37	rna	SNP	0.000	C
TBC1D1	23216	genome.wustl.edu	37	4	38140081	38140082	+	3'UTR	INS	-	-	A	rs11330073|rs371391694	byFrequency	TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr4:38140081_38140082insA	ENST00000261439.4	+	0	4987_4988				TBC1D1_ENST00000407365.1_3'UTR	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CTGGGACTTTCAAAAAAAAAAG	0.46																																																	0								ENSG00000065882																																			TBC1D1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.*1126->A	4.37:g.38140091_38140091dupA		Somatic	0	20	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261439.4	37	NULL	CCDS33972.1	4																																																																																			-	-		0.460	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	protein_coding	OTTHUMT00000317443.2	-	NM_015173			38140082	+1	no_errors	ENST00000407365	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
TPTE2P2	644623	genome.wustl.edu	37	13	52793775	52793776	+	RNA	INS	-	-	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr13:52793775_52793776insA	ENST00000451298.1	-	0	1229				TPTE2P2_ENST00000606973.1_RNA																							CCTAAGAATAGAAAAAAAAATT	0.292																																																	0								ENSG00000272281																																			TPTE2P2			0				HGNC																													13.37:g.52793784_52793784dupA		Somatic	0	21	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	34	8.11		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000451298.1	37	NULL		13																																																																																			-	-		0.292	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	TPTE2P2	processed_transcript	OTTHUMT00000471093.1	-				52793776	-1	no_errors	ENST00000606973	ensembl	human	known	74_37	rna	INS	0.002:0.003	A
CORIN	10699	genome.wustl.edu	37	4	47809025	47809025	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr4:47809025A>C	ENST00000273857.4	-	2	102	c.103T>G	c.(103-105)Tct>Gct	p.S35A	CORIN_ENST00000504584.1_Missense_Mutation_p.S35A|CORIN_ENST00000502252.1_Missense_Mutation_p.S35A|CORIN_ENST00000505909.1_Missense_Mutation_p.S35A	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	35					female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						AGCTTCTGAGAGCAGCCATTG	0.433																																																	0								ENSG00000145244						106.0	88.0	94.0					4																	47809025		2203	4300	6503	CORIN	SO:0001583	missense	0			-	HGNC	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.103T>G	4.37:g.47809025A>C	ENSP00000273857:p.Ser35Ala	Somatic	0	51	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	41	36.92	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_Frizzled_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Frizzled_dom,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.S35A	ENST00000273857.4	37	c.103	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	A	6.791	0.514858	0.12944	.	.	ENSG00000145244	ENST00000273857;ENST00000502252;ENST00000505909;ENST00000504584	D;D;D;D	0.93953	-2.7;-3.04;-2.67;-3.32	4.95	-0.211	0.13172	.	0.183649	0.38005	N	0.001846	D	0.85869	0.5797	L	0.32530	0.975	0.25018	N	0.991359	B;B;B	0.28055	0.003;0.0;0.199	B;B;B	0.27380	0.004;0.003;0.079	T	0.75679	-0.3234	10	0.46703	T	0.11	.	5.8168	0.18497	0.5707:0.2829:0.1464:0.0	.	35;35;35	B4E2W9;B4E1Y7;Q9Y5Q5	.;.;CORIN_HUMAN	A	35	ENSP00000273857:S35A;ENSP00000424212:S35A;ENSP00000425401:S35A;ENSP00000423216:S35A	ENSP00000273857:S35A	S	-	1	0	CORIN	47503782	1.000000	0.71417	0.106000	0.21319	0.027000	0.11550	2.030000	0.41108	-0.168000	0.10853	-0.256000	0.11100	TCT	-	pirsf_Peptidase_S1A_corin		0.433	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	protein_coding	OTTHUMT00000216906.2	A		-		47809025	-1	no_errors	ENST00000273857	ensembl	human	known	74_37	missense	SNP	0.982	C
BBIP1	92482	genome.wustl.edu	37	10	112667566	112667566	+	Intron	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr10:112667566G>T	ENST00000448814.1	-	3	247				BBIP1_ENST00000454061.1_Silent_p.I22I|BBIP1_ENST00000436562.1_Intron|BBIP1_ENST00000605742.1_Intron|BBIP1_ENST00000605265.1_5'Flank|BBIP1_ENST00000447005.1_Intron|BBIP1_ENST00000423273.1_Intron|RP11-348N5.7_ENST00000603915.1_RNA	NM_001195305.1|NM_001195306.1	NP_001182234.1|NP_001182235.1	A8MTZ0	BBIP1_HUMAN	BBSome interacting protein 1						cilium assembly (GO:0042384)|protein transport (GO:0015031)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)											tttctgataagattccatagt	0.323																																																	0								ENSG00000214413																																			BBIP1	SO:0001627	intron_variant	0			-	HGNC	AK025724	CCDS55726.1, CCDS55727.1, CCDS55728.1, CCDS58094.1	10q25.3	2014-01-28	2010-12-09	2010-12-09	ENSG00000214413	ENSG00000214413			28093	protein-coding gene	gene with protein product		613605	"""non-protein coding RNA 81"""	NCRNA00081		19081074	Standard	NM_001195304		Approved	bA348N5.3, BBIP10, BBS18	uc009xxw.2	A8MTZ0	OTTHUMG00000019046	ENST00000448814.1:c.38-6196C>A	10.37:g.112667566G>T		Somatic	0	43	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	E9PIY9|E9PM41|E9PRI7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I22	ENST00000448814.1	37	c.66	CCDS55727.1	10																																																																																			-	NULL		0.323	BBIP1-001	KNOWN	basic|CCDS	protein_coding	BBIP1	protein_coding	OTTHUMT00000050347.2	G	NR_015402	-		112667566	-1	no_errors	ENST00000454061	ensembl	human	putative	74_37	silent	SNP	0.085	T
ITGA6	3655	genome.wustl.edu	37	2	173340339	173340339	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr2:173340339G>T	ENST00000264106.6	+	9	1515	c.1312G>T	c.(1312-1314)Gct>Tct	p.A438S	ITGA6_ENST00000343713.4_Missense_Mutation_p.A394S|ITGA6_ENST00000375221.2_Missense_Mutation_p.A438S|ITGA6_ENST00000409532.1_Missense_Mutation_p.A280S|ITGA6_ENST00000409080.1_Missense_Mutation_p.A399S|ITGA6_ENST00000264107.7_Missense_Mutation_p.A399S			P23229	ITA6_HUMAN	integrin, alpha 6	438					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TGCAGTTGGAGCTCCGTATGA	0.348																																																	0								ENSG00000091409						156.0	161.0	159.0					2																	173340339		2203	4300	6503	ITGA6	SO:0001583	missense	0			-	HGNC		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1312G>T	2.37:g.173340339G>T	ENSP00000264106:p.Ala438Ser	Somatic	0	34	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.00	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.A438S	ENST00000264106.6	37	c.1312		2	.	.	.	.	.	.	.	.	.	.	G	34	5.354759	0.95854	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.87617	0.6222	M	0.81239	2.535	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.996;0.996	D	0.88655	0.3185	10	0.87932	D	0	.	19.586	0.95490	0.0:0.0:1.0:0.0	.	394;438;399;399	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	S	280;399;438;438;394;399;438;394	ENSP00000386614:A280S;ENSP00000264107:A399S;ENSP00000264106:A438S;ENSP00000364369:A438S;ENSP00000341078:A394S;ENSP00000386896:A399S;ENSP00000406694:A438S;ENSP00000394169:A394S	ENSP00000264106:A438S	A	+	1	0	ITGA6	173048585	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.865000	0.99609	2.627000	0.88993	0.644000	0.83932	GCT	-	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha		0.348	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	protein_coding		G		-		173340339	+1	no_errors	ENST00000264106	ensembl	human	known	74_37	missense	SNP	1.000	T
MYOF	26509	genome.wustl.edu	37	10	95139652	95139652	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr10:95139652C>T	ENST00000359263.4	-	21	1968	c.1969G>A	c.(1969-1971)Gtg>Atg	p.V657M	MYOF_ENST00000371502.4_Missense_Mutation_p.V657M|MYOF_ENST00000358334.5_Missense_Mutation_p.V644M|MYOF_ENST00000371501.4_Missense_Mutation_p.V657M	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	657					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AGAGTGTTCACCGCATCCAGG	0.468																																																	0								ENSG00000138119						69.0	67.0	67.0					10																	95139652		1928	4130	6058	MYOF	SO:0001583	missense	0			-	HGNC	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.1969G>A	10.37:g.95139652C>T	ENSP00000352208:p.Val657Met	Somatic	0	35	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.V657M	ENST00000359263.4	37	c.1969	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	C	16.26	3.073911	0.55646	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	5.09	5.09	0.68999	.	0.059138	0.64402	D	0.000002	D	0.87366	0.6159	M	0.65320	2	0.58432	D	0.999999	P;D	0.56287	0.896;0.975	P;P	0.58331	0.817;0.837	D	0.85902	0.1435	10	0.38643	T	0.18	-19.9024	14.7451	0.69485	0.145:0.855:0.0:0.0	.	644;657	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	M	644;657;657;657	ENSP00000351094:V644M;ENSP00000352208:V657M;ENSP00000360556:V657M;ENSP00000360557:V657M	ENSP00000351094:V644M	V	-	1	0	MYOF	95129642	1.000000	0.71417	0.969000	0.41365	0.621000	0.37620	4.588000	0.60999	2.791000	0.96007	0.655000	0.94253	GTG	-	NULL		0.468	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	protein_coding	OTTHUMT00000049423.2	C	NM_013451	-		95139652	-1	no_errors	ENST00000359263	ensembl	human	known	74_37	missense	SNP	0.995	T
LINC00937	389634	genome.wustl.edu	37	12	8476956	8476956	+	lincRNA	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr12:8476956G>A	ENST00000544461.1	-	0	1081				AC092745.1_ENST00000408380.1_RNA|RP11-90D4.3_ENST00000535746.1_lincRNA|RP11-113C12.4_ENST00000537764.1_RNA					long intergenic non-protein coding RNA 937																		tttctcgctcgggcctccaAA	0.537																																																	0								ENSG00000221307																																			AC092745.1			0			-	Clone_based_ensembl_gene	BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8476956G>A		Somatic	1	132	0.75		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	125	11.35		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			-	-		0.537	LINC00937-001	KNOWN	basic	lincRNA	ENSG00000221307	lincRNA	OTTHUMT00000400511.1	G		-		8476956	+1	no_errors	ENST00000408380	ensembl	human	novel	74_37	rna	SNP	0.279	A
ABR	29	genome.wustl.edu	37	17	994962	994962	+	Nonsense_Mutation	SNP	G	G	T	rs35857113	byFrequency	TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr17:994962G>T	ENST00000302538.5	-	4	620	c.474C>A	c.(472-474)tgC>tgA	p.C158*	ABR_ENST00000574437.1_Nonsense_Mutation_p.C112*|ABR_ENST00000544583.2_Nonsense_Mutation_p.C112*|ABR_ENST00000291107.2_Nonsense_Mutation_p.C121*	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	158	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GCACCTTGGGGCACAGGTTGT	0.577																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)												0								ENSG00000159842						162.0	136.0	145.0					17																	994962		2203	4300	6503	ABR	SO:0001587	stop_gained	0			-	HGNC	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.474C>A	17.37:g.994962G>T	ENSP00000303909:p.Cys158*	Somatic	0	28	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_C2_dom,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RhoGAP_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.C158*	ENST00000302538.5	37	c.474	CCDS10999.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.492239	0.96339	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000382259	.	.	.	6.04	3.89	0.44902	.	0.263930	0.44285	D	0.000472	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	11.4977	0.50419	0.1554:0.0:0.8446:0.0	.	.	.	.	X	158;112;121;42	.	ENSP00000291107:C121X	C	-	3	2	ABR	941712	0.937000	0.31787	1.000000	0.80357	0.984000	0.73092	0.091000	0.15046	0.771000	0.33359	0.563000	0.77884	TGC	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.577	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	protein_coding	OTTHUMT00000206675.4	G		-		994962	-1	no_errors	ENST00000302538	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RRP8	23378	genome.wustl.edu	37	11	6621898	6621898	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr11:6621898C>T	ENST00000254605.6	-	5	1272		c.e5+1		RP11-732A19.8_ENST00000527191.1_RNA|RRP8_ENST00000534343.1_Splice_Site	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)						cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						GGGGCTCTTACCCTGGCTTCA	0.488																																																	0								ENSG00000132275						101.0	102.0	102.0					11																	6621898		2201	4296	6497	RRP8	SO:0001630	splice_region_variant	0			-	HGNC	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.1154+1G>A	11.37:g.6621898C>T		Somatic	0	29	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q7KZ78|Q9BVM6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5+1	ENST00000254605.6	37	c.1154+1	CCDS31411.1	11	.	.	.	.	.	.	.	.	.	.	C	17.54	3.416064	0.62511	.	.	ENSG00000132275	ENST00000254605;ENST00000534343	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.543	0.87853	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RRP8	6578474	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	6.953000	0.75995	2.793000	0.96121	0.561000	0.74099	.	-	-		0.488	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP8	protein_coding	OTTHUMT00000384505.1	C	NM_015324	-	Intron	6621898	-1	no_errors	ENST00000254605	ensembl	human	known	74_37	splice_site	SNP	1.000	T
FAM111B	374393	genome.wustl.edu	37	11	58892377	58892377	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr11:58892377delA	ENST00000343597.3	+	4	998	c.807delA	c.(805-807)tcafs	p.S269fs	FAM111B_ENST00000411426.1_Frame_Shift_Del_p.S239fs|FAM111B_ENST00000529618.1_Frame_Shift_Del_p.S239fs	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	269							catalytic activity (GO:0003824)	p.A273fs*9(1)|p.K272delK(1)|p.A273fs*26(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TGGACATTTCAAAAAAAAAAG	0.313																																																	3	Deletion - Frameshift(1)|Deletion - In frame(1)|Insertion - Frameshift(1)	kidney(2)|ovary(1)						ENSG00000189057																																			FAM111B	SO:0001589	frameshift_variant	0				HGNC	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.807delA	11.37:g.58892377delA	ENSP00000341565:p.Ser269fs	Somatic	0	24	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B4E2G2|Q6P661	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Trypsin-like_Pept_dom	p.K272fs	ENST00000343597.3	37	c.807	CCDS7972.1	11																																																																																			-	NULL		0.313	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM111B	protein_coding	OTTHUMT00000393974.1	A	NM_198947			58892377	+1	no_errors	ENST00000343597	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
KIAA1731	85459	genome.wustl.edu	37	11	93431161	93431161	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr11:93431161G>C	ENST00000325212.6	+	15	3245	c.3083G>C	c.(3082-3084)gGa>gCa	p.G1028A	KIAA1731_ENST00000531700.1_Intron|KIAA1731_ENST00000411936.1_Missense_Mutation_p.G1028A|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	1028						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGCGAGAAAGGACTTGTTTCA	0.413																																																	0								ENSG00000166004						93.0	72.0	79.0					11																	93431161		692	1591	2283	KIAA1731	SO:0001583	missense	0			-	HGNC	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.3083G>C	11.37:g.93431161G>C	ENSP00000316681:p.Gly1028Ala	Somatic	0	25	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.05	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G1028A	ENST00000325212.6	37	c.3083	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	G	1.077	-0.668192	0.03428	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.27890	1.64;1.64	4.22	2.15	0.27550	.	0.777923	0.11320	N	0.576173	T	0.21307	0.0513	L	0.28344	0.845	0.09310	N	0.999992	P	0.40180	0.705	B	0.41510	0.359	T	0.11792	-1.0573	10	0.40728	T	0.16	-4.6395	4.7369	0.12993	0.1179:0.0:0.6767:0.2053	.	1028	Q9C0D2	K1731_HUMAN	A	1028	ENSP00000316681:G1028A;ENSP00000406505:G1028A	ENSP00000316681:G1028A	G	+	2	0	KIAA1731	93070809	0.000000	0.05858	0.002000	0.10522	0.045000	0.14185	0.082000	0.14847	0.606000	0.29965	0.655000	0.94253	GGA	-	NULL		0.413	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	protein_coding	OTTHUMT00000394640.1	G	NM_033395	-		93431161	+1	no_errors	ENST00000411936	ensembl	human	known	74_37	missense	SNP	0.002	C
ANKRD20A1	84210	genome.wustl.edu	37	9	67925159	67925159	+	5'Flank	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr9:67925159G>T	ENST00000377477.2	+	0	0				BX649567.1_ENST00000543078.1_Silent_p.R18R	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1							plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						CCTGAGGGCCGTCCAGGGGAG	0.637																																																	0								ENSG00000233434																																			BX649567.1	SO:0001631	upstream_gene_variant	0			-	Clone_based_ensembl_gene	AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594		9.37:g.67925159G>T	Exception_encountered	Somatic	0	64	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	69	8.00	Q9H0H6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R18	ENST00000377477.2	37	c.52	CCDS6620.1	9																																																																																			-	NULL		0.637	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000233434	protein_coding	OTTHUMT00000083800.1	G		-		67925159	-1	no_errors	ENST00000543078	ensembl	human	novel	74_37	silent	SNP	0.148	T
TAOK3	51347	genome.wustl.edu	37	12	118604652	118604653	+	Intron	INS	-	-	ACAC	rs376430378|rs373259313|rs200569755|rs7487392		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr12:118604652_118604653insACAC	ENST00000392533.3	-	18	2390				AC026366.1_ENST00000408353.1_RNA|TAOK3_ENST00000537952.1_Intron|TAOK3_ENST00000419821.2_Intron	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cacacacacatacacacacaca	0.421																																																	0								ENSG00000221280																																			AC026366.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4820->GTGT	12.37:g.118604657_118604660dupACAC		Somatic	0	10	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	-		0.421	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	protein_coding	OTTHUMT00000401456.2	-	NM_016281			118604653	+1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	INS	0.002:0.000	ACAC
TAAR6	319100	genome.wustl.edu	37	6	132891510	132891510	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr6:132891510A>T	ENST00000275198.1	+	1	50	c.50A>T	c.(49-51)aAc>aTc	p.N17I		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	17					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		TGCTACGCGAACGTGAATGGG	0.488																																																	0								ENSG00000146383						119.0	112.0	115.0					6																	132891510		2203	4300	6503	TAAR6	SO:0001583	missense	0			-	HGNC	AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.50A>T	6.37:g.132891510A>T	ENSP00000275198:p.Asn17Ile	Somatic	0	58	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	62	10.14	Q5VUQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_TAAR_fam	p.N17I	ENST00000275198.1	37	c.50	CCDS5155.1	6	.	.	.	.	.	.	.	.	.	.	A	12.06	1.823476	0.32237	.	.	ENSG00000146383	ENST00000275198	T	0.62498	0.02	4.99	3.8	0.43715	.	0.392376	0.20710	U	0.087101	T	0.44973	0.1319	M	0.77616	2.38	0.09310	N	1	B	0.23249	0.082	B	0.32677	0.15	T	0.43523	-0.9386	10	0.22109	T	0.4	-2.2376	10.3884	0.44154	0.5416:0.4584:0.0:0.0	.	17	Q96RI8	TAAR6_HUMAN	I	17	ENSP00000275198:N17I	ENSP00000275198:N17I	N	+	2	0	TAAR6	132933203	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.838000	0.27572	0.881000	0.35993	0.460000	0.39030	AAC	-	NULL		0.488	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR6	protein_coding	OTTHUMT00000042255.1	A	NM_175067	-		132891510	+1	no_errors	ENST00000275198	ensembl	human	known	74_37	missense	SNP	0.004	T
ZNF691	51058	genome.wustl.edu	37	1	43316717	43316717	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:43316717G>A	ENST00000372506.1	+	4	428	c.88G>A	c.(88-90)Ggt>Agt	p.G30S	ZNF691_ENST00000372502.1_Missense_Mutation_p.G52S|ZNF691_ENST00000372504.1_Missense_Mutation_p.G52S|ZNF691_ENST00000372507.1_Missense_Mutation_p.G30S|ZNF691_ENST00000372508.3_Missense_Mutation_p.G30S|ZNF691_ENST00000397044.3_Missense_Mutation_p.G61S	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	61						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGACTCAGAGGGTTCTTGGAT	0.542																																																	0								ENSG00000164011						86.0	86.0	86.0					1																	43316717		2203	4300	6503	ZNF691	SO:0001583	missense	0			-	HGNC		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.88G>A	1.37:g.43316717G>A	ENSP00000361584:p.Gly30Ser	Somatic	0	31	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	24	44.19	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G61S	ENST00000372506.1	37	c.181	CCDS476.1	1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.540399	0.27563	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000397034;ENST00000372503;ENST00000372502	T;T;T;T;T;T;T	0.09163	3.09;3.09;3.09;3.01;3.06;4.57;3.06	4.89	2.99	0.34606	.	0.498297	0.18818	N	0.130308	T	0.05273	0.0140	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.001;0.003	T	0.31971	-0.9924	10	0.72032	D	0.01	-1.3132	5.692	0.17835	0.1777:0.1636:0.6587:0.0	.	61;61	B4DJR7;Q5VV52	.;ZN691_HUMAN	S	30;30;30;61;52;61;61;52	ENSP00000361586:G30S;ENSP00000361585:G30S;ENSP00000361584:G30S;ENSP00000380237:G61S;ENSP00000361582:G52S;ENSP00000380228:G61S;ENSP00000361580:G52S	ENSP00000361580:G52S	G	+	1	0	ZNF691	43089304	0.001000	0.12720	0.006000	0.13384	0.494000	0.33585	0.686000	0.25392	0.737000	0.32582	-0.176000	0.13171	GGT	-	NULL		0.542	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF691	protein_coding	OTTHUMT00000020192.1	G	NM_015911	-		43316717	+1	no_errors	ENST00000397044	ensembl	human	known	74_37	missense	SNP	0.011	A
NINL	22981	genome.wustl.edu	37	20	25443278	25443279	+	Intron	INS	-	-	TTTGTTTTGT	rs200513281|rs377227803|rs113237945		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr20:25443278_25443279insTTTGTTTTGT	ENST00000278886.6	-	20	3497				NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TTAAGTAGTCAtttgttttgtt	0.361																																																	0								ENSG00000101004																																			NINL	SO:0001627	intron_variant	0				HGNC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3424-101->ACAAAACAAA	20.37:g.25443279_25443288dupTTTGTTTTGT		Somatic	NA	NA	NA		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278886.6	37	NULL	CCDS33452.1	20																																																																																			-	-		0.361	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	protein_coding	OTTHUMT00000078445.3	-	NM_025176			25443279	-1	no_errors	ENST00000496509	ensembl	human	known	74_37	rna	INS	0.010:0.013	TTTGTTTTGT
CECR5	27440	genome.wustl.edu	37	22	17646166	17646166	+	5'UTR	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr22:17646166C>T	ENST00000155674.5	-	0	11				CECR5-AS1_ENST00000431923.1_RNA|CECR5-AS1_ENST00000329743.3_RNA	NM_017829.5	NP_060299.4	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5							mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				TAGGAGCCAGCTGGTCCACCA	0.542																																																	0								ENSG00000185837						86.0	69.0	74.0					22																	17646166		2203	4300	6503	CECR5-AS1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000155674.5:c.-32G>A	22.37:g.17646166C>T		Somatic	0	27	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000155674.5	37	NULL	CCDS13741.1	22																																																																																			-	-		0.542	CECR5-001	KNOWN	basic|CCDS	protein_coding	CECR5-AS1	protein_coding	OTTHUMT00000316099.1	C	NM_017829	-		17646166	+1	no_errors	ENST00000329743	ensembl	human	known	74_37	rna	SNP	0.001	T
SYT6	148281	genome.wustl.edu	37	1	114682311	114682311	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:114682311C>A	ENST00000610222.1	-	2	584	c.438G>T	c.(436-438)caG>caT	p.Q146H	SYT6_ENST00000607941.1_Missense_Mutation_p.Q61H|SYT6_ENST00000393296.1_Missense_Mutation_p.Q146H|SYT6_ENST00000369547.1_Missense_Mutation_p.Q61H|SYT6_ENST00000609117.1_Missense_Mutation_p.Q61H			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	146					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGACCGACATCTGCACCTCAG	0.617																																																	0								ENSG00000134207						109.0	87.0	95.0					1																	114682311		2203	4300	6503	SYT6	SO:0001583	missense	0			-	HGNC		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.438G>T	1.37:g.114682311C>A	ENSP00000476396:p.Gln146His	Somatic	0	36	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B1AMB8|B3KPK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.Q146H	ENST00000610222.1	37	c.438		1	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854725	0.71719	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545;ENST00000425037;ENST00000447981	T;T;T;T;T;T	0.61627	0.16;0.09;0.16;0.09;1.09;0.37	5.76	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.48519	0.1504	M	0.64260	1.97	0.80722	D	1	B	0.32409	0.37	B	0.37387	0.248	T	0.57774	-0.7753	10	0.72032	D	0.01	.	14.22	0.65820	0.0:0.9288:0.0:0.0712	.	146	Q5T7P8	SYT6_HUMAN	H	61;146;61;146;61;61	ENSP00000358560:Q61H;ENSP00000376974:Q146H;ENSP00000358559:Q61H;ENSP00000358558:Q146H;ENSP00000412443:Q61H;ENSP00000389266:Q61H	ENSP00000358558:Q146H	Q	-	3	2	SYT6	114483834	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.740000	0.47418	2.732000	0.93576	0.655000	0.94253	CAG	-	NULL		0.617	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	protein_coding	OTTHUMT00000314819.2	C	NM_205848	-		114682311	-1	no_errors	ENST00000393296	ensembl	human	known	74_37	missense	SNP	1.000	A
TNC	3371	genome.wustl.edu	37	9	117825327	117825327	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr9:117825327T>C	ENST00000350763.4	-	13	4313	c.3902A>G	c.(3901-3903)aAt>aGt	p.N1301S	TNC_ENST00000537320.1_Intron|TNC_ENST00000341037.4_Intron|TNC_ENST00000346706.3_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000340094.3_Intron|TNC_ENST00000423613.2_Missense_Mutation_p.N1301S|TNC_ENST00000345230.3_Intron|TNC_ENST00000542877.1_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1301	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AACCGTGAGATTGTGAGCCTC	0.587																																																	0								ENSG00000041982						120.0	83.0	95.0					9																	117825327		2203	4300	6503	TNC	SO:0001583	missense	0			-	HGNC		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.3902A>G	9.37:g.117825327T>C	ENSP00000265131:p.Asn1301Ser	Somatic	0	35	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	30	50.00	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.N1301S	ENST00000350763.4	37	c.3902	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.621019	0.00820	.	.	ENSG00000041982	ENST00000350763;ENST00000423613	T;T	0.55760	0.5;0.5	5.12	1.63	0.23807	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.137514	0.64402	N	0.000004	T	0.48409	0.1498	M	0.82056	2.57	0.80722	D	1	B;B	0.21520	0.057;0.0	B;B	0.27500	0.08;0.005	T	0.25710	-1.0124	10	0.15499	T	0.54	.	6.2323	0.20742	0.0:0.3912:0.0:0.6088	.	1301;1301	E9PC84;P24821	.;TENA_HUMAN	S	1301	ENSP00000265131:N1301S;ENSP00000411406:N1301S	ENSP00000265131:N1301S	N	-	2	0	TNC	116865148	0.830000	0.29337	0.176000	0.23000	0.040000	0.13550	2.631000	0.46502	0.106000	0.17784	-0.256000	0.11100	AAT	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.587	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	protein_coding	OTTHUMT00000055418.2	T	NM_002160	-		117825327	-1	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	SNP	0.996	C
TM4SF18	116441	genome.wustl.edu	37	3	149051132	149051132	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr3:149051132delA	ENST00000296059.2	-	2	303	c.38delT	c.(37-39)ttgfs	p.L14fs	RP11-206M11.7_ENST00000489011.1_RNA|TM4SF18_ENST00000470080.1_Frame_Shift_Del_p.L14fs	NM_138786.3	NP_620141.1	Q96CE8	T4S18_HUMAN	transmembrane 4 L six family member 18	14						integral component of membrane (GO:0016021)				lung(1)|ovary(1)|prostate(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CGGAATCAGCAAACAACTTAG	0.433																																																	0								ENSG00000163762						61.0	59.0	60.0					3																	149051132		2203	4300	6503	TM4SF18	SO:0001589	frameshift_variant	0				HGNC	BC014339	CCDS3142.1	3q25.1	2005-08-09			ENSG00000163762	ENSG00000163762			25181	protein-coding gene	gene with protein product						10975581	Standard	NM_001184723		Approved	L6D	uc021xfl.1	Q96CE8	OTTHUMG00000159582	ENST00000296059.2:c.38delT	3.37:g.149051132delA	ENSP00000296059:p.Leu14fs	Somatic	0	34	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	32	41.82	B2R8K0|D3DNH5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_L6_membrane	p.L13fs	ENST00000296059.2	37	c.38	CCDS3142.1	3																																																																																			-	pfam_L6_membrane		0.433	TM4SF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF18	protein_coding	OTTHUMT00000356326.1	A	NM_138786			149051132	-1	no_errors	ENST00000296059	ensembl	human	known	74_37	frame_shift_del	DEL	0.992	-
MIR519A2	574500	genome.wustl.edu	37	19	54265614	54265614	+	lincRNA	SNP	T	T	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr19:54265614T>C	ENST00000384990.1	+	0	17				MIR516A2_ENST00000384888.1_RNA|RNU6-1041P_ENST00000516254.1_RNA	NR_030222.1				microRNA 519a-2																		GCTGTGTCCCTCTACAGGGAA	0.408																																																	0								ENSG00000269842						174.0	155.0	160.0					19																	54265614		1568	3582	5150	MIR519A2			0			-	HGNC			19q13.42	2011-09-12		2008-12-18	ENSG00000207723			"""ncRNAs / Micro RNAs"""	32132	non-coding RNA	RNA, micro				MIRN519A-2, MIRN519A2			Standard	NR_030222		Approved	hsa-mir-519a-2	uc021vaz.1				19.37:g.54265614T>C		Somatic	0	114	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	76	38.21		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384990.1	37	NULL		19																																																																																			-	-		0.408	MIR519A2-201	KNOWN	basic	miRNA	MIR519A2	lincRNA		T	NR_030222	-		54265614	+1	no_errors	ENST00000384990	ensembl	human	known	74_37	rna	SNP	0.001	C
C12orf45	121053	genome.wustl.edu	37	12	105380151	105380151	+	Silent	SNP	C	C	G	rs539464433		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr12:105380151C>G	ENST00000552951.1	+	1	64	c.21C>G	c.(19-21)ccC>ccG	p.P7P	C12orf45_ENST00000280749.5_Silent_p.P7P	NM_152318.2	NP_689531.2	Q8N5I9	CL045_HUMAN	chromosome 12 open reading frame 45	7										large_intestine(1)|lung(2)	3						ATGGCAAGCCCAAGGCTAGCC	0.662																																																	0								ENSG00000151131						22.0	27.0	25.0					12																	105380151		1960	4152	6112	C12orf45	SO:0001819	synonymous_variant	0			-	HGNC	BC032326	CCDS41825.1	12q23.3	2012-05-30			ENSG00000151131	ENSG00000151131			28628	protein-coding gene	gene with protein product						12477932	Standard	NM_152318		Approved	MGC40397	uc001tlb.3	Q8N5I9	OTTHUMG00000169822	ENST00000552951.1:c.21C>G	12.37:g.105380151C>G		Somatic	0	190	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	83	39.42		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P7	ENST00000552951.1	37	c.21	CCDS41825.1	12																																																																																			-	NULL		0.662	C12orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf45	protein_coding	OTTHUMT00000406076.1	C	NM_152318	-		105380151	+1	no_errors	ENST00000552951	ensembl	human	known	74_37	silent	SNP	0.000	G
CCDC14	64770	genome.wustl.edu	37	3	123650246	123650246	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr3:123650246G>T	ENST00000488653.2	-	11	1788	c.1698C>A	c.(1696-1698)aaC>aaA	p.N566K	CCDC14_ENST00000485727.1_Missense_Mutation_p.N366K|CCDC14_ENST00000433542.2_Missense_Mutation_p.N525K|CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000489746.1_Missense_Mutation_p.N366K|CCDC14_ENST00000310351.4_Missense_Mutation_p.N406K			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	566					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		TAAATTTTTTGTTTTCATCTT	0.284																																																	0								ENSG00000175455						36.0	33.0	34.0					3																	123650246		2179	4251	6430	CCDC14	SO:0001583	missense	0			-	HGNC	AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1698C>A	3.37:g.123650246G>T	ENSP00000420180:p.Asn566Lys	Somatic	0	39	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	52	10.34	B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N566K	ENST00000488653.2	37	c.1698		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.36|15.36	2.811200|2.811200	0.50527|0.50527	.|.	.|.	ENSG00000175455|ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000419247|ENST00000479903	T;T;T;T;T;T;T|.	0.49432|.	0.78;0.78;0.78;0.78;0.78;0.78;0.78|.	4.92|4.92	4.05|4.05	0.47172|0.47172	.|.	0.272209|.	0.35495|.	N|.	0.003165|.	T|T	0.54303|0.54303	0.1850|0.1850	L|L	0.56769|0.56769	1.78|1.78	0.33373|0.33373	D|D	0.573872|0.573872	D;D;D;D|.	0.71674|.	0.998;0.998;0.998;0.998|.	D;D;D;D|.	0.66979|.	0.948;0.948;0.929;0.929|.	T|T	0.63812|0.63812	-0.6552|-0.6552	10|5	0.18710|.	T|.	0.47|.	.|.	7.7522|7.7522	0.28904|0.28904	0.2629:0.0:0.7371:0.0|0.2629:0.0:0.7371:0.0	.|.	566;525;366;407|.	Q49A88;Q49A88-6;Q49A88-4;Q49A88-5|.	CCD14_HUMAN;.;.;.|.	K|K	566;406;366;366;525;547;207|148	ENSP00000420180:N566K;ENSP00000312031:N406K;ENSP00000418002:N366K;ENSP00000418403:N366K;ENSP00000395706:N525K;ENSP00000386866:N547K;ENSP00000400957:N207K|.	ENSP00000312031:N406K|.	N|T	-|-	3|2	2|0	CCDC14|CCDC14	125132936|125132936	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.888000|0.888000	0.51559|0.51559	1.391000|1.391000	0.34475|0.34475	1.307000|1.307000	0.44944|0.44944	0.557000|0.557000	0.71058|0.71058	AAC|ACA	-	NULL		0.284	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC14	protein_coding		G	NM_022757	-		123650246	-1	no_errors	ENST00000488653	ensembl	human	known	74_37	missense	SNP	1.000	T
ADARB2	105	genome.wustl.edu	37	10	1284348	1284348	+	Nonsense_Mutation	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr10:1284348G>A	ENST00000381312.1	-	5	1532	c.1207C>T	c.(1207-1209)Cag>Tag	p.Q403*	ADARB2_ENST00000469464.1_5'Flank	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	403					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		ACCTGCGCCTGCCGAGCATCC	0.662																																																	0								ENSG00000185736						19.0	14.0	16.0					10																	1284348		2179	4258	6437	ADARB2	SO:0001587	stop_gained	0			-	HGNC	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1207C>T	10.37:g.1284348G>A	ENSP00000370713:p.Gln403*	Somatic	0	67	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	B2RPJ5|Q5VUT6|Q5VW42	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.Q403*	ENST00000381312.1	37	c.1207	CCDS7058.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.328409	0.97476	.	.	ENSG00000185736	ENST00000381312	.	.	.	5.7	5.7	0.88788	.	0.222920	0.47093	D	0.000247	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-24.8849	19.8391	0.96675	0.0:0.0:1.0:0.0	.	.	.	.	X	403	.	ENSP00000370713:Q403X	Q	-	1	0	ADARB2	1274348	1.000000	0.71417	0.132000	0.22025	0.035000	0.12851	5.345000	0.65987	2.690000	0.91761	0.462000	0.41574	CAG	-	smart_A_deamin		0.662	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	protein_coding	OTTHUMT00000046426.1	G	NM_018702	-		1284348	-1	no_errors	ENST00000381312	ensembl	human	known	74_37	nonsense	SNP	0.989	A
NANOG	79923	genome.wustl.edu	37	12	7947686	7947686	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr12:7947686G>T	ENST00000229307.4	+	4	1132	c.913G>T	c.(913-915)Gtg>Ttg	p.V305L	NANOG_ENST00000526286.1_Missense_Mutation_p.V289L	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	305	Sufficient for strong transactivation activity. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		ACCTGAAGACGTGTGAAGATG	0.418																																																	0								ENSG00000111704						14.0	15.0	14.0					12																	7947686		1000	2043	3043	NANOG	SO:0001583	missense	0			-	HGNC	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.913G>T	12.37:g.7947686G>T	ENSP00000229307:p.Val305Leu	Somatic	0	76	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	54	20.59	D3DUU4|Q2TTG0|Q6JZS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V305L	ENST00000229307.4	37	c.913	CCDS31736.1	12	.	.	.	.	.	.	.	.	.	.	g	2.404	-0.336966	0.05278	.	.	ENSG00000111704	ENST00000229307;ENST00000526286	D;D	0.91351	-2.81;-2.83	2.51	-2.21	0.06973	.	2.488580	0.01124	N	0.005841	D	0.82884	0.5134	L	0.38531	1.155	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63773	-0.6561	10	0.21014	T	0.42	.	1.1207	0.01724	0.2554:0.152:0.4205:0.1722	.	305	Q9H9S0	NANOG_HUMAN	L	305;289	ENSP00000229307:V305L;ENSP00000435288:V289L	ENSP00000229307:V305L	V	+	1	0	NANOG	7838953	0.000000	0.05858	0.049000	0.19019	0.108000	0.19459	-1.946000	0.01536	-0.945000	0.03681	-0.967000	0.02615	GTG	-	NULL		0.418	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NANOG	protein_coding	OTTHUMT00000387480.2	G	NM_024865	-		7947686	+1	no_errors	ENST00000229307	ensembl	human	known	74_37	missense	SNP	0.090	T
CDH18	1016	genome.wustl.edu	37	5	19473140	19473140	+	Intron	DEL	T	T	-	rs34972691|rs560217404	byFrequency	TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr5:19473140delT	ENST00000382275.1	-	13	3087				CDH18_ENST00000510297.1_5'UTR	NM_001167667.1|NM_004934.3	NP_001161139.1|NP_004925.1	Q13634	CAD18_HUMAN	cadherin 18, type 2						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ttgtattgtcttttttttttt	0.323													|||unknown(HR)	2579	0.514976	0.5772	0.5	5008	,	,		16219	0.4633		0.495	False		,,,				2504	0.5153																0								ENSG00000145526																																			CDH18	SO:0001627	intron_variant	0				HGNC	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000382275.1:c.2370+1A>-	5.37:g.19473140delT		Somatic	0	9	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	A8K0I2|B4DHG6|Q8N5Z2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382275.1	37	NULL	CCDS3889.1	5																																																																																			-	-		0.323	CDH18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH18	protein_coding	OTTHUMT00000207117.1	T	NM_004934			19473140	-1	no_errors	ENST00000510297	ensembl	human	known	74_37	rna	DEL	0.000	-
RYR2	6262	genome.wustl.edu	37	1	237947932	237947932	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:237947932G>A	ENST00000366574.2	+	90	13237	c.12920G>A	c.(12919-12921)cGc>cAc	p.R4307H	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.R4313H|RYR2_ENST00000542537.1_Missense_Mutation_p.R4291H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4307					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.R4305L(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGCTTTTTCCGCATCATTTGC	0.502																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000198626						78.0	76.0	77.0					1																	237947932		1918	4126	6044	RYR2	SO:0001583	missense	0			-	HGNC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12920G>A	1.37:g.237947932G>A	ENSP00000355533:p.Arg4307His	Somatic	0	28	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	41	24.07	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R4313H	ENST00000366574.2	37	c.12938	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	2.223	-0.377914	0.05000	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	T;D;T	0.96554	-0.29;-4.05;-0.29	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000018	D	0.91064	0.7188	L	0.38175	1.15	0.22851	N	0.99865	B;B	0.27316	0.022;0.175	B;B	0.12156	0.006;0.007	T	0.78788	-0.2067	10	0.16420	T	0.52	-11.0906	8.1681	0.31239	0.0786:0.0:0.7635:0.1579	.	1281;4307	B4DGV4;Q92736	.;RYR2_HUMAN	H	4307;4313;4291;1281	ENSP00000355533:R4307H;ENSP00000353174:R4313H;ENSP00000443798:R4291H	ENSP00000353174:R4313H	R	+	2	0	RYR2	236014555	1.000000	0.71417	0.643000	0.29450	0.474000	0.32979	3.788000	0.55446	2.657000	0.90304	0.655000	0.94253	CGC	-	NULL		0.502	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035	-		237947932	+1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	SNP	0.017	A
TULP3	7289	genome.wustl.edu	37	12	3031436	3031436	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr12:3031436G>T	ENST00000448120.2	+	4	313	c.262G>T	c.(262-264)Ggt>Tgt	p.G88C	TULP3_ENST00000397132.2_Missense_Mutation_p.G88C	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	88					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			AGGTATTGATGGTCCAGCTGC	0.398																																																	0								ENSG00000078246						148.0	133.0	138.0					12																	3031436		2203	4300	6503	TULP3	SO:0001583	missense	0			-	HGNC	AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.262G>T	12.37:g.3031436G>T	ENSP00000410051:p.Gly88Cys	Somatic	0	62	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	30	30.23	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.G88C	ENST00000448120.2	37	c.262	CCDS8519.1	12	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399839	0.25291	.	.	ENSG00000078246	ENST00000535226;ENST00000228245;ENST00000448120;ENST00000397132	D;D	0.93426	-3.15;-3.22	5.18	5.18	0.71444	.	0.340862	0.34046	N	0.004318	D	0.95943	0.8679	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.99	D	0.96009	0.9000	10	0.87932	D	0	-32.7796	11.78	0.52008	0.0862:0.0:0.9138:0.0	.	88;88	O75386;F8WBZ9	TULP3_HUMAN;.	C	69;88;88;88	ENSP00000410051:G88C;ENSP00000380321:G88C	ENSP00000228245:G88C	G	+	1	0	TULP3	2901697	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	7.158000	0.77470	2.406000	0.81754	0.561000	0.74099	GGT	-	NULL		0.398	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TULP3	protein_coding	OTTHUMT00000398468.1	G	NM_003324	-		3031436	+1	no_errors	ENST00000448120	ensembl	human	known	74_37	missense	SNP	1.000	T
NPY2R	4887	genome.wustl.edu	37	4	156135160	156135160	+	Silent	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr4:156135160G>T	ENST00000329476.3	+	2	558	c.69G>T	c.(67-69)ggG>ggT	p.G23G	NPY2R_ENST00000506608.1_Silent_p.G23G	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	23					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	AACAATACGGGCCACAAACAA	0.488																																																	0								ENSG00000185149						167.0	154.0	159.0					4																	156135160		2203	4300	6503	NPY2R	SO:0001819	synonymous_variant	0			-	HGNC	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.69G>T	4.37:g.156135160G>T		Somatic	0	33	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY2_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.G23	ENST00000329476.3	37	c.69	CCDS3791.1	4																																																																																			-	NULL		0.488	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY2R	protein_coding	OTTHUMT00000365128.1	G	NM_000910	-		156135160	+1	no_errors	ENST00000329476	ensembl	human	known	74_37	silent	SNP	0.000	T
FAM129C	199786	genome.wustl.edu	37	19	17654235	17654235	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr19:17654235T>G	ENST00000335393.4	+	12	1670	c.1532T>G	c.(1531-1533)gTg>gGg	p.V511G	FAM129C_ENST00000600871.1_Missense_Mutation_p.V457G|FAM129C_ENST00000599124.1_Missense_Mutation_p.V480G|FAM129C_ENST00000449408.2_Missense_Mutation_p.V237G|FAM129C_ENST00000352727.3_Missense_Mutation_p.V511G|FAM129C_ENST00000300971.2_Missense_Mutation_p.V511G|FAM129C_ENST00000332386.5_Missense_Mutation_p.V511G|FAM129C_ENST00000595684.1_Missense_Mutation_p.V511G|FAM129C_ENST00000601861.1_Missense_Mutation_p.V480G|FAM129C_ENST00000599164.1_Missense_Mutation_p.V480G	NM_173544.4	NP_775815	Q86XR2	NIBL2_HUMAN	family with sequence similarity 129, member C	511										autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(2)|lung(14)|ovary(1)|skin(3)|stomach(1)	33						AGGGGGCGCGTGCTGAAGGTG	0.647																																																	0								ENSG00000167483						89.0	92.0	91.0					19																	17654235		2203	4300	6503	FAM129C	SO:0001583	missense	0			-	HGNC	AY254198	CCDS12362.1, CCDS42521.1	19p13.11	2008-02-05				ENSG00000167483			24130	protein-coding gene	gene with protein product	B cell novel protein 1	609967				12886250	Standard	NM_173544		Approved	FLJ39802, BCNP1	uc021uqj.1	Q86XR2		ENST00000335393.4:c.1532T>G	19.37:g.17654235T>G	ENSP00000335040:p.Val511Gly	Somatic	0	91	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	101	8.18	B4DNU3|B4DVN7|Q7Z6H6|Q86XR3|Q86XR4|Q8TEQ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Pleckstrin_homology	p.V511G	ENST00000335393.4	37	c.1532	CCDS12362.1	19	.	.	.	.	.	.	.	.	.	.	t	16.80	3.224256	0.58668	.	.	ENSG00000167483	ENST00000335393;ENST00000332386;ENST00000352727;ENST00000300971;ENST00000449408;ENST00000435646	T;T;T;T;T	0.56275	0.76;0.7;1.01;0.77;0.47	4.87	4.87	0.63330	.	0.000000	0.52532	D	0.000075	T	0.66157	0.2761	M	0.76002	2.32	0.50813	D	0.999899	D;D;D;D;P;D	0.67145	0.986;0.996;0.996;0.992;0.948;0.996	P;P;P;P;P;P	0.58266	0.714;0.714;0.776;0.714;0.628;0.836	T	0.70967	-0.4728	10	0.87932	D	0	-42.1399	11.1532	0.48471	0.0:0.0:0.0:1.0	.	457;511;511;511;237;511	E7ENP6;Q86XR2;Q86XR2-3;Q86XR2-4;B4DNU3;Q86XR2-2	.;NIBL2_HUMAN;.;.;.;.	G	511;511;511;511;237;457	ENSP00000335040:V511G;ENSP00000333447:V511G;ENSP00000341067:V511G;ENSP00000300971:V511G;ENSP00000394929:V237G	ENSP00000300971:V511G	V	+	2	0	FAM129C	17515235	1.000000	0.71417	0.993000	0.49108	0.466000	0.32739	2.511000	0.45476	1.960000	0.56953	0.398000	0.26397	GTG	-	NULL		0.647	FAM129C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM129C	protein_coding	OTTHUMT00000464206.1	T	NM_173544	-		17654235	+1	no_errors	ENST00000335393	ensembl	human	known	74_37	missense	SNP	0.999	G
TP53	7157	genome.wustl.edu	37	17	7578555	7578555	+	Splice_Site	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr17:7578555C>T	ENST00000269305.4	-	5	565		c.e5-1		TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(39)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGGGGAGTACTGTAGGAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Unknown(39)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	ovary(9)|pancreas(6)|bone(5)|upper_aerodigestive_tract(4)|liver(4)|lung(4)|breast(4)|large_intestine(3)|central_nervous_system(3)|oesophagus(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|endometrium(1)|urinary_tract(1)|autonomic_ganglia(1)						ENSG00000141510						42.0	42.0	42.0					17																	7578555		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-1G>A	17.37:g.7578555C>T		Somatic	0	17	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	5	73.68	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4-1	ENST00000269305.4	37	c.376-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	17.60	3.431133	0.62844	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.87	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4246	0.50003	0.0:0.9094:0.0:0.0906	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519280	1.000000	0.71417	0.999000	0.59377	0.918000	0.54935	7.639000	0.83342	1.359000	0.45940	0.655000	0.94253	.	-	-		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-	Intron	7578555	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	SNP	1.000	T
GPR156	165829	genome.wustl.edu	37	3	119886364	119886364	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr3:119886364C>T	ENST00000464295.1	-	10	2405	c.1960G>A	c.(1960-1962)Gta>Ata	p.V654I	GPR156_ENST00000315843.3_Missense_Mutation_p.V654I|GPR156_ENST00000461057.1_Missense_Mutation_p.V650I			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	654						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		GGTCTTCGTACTCTGGAATCA	0.577																																																	0								ENSG00000175697						59.0	58.0	58.0					3																	119886364		2203	4300	6503	GPR156	SO:0001583	missense	0			-	HGNC	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.1960G>A	3.37:g.119886364C>T	ENSP00000417261:p.Val654Ile	Somatic	0	40	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B	p.V654I	ENST00000464295.1	37	c.1960	CCDS2997.1	3	.	.	.	.	.	.	.	.	.	.	C	0.798	-0.756580	0.03019	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.24723	1.84;1.84;1.84	5.18	-0.782	0.10961	.	1.717380	0.03184	N	0.172447	T	0.22166	0.0534	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27571	-1.0070	9	.	.	.	5.6454	10.3124	0.43716	0.0:0.5291:0.0:0.4709	.	650;654	E9PFZ4;Q8NFN8	.;GP156_HUMAN	I	654;654;650	ENSP00000417261:V654I;ENSP00000324553:V654I;ENSP00000418758:V650I	.	V	-	1	0	GPR156	121369054	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.202000	0.17295	-0.639000	0.05502	-1.119000	0.02030	GTA	-	NULL		0.577	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR156	protein_coding	OTTHUMT00000355139.1	C	NM_153002	-		119886364	-1	no_errors	ENST00000315843	ensembl	human	known	74_37	missense	SNP	0.000	T
ERVW-1	30816	genome.wustl.edu	37	7	92099781	92099781	+	5'UTR	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr7:92099781G>A	ENST00000493463.2	-	0	838				ERVW-1_ENST00000604270.1_5'UTR|ERVW-1_ENST00000603053.1_5'UTR|AC007566.10_ENST00000427458.1_RNA	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1						anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						ggaatagctagcgttgtctcc	0.463																																																	0								ENSG00000242950																																			ERVW-1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.-86C>T	7.37:g.92099781G>A		Somatic	0	24	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	11	59.26	B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000493463.2	37	NULL	CCDS5626.1	7																																																																																			-	-		0.463	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	protein_coding	OTTHUMT00000254009.2	G	NM_014590	-		92099781	-1	no_errors	ENST00000604270	ensembl	human	known	74_37	rna	SNP	0.220	A
ZNF594	84622	genome.wustl.edu	37	17	5087237	5087237	+	Silent	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr17:5087237G>T	ENST00000399604.4	-	1	455	c.315C>A	c.(313-315)ggC>ggA	p.G105G	ZNF594_ENST00000575779.1_Silent_p.G105G			Q96JF6	ZN594_HUMAN	zinc finger protein 594	105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TGAAGTTTTGGCCACTAACCT	0.378																																																	0								ENSG00000180626						74.0	70.0	71.0					17																	5087237		1847	4098	5945	ZNF594	SO:0001819	synonymous_variant	0			-	HGNC	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.315C>A	17.37:g.5087237G>T		Somatic	0	34	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q6RFS0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G105	ENST00000399604.4	37	c.315	CCDS42241.1	17																																																																																			-	smart_Znf_C2H2-like		0.378	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF594	protein_coding	OTTHUMT00000438996.1	G	XM_290737	-		5087237	-1	no_errors	ENST00000399604	ensembl	human	known	74_37	silent	SNP	0.756	T
CTAG2	30848	genome.wustl.edu	37	X	153881533	153881533	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chrX:153881533C>T	ENST00000247306.4	-	1	320	c.257G>A	c.(256-258)cGc>cAc	p.R86H	CTAG2_ENST00000369585.3_Missense_Mutation_p.R86H	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	86						centrosome (GO:0005813)		p.R86H(2)		central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGAAGCAGGCGGCTGTCCGG	0.687																																																	2	Substitution - Missense(2)	pancreas(2)						ENSG00000126890						38.0	37.0	37.0					X																	153881533		2200	4297	6497	CTAG2	SO:0001583	missense	0			-	HGNC	AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.257G>A	X.37:g.153881533C>T	ENSP00000247306:p.Arg86His	Somatic	0	22	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EKC/KEOPS_Pcc1	p.R86H	ENST00000247306.4	37	c.257	CCDS14759.1	X	.	.	.	.	.	.	.	.	.	.	c	12.41	1.929421	0.34096	.	.	ENSG00000126890	ENST00000247306;ENST00000369585;ENST00000454505	T;T	0.54071	1.06;0.59	1.39	-2.79	0.05841	.	.	.	.	.	T	0.27697	0.0681	N	0.14661	0.345	0.09310	N	1	B;B	0.23854	0.055;0.092	B;B	0.06405	0.001;0.002	T	0.13308	-1.0514	9	0.87932	D	0	0.1405	2.8387	0.05523	0.0:0.2296:0.2473:0.5231	.	86;86	O75638;O75638-2	CTAG2_HUMAN;.	H	86;86;28	ENSP00000247306:R86H;ENSP00000358598:R86H	ENSP00000247306:R86H	R	-	2	0	CTAG2	153534727	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.939000	0.03933	-0.758000	0.04690	-0.491000	0.04670	CGC	-	NULL		0.687	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	CTAG2	protein_coding	OTTHUMT00000061176.1	C	NM_020994	-		153881533	-1	no_errors	ENST00000369585	ensembl	human	known	74_37	missense	SNP	0.000	T
PYGB	5834	genome.wustl.edu	37	20	25260953	25260953	+	Missense_Mutation	SNP	C	C	T	rs375208225		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr20:25260953C>T	ENST00000216962.4	+	10	1254	c.1144C>T	c.(1144-1146)Cct>Tct	p.P382S		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	382					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						CACTGTGCTGCCTGAGGCCTT	0.542																																																	0								ENSG00000100994	C	SER/PRO	0,4406		0,0,2203	131.0	118.0	122.0		1144	3.8	1.0	20		122	1,8599	1.2+/-3.3	0,1,4299	no	missense	PYGB	NM_002862.3	74	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	382/844	25260953	1,13005	2203	4300	6503	PYGB	SO:0001583	missense	0			-	HGNC		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1144C>T	20.37:g.25260953C>T	ENSP00000216962:p.Pro382Ser	Somatic	0	38	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q96AK1|Q9NPX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.P382S	ENST00000216962.4	37	c.1144	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350179	0.82132	0.0	1.16E-4	ENSG00000100994	ENST00000216962	D	0.92858	-3.12	3.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	D	0.95108	0.8415	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94368	0.7593	10	0.36615	T	0.2	-17.4395	15.908	0.79445	0.0:1.0:0.0:0.0	.	382	P11216	PYGB_HUMAN	S	382	ENSP00000216962:P382S	ENSP00000216962:P382S	P	+	1	0	PYGB	25208953	1.000000	0.71417	0.991000	0.47740	0.926000	0.56050	7.518000	0.81795	2.144000	0.66660	0.462000	0.41574	CCT	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas		0.542	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	protein_coding	OTTHUMT00000078415.2	C	NM_002862	-		25260953	+1	no_errors	ENST00000216962	ensembl	human	known	74_37	missense	SNP	1.000	T
WSCD2	9671	genome.wustl.edu	37	12	108589816	108589816	+	Silent	SNP	C	C	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr12:108589816C>T	ENST00000332082.4	+	3	1025	c.207C>T	c.(205-207)gaC>gaT	p.D69D	WSCD2_ENST00000549903.1_Silent_p.D69D|WSCD2_ENST00000547525.1_Silent_p.D69D|WSCD2_ENST00000261400.3_Silent_p.D69D			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	69						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						TCTTGGGTGACATGCATCTGG	0.617																																																	0								ENSG00000075035						144.0	145.0	145.0					12																	108589816		2067	4220	6287	WSCD2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.207C>T	12.37:g.108589816C>T		Somatic	0	32	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	35	23.91	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WSC_carb-bd,superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.D69	ENST00000332082.4	37	c.207	CCDS41828.1	12																																																																																			-	NULL		0.617	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	protein_coding	OTTHUMT00000405554.1	C	NM_014653	-		108589816	+1	no_errors	ENST00000261400	ensembl	human	known	74_37	silent	SNP	0.016	T
GPR113	165082	genome.wustl.edu	37	2	26539786	26539786	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr2:26539786T>C	ENST00000311519.1	-	4	495	c.496A>G	c.(496-498)Aca>Gca	p.T166A	GPR113_ENST00000333478.6_Missense_Mutation_p.T107A|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000541401.1_Intron|GPR113_ENST00000421160.2_Missense_Mutation_p.T97A	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	166					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTACCTGTTGTGAGTCTGAGG	0.597																																																	0								ENSG00000173567						63.0	60.0	61.0					2																	26539786		2203	4300	6503	GPR113	SO:0001583	missense	0			-	HGNC	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.496A>G	2.37:g.26539786T>C	ENSP00000307831:p.Thr166Ala	Somatic	0	39	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	24	44.19	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T107A	ENST00000311519.1	37	c.319	CCDS46239.1	2	.	.	.	.	.	.	.	.	.	.	T	18.55	3.647299	0.67358	.	.	ENSG00000173567	ENST00000333478;ENST00000421160;ENST00000311519	T;T;T	0.56611	1.1;0.51;0.45	4.58	4.58	0.56647	.	.	.	.	.	T	0.65186	0.2667	L	0.55990	1.75	0.50813	D	0.999895	D;P;D	0.76494	0.999;0.95;0.999	D;P;D	0.76071	0.987;0.59;0.987	T	0.67597	-0.5630	9	0.72032	D	0.01	55.3733	10.3659	0.44024	0.0:0.0:0.0:1.0	.	97;107;166	E9PEV1;Q8IZF5-2;Q8IZF5	.;.;GP113_HUMAN	A	107;97;166	ENSP00000327396:T107A;ENSP00000388537:T97A;ENSP00000307831:T166A	ENSP00000307831:T166A	T	-	1	0	GPR113	26393290	0.997000	0.39634	0.022000	0.16811	0.957000	0.61999	1.590000	0.36654	1.714000	0.51371	0.402000	0.26972	ACA	-	NULL		0.597	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	protein_coding	OTTHUMT00000316892.1	T	NM_153835	-		26539786	-1	no_errors	ENST00000333478	ensembl	human	known	74_37	missense	SNP	0.295	C
HMGXB4	10042	genome.wustl.edu	37	22	35661544	35661544	+	Frame_Shift_Del	DEL	A	A	-	rs76572304		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr22:35661544delA	ENST00000216106.5	+	5	1291	c.1163delA	c.(1162-1164)gaafs	p.E388fs	HMGXB4_ENST00000444518.2_Frame_Shift_Del_p.E279fs	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	388					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GGGCATAGTGAaaaaaaaaag	0.493																																																	0								ENSG00000100281																																			HMGXB4	SO:0001589	frameshift_variant	0				HGNC	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1163delA	22.37:g.35661544delA	ENSP00000216106:p.Glu388fs	Somatic	0	33	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	O75672|O75673|Q9UMT5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K391fs	ENST00000216106.5	37	c.1163	CCDS33641.1	22																																																																																			-	superfamily_HMG_box_dom		0.493	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HMGXB4	protein_coding	OTTHUMT00000318104.2	A	NM_005487			35661544	+1	no_errors	ENST00000216106	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
C16orf62	57020	genome.wustl.edu	37	16	19584522	19584522	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr16:19584522G>T	ENST00000251143.5	+	4	379	c.367G>T	c.(367-369)Gaa>Taa	p.E123*	C16orf62_ENST00000542263.1_Nonsense_Mutation_p.E212*|C16orf62_ENST00000417362.2_Nonsense_Mutation_p.E123*|C16orf62_ENST00000538853.1_Nonsense_Mutation_p.E212*|C16orf62_ENST00000438132.3_Nonsense_Mutation_p.E212*			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	123						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CAAACGGGGAGAAATCCTTGC	0.448																																																	0								ENSG00000103544						137.0	136.0	136.0					16																	19584522		2197	4300	6497	C16orf62	SO:0001587	stop_gained	0			-	HGNC		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.367G>T	16.37:g.19584522G>T	ENSP00000251143:p.Glu123*	Somatic	0	42	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	25	47.92	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E212*	ENST00000251143.5	37	c.634		16	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641998	0.87859	.	.	ENSG00000103544	ENST00000438132;ENST00000538853;ENST00000542263;ENST00000251143;ENST00000417362	.	.	.	5.3	5.3	0.74995	.	0.060450	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-24.0285	17.9828	0.89146	0.0:0.0:1.0:0.0	.	.	.	.	X	212;212;212;123;123	.	ENSP00000251143:E123X	E	+	1	0	C16orf62	19492023	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.487000	0.97945	2.484000	0.83849	0.552000	0.68991	GAA	-	NULL		0.448	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	protein_coding		G	NM_020314	-		19584522	+1	no_errors	ENST00000438132	ensembl	human	known	74_37	nonsense	SNP	1.000	T
LILRB1	10859	genome.wustl.edu	37	19	55144624	55144624	+	Silent	SNP	G	G	A	rs369300705		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr19:55144624G>A	ENST00000396331.1	+	8	1473	c.1116G>A	c.(1114-1116)acG>acA	p.T372T	LILRB1_ENST00000396315.1_Silent_p.T372T|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396321.2_Silent_p.T372T|LILRB1_ENST00000396317.1_Silent_p.T372T|LILRB1_ENST00000427581.2_Silent_p.T408T|LILRB1_ENST00000396332.4_Silent_p.T372T|LILRB1_ENST00000418536.2_Silent_p.T372T|LILRB1_ENST00000324602.7_Silent_p.T372T|LILRB1_ENST00000434867.2_Silent_p.T372T|LILRB1_ENST00000448689.1_Silent_p.T372T|LILRB1_ENST00000396327.3_Silent_p.T372T	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	372	Ig-like C2-type 4.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		TAAGATCAACGTACCAATCTC	0.547										HNSCC(37;0.09)																																							0								ENSG00000104972	A	,,,	1,4405	825.4+/-416.5	0,1,2202	117.0	127.0	123.0		1116,1116,1116,1116	0.9	0.0	19		123	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LILRB1	NM_001081637.1,NM_001081638.1,NM_001081639.1,NM_006669.3	,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,	372/653,372/652,372/652,372/651	55144624	1,13005	2203	4300	6503	LILRB1	SO:0001819	synonymous_variant	0			-	HGNC	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1116G>A	19.37:g.55144624G>A		Somatic	0	62	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	34	41.38	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T372	ENST00000396331.1	37	c.1116	CCDS42617.1	19																																																																																			-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.547	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	protein_coding	OTTHUMT00000140796.4	G		-		55144624	+1	no_errors	ENST00000324602	ensembl	human	known	74_37	silent	SNP	0.000	A
SLC16A9	220963	genome.wustl.edu	37	10	61413832	61413832	+	Missense_Mutation	SNP	T	T	G	rs199889507	byFrequency	TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr10:61413832T>G	ENST00000395348.3	-	5	1588	c.952A>C	c.(952-954)Atc>Ctc	p.I318L	SLC16A9_ENST00000395347.1_Missense_Mutation_p.I318L	NM_194298.2	NP_919274.1	Q7RTY1	MOT9_HUMAN	solute carrier family 16, member 9	318					urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			kidney(3)|large_intestine(5)|lung(5)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	23						AACCCTCCGATGTCAAAGAGT	0.358																																																	0								ENSG00000165449						54.0	53.0	53.0					10																	61413832		2203	4300	6503	SLC16A9	SO:0001583	missense	0			-	HGNC	AK125791	CCDS7256.1	10q21.3	2013-07-18	2013-07-18	2004-01-21	ENSG00000165449	ENSG00000165449		"""Solute carriers"""	23520	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 9"""	614242	"""chromosome 10 open reading frame 36"", ""solute carrier family 16 (monocarboxylic acid transporters), member 9"", ""solute carrier family 16, member 9 (monocarboxylic acid transporter 9)"""	C10orf36			Standard	NM_194298		Approved	FLJ43803, MCT9	uc010qig.1	Q7RTY1	OTTHUMG00000018283	ENST00000395348.3:c.952A>C	10.37:g.61413832T>G	ENSP00000378757:p.Ile318Leu	Somatic	0	27	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	7	68.18	Q6ZMI2|Q9UFH8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I318L	ENST00000395348.3	37	c.952	CCDS7256.1	10	.	.	.	.	.	.	.	.	.	.	T	8.009	0.757144	0.15846	.	.	ENSG00000165449	ENST00000395348;ENST00000395347	T;T	0.57752	0.38;0.38	4.92	2.56	0.30785	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.177997	0.49305	D	0.000146	T	0.25121	0.0610	N	0.10733	0.035	0.40526	D	0.980884	B	0.02656	0.0	B	0.12156	0.007	T	0.22068	-1.0227	10	0.02654	T	1	.	9.2212	0.37377	0.0:0.1503:0.0:0.8497	.	318	Q7RTY1	MOT9_HUMAN	L	318	ENSP00000378757:I318L;ENSP00000378756:I318L	ENSP00000378756:I318L	I	-	1	0	SLC16A9	61083838	1.000000	0.71417	0.911000	0.35937	0.960000	0.62799	1.395000	0.34520	0.230000	0.21059	-0.346000	0.07831	ATC	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.358	SLC16A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC16A9	protein_coding	OTTHUMT00000048174.2	T	NM_194298	-		61413832	-1	no_errors	ENST00000395347	ensembl	human	known	74_37	missense	SNP	1.000	G
NLRP9	338321	genome.wustl.edu	37	19	56241270	56241270	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr19:56241270T>C	ENST00000332836.2	-	3	1948	c.1921A>G	c.(1921-1923)Agc>Ggc	p.S641G		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	641						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TCATCAAGGCTGGTATTTTCC	0.428																																																	0								ENSG00000185792						102.0	101.0	102.0					19																	56241270		2203	4300	6503	NLRP9	SO:0001583	missense	0			-	HGNC	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1921A>G	19.37:g.56241270T>C	ENSP00000331857:p.Ser641Gly	Somatic	0	41	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	B2RN12|Q86W27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.S641G	ENST00000332836.2	37	c.1921	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	t	4.261	0.047573	0.08243	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.52754	0.65	3.4	-1.53	0.08611	.	.	.	.	.	T	0.28499	0.0705	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.20240	-1.0281	9	0.22706	T	0.39	.	6.3944	0.21605	0.0:0.1069:0.5542:0.339	.	641	Q7RTR0	NALP9_HUMAN	G	641	ENSP00000331857:S641G	ENSP00000331857:S641G	S	-	1	0	NLRP9	60933082	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.200000	0.09478	-0.391000	0.07763	-1.193000	0.01689	AGC	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.428	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	protein_coding	OTTHUMT00000453653.1	T	NM_176820	-		56241270	-1	no_errors	ENST00000332836	ensembl	human	known	74_37	missense	SNP	0.000	C
SLC6A17	388662	genome.wustl.edu	37	1	110714757	110714757	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:110714757G>T	ENST00000331565.4	+	3	847	c.362G>T	c.(361-363)gGt>gTt	p.G121V	RP5-1028L10.1_ENST00000443008.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	121					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CTGGCTGTGGGTCAGAGGATC	0.622																																																	0								ENSG00000197106						69.0	50.0	57.0					1																	110714757		2203	4300	6503	SLC6A17	SO:0001583	missense	0			-	HGNC		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.362G>T	1.37:g.110714757G>T	ENSP00000330199:p.Gly121Val	Somatic	0	51	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.G121V	ENST00000331565.4	37	c.362	CCDS30799.1	1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.854008	0.91355	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	D	0.97924	-4.61	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.99456	0.9807	H	0.99454	4.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98029	1.0375	10	0.87932	D	0	.	18.6986	0.91611	0.0:0.0:1.0:0.0	.	121	Q9H1V8	S6A17_HUMAN	V	121	ENSP00000330199:G121V	ENSP00000330199:G121V	G	+	2	0	SLC6A17	110516280	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.869000	0.99810	2.404000	0.81709	0.585000	0.79938	GGT	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.622	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A17	protein_coding	OTTHUMT00000032550.2	G	XM_371280	-		110714757	+1	no_errors	ENST00000331565	ensembl	human	known	74_37	missense	SNP	1.000	T
COG7	91949	genome.wustl.edu	37	16	23430054	23430054	+	Silent	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr16:23430054G>A	ENST00000307149.5	-	8	1289	c.1104C>T	c.(1102-1104)agC>agT	p.S368S		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	368					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		TGAGGAGGTTGCTCTCTTCCA	0.517																																																	0								ENSG00000168434						136.0	100.0	112.0					16																	23430054		2197	4300	6497	COG7	SO:0001819	synonymous_variant	0			-	HGNC	AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1104C>T	16.37:g.23430054G>A		Somatic	0	22	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q6UWU7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_COG7	p.S368	ENST00000307149.5	37	c.1104	CCDS10610.1	16																																																																																			-	pfam_COG7		0.517	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG7	protein_coding	OTTHUMT00000211625.1	G		-		23430054	-1	no_errors	ENST00000307149	ensembl	human	known	74_37	silent	SNP	0.000	A
POLA1	5422	genome.wustl.edu	37	X	24760226	24760226	+	Silent	SNP	T	T	C			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chrX:24760226T>C	ENST00000379059.3	+	22	2451	c.2436T>C	c.(2434-2436)ccT>ccC	p.P812P	SCARNA23_ENST00000516060.1_RNA|POLA1_ENST00000379068.3_Silent_p.P818P	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	812					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TCAGAAAGCCTCAGCAAAAAC	0.423																																																	0								ENSG00000101868						91.0	78.0	82.0					X																	24760226		2203	4300	6503	POLA1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.2436T>C	X.37:g.24760226T>C		Somatic	0	226	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	232	8.66	Q86UQ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.P818	ENST00000379059.3	37	c.2454	CCDS14214.1	X																																																																																			-	pfam_DNA-dir_DNA_pol_B_multi_dom,smart_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2		0.423	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	protein_coding	OTTHUMT00000056111.1	T	NM_016937	-		24760226	+1	no_errors	ENST00000379068	ensembl	human	known	74_37	silent	SNP	1.000	C
IMMP2L	83943	genome.wustl.edu	37	7	110568408	110568413	+	Intron	DEL	CACACA	CACACA	-	rs13230194|rs71692948|rs202224708|rs58639346	byFrequency	TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	CACACA	CACACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr7:110568408_110568413delCACACA	ENST00000405709.2	-	4	748				AC005161.1_ENST00000408352.1_RNA|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000452895.1_Intron	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)						ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		TATGTACCTGcacacacacacacaca	0.325														2795	0.558107	0.4917	0.5159	5008	,	,		10746	0.6706		0.4742	False		,,,				2504	0.6483																0								ENSG00000221279																																			AC005161.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.305+35142TGTGTG>-	7.37:g.110568414_110568419delCACACA		Somatic	NA	NA	NA		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000405709.2	37	NULL	CCDS5753.1	7																																																																																			-	-		0.325	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221279	protein_coding	OTTHUMT00000338109.4	CACACA	NM_032549			110568413	+1	no_errors	ENST00000408352	ensembl	human	novel	74_37	rna	DEL	0.000:0.003:0.009:0.052:0.060:0.063	-
RALGAPB	57148	genome.wustl.edu	37	20	37137749	37137749	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr20:37137749T>A	ENST00000262879.6	+	6	1054	c.770T>A	c.(769-771)tTt>tAt	p.F257Y	RALGAPB_ENST00000397042.3_Missense_Mutation_p.F257Y|RALGAPB_ENST00000397040.1_Missense_Mutation_p.F257Y|RALGAPB_ENST00000397038.1_Missense_Mutation_p.F35Y|RALGAPB_ENST00000537204.1_Missense_Mutation_p.F257Y			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	257					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						GGTCCTTCATTTCCTGCATTT	0.378																																																	0								ENSG00000170471						221.0	198.0	206.0					20																	37137749		2203	4300	6503	RALGAPB	SO:0001583	missense	0			-	HGNC	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.770T>A	20.37:g.37137749T>A	ENSP00000262879:p.Phe257Tyr	Somatic	0	86	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	71	21.98	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.F257Y	ENST00000262879.6	37	c.770	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	T	29.3	4.996030	0.93167	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000304939;ENST00000397038;ENST00000537204;ENST00000397040;ENST00000438490	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.68467	0.3004	L	0.43923	1.385	0.80722	D	1	D;D;D;D	0.67145	0.996;0.989;0.989;0.989	D;D;D;D	0.76071	0.987;0.969;0.969;0.969	T	0.67457	-0.5666	9	0.38643	T	0.18	.	15.2591	0.73606	0.0:0.0:0.0:1.0	.	257;257;257;257	B4E2E8;Q86X10-4;A2A2E9;Q86X10	.;.;.;RLGPB_HUMAN	Y	257;257;257;35;257;257;85	.	ENSP00000262879:F257Y	F	+	2	0	RALGAPB	36571163	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.037000	0.88933	2.024000	0.59613	0.383000	0.25322	TTT	-	NULL		0.378	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	protein_coding	OTTHUMT00000079191.1	T	NM_020336	-		37137749	+1	no_errors	ENST00000262879	ensembl	human	known	74_37	missense	SNP	1.000	A
FANK1	92565	genome.wustl.edu	37	10	127585221	127585221	+	Nonsense_Mutation	SNP	C	C	T	rs202109621		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr10:127585221C>T	ENST00000368693.1	+	1	114	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	FANK1_ENST00000449042.2_5'UTR|FANK1_ENST00000368695.1_5'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	4						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				CATGGAGCCCCAGAGTAAGGg	0.756																																																	0								ENSG00000203780						8.0	12.0	11.0					10																	127585221		2169	4258	6427	FANK1	SO:0001587	stop_gained	0			-	HGNC	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.10C>T	10.37:g.127585221C>T	ENSP00000357682:p.Gln4*	Somatic	0	107	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	92	8.91	Q6UXY9|Q6X7T6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3,prints_Ankyrin_rpt	p.Q4*	ENST00000368693.1	37	c.10	CCDS31309.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.122908	0.94429	.	.	ENSG00000203780	ENST00000368693	.	.	.	2.62	1.68	0.24146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	6.8436	0.23977	0.274:0.726:0.0:0.0	.	.	.	.	X	4	.	ENSP00000357682:Q4X	Q	+	1	0	FANK1	127575211	1.000000	0.71417	0.999000	0.59377	0.552000	0.35366	1.578000	0.36525	0.621000	0.30232	0.462000	0.41574	CAG	-	NULL		0.756	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	protein_coding		C	NM_145235	rs202109621		127585221	+1	no_errors	ENST00000368693	ensembl	human	known	74_37	nonsense	SNP	0.999	T
CASP5	838	genome.wustl.edu	37	11	104878040	104878041	+	Frame_Shift_Ins	INS	-	-	T	rs112680102|rs144697764		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr11:104878040_104878041insT	ENST00000260315.3	-	3	201_202	c.202_203insA	c.(202-204)acafs	p.T68fs	CASP5_ENST00000393141.2_Frame_Shift_Ins_p.T81fs|CASP5_ENST00000526056.1_Frame_Shift_Ins_p.T81fs|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000444749.2_Frame_Shift_Ins_p.T10fs|CASP5_ENST00000531367.1_Intron|CASP5_ENST00000393139.2_Frame_Shift_Ins_p.T35fs			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	68	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.T52fs*26(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CATCTTAACTGTTTTTTTTTTG	0.356																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000137757																																			CASP5	SO:0001589	frameshift_variant	0				HGNC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.203dupA	11.37:g.104878050_104878050dupT	ENSP00000260315:p.Thr68fs	Somatic	0	31	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.T81fs	ENST00000260315.3	37	c.242_241	CCDS8328.2	11																																																																																			-	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta,pfscan_CARD		0.356	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	protein_coding	OTTHUMT00000109397.2	-	NM_004347			104878041	-1	no_errors	ENST00000393141	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	T
RABGAP1L	9910	genome.wustl.edu	37	1	174200309	174200309	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:174200309C>A	ENST00000251507.4	+	4	532	c.358C>A	c.(358-360)Cca>Aca	p.P120T	RABGAP1L_ENST00000367689.3_5'UTR|RABGAP1L_ENST00000357444.6_Missense_Mutation_p.P83T	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						ACCATCTTCTCCAGGTGGACT	0.378																																																	0								ENSG00000152061						60.0	61.0	60.0					1																	174200309		2203	4300	6503	RABGAP1L	SO:0001583	missense	0			-	HGNC	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.358C>A	1.37:g.174200309C>A	ENSP00000251507:p.Pro120Thr	Somatic	0	21	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	29	32.56	B7ZAA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.P120T	ENST00000251507.4	37	c.358	CCDS1314.1	1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259951	0.80246	.	.	ENSG00000152061	ENST00000357444;ENST00000251507;ENST00000457696;ENST00000367692	T;T;T	0.46819	0.86;3.5;0.92	5.59	5.59	0.84812	.	0.179677	0.49305	D	0.000150	T	0.48642	0.1511	L	0.47716	1.5	0.80722	D	1	P;P;P	0.50617	0.937;0.63;0.822	B;B;B	0.43916	0.421;0.434;0.436	T	0.47649	-0.9101	10	0.45353	T	0.12	.	19.5944	0.95530	0.0:1.0:0.0:0.0	.	120;120;83	B7WPG6;Q5R372;Q5R372-2	.;RBG1L_HUMAN;.	T	83;120;120;120	ENSP00000350027:P83T;ENSP00000251507:P120T;ENSP00000403136:P120T	ENSP00000251507:P120T	P	+	1	0	RABGAP1L	172466932	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.141000	0.64814	2.627000	0.88993	0.563000	0.77884	CCA	-	NULL		0.378	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1L	protein_coding	OTTHUMT00000084497.1	C	NM_001243765	-		174200309	+1	no_errors	ENST00000251507	ensembl	human	known	74_37	missense	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100677255	100677255	+	Frame_Shift_Del	DEL	C	C	-	rs140905069		TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr7:100677255delC	ENST00000306151.4	+	3	2622	c.2558delC	c.(2557-2559)accfs	p.T853fs		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	853	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.T853N(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTGAAGGTACCAGCATGCCA	0.488																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000169876						290.0	282.0	285.0					7																	100677255		2203	4298	6501	MUC17	SO:0001589	frameshift_variant	0				HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2558delC	7.37:g.100677255delC	ENSP00000302716:p.Thr853fs	Somatic	0	54	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	56	37.78	O14761|Q685J2|Q8TDH7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S854fs	ENST00000306151.4	37	c.2558	CCDS34711.1	7																																																																																			-	NULL		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	C	NM_001040105			100677255	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
KIAA0754	643314	genome.wustl.edu	37	1	39877426	39877426	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HP-01A-11D-A387-09	TCGA-3B-A9HP-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bd65431f-eb47-461e-bf3f-5bcbe231c50d	d674737f-2b83-480d-9de2-ee333824475e	g.chr1:39877426G>A	ENST00000530275.1	+	1	1276	c.1081G>A	c.(1081-1083)Gca>Aca	p.A361T	MACF1_ENST00000372915.3_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	361										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGGGCTGGCTGCATCCCAGGA	0.408																																																	0								ENSG00000255103						60.0	59.0	59.0					1																	39877426		1842	4092	5934	KIAA0754	SO:0001583	missense	0			-	HGNC			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1081G>A	1.37:g.39877426G>A	ENSP00000431179:p.Ala361Thr	Somatic	0	28	0.00		0.6252137825298707	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A361T	ENST00000530275.1	37	c.1081		1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323907	0.24080	.	.	ENSG00000255103	ENST00000530275	D	0.85556	-2.0	5.14	0.492	0.16872	.	.	.	.	.	T	0.66790	0.2825	N	0.08118	0	0.09310	N	1	B	0.21225	0.053	B	0.18561	0.022	T	0.57418	-0.7815	9	0.87932	D	0	.	2.9356	0.05814	0.1053:0.425:0.2458:0.2239	.	361	O94854	K0754_HUMAN	T	361	ENSP00000431179:A361T	ENSP00000431179:A361T	A	+	1	0	RP4-562N20.1	39650013	0.000000	0.05858	0.966000	0.40874	0.352000	0.29268	-0.168000	0.09925	0.177000	0.19895	-0.211000	0.12701	GCA	-	NULL		0.408	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	protein_coding	OTTHUMT00000392100.1	G	NM_015038	-		39877426	+1	no_errors	ENST00000530275	ensembl	human	known	74_37	missense	SNP	0.062	A
