#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
OPRK1	4986	genome.wustl.edu	37	8	54163589	54163589	+	Silent	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr8:54163589G>T	ENST00000265572.3	-	2	306	c.9C>A	c.(7-9)tcC>tcA	p.S3S	OPRK1_ENST00000520287.1_Silent_p.S3S	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	3					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TCTGGATCGGGGAGTCCATGG	0.711																																																	0								ENSG00000082556						6.0	9.0	8.0					8																	54163589		1954	4010	5964	OPRK1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.9C>A	8.37:g.54163589G>T		Somatic	0	28	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	E5RHC9|Q499G4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Kappa_opi_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Neuropept_B/W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.S3	ENST00000265572.3	37	c.9	CCDS6152.1	8																																																																																			-	NULL		0.711	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	protein_coding	OTTHUMT00000378048.1	G		-		54163589	-1	no_errors	ENST00000265572	ensembl	human	known	74_37	silent	SNP	0.999	T
LRRK1	79705	genome.wustl.edu	37	15	101554526	101554526	+	Silent	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr15:101554526C>T	ENST00000388948.3	+	11	1784	c.1425C>T	c.(1423-1425)ctC>ctT	p.L475L	LRRK1_ENST00000284395.5_Silent_p.L472L	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CTCAGGCCCTCATGTTCTTGA	0.547																																																	0								ENSG00000154237						84.0	89.0	87.0					15																	101554526		1932	4124	6056	LRRK1	SO:0001819	synonymous_variant	0			-	HGNC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1425C>T	15.37:g.101554526C>T		Somatic	0	34	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.L475	ENST00000388948.3	37	c.1425	CCDS42086.1	15																																																																																			-	smart_Leu-rich_rpt_typical-subtyp		0.547	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	protein_coding	OTTHUMT00000384567.2	C	NM_024652	-		101554526	+1	no_errors	ENST00000388948	ensembl	human	known	74_37	silent	SNP	0.999	T
GRAMD4	23151	genome.wustl.edu	37	22	47059047	47059047	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr22:47059047G>A	ENST00000406902.1	+	6	790	c.577G>A	c.(577-579)Gag>Aag	p.E193K	GRAMD4_ENST00000361034.3_Missense_Mutation_p.E193K			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	193					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		TGTGGAGACAGAGGAACCCCT	0.677																																																	0								ENSG00000075240						55.0	62.0	60.0					22																	47059047		2203	4300	6503	GRAMD4	SO:0001583	missense	0			-	HGNC		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.577G>A	22.37:g.47059047G>A	ENSP00000385689:p.Glu193Lys	Somatic	0	86	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	64	16.88	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GRAM,smart_GRAM	p.E193K	ENST00000406902.1	37	c.577	CCDS33672.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.148503|4.148503	0.78001|0.78001	.|.	.|.	ENSG00000075240|ENSG00000075240	ENST00000406902;ENST00000361034|ENST00000456069	T;T|.	0.40225|.	1.04;1.04|.	4.77|4.77	4.77|4.77	0.60923|0.60923	.|.	0.060085|.	0.64402|.	D|.	0.000007|.	T|T	0.70587|0.70587	0.3241|0.3241	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999999|0.999999	P;B|.	0.46142|.	0.873;0.393|.	B;B|.	0.41510|.	0.359;0.121|.	T|T	0.68773|0.68773	-0.5320|-0.5320	10|5	0.52906|.	T|.	0.07|.	-30.4068|-30.4068	16.1456|16.1456	0.81563|0.81563	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	15;193|.	B0QZ08;Q6IC98|.	.;GRAM4_HUMAN|.	K|K	193|15	ENSP00000385689:E193K;ENSP00000354313:E193K|.	ENSP00000354313:E193K|.	E|R	+|+	1|2	0|0	GRAMD4|GRAMD4	45437711|45437711	1.000000|1.000000	0.71417|0.71417	0.956000|0.956000	0.39512|0.39512	0.288000|0.288000	0.27193|0.27193	6.678000|6.678000	0.74508|0.74508	2.602000|2.602000	0.87976|0.87976	0.558000|0.558000	0.71614|0.71614	GAG|AGA	-	NULL		0.677	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	protein_coding	OTTHUMT00000317969.1	G	NM_015124	-		47059047	+1	no_errors	ENST00000361034	ensembl	human	known	74_37	missense	SNP	0.999	A
OR1K1	392392	genome.wustl.edu	37	9	125562968	125562968	+	Silent	SNP	G	G	T	rs149046653		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:125562968G>T	ENST00000277309.2	+	1	599	c.567G>T	c.(565-567)tcG>tcT	p.S189S		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						TAAGGCTCTCGTGCTCTGACA	0.592																																																	0								ENSG00000165204	G		0,4406		0,0,2203	112.0	91.0	98.0		567	-9.0	0.0	9	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OR1K1	NM_080859.1		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		189/317	125562968	1,13005	2203	4300	6503	OR1K1	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.567G>T	9.37:g.125562968G>T		Somatic	0	57	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B9EH41|Q4VXB7|Q96R23	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S189	ENST00000277309.2	37	c.567	CCDS35132.1	9																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.592	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1K1	protein_coding	OTTHUMT00000053958.1	G		rs149046653		125562968	+1	no_errors	ENST00000277309	ensembl	human	known	74_37	silent	SNP	0.001	T
OTOP3	347741	genome.wustl.edu	37	17	72943417	72943417	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr17:72943417G>T	ENST00000328801.4	+	6	1467	c.1467G>T	c.(1465-1467)caG>caT	p.Q489H		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	489						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					CAGGAAAGCAGGAGGCTGAGC	0.647																																																	0								ENSG00000182938						26.0	27.0	27.0					17																	72943417		2203	4300	6503	OTOP3	SO:0001583	missense	0			-	HGNC	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.1467G>T	17.37:g.72943417G>T	ENSP00000328090:p.Gln489His	Somatic	0	62	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Otopetrin	p.Q489H	ENST00000328801.4	37	c.1467	CCDS11709.1	17	.	.	.	.	.	.	.	.	.	.	G	2.263	-0.368802	0.05069	.	.	ENSG00000182938	ENST00000328801	T	0.08634	3.07	4.02	-3.46	0.04767	.	3.373660	0.00859	N	0.001915	T	0.09024	0.0223	L	0.43152	1.355	0.09310	N	1	B	0.12013	0.005	B	0.15052	0.012	T	0.41395	-0.9511	10	0.49607	T	0.09	0.9626	7.9648	0.30091	0.4816:0.1072:0.4112:0.0	.	489	Q7RTS5	OTOP3_HUMAN	H	489	ENSP00000328090:Q489H	ENSP00000328090:Q489H	Q	+	3	2	OTOP3	70455012	0.000000	0.05858	0.008000	0.14137	0.094000	0.18550	-1.124000	0.03260	-0.534000	0.06315	-0.379000	0.06801	CAG	-	NULL		0.647	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP3	protein_coding	OTTHUMT00000445308.1	G	NM_178233	-		72943417	+1	no_errors	ENST00000328801	ensembl	human	known	74_37	missense	SNP	0.000	T
CENPC	1060	genome.wustl.edu	37	4	68357896	68357896	+	Splice_Site	SNP	A	A	C			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:68357896A>C	ENST00000273853.6	-	16	2766		c.e16+1			NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C						chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										GCCTGATCTTACCCATGAGAA	0.383																																																	0								ENSG00000145241						107.0	91.0	96.0					4																	68357896		1833	4086	5919	CENPC	SO:0001630	splice_region_variant	0			-	HGNC	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2515+1T>G	4.37:g.68357896A>C		Somatic	0	78	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	57	35.96	Q8IW27|Q9P0M5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e16+2	ENST00000273853.6	37	c.2515+2	CCDS47063.1	4	.	.	.	.	.	.	.	.	.	.	A	18.27	3.587082	0.66105	.	.	ENSG00000145241	ENST00000273853	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3065	0.49338	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CENPC1	68040491	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.625000	0.61262	2.235000	0.73313	0.460000	0.39030	.	-	-		0.383	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPC	protein_coding	OTTHUMT00000362001.2	A		-	Intron	68357896	-1	no_errors	ENST00000273853	ensembl	human	known	74_37	splice_site	SNP	1.000	C
SETX	23064	genome.wustl.edu	37	9	135137998	135137998	+	3'UTR	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:135137998C>T	ENST00000224140.5	-	0	9844				SETX_ENST00000477049.1_5'UTR|SETX_ENST00000372169.2_3'UTR|SETX_ENST00000393220.1_3'UTR	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin						cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CAGGAAGTCACCTGCTCCCTG	0.527																																																	0								ENSG00000107290																																			SETX	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.*1628G>A	9.37:g.135137998C>T		Somatic	0	37	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000224140.5	37	NULL	CCDS6947.1	9																																																																																			-	-		0.527	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	protein_coding	OTTHUMT00000054774.3	C	NM_015046	-		135137998	-1	no_errors	ENST00000477049	ensembl	human	known	74_37	rna	SNP	0.000	T
CR2	1380	genome.wustl.edu	37	1	207649750	207649750	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:207649750C>G	ENST00000367058.3	+	14	2900	c.2711C>G	c.(2710-2712)gCc>gGc	p.A904G	CR2_ENST00000367057.3_Missense_Mutation_p.A963G|CR2_ENST00000367059.3_Intron|CR2_ENST00000458541.2_Missense_Mutation_p.A877G	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	904	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						AGCCAACCTGCCCCTCATTGT	0.413																																																	0								ENSG00000117322						59.0	54.0	55.0					1																	207649750		2203	4300	6503	CR2	SO:0001583	missense	0			-	HGNC	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2711C>G	1.37:g.207649750C>G	ENSP00000356025:p.Ala904Gly	Somatic	0	77	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	33	29.79	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.A963G	ENST00000367058.3	37	c.2888	CCDS1478.1	1	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374802	0.42105	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000458541	T;T;T	0.65732	-0.17;-0.17;-0.17	4.87	-1.35	0.09114	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.67496	0.2899	M	0.90145	3.09	0.09310	N	1	B;P	0.36616	0.368;0.561	B;P	0.45610	0.426;0.487	T	0.58973	-0.7541	9	0.29301	T	0.29	.	2.7925	0.05392	0.3329:0.3403:0.0:0.3268	.	904;963	P20023;P20023-3	CR2_HUMAN;.	G	904;963;877	ENSP00000356025:A904G;ENSP00000356024:A963G;ENSP00000404222:A877G	ENSP00000356024:A963G	A	+	2	0	CR2	205716373	0.000000	0.05858	0.033000	0.17914	0.855000	0.48748	-0.409000	0.07160	-0.027000	0.13873	0.655000	0.94253	GCC	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.413	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	protein_coding	OTTHUMT00000088274.1	C	NM_001877	-		207649750	+1	no_errors	ENST00000367057	ensembl	human	known	74_37	missense	SNP	0.106	G
HAUS7	55559	genome.wustl.edu	37	X	152721042	152721042	+	Silent	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chrX:152721042G>A	ENST00000370211.4	-	8	961	c.918C>T	c.(916-918)ccC>ccT	p.P306P	TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000421080.2_Missense_Mutation_p.P128L|HAUS7_ENST00000484394.1_5'UTR|TREX2_ENST00000370232.1_5'UTR|TREX2_ENST00000338525.2_5'UTR|HAUS7_ENST00000370212.3_Silent_p.P306P|TREX2_ENST00000334497.2_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	306					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						CCTGGATGATGGGGCCGCACG	0.622																																																	0								ENSG00000213397						88.0	69.0	75.0					X																	152721042		2203	4298	6501	HAUS7	SO:0001819	synonymous_variant	0			-	HGNC	AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.918C>T	X.37:g.152721042G>A		Somatic	0	118	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	67	31.31	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P128L	ENST00000370211.4	37	c.383	CCDS35438.1	X	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287466	0.40494	.	.	ENSG00000213397	ENST00000435662;ENST00000421080	T	0.26957	1.7	4.99	4.07	0.47477	.	0.319686	0.33309	N	0.005042	T	0.25531	0.0621	.	.	.	0.33026	D	0.529479	.	.	.	.	.	.	T	0.24190	-1.0167	7	0.24483	T	0.36	-25.7866	10.1883	0.43011	0.0:0.0:0.8024:0.1976	.	.	.	.	L	90;128	ENSP00000389431:P90L	ENSP00000395447:P128L	P	-	2	0	HAUS7	152374236	0.677000	0.27577	0.975000	0.42487	0.390000	0.30446	0.637000	0.24659	2.221000	0.72209	0.292000	0.19580	CCA	-	NULL		0.622	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HAUS7	protein_coding	OTTHUMT00000060963.2	G	NM_017518	-		152721042	-1	no_errors	ENST00000421080	ensembl	human	known	74_37	missense	SNP	0.936	A
LRRC42	115353	genome.wustl.edu	37	1	54427720	54427720	+	Silent	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:54427720C>T	ENST00000371370.3	+	6	1259	c.738C>T	c.(736-738)atC>atT	p.I246I	LRRC42_ENST00000477905.1_3'UTR|LRRC42_ENST00000319223.4_Silent_p.I246I	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	246										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						ACCCTGAGATCACAGATGCAG	0.398																																																	0								ENSG00000116212						144.0	139.0	141.0					1																	54427720		2203	4300	6503	LRRC42	SO:0001819	synonymous_variant	0			-	HGNC	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.738C>T	1.37:g.54427720C>T		Somatic	0	90	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	108	27.03	D3DQ46|Q8N2Q8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I246	ENST00000371370.3	37	c.738	CCDS585.1	1																																																																																			-	NULL		0.398	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC42	protein_coding	OTTHUMT00000023250.1	C	NM_052940	-		54427720	+1	no_errors	ENST00000319223	ensembl	human	known	74_37	silent	SNP	1.000	T
LRRC63	220416	genome.wustl.edu	37	13	46802140	46802140	+	Silent	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr13:46802140G>T	ENST00000595396.1	+	2	579	c.579G>T	c.(577-579)tcG>tcT	p.S193S	LRRC63_ENST00000446175.1_Silent_p.S193S			Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	193										lung(1)|ovary(1)	2						AGCACATCTCGAGAGACTTAA	0.433																																																	0								ENSG00000173988																																			LRRC63	SO:0001819	synonymous_variant	0			-	HGNC		CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.579G>T	13.37:g.46802140G>T		Somatic	0	62	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5TBN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S193	ENST00000595396.1	37	c.579		13																																																																																			-	NULL		0.433	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LRRC63	protein_coding	OTTHUMT00000463266.1	G	XM_001718341	-		46802140	+1	no_errors	ENST00000446175	ensembl	human	known	74_37	silent	SNP	0.000	T
ABCD1	215	genome.wustl.edu	37	X	153008509	153008509	+	Missense_Mutation	SNP	C	C	G	rs4010613		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chrX:153008509C>G	ENST00000218104.3	+	8	2248	c.1849C>G	c.(1849-1851)Cgc>Ggc	p.R617G	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	617	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> C (in ALD; ALD-type and asymptomatic). {ECO:0000269|PubMed:8040304, ECO:0000269|PubMed:8566952}.|R -> G (in ALD; ADO and AMN-types with cerebral involvement). {ECO:0000269|PubMed:8566952}.|R -> H (in ALD). {ECO:0000269|PubMed:21700483, ECO:0000269|PubMed:8040304}.		alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGGCATGGCCCGCATGTTCTA	0.647																																																	0			GRCh37	CD051288|CM940041|CM960044	ABCD1	D|M	rs4010613	ENSG00000101986						42.0	28.0	33.0					X																	153008509		2194	4288	6482	ABCD1	SO:0001583	missense	0			-	HGNC	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1849C>G	X.37:g.153008509C>G	ENSP00000218104:p.Arg617Gly	Somatic	0	168	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	80	37.21	Q6GTZ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_Peroxi_TM,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_FA_transporter	p.R617G	ENST00000218104.3	37	c.1849	CCDS14728.1	X	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296668	0.81025	.	.	ENSG00000101986	ENST00000218104	D	0.99889	-7.55	5.46	5.46	0.80206	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000002	D	0.99910	0.9957	M	0.93241	3.395	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.96070	0.9045	10	0.87932	D	0	-32.3224	17.0243	0.86441	0.0:1.0:0.0:0.0	.	617	P33897	ABCD1_HUMAN	G	617	ENSP00000218104:R617G	ENSP00000218104:R617G	R	+	1	0	ABCD1	152661703	0.999000	0.42202	1.000000	0.80357	0.990000	0.78478	4.321000	0.59209	2.283000	0.76528	0.429000	0.28392	CGC	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_FA_transporter		0.647	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD1	protein_coding	OTTHUMT00000061041.1	C	NM_000033	-		153008509	+1	no_errors	ENST00000218104	ensembl	human	known	74_37	missense	SNP	1.000	G
LRRC42	115353	genome.wustl.edu	37	1	54427946	54427946	+	Intron	SNP	C	C	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:54427946C>G	ENST00000371370.3	+	7	1334				LRRC42_ENST00000477905.1_3'UTR|LRRC42_ENST00000319223.4_Intron	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42											breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						ATTTGCATTTCTGATCTGTCT	0.388																																																	0								ENSG00000116212						71.0	68.0	69.0					1																	54427946		2203	4300	6503	LRRC42	SO:0001627	intron_variant	0			-	HGNC	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.814-23C>G	1.37:g.54427946C>G		Somatic	0	78	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	102	25.55	D3DQ46|Q8N2Q8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371370.3	37	NULL	CCDS585.1	1																																																																																			-	-		0.388	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC42	protein_coding	OTTHUMT00000023250.1	C	NM_052940	-		54427946	+1	no_errors	ENST00000477905	ensembl	human	known	74_37	rna	SNP	0.011	G
DMBT1	1755	genome.wustl.edu	37	10	124336090	124336090	+	Silent	SNP	A	A	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr10:124336090A>G	ENST00000338354.3	+	7	565	c.459A>G	c.(457-459)ggA>ggG	p.G153G	DMBT1_ENST00000344338.3_Silent_p.G153G|DMBT1_ENST00000368955.3_Silent_p.G153G|DMBT1_ENST00000359586.6_Silent_p.G153G|DMBT1_ENST00000368909.3_Silent_p.G153G|DMBT1_ENST00000330163.4_Silent_p.G153G|DMBT1_ENST00000368956.2_Silent_p.G153G			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	153	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CAGCTCCAGGAAATGCCTGGT	0.612																																					Ovarian(182;93 2026 18125 22222 38972)												0								ENSG00000187908						152.0	156.0	155.0					10																	124336090		2102	4250	6352	DMBT1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.459A>G	10.37:g.124336090A>G		Somatic	1	219	0.45		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	27	67.07	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.G153	ENST00000338354.3	37	c.459		10																																																																																			-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.612	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	protein_coding	OTTHUMT00000050792.2	A	NM_004406	-		124336090	+1	no_errors	ENST00000338354	ensembl	human	known	74_37	silent	SNP	0.000	G
TEX13B	56156	genome.wustl.edu	37	X	107224536	107224536	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chrX:107224536G>T	ENST00000302917.1	-	3	805	c.713C>A	c.(712-714)gCa>gAa	p.A238E		NM_031273.2	NP_112563.1	Q9BXU2	TX13B_HUMAN	testis expressed 13B	238										breast(1)|endometrium(5)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28						TTCTCCCTCTGCCCCGCAAAG	0.597																																																	0								ENSG00000170925						149.0	133.0	139.0					X																	107224536		2199	4300	6499	TEX13B	SO:0001583	missense	0			-	HGNC	AF285598	CCDS14534.1	Xq23	2008-02-05	2007-03-13		ENSG00000170925	ENSG00000170925			11736	protein-coding gene	gene with protein product		300313	"""testis expressed sequence 13B"""			11279525	Standard	NM_031273		Approved	TSGA5, TGC3B	uc004enn.1	Q9BXU2	OTTHUMG00000022174	ENST00000302917.1:c.713C>A	X.37:g.107224536G>T	ENSP00000303777:p.Ala238Glu	Somatic	0	52	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	24	35.90	Q5JYF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A238E	ENST00000302917.1	37	c.713	CCDS14534.1	X	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281596	0.23392	.	.	ENSG00000170925	ENST00000302917	.	.	.	3.29	2.39	0.29439	.	.	.	.	.	T	0.41050	0.1142	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.70487	0.969	T	0.17349	-1.0372	8	0.26408	T	0.33	.	7.4411	0.27183	0.0:0.2635:0.7365:0.0	.	238	Q9BXU2	TX13B_HUMAN	E	238	.	ENSP00000303777:A238E	A	-	2	0	TEX13B	107111192	0.000000	0.05858	0.120000	0.21714	0.109000	0.19521	-0.104000	0.10923	0.740000	0.32651	0.594000	0.82650	GCA	-	NULL		0.597	TEX13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX13B	protein_coding	OTTHUMT00000057857.1	G		-		107224536	-1	no_errors	ENST00000302917	ensembl	human	known	74_37	missense	SNP	0.090	T
QRICH2	84074	genome.wustl.edu	37	17	74287496	74287496	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr17:74287496G>T	ENST00000262765.5	-	4	2993	c.2814C>A	c.(2812-2814)gaC>gaA	p.D938E		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	938										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						AATCATGACTGTCAAAGAGAG	0.517																																																	0								ENSG00000129646						91.0	62.0	72.0					17																	74287496		2203	4300	6503	QRICH2	SO:0001583	missense	0			-	HGNC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.2814C>A	17.37:g.74287496G>T	ENSP00000262765:p.Asp938Glu	Somatic	0	39	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A2RRE1|Q96LM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D938E	ENST00000262765.5	37	c.2814	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	G	6.219	0.408582	0.11812	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.10477	2.87	4.23	-0.833	0.10782	.	.	.	.	.	T	0.04543	0.0124	N	0.14661	0.345	0.09310	N	1	B;B	0.14438	0.01;0.001	B;B	0.14578	0.011;0.007	T	0.44697	-0.9311	9	0.02654	T	1	.	6.7309	0.23383	0.0:0.3077:0.3445:0.3478	.	938;938	B5MD94;Q9H0J4	.;QRIC2_HUMAN	E	938	ENSP00000262765:D938E	ENSP00000262765:D938E	D	-	3	2	QRICH2	71799091	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.108000	0.15396	-0.324000	0.08589	0.491000	0.48974	GAC	-	NULL		0.517	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	protein_coding	OTTHUMT00000395140.1	G	NM_032134	-		74287496	-1	no_errors	ENST00000262765	ensembl	human	known	74_37	missense	SNP	0.000	T
DAAM2	23500	genome.wustl.edu	37	6	39855307	39855307	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr6:39855307G>T	ENST00000398904.2	+	16	2181	c.1999G>T	c.(1999-2001)Gtc>Ttc	p.V667F	RP11-61I13.3_ENST00000420293.1_RNA|DAAM2_ENST00000538976.1_Missense_Mutation_p.V667F|RP11-61I13.3_ENST00000607675.1_RNA|RP11-61I13.3_ENST00000606829.1_RNA|RP11-61I13.3_ENST00000607215.1_RNA|DAAM2_ENST00000274867.4_Missense_Mutation_p.V667F|RP11-61I13.3_ENST00000430595.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	667	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					TTCCCGCAAGGTCAAAGAGCT	0.522																																																	0								ENSG00000146122						68.0	73.0	71.0					6																	39855307		1945	4138	6083	DAAM2	SO:0001583	missense	0			-	HGNC	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.1999G>T	6.37:g.39855307G>T	ENSP00000381876:p.Val667Phe	Somatic	0	48	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.V667F	ENST00000398904.2	37	c.1999	CCDS56426.1	6	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650194	0.87958	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.17691	2.26;2.26;2.26	5.47	5.47	0.80525	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.065972	0.64402	D	0.000012	T	0.36054	0.0953	M	0.79805	2.47	0.80722	D	1	D;D	0.67145	0.979;0.996	P;D	0.63033	0.704;0.91	T	0.13495	-1.0507	10	0.59425	D	0.04	.	18.4564	0.90722	0.0:0.0:1.0:0.0	.	667;667	G5EA45;Q86T65	.;DAAM2_HUMAN	F	667	ENSP00000274867:V667F;ENSP00000381876:V667F;ENSP00000437808:V667F	ENSP00000274867:V667F	V	+	1	0	DAAM2	39963285	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.649000	0.83500	2.728000	0.93425	0.655000	0.94253	GTC	-	pfam_FH2_Formin,smart_FH2_Formin		0.522	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DAAM2	protein_coding	OTTHUMT00000280648.1	G		-		39855307	+1	no_errors	ENST00000274867	ensembl	human	known	74_37	missense	SNP	1.000	T
RGPD2	729857	genome.wustl.edu	37	2	88071786	88071786	+	Frame_Shift_Del	DEL	A	A	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr2:88071786delA	ENST00000398146.3	-	22	5360	c.5138delT	c.(5137-5139)ttgfs	p.L1713fs	RGPD2_ENST00000420840.2_Frame_Shift_Del_p.L1705fs|RGPD2_ENST00000327544.6_Frame_Shift_Del_p.L970fs			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	1713	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						ACCTGGCTTCAAGAAAATGAA	0.443																																																	0								ENSG00000185304						1.0	1.0	1.0					2																	88071786		540	1381	1921	RGPD2	SO:0001589	frameshift_variant	0				HGNC		CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.5138delT	2.37:g.88071786delA	ENSP00000381214:p.Leu1713fs	Somatic	0	20	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	10	62.96	P0C839|Q68DN6|Q6V1X0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_2,pfam_TPR_1,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.L1713fs	ENST00000398146.3	37	c.5138	CCDS42710.2	2																																																																																			-	pfam_GRIP,superfamily_GRIP,smart_GRIP,pfscan_GRIP		0.443	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGPD2	protein_coding	OTTHUMT00000330534.2	A	NM_001078170			88071786	-1	no_errors	ENST00000398146	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PRRX1	5396	genome.wustl.edu	37	1	170705412	170705412	+	3'UTR	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:170705412G>T	ENST00000239461.6	+	0	1136				PRRX1_ENST00000367760.3_3'UTR|PRRX1_ENST00000476867.2_3'UTR	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1						artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CATCTGCTGGGGGGAAAAAGT	0.358																																																	0								ENSG00000116132																																			PRRX1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.*85G>T	1.37:g.170705412G>T		Somatic	0	56	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	55	36.78	B5BUM7|O60807	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000239461.6	37	NULL	CCDS1290.1	1																																																																																			-	-		0.358	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	protein_coding	OTTHUMT00000085236.3	G	NM_006902	-		170705412	+1	no_errors	ENST00000476867	ensembl	human	known	74_37	rna	SNP	0.550	T
KIAA0430	9665	genome.wustl.edu	37	16	15696497	15696498	+	Intron	INS	-	-	C	rs370453498|rs546564067|rs528582430	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr16:15696497_15696498insC	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Ins_p.P1108fs|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000540441.2_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						gaaggaagaggagaaagaaAAG	0.431																																																	0								ENSG00000166783																																			KIAA0430	SO:0001627	intron_variant	0				HGNC	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-437->G	16.37:g.15696497_15696498insC		Somatic	0	27	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36	16.28	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1107fs	ENST00000396368.3	37	c.3322_3321	CCDS10562.2	16																																																																																			-	NULL		0.431	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	protein_coding	OTTHUMT00000252131.2	-	NM_014647			15696498	-1	no_errors	ENST00000344181	ensembl	human	known	74_37	frame_shift_ins	INS	0.001:0.000	C
WDR31	114987	genome.wustl.edu	37	9	116079028	116079028	+	3'UTR	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:116079028C>T	ENST00000374193.4	-	0	1351				WDR31_ENST00000461942.1_5'UTR|WDR31_ENST00000374195.3_3'UTR|WDR31_ENST00000341761.4_3'UTR	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31											NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						GTCTCTTGGCCTCAGAATGCT	0.502																																																	0								ENSG00000148225						166.0	147.0	153.0					9																	116079028		2203	4300	6503	WDR31	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.*1G>A	9.37:g.116079028C>T		Somatic	0	71	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5W0T9|Q96EG8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374193.4	37	NULL	CCDS35110.1	9																																																																																			-	-		0.502	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR31	protein_coding	OTTHUMT00000053734.2	C	NM_145241	-		116079028	-1	no_errors	ENST00000461942	ensembl	human	known	74_37	rna	SNP	0.031	T
EPHB6	2051	genome.wustl.edu	37	7	142562052	142562054	+	In_Frame_Del	DEL	CCT	CCT	-	rs8177142|rs372769362	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr7:142562052_142562054delCCT	ENST00000392957.2	+	7	1281_1283	c.494_496delCCT	c.(493-498)ccctcc>ccc	p.S176del	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_In_Frame_Del_p.S176del	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	176	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GAGAGCTTTCcctcctcctcctc	0.626																																																	0								ENSG00000106123																																			EPHB6	SO:0001651	inframe_deletion	0				HGNC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.494_496delCCT	7.37:g.142562061_142562063delCCT	ENSP00000376684:p.Ser176del	Somatic	0	42	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S169in_frame_del	ENST00000392957.2	37	c.494_496	CCDS5873.2	7																																																																																			-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom		0.626	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	protein_coding	OTTHUMT00000341329.1	CCT				142562054	+1	no_errors	ENST00000392957	ensembl	human	known	74_37	in_frame_del	DEL	0.978:0.949:0.908	-
CDH6	1004	genome.wustl.edu	37	5	31323298	31323298	+	Silent	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr5:31323298G>A	ENST00000265071.2	+	12	2521	c.2256G>A	c.(2254-2256)tcG>tcA	p.S752S		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	752					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CCCTGAGCTCGCTGGAGTCAG	0.532																																																	0								ENSG00000113361						55.0	51.0	52.0					5																	31323298		2203	4300	6503	CDH6	SO:0001819	synonymous_variant	0			-	HGNC	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2256G>A	5.37:g.31323298G>A		Somatic	0	56	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	32	52.24	A8K5H5|Q9BWS0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S752	ENST00000265071.2	37	c.2256	CCDS3894.1	5																																																																																			-	pfam_Cadherin_cytoplasmic-dom		0.532	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	protein_coding	OTTHUMT00000207355.2	G	NM_004932	-		31323298	+1	no_errors	ENST00000265071	ensembl	human	known	74_37	silent	SNP	0.985	A
CHL1	10752	genome.wustl.edu	37	3	369953	369953	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr3:369953T>A	ENST00000256509.2	+	5	943	c.301T>A	c.(301-303)Tct>Act	p.S101T	CHL1_ENST00000397491.2_Missense_Mutation_p.S101T	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GGGGCACATATCTCACTTTCA	0.403																																																	0								ENSG00000134121						128.0	127.0	127.0					3																	369953		2203	4300	6503	CHL1	SO:0001583	missense	0			-	HGNC	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.301T>A	3.37:g.369953T>A	ENSP00000256509:p.Ser101Thr	Somatic	0	78	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	42	36.36	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S101T	ENST00000256509.2	37	c.301	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	T	12.43	1.936064	0.34189	.	.	ENSG00000134121	ENST00000256509;ENST00000397491;ENST00000435603	T;T;T	0.72051	1.11;1.11;-0.62	5.02	-5.22	0.02806	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.273852	0.34156	N	0.004207	T	0.44265	0.1285	N	0.13003	0.285	0.09310	N	0.999995	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.12837	0.008;0.008;0.004	T	0.28396	-1.0045	10	0.35671	T	0.21	.	8.7513	0.34618	0.1532:0.0:0.4943:0.3524	.	101;101;101	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	T	101	ENSP00000256509:S101T;ENSP00000380628:S101T;ENSP00000397445:S101T	ENSP00000256509:S101T	S	+	1	0	CHL1	344953	0.782000	0.28689	0.603000	0.28903	0.991000	0.79684	0.397000	0.20883	-0.387000	0.07809	0.533000	0.62120	TCT	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.403	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	protein_coding	OTTHUMT00000207155.2	T	NM_006614	-		369953	+1	no_errors	ENST00000256509	ensembl	human	known	74_37	missense	SNP	0.037	A
SP110	3431	genome.wustl.edu	37	2	231036818	231036818	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr2:231036818C>G	ENST00000358662.4	-	16	1857	c.1779G>C	c.(1777-1779)aaG>aaC	p.K593N	AC009950.2_ENST00000594622.1_RNA|AC009950.2_ENST00000595586.2_RNA|SP110_ENST00000258381.6_Missense_Mutation_p.K593N|AC009950.2_ENST00000454058.1_RNA|AC009950.2_ENST00000600787.1_RNA|AC009950.2_ENST00000609120.1_RNA	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	593	Bromo.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TCTCCAGGGTCTTAGATACAT	0.517																																																	0								ENSG00000135899						163.0	152.0	155.0					2																	231036818		2203	4300	6503	SP110	SO:0001583	missense	0			-	HGNC	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1779G>C	2.37:g.231036818C>G	ENSP00000351488:p.Lys593Asn	Somatic	0	45	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sp100,pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.K593N	ENST00000358662.4	37	c.1779	CCDS2474.1	2	.	.	.	.	.	.	.	.	.	.	C	9.272	1.045964	0.19748	.	.	ENSG00000135899	ENST00000258381;ENST00000358662	T;T	0.43294	0.96;0.95	3.42	2.53	0.30540	Bromodomain (2);	.	.	.	.	T	0.19765	0.0475	N	0.08118	0	0.09310	N	0.999997	B;B	0.34161	0.436;0.439	B;B	0.27380	0.057;0.079	T	0.09596	-1.0667	9	0.45353	T	0.12	.	7.2417	0.26100	0.0:0.8668:0.0:0.1332	.	593;593	Q9HB58;Q9HB58-6	SP110_HUMAN;.	N	593	ENSP00000258381:K593N;ENSP00000351488:K593N	ENSP00000258381:K593N	K	-	3	2	SP110	230745062	0.031000	0.19500	0.006000	0.13384	0.022000	0.10575	2.916000	0.48813	0.736000	0.32559	0.563000	0.77884	AAG	-	superfamily_Bromodomain		0.517	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP110	protein_coding	OTTHUMT00000332414.1	C	NM_080424	-		231036818	-1	no_errors	ENST00000258381	ensembl	human	known	74_37	missense	SNP	0.004	G
ZCCHC6	79670	genome.wustl.edu	37	9	88937339	88937339	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:88937339delC	ENST00000375963.3	-	14	3101	c.2929delG	c.(2929-2931)gacfs	p.D977fs	ZCCHC6_ENST00000375957.1_5'Flank|ZCCHC6_ENST00000277141.6_Frame_Shift_Del_p.D266fs|ZCCHC6_ENST00000375961.2_Frame_Shift_Del_p.D977fs|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000375960.2_Intron	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	977					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TCAGGACAGTCCTTCTTTAGA	0.403																																																	0								ENSG00000083223						125.0	124.0	124.0					9																	88937339		2203	4300	6503	ZCCHC6	SO:0001589	frameshift_variant	0				HGNC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2929delG	9.37:g.88937339delC	ENSP00000365130:p.Asp977fs	Somatic	0	96	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	44	40.54	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.D977fs	ENST00000375963.3	37	c.2929	CCDS35057.1	9																																																																																			-	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC		0.403	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	protein_coding	OTTHUMT00000052918.1	C	NM_024617			88937339	-1	no_errors	ENST00000375963	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
HECTD2	143279	genome.wustl.edu	37	10	93245134	93245134	+	Intron	SNP	A	A	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr10:93245134A>T	ENST00000298068.5	+	10	1188				HECTD2_ENST00000498446.1_3'UTR|HECTD2_ENST00000536715.1_Intron|HECTD2_ENST00000446394.1_Intron|HECTD2_ENST00000371667.1_Intron	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GTTTAAGTTTATATGAAGTTT	0.264																																					NSCLC(12;376 469 1699 39910 41417)												0								ENSG00000165338																																			HECTD2	SO:0001627	intron_variant	0			-	HGNC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1094+74A>T	10.37:g.93245134A>T		Somatic	0	47	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	11	63.33	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000298068.5	37	NULL	CCDS7414.1	10																																																																																			-	-		0.264	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	protein_coding	OTTHUMT00000098620.1	A		-		93245134	+1	no_errors	ENST00000498446	ensembl	human	known	74_37	rna	SNP	0.013	T
OR51E1	143503	genome.wustl.edu	37	11	4673791	4673791	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr11:4673791C>A	ENST00000530215.1	+	1	76	c.35C>A	c.(34-36)gCt>gAt	p.A12D	OR51E1_ENST00000396952.5_Missense_Mutation_p.A12D			Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAATCCAGTGCTACATACTTC	0.493																																																	0								ENSG00000180785						262.0	192.0	216.0					11																	4673791		2201	4298	6499	OR51E1	SO:0001583	missense	0			-	HGNC	AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000530215.1:c.35C>A	11.37:g.4673791C>A	ENSP00000431593:p.Ala12Asp	Somatic	0	67	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	39	35.00	A8KAM6|Q5S4P5|Q66X57|Q6IF93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A12D	ENST00000530215.1	37	c.35		11	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319148	0.23994	.	.	ENSG00000180785	ENST00000396952;ENST00000530215	T;T	0.00325	8.1;8.1	4.74	2.84	0.33178	.	0.249489	0.28209	N	0.016195	T	0.00178	0.0005	L	0.34521	1.04	0.33700	D	0.614395	B	0.19583	0.037	B	0.20955	0.032	T	0.49224	-0.8962	10	0.72032	D	0.01	.	5.4137	0.16361	0.1597:0.6672:0.0:0.1731	.	11	Q8TCB6	O51E1_HUMAN	D	12	ENSP00000380155:A12D;ENSP00000431593:A12D	ENSP00000380155:A12D	A	+	2	0	OR51E1	4630367	0.049000	0.20398	0.744000	0.31058	0.402000	0.30811	2.310000	0.43708	0.587000	0.29643	0.563000	0.77884	GCT	-	NULL		0.493	OR51E1-002	PUTATIVE	basic|exp_conf	protein_coding	OR51E1	protein_coding	OTTHUMT00000385957.1	C	NM_152430	-		4673791	+1	no_errors	ENST00000396952	ensembl	human	known	74_37	missense	SNP	0.749	A
SERPINF2	5345	genome.wustl.edu	37	17	1657573	1657573	+	Silent	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr17:1657573C>T	ENST00000324015.3	+	10	1298	c.1221C>T	c.(1219-1221)tcC>tcT	p.S407S	SERPINF2_ENST00000450523.2_Silent_p.S343S|SERPINF2_ENST00000382061.4_Silent_p.S407S	NM_000934.3	NP_000925.2	P08697	A2AP_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	407					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of proteolysis (GO:0030162)|response to organic substance (GO:0010033)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Ocriplasmin(DB08888)	TGTCCCTGTCCTCCTTCAGCG	0.652																																																	0								ENSG00000167711						149.0	123.0	132.0					17																	1657573		2203	4300	6503	SERPINF2	SO:0001819	synonymous_variant	0			-	HGNC	D00174	CCDS11011.1, CCDS54064.1	17p13.3	2014-02-18	2005-08-18		ENSG00000167711	ENSG00000167711		"""Serine (or cysteine) peptidase inhibitors"""	9075	protein-coding gene	gene with protein product	"""alpha-2-plasmin inhibitor"", ""alpha-2-antiplasmin"""	613168	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2"""	PLI		3416655, 24172014	Standard	NM_000934		Approved	API, ALPHA-2-PI, A2AP, AAP	uc002ftk.1	P08697	OTTHUMG00000090552	ENST00000324015.3:c.1221C>T	17.37:g.1657573C>T		Somatic	0	63	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	8	75.76	B4E1B7|Q8N5U7|Q9UCG2|Q9UCG3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.S407	ENST00000324015.3	37	c.1221	CCDS11011.1	17																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.652	SERPINF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF2	protein_coding	OTTHUMT00000207078.3	C	NM_000934	-		1657573	+1	no_errors	ENST00000324015	ensembl	human	known	74_37	silent	SNP	0.066	T
TMCO4	255104	genome.wustl.edu	37	1	20027301	20027301	+	Missense_Mutation	SNP	G	G	A	rs144254063		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:20027301G>A	ENST00000294543.6	-	14	1583	c.1342C>T	c.(1342-1344)Cgg>Tgg	p.R448W	TMCO4_ENST00000375122.2_Missense_Mutation_p.R408W|TMCO4_ENST00000489814.1_5'UTR|TMCO4_ENST00000375127.1_Missense_Mutation_p.R448W	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	448						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		ACCACCTTCCGGAAAGGCTCC	0.567																																																	0								ENSG00000162542	G	TRP/ARG	0,4406		0,0,2203	137.0	116.0	123.0		1342	4.6	1.0	1	dbSNP_134	123	1,8599	1.2+/-3.3	0,1,4299	no	missense	TMCO4	NM_181719.4	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	448/635	20027301	1,13005	2203	4300	6503	TMCO4	SO:0001583	missense	0			-	HGNC		CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.1342C>T	1.37:g.20027301G>A	ENSP00000294543:p.Arg448Trp	Somatic	0	65	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	44	25.42	Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF726,pfam_DUF900_hydrolase	p.R448W	ENST00000294543.6	37	c.1342	CCDS198.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144479	0.77888	0.0	1.16E-4	ENSG00000162542	ENST00000294543;ENST00000375127;ENST00000375122	T;T;T	0.53423	0.62;0.62;0.62	5.58	4.56	0.56223	.	0.254426	0.28349	N	0.015665	T	0.66117	0.2757	M	0.77486	2.375	0.35712	D	0.81645	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72625	0.978;0.978;0.977	T	0.74542	-0.3631	10	0.72032	D	0.01	-16.9222	10.7428	0.46162	0.0:0.0:0.6984:0.3016	.	32;448;408	Q6ZSC6;Q5TGY1;Q5TGY1-2	.;TMCO4_HUMAN;.	W	448;448;408	ENSP00000294543:R448W;ENSP00000364269:R448W;ENSP00000364264:R408W	ENSP00000294543:R448W	R	-	1	2	TMCO4	19899888	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.895000	0.28363	2.806000	0.96561	0.655000	0.94253	CGG	-	pfam_DUF726,pfam_DUF900_hydrolase		0.567	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	protein_coding	OTTHUMT00000007658.1	G	NM_181719	rs144254063		20027301	-1	no_errors	ENST00000294543	ensembl	human	known	74_37	missense	SNP	1.000	A
SPTBN4	57731	genome.wustl.edu	37	19	40978532	40978532	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr19:40978532G>A	ENST00000352632.3	+	2	90	c.4G>A	c.(4-6)Gcg>Acg	p.A2T	SPTBN4_ENST00000595535.1_Missense_Mutation_p.A2T|SPTBN4_ENST00000344104.3_Missense_Mutation_p.A2T|SPTBN4_ENST00000598249.1_Missense_Mutation_p.A2T|SPTBN4_ENST00000338932.3_Missense_Mutation_p.A2T			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2	Actin-binding.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTCCCCGATGGCGCAGGTACC	0.592																																																	0								ENSG00000160460						48.0	35.0	40.0					19																	40978532		2203	4300	6503	SPTBN4	SO:0001583	missense	0			-	HGNC	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.4G>A	19.37:g.40978532G>A	ENSP00000263373:p.Ala2Thr	Somatic	0	93	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	13	55.17	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A2T	ENST00000352632.3	37	c.4	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284168	0.40394	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.80123	-1.34;-1.26;-1.31	5.91	5.91	0.95273	.	0.229203	0.25991	U	0.027010	T	0.81399	0.4814	N	0.22421	0.69	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.70935	0.971;0.971	T	0.75525	-0.3287	10	0.12766	T	0.61	.	15.7986	0.78433	0.0:0.0:1.0:0.0	.	2;2	Q9H254;Q71S06	SPTN4_HUMAN;.	T	2	ENSP00000263373:A2T;ENSP00000340345:A2T;ENSP00000340741:A2T	ENSP00000340345:A2T	A	+	1	0	SPTBN4	45670372	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	4.641000	0.61375	2.793000	0.96121	0.655000	0.94253	GCG	-	pirsf_Spectrin_bsu		0.592	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	protein_coding	OTTHUMT00000462559.2	G		-		40978532	+1	no_errors	ENST00000352632	ensembl	human	known	74_37	missense	SNP	1.000	A
TEC	7006	genome.wustl.edu	37	4	48165756	48165756	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:48165756C>T	ENST00000381501.3	-	8	857	c.700G>A	c.(700-702)Gta>Ata	p.V234I		NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	234	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.V234I(1)		breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						TTTCCCGTTACGTAATTACTT	0.279																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000135605						69.0	62.0	64.0					4																	48165756		2188	4269	6457	TEC	SO:0001583	missense	0			-	HGNC	D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.700G>A	4.37:g.48165756C>T	ENSP00000370912:p.Val234Ile	Somatic	0	93	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	64	32.63	B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.V234I	ENST00000381501.3	37	c.700	CCDS3481.1	4	.	.	.	.	.	.	.	.	.	.	C	18.89	3.719590	0.68844	.	.	ENSG00000135605	ENST00000381501	T	0.29142	1.58	5.69	5.69	0.88448	Src homology-3 domain (3);	0.129327	0.51477	D	0.000096	T	0.58878	0.2153	M	0.75447	2.3	0.48696	D	0.999698	D	0.89917	1.0	D	0.80764	0.994	T	0.59295	-0.7481	10	0.59425	D	0.04	.	19.7977	0.96492	0.0:1.0:0.0:0.0	.	234	P42680	TEC_HUMAN	I	234	ENSP00000370912:V234I	ENSP00000370912:V234I	V	-	1	0	TEC	47860513	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.626000	0.67777	2.692000	0.91855	0.491000	0.48974	GTA	-	pfam_SH3_2,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.279	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	protein_coding	OTTHUMT00000250492.3	C		-		48165756	-1	no_errors	ENST00000381501	ensembl	human	known	74_37	missense	SNP	1.000	T
CENPU	79682	genome.wustl.edu	37	4	185637744	185637744	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:185637744A>G	ENST00000281453.5	-	6	495	c.425T>C	c.(424-426)aTt>aCt	p.I142T	MLF1IP_ENST00000506535.1_5'Flank|MLF1IP_ENST00000541971.1_Missense_Mutation_p.I142T	NM_024629.3	NP_078905.2														endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|stomach(1)	13		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		ACTTTCTTCAATGCTTTCAGA	0.373																																																	0								ENSG00000151725						112.0	100.0	104.0					4																	185637744		2203	4300	6503	MLF1IP	SO:0001583	missense	0			-	HGNC																												ENST00000281453.5:c.425T>C	4.37:g.185637744A>G	ENSP00000281453:p.Ile142Thr	Somatic	0	81	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	49	30.99		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I142T	ENST00000281453.5	37	c.425	CCDS3838.1	4	.	.	.	.	.	.	.	.	.	.	a	0.011	-1.733385	0.00687	.	.	ENSG00000151725	ENST00000281453;ENST00000541665;ENST00000541971;ENST00000514781	T;T;T	0.39056	2.67;2.67;1.1	4.06	-4.44	0.03557	.	2.287230	0.02124	N	0.055872	T	0.14700	0.0355	N	0.01576	-0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42258	-0.9462	10	0.02654	T	1	-14.7721	9.6878	0.40109	0.1788:0.6338:0.1874:0.0	.	142;142	Q09GN1;Q71F23	.;CENPU_HUMAN	T	142;142;142;113	ENSP00000281453:I142T;ENSP00000445862:I142T;ENSP00000423167:I113T	ENSP00000281453:I142T	I	-	2	0	MLF1IP	185874738	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.706000	0.05047	-0.928000	0.03761	-0.394000	0.06481	ATT	-	NULL		0.373	MLF1IP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLF1IP	protein_coding	OTTHUMT00000360841.2	A		-		185637744	-1	no_errors	ENST00000281453	ensembl	human	known	74_37	missense	SNP	0.000	G
OR10V1	390201	genome.wustl.edu	37	11	59480549	59480549	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr11:59480549C>T	ENST00000307552.2	-	1	788	c.770G>A	c.(769-771)aGc>aAc	p.S257N	STX3_ENST00000300150.7_5'Flank	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						GTATATAAAGCTGGTGCAGCC	0.517																																																	0								ENSG00000172289						67.0	67.0	67.0					11																	59480549		2201	4295	6496	OR10V1	SO:0001583	missense	0			-	HGNC	AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.770G>A	11.37:g.59480549C>T	ENSP00000302199:p.Ser257Asn	Somatic	0	48	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	9.76	Q6IFD9|Q96R50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S257N	ENST00000307552.2	37	c.770	CCDS31565.1	11	.	.	.	.	.	.	.	.	.	.	C	16.79	3.219824	0.58560	.	.	ENSG00000172289	ENST00000307552	T	0.37752	1.18	4.47	4.47	0.54385	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	T	0.50735	0.1633	L	0.56280	1.765	0.25137	N	0.990525	D	0.76494	0.999	D	0.65140	0.932	T	0.37820	-0.9689	10	0.44086	T	0.13	.	13.0174	0.58766	0.0:1.0:0.0:0.0	.	257	Q8NGI7	O10V1_HUMAN	N	257	ENSP00000302199:S257N	ENSP00000302199:S257N	S	-	2	0	OR10V1	59237125	0.000000	0.05858	0.997000	0.53966	0.980000	0.70556	0.013000	0.13310	2.507000	0.84556	0.543000	0.68304	AGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.517	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10V1	protein_coding	OTTHUMT00000394517.1	C	NM_001005324	-		59480549	-1	no_errors	ENST00000307552	ensembl	human	known	74_37	missense	SNP	0.995	T
IL17A	3605	genome.wustl.edu	37	6	52053855	52053855	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr6:52053855G>A	ENST00000340057.1	+	3	278	c.233G>A	c.(232-234)cGc>cAc	p.R78H		NM_002190.2	NP_002181.1	Q16552	IL17_HUMAN	interleukin 17A	78					apoptotic process (GO:0006915)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|cellular response to interleukin-1 (GO:0071347)|fibroblast activation (GO:0072537)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein glycosylation (GO:0006486)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(3)|large_intestine(2)|lung(8)|prostate(3)|skin(1)	17	Lung NSC(77;0.116)					CTCTGCAGCCGCAATGAGGAC	0.493																																																	0								ENSG00000112115						40.0	40.0	40.0					6																	52053855		2203	4300	6503	IL17A	SO:0001583	missense	0			-	HGNC	U32659	CCDS4937.1	6p12	2011-07-14	2006-04-26	2006-04-26	ENSG00000112115	ENSG00000112115		"""Interleukins and interleukin receptors"""	5981	protein-coding gene	gene with protein product	"""cytotoxic T-lymphocyte-associated protein 8"""	603149	"""interleukin 17 (cytotoxic T-lymphocyte-associated serine esterase 8)"""	CTLA8, IL17		8390535	Standard	NM_002190		Approved	IL-17A, IL-17	uc003pak.1	Q16552	OTTHUMG00000014840	ENST00000340057.1:c.233G>A	6.37:g.52053855G>A	ENSP00000344192:p.Arg78His	Somatic	0	50	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	Q5T2P0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-17_fam,prints_IL-17_chr	p.R78H	ENST00000340057.1	37	c.233	CCDS4937.1	6	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025045	0.54683	.	.	ENSG00000112115	ENST00000340057	T	0.55413	0.52	5.64	0.119	0.14685	.	0.513598	0.19749	N	0.106959	T	0.40272	0.1110	M	0.62723	1.935	0.09310	N	1	D	0.59767	0.986	P	0.57846	0.828	T	0.13072	-1.0523	10	0.42905	T	0.14	-20.7789	3.2898	0.06945	0.0795:0.2062:0.2558:0.4585	.	78	Q16552	IL17_HUMAN	H	78	ENSP00000344192:R78H	ENSP00000344192:R78H	R	+	2	0	IL17A	52161814	0.076000	0.21285	0.965000	0.40720	0.737000	0.42083	1.497000	0.35649	0.677000	0.31305	0.609000	0.83330	CGC	-	pfam_IL-17_fam,prints_IL-17_chr		0.493	IL17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17A	protein_coding	OTTHUMT00000040892.1	G	NM_002190	-		52053855	+1	no_errors	ENST00000340057	ensembl	human	known	74_37	missense	SNP	0.024	A
BNC1	646	genome.wustl.edu	37	15	83935620	83935620	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr15:83935620G>T	ENST00000345382.2	-	3	488	c.403C>A	c.(403-405)Ctt>Att	p.L135I	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.L128I	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	135					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TAATCCTGAAGTGTCCAGTCC	0.478																																																	0								ENSG00000169594						141.0	136.0	137.0					15																	83935620		2203	4300	6503	BNC1	SO:0001583	missense	0			-	HGNC	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.403C>A	15.37:g.83935620G>T	ENSP00000307041:p.Leu135Ile	Somatic	0	76	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	61	29.89	Q15840	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L135I	ENST00000345382.2	37	c.403	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.241420	0.95272	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.03860	3.78	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	L	0.53249	1.67	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.80764	0.991;0.994	T	0.00007	-1.2500	10	0.66056	D	0.02	-20.5593	19.9142	0.97043	0.0:0.0:1.0:0.0	.	128;135	F5GY04;Q01954	.;BNC1_HUMAN	I	135;128	ENSP00000307041:L135I	ENSP00000307041:L135I	L	-	1	0	BNC1	81726624	1.000000	0.71417	0.957000	0.39632	0.977000	0.68977	7.691000	0.84191	2.941000	0.99782	0.655000	0.94253	CTT	-	NULL		0.478	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	protein_coding	OTTHUMT00000304006.1	G	NM_001717	-		83935620	-1	no_errors	ENST00000345382	ensembl	human	known	74_37	missense	SNP	1.000	T
OGDH	4967	genome.wustl.edu	37	7	44695959	44695959	+	Intron	SNP	G	G	C			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr7:44695959G>C	ENST00000222673.5	+	4	559				OGDH_ENST00000444676.1_Missense_Mutation_p.G187A|OGDH_ENST00000443864.2_Intron|OGDH_ENST00000439616.2_Intron|OGDH_ENST00000543843.1_Missense_Mutation_p.G123A|OGDH_ENST00000447398.1_Missense_Mutation_p.G183A|OGDH_ENST00000449767.1_Intron	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)						2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	CTAACAGTAGGAGGTATGAAA	0.433																																																	0								ENSG00000105953																																			OGDH	SO:0001627	intron_variant	0			-	HGNC	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.517+8601G>C	7.37:g.44695959G>C		Somatic	0	106	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	34	43.33	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.G123A	ENST00000222673.5	37	c.368	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072159	0.36566	.	.	ENSG00000105953	ENST00000447398;ENST00000444676;ENST00000543843	T;T;T	0.04970	3.52;3.52;3.52	5.78	5.78	0.91487	.	.	.	.	.	T	0.20820	0.0501	.	.	.	0.45704	D	0.998614	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.981	T	0.02326	-1.1176	8	0.16896	T	0.51	.	19.6167	0.95636	0.0:0.0:1.0:0.0	.	183;74	E9PDF2;A2VCT2	.;.	A	183;187;123	ENSP00000388183:G183A;ENSP00000414662:G187A;ENSP00000443821:G123A	ENSP00000414662:G187A	G	+	2	0	OGDH	44662484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.818000	0.91991	2.741000	0.93983	0.555000	0.69702	GGA	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1		0.433	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	protein_coding	OTTHUMT00000339391.1	G		-		44695959	+1	no_errors	ENST00000543843	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC17A7	57030	genome.wustl.edu	37	19	49934335	49934335	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr19:49934335G>T	ENST00000221485.3	-	11	1497	c.1326C>A	c.(1324-1326)aaC>aaA	p.N442K	SLC17A7_ENST00000543531.1_Missense_Mutation_p.N430K|SLC17A7_ENST00000600601.1_Missense_Mutation_p.N375K	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	442					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		TGCCCACGCCGTTGGAGATGC	0.622																																																	0								ENSG00000104888						89.0	72.0	78.0					19																	49934335		2203	4300	6503	SLC17A7	SO:0001583	missense	0			-	HGNC	AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.1326C>A	19.37:g.49934335G>T	ENSP00000221485:p.Asn442Lys	Somatic	0	34	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	B4DFR9|B4DG46|Q6PCD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.N442K	ENST00000221485.3	37	c.1326	CCDS12764.1	19	.	.	.	.	.	.	.	.	.	.	g	14.37	2.515946	0.44763	.	.	ENSG00000104888	ENST00000221485;ENST00000543531	T;T	0.59502	0.26;0.26	4.38	-0.242	0.13039	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.175836	0.36972	N	0.002316	T	0.77274	0.4106	H	0.96239	3.79	0.53688	D	0.999973	D;D	0.76494	0.997;0.999	D;D	0.75020	0.977;0.985	T	0.73135	-0.4078	10	0.87932	D	0	.	4.3645	0.11218	0.2787:0.0:0.5632:0.1581	.	442;284	Q9P2U7;A8K0Q7	VGLU1_HUMAN;.	K	442;430	ENSP00000221485:N442K;ENSP00000441767:N430K	ENSP00000221485:N442K	N	-	3	2	SLC17A7	54626147	0.984000	0.35163	0.979000	0.43373	0.127000	0.20565	0.138000	0.16016	-0.011000	0.14247	-1.175000	0.01729	AAC	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.622	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A7	protein_coding	OTTHUMT00000465367.2	G		-		49934335	-1	no_errors	ENST00000221485	ensembl	human	known	74_37	missense	SNP	1.000	T
HS3ST1	9957	genome.wustl.edu	37	4	11401038	11401038	+	Missense_Mutation	SNP	C	C	T	rs202015819		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:11401038C>T	ENST00000002596.5	-	2	1766	c.592G>A	c.(592-594)Gtg>Atg	p.V198M		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	198					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						TGCATGTGCACGTGGTAGAGG	0.597													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18698	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000002587	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	60.0	56.0	57.0		592	2.4	1.0	4		57	0,8600		0,0,4300	no	missense	HS3ST1	NM_005114.2	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	198/308	11401038	1,13005	2203	4300	6503	HS3ST1	SO:0001583	missense	0			GMAF=0	HGNC	AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.592G>A	4.37:g.11401038C>T	ENSP00000002596:p.Val198Met	Somatic	0	14	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	7	50.00	B3KUA6|Q6PEY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.V198M	ENST00000002596.5	37	c.592	CCDS3408.1	4	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	10.35	1.326398	0.24080	2.27E-4	0.0	ENSG00000002587	ENST00000002596	D	0.82255	-1.59	5.61	2.37	0.29283	Sulfotransferase domain (1);	1.002150	0.08039	N	0.994758	T	0.74898	0.3777	L	0.45352	1.415	0.36031	D	0.83941	D	0.54601	0.967	B	0.42319	0.383	T	0.72261	-0.4345	10	0.41790	T	0.15	.	3.822	0.08839	0.2057:0.3122:0.3951:0.087	.	198	O14792	HS3S1_HUMAN	M	198	ENSP00000002596:V198M	ENSP00000002596:V198M	V	-	1	0	HS3ST1	11010136	0.948000	0.32251	0.998000	0.56505	0.906000	0.53458	-0.011000	0.12721	0.784000	0.33661	0.655000	0.94253	GTG	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.597	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST1	protein_coding	OTTHUMT00000207073.3	C	NM_005114	rs202015819		11401038	-1	no_errors	ENST00000002596	ensembl	human	known	74_37	missense	SNP	0.949	T
STARD4	134429	genome.wustl.edu	37	5	110837715	110837715	+	Missense_Mutation	SNP	C	C	T	rs143239767	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr5:110837715C>T	ENST00000296632.3	-	4	361	c.227G>A	c.(226-228)cGt>cAt	p.R76H	STARD4_ENST00000512160.1_Intron|STARD4_ENST00000511569.1_5'UTR|STARD4_ENST00000502322.1_Missense_Mutation_p.R76H|STARD4_ENST00000509887.1_Intron	NM_139164.1	NP_631903.1	Q96DR4	STAR4_HUMAN	StAR-related lipid transfer (START) domain containing 4	76	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	12		all_cancers(142;0.00259)|all_epithelial(76;8.32e-05)|Prostate(80;0.0115)|Colorectal(10;0.0959)|Ovarian(225;0.156)|all_lung(232;0.18)|Lung NSC(167;0.248)		OV - Ovarian serous cystadenocarcinoma(64;4.91e-09)|Epithelial(69;1.39e-08)|all cancers(49;2.34e-06)|COAD - Colon adenocarcinoma(37;0.049)|Colorectal(14;0.138)		CCAATCCAAACGACAAGGCCC	0.393													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18449	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000164211	C	HIS/ARG	8,4396	14.3+/-33.2	0,8,2194	138.0	145.0	142.0		227	5.9	1.0	5	dbSNP_134	142	0,8600		0,0,4300	yes	missense	STARD4	NM_139164.1	29	0,8,6494	TT,TC,CC		0.0,0.1817,0.0615	probably-damaging	76/206	110837715	8,12996	2202	4300	6502	STARD4	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF480299	CCDS4104.1	5q22	2011-09-12	2007-08-16		ENSG00000164211	ENSG00000164211		"""StAR-related lipid transfer (START) domain containing"""	18058	protein-coding gene	gene with protein product		607049	"""START domain containing 4, sterol regulated"""			12011452	Standard	NM_139164		Approved		uc003kph.1	Q96DR4	OTTHUMG00000128793	ENST00000296632.3:c.227G>A	5.37:g.110837715C>T	ENSP00000296632:p.Arg76His	Somatic	0	72	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	60	53.85	Q86TN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.R76H	ENST00000296632.3	37	c.227	CCDS4104.1	5	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	23.8	4.464260	0.84425	0.001817	0.0	ENSG00000164211	ENST00000296632;ENST00000505803;ENST00000502322	T;T;T	0.54279	0.58;0.58;0.58	5.94	5.94	0.96194	Lipid-binding START (2);START-like domain (1);	0.000000	0.64402	D	0.000002	T	0.59074	0.2167	M	0.76002	2.32	0.80722	D	1	P;D	0.54772	0.889;0.968	B;B	0.42495	0.243;0.389	T	0.63919	-0.6528	10	0.49607	T	0.09	-8.936	20.3501	0.98811	0.0:1.0:0.0:0.0	.	76;76	Q86TN9;Q96DR4	.;STAR4_HUMAN	H	76	ENSP00000296632:R76H;ENSP00000427478:R76H;ENSP00000427639:R76H	ENSP00000296632:R76H	R	-	2	0	STARD4	110865614	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.031000	0.70911	2.821000	0.97095	0.655000	0.94253	CGT	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom		0.393	STARD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD4	protein_coding	OTTHUMT00000250720.1	C	NM_139164	rs143239767		110837715	-1	no_errors	ENST00000296632	ensembl	human	known	74_37	missense	SNP	1.000	T
ANGPT4	51378	genome.wustl.edu	37	20	896733	896733	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr20:896733T>G	ENST00000381922.3	-	1	227	c.125A>C	c.(124-126)cAc>cCc	p.H42P	ANGPT4_ENST00000546022.1_Missense_Mutation_p.H42P	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	42					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						GTAGCTACAGTGGCCGTGCTG	0.612																																					Pancreas(181;481 2077 3259 31286 49856)												0								ENSG00000101280						113.0	107.0	109.0					20																	896733		2203	4300	6503	ANGPT4	SO:0001583	missense	0			-	HGNC	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.125A>C	20.37:g.896733T>G	ENSP00000371347:p.His42Pro	Somatic	0	36	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.H42P	ENST00000381922.3	37	c.125	CCDS13009.1	20	.	.	.	.	.	.	.	.	.	.	T	5.214	0.225040	0.09916	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.13307	2.6;2.6	4.57	3.43	0.39272	.	0.162448	0.28996	N	0.013480	T	0.04588	0.0125	N	0.04090	-0.28	0.25384	N	0.98859	P;P	0.35363	0.497;0.497	B;B	0.25614	0.062;0.062	T	0.36163	-0.9759	10	0.26408	T	0.33	.	7.1584	0.25651	0.1989:0.0:0.0:0.8011	.	42;42	B4E3J9;Q9Y264	.;ANGP4_HUMAN	P	42	ENSP00000371347:H42P;ENSP00000439605:H42P	ENSP00000371347:H42P	H	-	2	0	ANGPT4	844733	0.976000	0.34144	1.000000	0.80357	0.472000	0.32918	0.721000	0.25911	0.751000	0.32900	0.254000	0.18369	CAC	-	NULL		0.612	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	protein_coding	OTTHUMT00000077493.1	T	NM_015985	-		896733	-1	no_errors	ENST00000381922	ensembl	human	known	74_37	missense	SNP	1.000	G
CLN6	54982	genome.wustl.edu	37	15	68504112	68504112	+	Silent	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr15:68504112C>T	ENST00000249806.5	-	4	544	c.387G>A	c.(385-387)gtG>gtA	p.V129V	CLN6_ENST00000564752.1_Silent_p.V129V|CLN6_ENST00000565471.1_Intron|RP11-315D16.2_ENST00000562767.1_Intron|CLN6_ENST00000538696.1_Silent_p.V161V|CLN6_ENST00000566347.1_Intron|CLN6_ENST00000418702.2_Intron	NM_017882.2	NP_060352.1	Q9NWW5	CLN6_HUMAN	ceroid-lipofuscinosis, neuronal 6, late infantile, variant	129					cell death (GO:0008219)|cellular macromolecule catabolic process (GO:0044265)|cholesterol metabolic process (GO:0008203)|ganglioside metabolic process (GO:0001573)|glycosaminoglycan metabolic process (GO:0030203)|locomotion involved in locomotory behavior (GO:0031987)|lysosomal lumen acidification (GO:0007042)|positive regulation of proteolysis (GO:0045862)|protein catabolic process (GO:0030163)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CAGAGTCACCCACCAGGTGGA	0.597																																																	0								ENSG00000128973						125.0	118.0	120.0					15																	68504112		2200	4298	6498	CLN6	SO:0001819	synonymous_variant	0			-	HGNC	AK000568	CCDS10227.1	15q23	2014-09-17			ENSG00000128973	ENSG00000128973			2077	protein-coding gene	gene with protein product		606725				9097964, 11727201	Standard	NM_017882		Approved	FLJ20561, HsT18960, nclf	uc002arf.3	Q9NWW5	OTTHUMG00000133286	ENST00000249806.5:c.387G>A	15.37:g.68504112C>T		Somatic	0	40	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	A8K560|B4DDH6|Q6IAB1|Q96SR0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V129	ENST00000249806.5	37	c.387	CCDS10227.1	15																																																																																			-	NULL		0.597	CLN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN6	protein_coding	OTTHUMT00000257066.1	C	NM_017882	-		68504112	-1	no_errors	ENST00000249806	ensembl	human	known	74_37	silent	SNP	1.000	T
KIAA0430	9665	genome.wustl.edu	37	16	15696492	15696493	+	Intron	INS	-	-	G	rs61282123|rs75196653		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr16:15696492_15696493insG	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Ins_p.L1109fs|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000540441.2_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						ggaaagaaggaagaggagaaag	0.421																																																	0								ENSG00000166783																																			KIAA0430	SO:0001627	intron_variant	0				HGNC	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-432->C	16.37:g.15696492_15696493insG		Somatic	0	25	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1110fs	ENST00000396368.3	37	c.3327_3326	CCDS10562.2	16																																																																																			-	NULL		0.421	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	protein_coding	OTTHUMT00000252131.2	-	NM_014647			15696493	-1	no_errors	ENST00000344181	ensembl	human	known	74_37	frame_shift_ins	INS	0.001:0.000	G
TP53	7157	genome.wustl.edu	37	17	7578369	7578369	+	Splice_Site	DEL	A	A	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr17:7578369delA	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(17)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGCTGCTCACCATCGCTAT	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	31	Unknown(17)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	liver(8)|upper_aerodigestive_tract(7)|bone(4)|ovary(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|breast(2)|stomach(1)						ENSG00000141510						47.0	46.0	46.0					17																	7578369		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1T>-	17.37:g.7578369delA		Somatic	0	37	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	13	50.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e4+2	ENST00000269305.4	37	c.559+2	CCDS11118.1	17																																																																																			-	-		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		Intron	7578369	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site_del	DEL	1.000	-
CDH26	60437	genome.wustl.edu	37	20	58587783	58587784	+	Intron	INS	-	-	A	rs370682137	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr20:58587783_58587784insA	ENST00000244047.5	+	15	2483				CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000350849.6_Stop_Codon_Ins|CDH26_ENST00000348616.4_Stop_Codon_Ins|CDH26_ENST00000244049.3_Stop_Codon_Ins			Q8IXH8	CAD26_HUMAN	cadherin 26						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.*833fs?(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			TGTTCCTTCCTAAAAAAAAAAG	0.396													|||unknown(HR)	163	0.0325479	0.1082	0.0115	5008	,	,		18084	0.003		0.004	False		,,,				2504	0.0051																1	Deletion - Frameshift(1)	ovary(1)						ENSG00000124215																																			CDH26	SO:0001627	intron_variant	0				HGNC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2172+5941->A	20.37:g.58587793_58587793dupA		Somatic	0	56	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.*834fs	ENST00000244047.5	37	c.2497_2498		20																																																																																			-	NULL		0.396	CDH26-201	KNOWN	basic	protein_coding	CDH26	protein_coding		-	NM_177980			58587784	+1	no_errors	ENST00000348616	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	A
M6PR	4074	genome.wustl.edu	37	12	9098969	9098969	+	Frame_Shift_Del	DEL	C	C	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr12:9098969delC	ENST00000000412.3	-	2	500	c.32delG	c.(31-33)ggafs	p.G11fs		NM_002355.3	NP_002346.1	P20645	MPRD_HUMAN	mannose-6-phosphate receptor (cation dependent)	11					endosome to lysosome transport (GO:0008333)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	mannose binding (GO:0005537)|mannose transmembrane transporter activity (GO:0015578)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(1)	11		Hepatocellular(102;0.137)		BRCA - Breast invasive adenocarcinoma(232;0.0146)	Alglucosidase alfa(DB01272)	TAGTAGCAGTCCAGTCCTCCA	0.493																																																	0								ENSG00000003056						94.0	92.0	93.0					12																	9098969		2203	4300	6503	M6PR	SO:0001589	frameshift_variant	0				HGNC		CCDS8598.1, CCDS73440.1	12p13.31	2013-09-20			ENSG00000003056	ENSG00000003056			6752	protein-coding gene	gene with protein product		154540					Standard	NM_002355		Approved		uc001qvf.3	P20645	OTTHUMG00000168276	ENST00000000412.3:c.32delG	12.37:g.9098969delC	ENSP00000000412:p.Gly11fs	Somatic	0	81	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	A8K528|D3DUV5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Man6P_isomerase_rcpt-bd_dom,prints_Man_6_P_rcpt	p.G11fs	ENST00000000412.3	37	c.32	CCDS8598.1	12																																																																																			-	NULL		0.493	M6PR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	M6PR	protein_coding	OTTHUMT00000399130.1	C				9098969	-1	no_errors	ENST00000000412	ensembl	human	known	74_37	frame_shift_del	DEL	0.055	-
CNTNAP5	129684	genome.wustl.edu	37	2	125504848	125504848	+	Frame_Shift_Del	DEL	G	G	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr2:125504848delG	ENST00000431078.1	+	14	2481	c.2117delG	c.(2116-2118)aggfs	p.R706fs		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	706	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCCAATGAAAGGCACCCTTAC	0.547																																																	0								ENSG00000155052						100.0	100.0	100.0					2																	125504848		2024	4194	6218	CNTNAP5	SO:0001589	frameshift_variant	0				HGNC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2117delG	2.37:g.125504848delG	ENSP00000399013:p.Arg706fs	Somatic	0	62	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	30	42.31	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R706fs	ENST00000431078.1	37	c.2117	CCDS46401.1	2																																																																																			-	NULL		0.547	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	G				125504848	+1	no_errors	ENST00000431078	ensembl	human	known	74_37	frame_shift_del	DEL	0.007	-
PPRC1	23082	genome.wustl.edu	37	10	103898382	103898382	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr10:103898382T>A	ENST00000278070.2	+	3	388	c.349T>A	c.(349-351)Tta>Ata	p.L117I	PPRC1_ENST00000413464.2_Missense_Mutation_p.L117I|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	117					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GCAGAGCAGGTTATCTCTGGA	0.488																																																	0								ENSG00000148840						103.0	96.0	99.0					10																	103898382		2203	4300	6503	PPRC1	SO:0001583	missense	0			-	HGNC	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.349T>A	10.37:g.103898382T>A	ENSP00000278070:p.Leu117Ile	Somatic	0	51	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	12	53.85	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L117I	ENST00000278070.2	37	c.349	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	T	14.88	2.667147	0.47677	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.54866	0.55;0.55	4.97	-1.89	0.07689	.	0.220744	0.26750	N	0.022696	T	0.28234	0.0697	N	0.24115	0.695	0.18873	N	0.999989	P;P	0.44816	0.844;0.844	B;B	0.39904	0.313;0.313	T	0.22906	-1.0203	10	0.54805	T	0.06	.	2.2832	0.04120	0.1052:0.3072:0.1746:0.4131	.	117;117	E7EVG6;Q5VV67	.;PPRC1_HUMAN	I	117	ENSP00000278070:L117I;ENSP00000399743:L117I	ENSP00000278070:L117I	L	+	1	2	PPRC1	103888372	0.965000	0.33210	0.996000	0.52242	0.985000	0.73830	0.085000	0.14912	0.016000	0.14998	0.379000	0.24179	TTA	-	NULL		0.488	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	protein_coding	OTTHUMT00000050021.1	T	NM_015062	-		103898382	+1	no_errors	ENST00000278070	ensembl	human	known	74_37	missense	SNP	0.354	A
DNAH7	56171	genome.wustl.edu	37	2	196849355	196849355	+	Splice_Site	SNP	C	C	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr2:196849355C>A	ENST00000312428.6	-	15	1934		c.e15+1			NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						ATAAACAATACCTTCATTTCC	0.333																																																	0								ENSG00000118997						115.0	106.0	109.0					2																	196849355		1834	4082	5916	DNAH7	SO:0001630	splice_region_variant	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.1833+1G>T	2.37:g.196849355C>A		Somatic	0	57	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	39	42.65	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e15+1	ENST00000312428.6	37	c.1833+1	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980160	0.74474	.	.	ENSG00000118997	ENST00000312428	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8919	0.92408	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH7	196557600	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	5.980000	0.70516	2.574000	0.86865	0.655000	0.94253	.	-	-		0.333	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	C	NM_018897	-	Intron	196849355	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	splice_site	SNP	1.000	A
PKD2	5311	genome.wustl.edu	37	4	88929231	88929231	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:88929231G>T	ENST00000237596.2	+	1	412	c.346G>T	c.(346-348)Gta>Tta	p.V116L		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		GGAGATGGACGTAGAGTGGCG	0.736																																																	0								ENSG00000118762						3.0	3.0	3.0					4																	88929231		1576	3184	4760	PKD2	SO:0001583	missense	0			-	HGNC	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.346G>T	4.37:g.88929231G>T	ENSP00000237596:p.Val116Leu	Somatic	0	64	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_hand_dom,prints_PKD_2,prints_PKD_1	p.V116L	ENST00000237596.2	37	c.346	CCDS3627.1	4	.	.	.	.	.	.	.	.	.	.	g	25.8	4.672354	0.88348	.	.	ENSG00000118762	ENST00000237596	T	0.64991	-0.13	3.22	3.22	0.36961	.	0.073216	0.56097	D	0.000040	T	0.43122	0.1233	L	0.27053	0.805	0.80722	D	1	B	0.33940	0.433	B	0.26614	0.071	T	0.35425	-0.9789	10	0.13470	T	0.59	-0.7903	14.1791	0.65562	0.0:0.0:1.0:0.0	.	116	Q13563	PKD2_HUMAN	L	116	ENSP00000237596:V116L	ENSP00000237596:V116L	V	+	1	0	PKD2	89148255	1.000000	0.71417	0.996000	0.52242	0.960000	0.62799	4.518000	0.60510	1.637000	0.50538	0.486000	0.48141	GTA	-	NULL		0.736	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	protein_coding	OTTHUMT00000253042.4	G	NM_000297	-		88929231	+1	no_errors	ENST00000237596	ensembl	human	known	74_37	missense	SNP	1.000	T
PPP1R26	9858	genome.wustl.edu	37	9	138377398	138377398	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:138377398A>G	ENST00000356818.2	+	4	1591	c.1042A>G	c.(1042-1044)Aag>Gag	p.K348E	PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000604351.1_Missense_Mutation_p.K348E|PPP1R26_ENST00000401470.3_Missense_Mutation_p.K348E|PPP1R26_ENST00000605660.1_Missense_Mutation_p.K348E|PPP1R26_ENST00000605286.1_Missense_Mutation_p.K348E	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	348					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										AAGGAGGGGAAAGCGAGTCAT	0.617																																																	0								ENSG00000196422						57.0	65.0	62.0					9																	138377398		2203	4300	6503	PPP1R26	SO:0001583	missense	0			-	HGNC	AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.1042A>G	9.37:g.138377398A>G	ENSP00000349274:p.Lys348Glu	Somatic	0	58	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	34	32.00	Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K348E	ENST00000356818.2	37	c.1042	CCDS6988.1	9	.	.	.	.	.	.	.	.	.	.	A	13.09	2.133753	0.37630	.	.	ENSG00000196422	ENST00000356818	T	0.10288	2.89	5.36	0.0272	0.14153	.	1.347700	0.04636	N	0.404552	T	0.12860	0.0312	L	0.53249	1.67	0.09310	N	1	B	0.16396	0.017	B	0.18871	0.023	T	0.38693	-0.9649	10	0.51188	T	0.08	-7.0677	7.1231	0.25456	0.4137:0.4265:0.1598:0.0	.	348	Q5T8A7	PPR26_HUMAN	E	348	ENSP00000349274:K348E	ENSP00000349274:K348E	K	+	1	0	KIAA0649	137517219	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.084000	0.11268	0.003000	0.14656	-0.274000	0.10170	AAG	-	NULL		0.617	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	protein_coding	OTTHUMT00000054987.1	A	NM_014811	-		138377398	+1	no_errors	ENST00000356818	ensembl	human	known	74_37	missense	SNP	0.000	G
FREM2	341640	genome.wustl.edu	37	13	39454452	39454452	+	Missense_Mutation	SNP	C	C	T	rs114400765	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr13:39454452C>T	ENST00000280481.7	+	24	9254	c.9038C>T	c.(9037-9039)aCg>aTg	p.T3013M		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	3013					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TATATACATACGATCTATACA	0.423													C|||	4	0.000798722	0.0	0.0	5008	,	,		19109	0.001		0.001	False		,,,				2504	0.002																0								ENSG00000150893	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	88.0	86.0	87.0		9038	5.9	1.0	13	dbSNP_132	87	24,8576	17.3+/-56.4	0,24,4276	yes	missense	FREM2	NM_207361.4	81	0,25,6478	TT,TC,CC		0.2791,0.0227,0.1922	probably-damaging	3013/3170	39454452	25,12981	2203	4300	6503	FREM2	SO:0001583	missense	0			GMAF=0	HGNC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.9038C>T	13.37:g.39454452C>T	ENSP00000280481:p.Thr3013Met	Somatic	0	63	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	8	75.00	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.T3013M	ENST00000280481.7	37	c.9038	CCDS31960.1	13	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	26.5	4.748071	0.89663	2.27E-4	0.002791	ENSG00000150893	ENST00000280481	T	0.64618	-0.11	5.89	5.89	0.94794	.	0.105878	0.64402	D	0.000005	T	0.79173	0.4401	M	0.84082	2.675	0.80722	D	1	D	0.76494	0.999	P	0.56960	0.81	T	0.81464	-0.0921	10	0.87932	D	0	.	20.2562	0.98421	0.0:1.0:0.0:0.0	.	3013	Q5SZK8	FREM2_HUMAN	M	3013	ENSP00000280481:T3013M	ENSP00000280481:T3013M	T	+	2	0	FREM2	38352452	1.000000	0.71417	0.951000	0.38953	0.614000	0.37383	7.593000	0.82686	2.797000	0.96272	0.563000	0.77884	ACG	-	NULL		0.423	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	protein_coding	OTTHUMT00000044599.2	C	NM_207361	rs114400765		39454452	+1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	SNP	1.000	T
HDDC3	374659	genome.wustl.edu	37	15	91477671	91477671	+	5'Flank	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr15:91477671C>T	ENST00000394272.3	-	0	0				HDDC3_ENST00000330334.3_5'Flank|HDDC3_ENST00000559898.1_5'Flank|UNC45A_ENST00000394275.2_5'UTR|UNC45A_ENST00000418476.2_5'Flank|AC068831.3_ENST00000438890.1_RNA|AC068831.3_ENST00000448987.1_RNA			Q8N4P3	MESH1_HUMAN	HD domain containing 3								guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity (GO:0008893)|metal ion binding (GO:0046872)			NS(1)|ovary(1)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CCAGAGGAAGCCTACTGCTGC	0.622											OREG0023476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000140553																																			UNC45A	SO:0001631	upstream_gene_variant	0			-	HGNC	AK057584	CCDS10366.1, CCDS66866.1	15q26.1	2005-08-22			ENSG00000184508	ENSG00000184508			30522	protein-coding gene	gene with protein product						12477932	Standard	NM_001286451		Approved	MGC45386	uc002bqe.4	Q8N4P3	OTTHUMG00000141260		15.37:g.91477671C>T	Exception_encountered	Somatic	0	47	0.00	1282	0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394272.3	37	NULL		15																																																																																			-	-		0.622	HDDC3-002	KNOWN	basic|appris_principal	protein_coding	UNC45A	protein_coding	OTTHUMT00000280403.2	C	NM_198527	-		91477671	+1	no_errors	ENST00000461266	ensembl	human	known	74_37	rna	SNP	0.998	T
ZNF207	7756	genome.wustl.edu	37	17	30700337	30700338	+	IGR	INS	-	-	A	rs561324841|rs191933623	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr17:30700337_30700338insA	ENST00000321233.6	+	0	2283				ZNF207_ENST00000394670.4_3'UTR|ZNF207_ENST00000577908.1_Intron|ZNF207_ENST00000584416.1_3'UTR	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207						attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TTGGGatttttaaaaaaaaaaa	0.337																																																	0								ENSG00000010244																																			ZNF207	SO:0001628	intergenic_variant	0				HGNC	AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810		17.37:g.30700348_30700348dupA		Somatic	0	33	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000321233.6	37	NULL	CCDS11271.1	17																																																																																			-	-		0.337	ZNF207-003	KNOWN	basic|CCDS	protein_coding	ZNF207	protein_coding	OTTHUMT00000256251.2	-				30700338	+1	no_errors	ENST00000584416	ensembl	human	putative	74_37	rna	INS	0.001:0.001	A
ADAMTSL1	92949	genome.wustl.edu	37	9	18826431	18826431	+	Silent	SNP	C	C	T	rs536763405		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:18826431C>T	ENST00000380548.4	+	22	4423	c.4084C>T	c.(4084-4086)Ctg>Ttg	p.L1362L	ADAMTSL1_ENST00000380545.5_Silent_p.L63L	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1362	Ig-like C2-type 3.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TCATGGAGAGCTGACTGAGAG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		17022	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000178031						41.0	43.0	42.0					9																	18826431		2062	4218	6280	ADAMTSL1	SO:0001819	synonymous_variant	0			-	HGNC	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.4084C>T	9.37:g.18826431C>T		Somatic	0	32	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L63	ENST00000380548.4	37	c.187	CCDS47954.1	9																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.577	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	protein_coding	OTTHUMT00000401206.1	C		-		18826431	+1	no_errors	ENST00000388710	ensembl	human	known	74_37	silent	SNP	1.000	T
LARP1	23367	genome.wustl.edu	37	5	154181828	154181828	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr5:154181828G>T	ENST00000336314.4	+	11	1771	c.1747G>T	c.(1747-1749)Gac>Tac	p.D583Y		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	660					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CCCAGGGGGGGACCGCACAGG	0.547																																																	0								ENSG00000155506						78.0	75.0	76.0					5																	154181828		2203	4300	6503	LARP1	SO:0001583	missense	0			-	HGNC	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1747G>T	5.37:g.154181828G>T	ENSP00000336721:p.Asp583Tyr	Somatic	0	46	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	15	48.39	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.D583Y	ENST00000336314.4	37	c.1747	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.137966	0.94517	.	.	ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000524248	T;T;T	0.60548	0.95;0.18;0.28	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.81351	0.4804	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.82486	-0.0433	10	0.87932	D	0	-28.5151	20.8794	0.99867	0.0:0.0:1.0:0.0	.	660;583	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	Y	583;660;455	ENSP00000336721:D583Y;ENSP00000428589:D660Y;ENSP00000429904:D455Y	ENSP00000336721:D583Y	D	+	1	0	LARP1	154162021	1.000000	0.71417	0.989000	0.46669	0.971000	0.66376	9.787000	0.99055	2.941000	0.99782	0.655000	0.94253	GAC	-	NULL		0.547	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	protein_coding	OTTHUMT00000252509.1	G	NM_033551	-		154181828	+1	no_errors	ENST00000336314	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPRK	5796	genome.wustl.edu	37	6	128321224	128321225	+	Intron	INS	-	-	A	rs202179145|rs78615852	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr6:128321224_128321225insA	ENST00000368215.3	-	16	2491				PTPRK_ENST00000368210.3_Intron|PTPRK_ENST00000368213.5_Intron|PTPRK_ENST00000368227.3_Intron|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000532331.1_Intron|PTPRK_ENST00000368207.3_Intron|PTPRK_ENST00000368226.4_Intron			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ACTTACCACTTAAAAAAAAAAA	0.297																																																	0								ENSG00000152894																																			PTPRK	SO:0001627	intron_variant	0				HGNC	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2492-1175->T	6.37:g.128321235_128321235dupA		Somatic	0	17	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368215.3	37	NULL		6																																																																																			-	-		0.297	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	protein_coding	OTTHUMT00000042163.1	-				128321225	-1	no_errors	ENST00000524481	ensembl	human	known	74_37	rna	INS	0.341:0.625	A
TRIOBP	11078	genome.wustl.edu	37	22	38122497	38122497	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr22:38122497G>A	ENST00000406386.3	+	7	4189	c.3934G>A	c.(3934-3936)Ggg>Agg	p.G1312R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1312					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GCGCCTCTTCGGGCAAGAGCG	0.701																																																	0								ENSG00000100106						3.0	4.0	4.0					22																	38122497		1681	3576	5257	TRIOBP	SO:0001583	missense	0			-	HGNC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3934G>A	22.37:g.38122497G>A	ENSP00000384312:p.Gly1312Arg	Somatic	0	11	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	6	53.85	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G1312R	ENST00000406386.3	37	c.3934	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687622	0.48097	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.70045	-0.45	5.07	4.04	0.47022	.	.	.	.	.	T	0.48484	0.1502	L	0.27053	0.805	0.80722	D	1	P	0.42456	0.78	B	0.29716	0.106	T	0.52230	-0.8603	9	0.49607	T	0.09	.	13.7004	0.62604	0.0:0.1543:0.8457:0.0	.	1312	Q9H2D6	TARA_HUMAN	R	1312	ENSP00000384312:G1312R	ENSP00000384312:G1312R	G	+	1	0	TRIOBP	36452443	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.921000	0.56454	1.118000	0.41863	0.558000	0.71614	GGG	-	NULL		0.701	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	protein_coding	OTTHUMT00000319439.2	G		-		38122497	+1	no_errors	ENST00000406386	ensembl	human	known	74_37	missense	SNP	1.000	A
FRK	2444	genome.wustl.edu	37	6	116289823	116289823	+	Silent	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr6:116289823G>T	ENST00000606080.1	-	3	992	c.546C>A	c.(544-546)atC>atA	p.I182I	FRK_ENST00000538210.1_Silent_p.I40I	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	182	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	GTGTTGAAAAGATTCTTCTTC	0.408																																																	0								ENSG00000111816						158.0	150.0	153.0					6																	116289823		2203	4300	6503	FRK	SO:0001819	synonymous_variant	0			-	HGNC	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.546C>A	6.37:g.116289823G>T		Somatic	0	138	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	77	31.86	B4DY49|Q13128|Q9NTR5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.I182	ENST00000606080.1	37	c.546	CCDS5103.1	6																																																																																			-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2		0.408	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRK	protein_coding	OTTHUMT00000041924.2	G	NM_002031	-		116289823	-1	no_errors	ENST00000606080	ensembl	human	known	74_37	silent	SNP	0.017	T
PYGM	5837	genome.wustl.edu	37	11	64525326	64525326	+	Silent	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr11:64525326G>T	ENST00000164139.3	-	5	983	c.585C>A	c.(583-585)ccC>ccA	p.P195P	PYGM_ENST00000377432.3_Silent_p.P107P	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	195					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCGTGAACTCGGGCCGGGCCT	0.622																																																	0								ENSG00000068976						75.0	66.0	69.0					11																	64525326		2201	4297	6498	PYGM	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.585C>A	11.37:g.64525326G>T		Somatic	0	44	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A0AVK1|A6NDY6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.P195	ENST00000164139.3	37	c.585	CCDS8079.1	11																																																																																			-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas		0.622	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	protein_coding	OTTHUMT00000143254.2	G	NM_005609	-		64525326	-1	no_errors	ENST00000164139	ensembl	human	known	74_37	silent	SNP	0.813	T
ESPL1	9700	genome.wustl.edu	37	12	53683327	53683327	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr12:53683327C>T	ENST00000257934.4	+	22	5153	c.5062C>T	c.(5062-5064)Ccc>Tcc	p.P1688S	ESPL1_ENST00000552462.1_Missense_Mutation_p.P1688S	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1688					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						TGGCCACTTCCCCCAGCCTGA	0.617																																					Colon(53;1069 1201 2587 5382)												0								ENSG00000135476						46.0	49.0	48.0					12																	53683327		2203	4300	6503	ESPL1	SO:0001583	missense	0			-	HGNC	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5062C>T	12.37:g.53683327C>T	ENSP00000257934:p.Pro1688Ser	Somatic	0	68	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C50,superfamily_DsrEFH-like	p.P1688S	ENST00000257934.4	37	c.5062	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478983	0.63849	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.17213	2.29;2.29	5.26	5.26	0.73747	.	0.123552	0.53938	D	0.000041	T	0.29389	0.0732	L	0.34521	1.04	0.46437	D	0.999044	D	0.76494	0.999	D	0.66084	0.941	T	0.00915	-1.1516	10	0.72032	D	0.01	.	14.2504	0.66016	0.0:1.0:0.0:0.0	.	1688	Q14674	ESPL1_HUMAN	S	1688;1363;1688	ENSP00000257934:P1688S;ENSP00000449831:P1688S	ENSP00000257934:P1688S	P	+	1	0	ESPL1	51969594	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	3.191000	0.50981	2.735000	0.93741	0.563000	0.77884	CCC	-	NULL		0.617	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	protein_coding	OTTHUMT00000406899.2	C	NM_012291	-		53683327	+1	no_errors	ENST00000257934	ensembl	human	known	74_37	missense	SNP	1.000	T
PWWP2B	170394	genome.wustl.edu	37	10	134219604	134219604	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr10:134219604C>T	ENST00000305233.5	+	2	1659	c.1600C>T	c.(1600-1602)Ccg>Tcg	p.P534S	PWWP2B_ENST00000368609.4_Intron	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	534	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.									central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		GTTTGGTTCTCCGACTACGTC	0.483																																																	0								ENSG00000171813						181.0	183.0	182.0					10																	134219604		2202	4300	6502	PWWP2B	SO:0001583	missense	0			-	HGNC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1600C>T	10.37:g.134219604C>T	ENSP00000306324:p.Pro534Ser	Somatic	0	96	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	17	55.26	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	p.P534S	ENST00000305233.5	37	c.1600	CCDS7667.2	10	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174427	0.57692	.	.	ENSG00000171813	ENST00000305233	T	0.69561	-0.41	4.28	4.28	0.50868	PWWP (2);	0.000000	0.64402	U	0.000003	T	0.63165	0.2488	N	0.16233	0.39	0.80722	D	1	B	0.26577	0.153	B	0.43103	0.408	T	0.67821	-0.5571	10	0.72032	D	0.01	.	16.2808	0.82678	0.0:1.0:0.0:0.0	.	534	Q6NUJ5	PWP2B_HUMAN	S	534	ENSP00000306324:P534S	ENSP00000306324:P534S	P	+	1	0	PWWP2B	134069594	1.000000	0.71417	0.979000	0.43373	0.714000	0.41099	7.021000	0.76425	2.396000	0.81511	0.563000	0.77884	CCG	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom		0.483	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWWP2B	protein_coding	OTTHUMT00000051075.3	C	NM_138499	-		134219604	+1	no_errors	ENST00000305233	ensembl	human	known	74_37	missense	SNP	1.000	T
ACAD11	84129	genome.wustl.edu	37	3	132358496	132358496	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr3:132358496G>T	ENST00000264990.6	-	5	1513	c.542C>A	c.(541-543)tCa>tAa	p.S181*	ACAD11_ENST00000545291.1_5'UTR|ACAD11_ENST00000489991.1_Intron|ACAD11_ENST00000355458.3_Nonsense_Mutation_p.S181*|ACAD11_ENST00000481970.2_Nonsense_Mutation_p.S181*	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	181					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						TGTCCAGGTTGATACCTAAAG	0.368																																																	0								ENSG00000240303						62.0	60.0	61.0					3																	132358496		2203	4300	6503	ACAD11	SO:0001587	stop_gained	0			-	HGNC	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.542C>A	3.37:g.132358496G>T	ENSP00000264990:p.Ser181*	Somatic	0	55	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminoglycoside_PTrfase,pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,pfam_AcylCoA_DH/ox_N,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_Kinase-like_dom	p.S181*	ENST00000264990.6	37	c.542	CCDS3074.1	3	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759891	0.89932	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	.	.	.	5.76	3.64	0.41730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2412	0.31660	0.1515:0.0:0.7179:0.1306	.	.	.	.	X	181	.	ENSP00000264990:S181X	S	-	2	0	ACAD11	133841186	0.968000	0.33430	0.870000	0.34147	0.838000	0.47535	1.522000	0.35921	1.422000	0.47177	0.561000	0.74099	TCA	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom		0.368	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD11	protein_coding	OTTHUMT00000357279.2	G	NM_032169	-		132358496	-1	no_errors	ENST00000264990	ensembl	human	known	74_37	nonsense	SNP	0.988	T
SF3A2	8175	genome.wustl.edu	37	19	2248202	2248202	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr19:2248202A>G	ENST00000221494.5	+	9	1470	c.1052A>G	c.(1051-1053)cAc>cGc	p.H351R	AMH_ENST00000221496.4_5'Flank|MIR4321_ENST00000592276.1_RNA	NM_007165.4	NP_009096.2	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2, 66kDa	351	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGGAGTCCACCCACCAGCC	0.746																																																	0								ENSG00000104897						2.0	3.0	2.0					19																	2248202		1384	3121	4505	SF3A2	SO:0001583	missense	0			-	HGNC	L21990	CCDS12084.1	19p13.3	2012-10-02	2002-08-29		ENSG00000104897	ENSG00000104897			10766	protein-coding gene	gene with protein product		600796	"""splicing factor 3a, subunit 2, 66kD"""			8211113, 8541848	Standard	NM_007165		Approved	SF3a66, SAP62, PRPF11, Prp11	uc002lvg.3	Q15428	OTTHUMG00000180414	ENST00000221494.5:c.1052A>G	19.37:g.2248202A>G	ENSP00000221494:p.His351Arg	Somatic	0	20	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67	B2RBU1|D6W605|O75245	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_U1,pfscan_Znf_C2H2_matrin	p.H351R	ENST00000221494.5	37	c.1052	CCDS12084.1	19	.	.	.	.	.	.	.	.	.	.	A	7.277	0.608326	0.14002	.	.	ENSG00000104897	ENST00000221494	T	0.41065	1.01	4.87	3.78	0.43462	.	0.137270	0.31461	U	0.007605	T	0.23492	0.0568	N	0.19112	0.55	0.09310	N	1	B	0.33073	0.396	B	0.26310	0.068	T	0.13045	-1.0524	10	0.40728	T	0.16	-21.7502	8.6324	0.33928	0.664:0.336:0.0:0.0	.	351	Q15428	SF3A2_HUMAN	R	351	ENSP00000221494:H351R	ENSP00000221494:H351R	H	+	2	0	SF3A2	2199202	0.000000	0.05858	0.053000	0.19242	0.061000	0.15899	-0.040000	0.12104	1.819000	0.53055	0.459000	0.35465	CAC	-	NULL		0.746	SF3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A2	protein_coding	OTTHUMT00000451268.3	A		-		2248202	+1	no_errors	ENST00000221494	ensembl	human	known	74_37	missense	SNP	0.009	G
EPHA5	2044	genome.wustl.edu	37	4	66230840	66230840	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:66230840C>A	ENST00000273854.3	-	12	2731	c.2131G>T	c.(2131-2133)Gta>Tta	p.V711L	EPHA5_ENST00000511294.1_Missense_Mutation_p.V712L|EPHA5_ENST00000354839.4_Missense_Mutation_p.V689L|EPHA5_ENST00000432638.2_Missense_Mutation_p.V548L	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	711	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GTATAGCCTACTTTAAGGGTT	0.388										TSP Lung(17;0.13)																																							0								ENSG00000145242						201.0	199.0	199.0					4																	66230840		2203	4300	6503	EPHA5	SO:0001583	missense	0			-	HGNC	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2131G>T	4.37:g.66230840C>A	ENSP00000273854:p.Val711Leu	Somatic	0	112	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	29	45.28	Q7Z3F2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V711L	ENST00000273854.3	37	c.2131	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020449	0.75275	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.97	5.97	0.96955	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000085	T	0.73187	0.3555	N	0.10945	0.07	0.53005	D	0.999963	B;B;B;B	0.24186	0.017;0.013;0.013;0.099	B;B;B;B	0.20955	0.032;0.021;0.014;0.024	T	0.69292	-0.5183	10	0.72032	D	0.01	.	20.4238	0.99064	0.0:1.0:0.0:0.0	.	690;712;689;711	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	L	711;548;689;712	ENSP00000273854:V711L;ENSP00000389208:V548L;ENSP00000346899:V689L;ENSP00000427638:V712L	ENSP00000273854:V711L	V	-	1	0	EPHA5	65913435	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	6.042000	0.70996	2.834000	0.97654	0.650000	0.86243	GTA	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Prot_kinase_dom		0.388	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	protein_coding	OTTHUMT00000251388.2	C	NM_004439	-		66230840	-1	no_errors	ENST00000273854	ensembl	human	known	74_37	missense	SNP	1.000	A
KYNU	8942	genome.wustl.edu	37	2	143743591	143743591	+	Splice_Site	SNP	G	G	C			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr2:143743591G>C	ENST00000264170.4	+	10	1160		c.e10+1		KYNU_ENST00000375773.2_Splice_Site|KYNU_ENST00000409512.1_Splice_Site	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		TTAAACCTGCGTGAGTACCAT	0.328																																																	0								ENSG00000115919						70.0	69.0	69.0					2																	143743591		2203	4300	6503	KYNU	SO:0001630	splice_region_variant	0			-	HGNC	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.902+1G>C	2.37:g.143743591G>C		Somatic	0	63	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	42	36.36		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9+1	ENST00000264170.4	37	c.902+1	CCDS2183.1	2	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676027	0.47886	.	.	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3412	0.90305	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KYNU	143460061	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	4.686000	0.61700	2.772000	0.95346	0.650000	0.86243	.	-	-		0.328	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KYNU	protein_coding	OTTHUMT00000254772.1	G	NM_001032998	-	Intron	143743591	+1	no_errors	ENST00000264170	ensembl	human	known	74_37	splice_site	SNP	1.000	C
FGFR1	2260	genome.wustl.edu	37	8	38283595	38283595	+	Intron	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr8:38283595C>T	ENST00000447712.2	-	6	1687				FGFR1_ENST00000397091.5_Intron|FGFR1_ENST00000397113.2_Intron|FGFR1_ENST00000397103.1_Intron|RP11-350N15.4_ENST00000528407.1_RNA|FGFR1_ENST00000532791.1_Intron|FGFR1_ENST00000356207.5_Intron|FGFR1_ENST00000397108.4_Intron|FGFR1_ENST00000425967.3_Intron|FGFR1_ENST00000341462.5_Intron|FGFR1_ENST00000326324.6_Intron|FGFR1_ENST00000335922.5_Intron	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1						angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCAAGCCTGGCTCTTCCCACT	0.537		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""				OREG0018722	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	0								ENSG00000255201						95.0	99.0	98.0					8																	38283595		2040	4196	6236	RP11-350N15.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.745+44G>A	8.37:g.38283595C>T		Somatic	0	44	0.00	877	0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000447712.2	37	NULL	CCDS6107.2	8																																																																																			-	-		0.537	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000255201	protein_coding		C		-		38283595	+1	no_errors	ENST00000528407	ensembl	human	known	74_37	rna	SNP	0.002	T
PHKB	5257	genome.wustl.edu	37	16	47545604	47545606	+	In_Frame_Del	DEL	CAA	CAA	-	rs146558295	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	CAA	CAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr16:47545604_47545606delCAA	ENST00000323584.5	+	5	458_460	c.434_436delCAA	c.(433-438)ccaaca>cca	p.T147del	PHKB_ENST00000566044.1_In_Frame_Del_p.T140del|PHKB_ENST00000299167.8_In_Frame_Del_p.T147del|PHKB_ENST00000567402.1_3'UTR|PHKB_ENST00000455779.1_In_Frame_Del_p.T140del	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	147					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GATCCACGCCCAACAACATGTCT	0.33																																																	0								ENSG00000102893																																			PHKB	SO:0001651	inframe_deletion	0				HGNC		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.434_436delCAA	16.37:g.47545607_47545609delCAA	ENSP00000313504:p.Thr147del	Somatic	0	66	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	27	32.50	Q8N4T5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.T147in_frame_del	ENST00000323584.5	37	c.434_436	CCDS10729.1	16																																																																																			-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.330	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	protein_coding	OTTHUMT00000430413.1	CAA				47545606	+1	no_errors	ENST00000299167	ensembl	human	known	74_37	in_frame_del	DEL	1.000:0.977:0.982	-
PPP2R2C	5522	genome.wustl.edu	37	4	6349641	6349641	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:6349641C>A	ENST00000382599.4	-	6	938	c.722G>T	c.(721-723)aGc>aTc	p.S241I	PPP2R2C_ENST00000506140.1_Missense_Mutation_p.S234I|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.S241I|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.S224I|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.S234I|PPP2R2C_ENST00000314348.8_5'Flank			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	241					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						CTTGCTGCTGCTGTAGACGAA	0.612																																																	0								ENSG00000074211						180.0	131.0	148.0					4																	6349641		2203	4300	6503	PPP2R2C	SO:0001583	missense	0			-	HGNC	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.722G>T	4.37:g.6349641C>A	ENSP00000372042:p.Ser241Ile	Somatic	0	86	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.S241I	ENST00000382599.4	37	c.722		4	.	.	.	.	.	.	.	.	.	.	C	25.2	4.610311	0.87258	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	4.73	4.73	0.59995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.52175	0.1718	M	0.84948	2.725	0.80722	D	1	P;D;P;P;P	0.58970	0.732;0.984;0.732;0.732;0.606	P;P;P;B;B	0.52554	0.522;0.702;0.522;0.399;0.295	T	0.62895	-0.6757	10	0.87932	D	0	-39.155	17.2337	0.86992	0.0:1.0:0.0:0.0	.	234;337;241;224;241	B7Z3Y1;Q59GC6;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;.;2ABG_HUMAN;.;.	I	241;234;224;241;234	ENSP00000335083:S241I;ENSP00000423649:S234I;ENSP00000422374:S224I;ENSP00000372042:S241I;ENSP00000425247:S234I	ENSP00000335083:S241I	S	-	2	0	PPP2R2C	6400542	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.672000	0.74477	2.606000	0.88127	0.561000	0.74099	AGC	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55		0.612	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	PPP2R2C	protein_coding	OTTHUMT00000206889.2	C	NM_181876	-		6349641	-1	no_errors	ENST00000335585	ensembl	human	known	74_37	missense	SNP	1.000	A
MYBPH	4608	genome.wustl.edu	37	1	203144809	203144809	+	Silent	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:203144809G>A	ENST00000255416.4	-	1	132	c.75C>T	c.(73-75)ccC>ccT	p.P25P		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	25					cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		GCTCTGCTGTGGGCACCTTGG	0.632																																					NSCLC(32;174 1025 14462 23899 42933)												0								ENSG00000133055						92.0	108.0	102.0					1																	203144809		2203	4300	6503	MYBPH	SO:0001819	synonymous_variant	0			-	HGNC	BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.75C>T	1.37:g.203144809G>A		Somatic	0	157	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	60	34.07	Q16886|Q86YC5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P25	ENST00000255416.4	37	c.75	CCDS30975.1	1																																																																																			-	NULL		0.632	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPH	protein_coding	OTTHUMT00000100264.1	G	NM_004997	-		203144809	-1	no_errors	ENST00000255416	ensembl	human	known	74_37	silent	SNP	0.670	A
MCU	90550	genome.wustl.edu	37	10	74644030	74644030	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr10:74644030G>T	ENST00000373053.3	+	7	889	c.868G>T	c.(868-870)Gtt>Ttt	p.V290F	MCU_ENST00000605416.1_3'UTR|MCU_ENST00000536019.1_Missense_Mutation_p.V241F|MCU_ENST00000357157.6_Missense_Mutation_p.V269F	NM_138357.2	NP_612366.1	Q8NE86	MCU_HUMAN	mitochondrial calcium uniporter	290					calcium ion transmembrane import into mitochondrion (GO:0036444)|calcium-mediated signaling (GO:0019722)|glucose homeostasis (GO:0042593)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein complex oligomerization (GO:0035786)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|uniplex complex (GO:1990246)	calcium channel activity (GO:0005262)|uniporter activity (GO:0015292)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(1)	14						TTAGGAATATGTTTATCCAGA	0.333																																																	0								ENSG00000156026						106.0	110.0	108.0					10																	74644030		2202	4299	6501	MCU	SO:0001583	missense	0			-	HGNC	BC034235	CCDS7317.1, CCDS59218.1, CCDS59219.1	10q22.2	2011-06-23	2011-06-23	2011-06-23	ENSG00000156026	ENSG00000156026			23526	protein-coding gene	gene with protein product		614197	"""coiled-coil domain containing 109A"""	C10orf42, CCDC109A		21685886, 21685888	Standard	NM_138357		Approved	FLJ46135	uc001jtc.3	Q8NE86	OTTHUMG00000018443	ENST00000373053.3:c.868G>T	10.37:g.74644030G>T	ENSP00000362144:p.Val290Phe	Somatic	0	84	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B2RDF3|B3KXV7|Q96FL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Coiled-coil-dom_prot_109_C	p.V290F	ENST00000373053.3	37	c.868	CCDS7317.1	10	.	.	.	.	.	.	.	.	.	.	G	17.53	3.413873	0.62511	.	.	ENSG00000156026	ENST00000373053;ENST00000357157;ENST00000536019	T;T;T	0.30714	1.52;1.52;1.52	5.92	5.01	0.66863	Coiled-coil domain containing protein 109, C-terminal (1);	0.187422	0.46758	D	0.000268	T	0.34019	0.0883	L	0.46157	1.445	0.54753	D	0.999986	P;B;P	0.50066	0.931;0.419;0.627	P;B;P	0.48571	0.582;0.187;0.454	T	0.05131	-1.0904	10	0.72032	D	0.01	-13.2867	10.6977	0.45909	0.1414:0.0:0.8586:0.0	.	269;241;290	Q8NE86-2;Q8NE86-3;Q8NE86	.;.;MCU_HUMAN	F	290;269;241	ENSP00000362144:V290F;ENSP00000349680:V269F;ENSP00000440913:V241F	ENSP00000349680:V269F	V	+	1	0	MCU	74314036	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.288000	0.43514	2.809000	0.96659	0.655000	0.94253	GTT	-	pfam_Coiled-coil-dom_prot_109_C		0.333	MCU-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCU	protein_coding	OTTHUMT00000048594.1	G	NM_138357	-		74644030	+1	no_errors	ENST00000373053	ensembl	human	known	74_37	missense	SNP	1.000	T
FREM2	341640	genome.wustl.edu	37	13	39262454	39262456	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	ATG	ATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr13:39262454_39262456delATG	ENST00000280481.7	+	1	1189_1191	c.973_975delATG	c.(973-975)atgdel	p.M328del		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	328					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTTCGTGGCCATGATGATGATGG	0.586																																																	0								ENSG00000150893																																			FREM2	SO:0001651	inframe_deletion	0				HGNC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.973_975delATG	13.37:g.39262463_39262465delATG	ENSP00000280481:p.Met328del	Somatic	0	62	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.M328in_frame_del	ENST00000280481.7	37	c.973_975	CCDS31960.1	13																																																																																			-	NULL		0.586	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	protein_coding	OTTHUMT00000044599.2	ATG	NM_207361			39262456	+1	no_errors	ENST00000280481	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
CELSR1	9620	genome.wustl.edu	37	22	46776812	46776812	+	Missense_Mutation	SNP	T	T	C	rs554929905		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr22:46776812T>C	ENST00000262738.3	-	22	7128	c.7129A>G	c.(7129-7131)Acg>Gcg	p.T2377A		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2377					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TACACCAGCGTGCTCACCATC	0.607													T|||	1	0.000199681	0.0	0.0	5008	,	,		18349	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000075275						39.0	41.0	40.0					22																	46776812		2203	4300	6503	CELSR1	SO:0001583	missense	0			-	HGNC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.7129A>G	22.37:g.46776812T>C	ENSP00000262738:p.Thr2377Ala	Somatic	0	81	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	32	31.91	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.T2377A	ENST00000262738.3	37	c.7129	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	T	2.341	-0.351176	0.05173	.	.	ENSG00000075275	ENST00000262738	T	0.06218	3.33	4.28	-6.28	0.02020	Domain of unknown function DUF3497 (1);	0.472911	0.18743	N	0.132383	T	0.03564	0.0102	N	0.17082	0.46	0.41935	D	0.990584	B;B	0.15930	0.015;0.001	B;B	0.19946	0.027;0.009	T	0.35276	-0.9795	10	0.22109	T	0.4	.	14.2111	0.65764	0.0:0.1454:0.0:0.8546	.	698;2377	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	A	2377	ENSP00000262738:T2377A	ENSP00000262738:T2377A	T	-	1	0	CELSR1	45155476	0.018000	0.18449	0.003000	0.11579	0.292000	0.27327	-0.438000	0.06905	-1.014000	0.03379	-1.843000	0.00578	ACG	-	pfam_DUF3497		0.607	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	protein_coding	OTTHUMT00000318037.1	T	NM_014246	-		46776812	-1	no_errors	ENST00000262738	ensembl	human	known	74_37	missense	SNP	0.003	C
KIT	3815	genome.wustl.edu	37	4	55592080	55592080	+	Silent	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr4:55592080G>T	ENST00000288135.5	+	9	1501	c.1404G>T	c.(1402-1404)ccG>ccT	p.P468P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	468	Ig-like C2-type 5.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P468P(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTGGGCCACCGTTTGGAAAGC	0.453		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - coding silent(1)	central_nervous_system(1)						ENSG00000157404						111.0	101.0	104.0					4																	55592080		2203	4300	6503	KIT	SO:0001819	synonymous_variant	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	-	HGNC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1404G>T	4.37:g.55592080G>T		Somatic	0	40	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P468	ENST00000288135.5	37	c.1404	CCDS3496.1	4																																																																																			-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt		0.453	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	protein_coding	OTTHUMT00000250618.1	G		-		55592080	+1	no_errors	ENST00000288135	ensembl	human	known	74_37	silent	SNP	0.004	T
URB2	9816	genome.wustl.edu	37	1	229787011	229787011	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:229787011G>T	ENST00000258243.2	+	8	4315	c.4179G>T	c.(4177-4179)ttG>ttT	p.L1393F		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1393						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CTTCTTTCTTGAACTCTTTCA	0.358																																																	0								ENSG00000135763						98.0	94.0	95.0					1																	229787011		2203	4300	6503	URB2	SO:0001583	missense	0			-	HGNC	D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.4179G>T	1.37:g.229787011G>T	ENSP00000258243:p.Leu1393Phe	Somatic	0	100	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	76	8.43	Q5VYC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Urb2/Npa2_C	p.L1393F	ENST00000258243.2	37	c.4179	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660477	0.67586	.	.	ENSG00000135763	ENST00000258243;ENST00000434387	T;T	0.49720	0.77;0.77	5.78	2.67	0.31697	Nucleolar 27S pre-rRNA processing, Urb2/Npa2, C-terminal (1);	0.117057	0.51477	D	0.000084	T	0.58764	0.2145	M	0.71581	2.175	0.51767	D	0.999935	D	0.76494	0.999	D	0.73380	0.98	T	0.57260	-0.7842	9	.	.	.	-4.8768	3.228	0.06739	0.1416:0.2509:0.476:0.1314	.	1393	Q14146	URB2_HUMAN	F	1393;9	ENSP00000258243:L1393F;ENSP00000395107:L9F	.	L	+	3	2	URB2	227853634	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	0.964000	0.29306	0.748000	0.32831	0.655000	0.94253	TTG	-	pfam_Urb2/Npa2_C		0.358	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	protein_coding	OTTHUMT00000095232.1	G	NM_014777	-		229787011	+1	no_errors	ENST00000258243	ensembl	human	known	74_37	missense	SNP	0.998	T
CATIP-AS2	103689911	genome.wustl.edu	37	2	219215889	219215890	+	RNA	INS	-	-	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr2:219215889_219215890insT	ENST00000411433.1	-	0	112_113																											ttacccatcgcttttttttttc	0.361																																																	0								ENSG00000237281																																			AC021016.8			0				Clone_based_vega_gene																													2.37:g.219215899_219215899dupT		Somatic	1	102	0.97		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411433.1	37	NULL		2																																																																																			-	-		0.361	AC021016.8-001	KNOWN	basic	antisense	ENSG00000237281	antisense	OTTHUMT00000338557.1	-				219215890	-1	no_errors	ENST00000411433	ensembl	human	known	74_37	rna	INS	0.210:0.199	T
LRRC16A	55604	genome.wustl.edu	37	6	25510734	25510734	+	Splice_Site	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr6:25510734G>T	ENST00000329474.6	+	19	1845		c.e19-1			NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						ATTCTTTCCAGGTTTAGAATC	0.328																																																	0								ENSG00000079691						58.0	48.0	51.0					6																	25510734		1832	4047	5879	LRRC16A	SO:0001630	splice_region_variant	0			-	HGNC	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.1478-1G>T	6.37:g.25510734G>T		Somatic	0	84	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e19-1	ENST00000329474.6	37	c.1478-1	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	G	25.7	4.662869	0.88251	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.745	0.96248	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRC16A	25618713	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.736000	0.93811	0.655000	0.94253	.	-	-		0.328	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	protein_coding	OTTHUMT00000040045.2	G	NM_017640	-	Intron	25510734	+1	no_errors	ENST00000329474	ensembl	human	novel	74_37	splice_site	SNP	1.000	T
ZFPM2	23414	genome.wustl.edu	37	8	106815148	106815148	+	Missense_Mutation	SNP	T	T	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr8:106815148T>G	ENST00000407775.2	+	8	3088	c.2838T>G	c.(2836-2838)agT>agG	p.S946R	RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S677R|ZFPM2_ENST00000517361.1_Missense_Mutation_p.S814R|RP11-152P17.2_ENST00000518932.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S814R|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000524045.2_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	946					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGGTCTTTAGTGAAGCTGCTC	0.418																																																	0								ENSG00000169946						30.0	29.0	29.0					8																	106815148		1861	4095	5956	ZFPM2	SO:0001583	missense	0			-	HGNC	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.2838T>G	8.37:g.106815148T>G	ENSP00000384179:p.Ser946Arg	Somatic	0	40	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S946R	ENST00000407775.2	37	c.2838	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	T	6.156	0.397040	0.11638	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.22945	1.93;2.42;2.42;3.62	5.76	-8.21	0.01041	.	0.175633	0.64402	D	0.000009	T	0.20740	0.0499	L	0.29908	0.895	0.42825	D	0.994006	D	0.56035	0.974	P	0.49140	0.601	T	0.49123	-0.8972	10	0.54805	T	0.06	.	16.2987	0.82793	0.0:0.4998:0.0:0.5002	.	946	Q8WW38	FOG2_HUMAN	R	946;814;814;677	ENSP00000384179:S946R;ENSP00000430757:S814R;ENSP00000428720:S814R;ENSP00000367733:S677R	ENSP00000367733:S677R	S	+	3	2	ZFPM2	106884324	0.005000	0.15991	0.199000	0.23439	0.315000	0.28087	-1.099000	0.03343	-2.008000	0.00955	-1.069000	0.02264	AGT	-	NULL		0.418	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	protein_coding	OTTHUMT00000380614.1	T		-		106815148	+1	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	SNP	0.499	G
SMG1P4	100507526	genome.wustl.edu	37	16	21896551	21896551	+	RNA	SNP	A	A	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr16:21896551A>T	ENST00000540706.1	-	0	1451																											TAAGGTGAGCACCGATTTGTC	0.428																																																	0								ENSG00000185710																																			RP11-645C24.2			0			-	Clone_based_vega_gene																													16.37:g.21896551A>T		Somatic	0	172	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	65	40.37		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000540706.1	37	NULL		16																																																																																			-	-		0.428	RP11-645C24.2-003	KNOWN	basic	processed_transcript	ENSG00000185710	pseudogene	OTTHUMT00000402428.1	A		-		21896551	-1	no_errors	ENST00000380598	ensembl	human	known	74_37	rna	SNP	1.000	T
ZAP70	7535	genome.wustl.edu	37	2	98351033	98351033	+	Missense_Mutation	SNP	G	G	A	rs200679935		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr2:98351033G>A	ENST00000264972.5	+	9	1155	c.940G>A	c.(940-942)Gtg>Atg	p.V314M	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.V188M|ZAP70_ENST00000451498.2_Missense_Mutation_p.V7M	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	314	Interdomain B.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						GGACACGAGCGTGTATGAGAG	0.602																																																	0								ENSG00000115085						112.0	97.0	102.0					2																	98351033		2203	4300	6503	ZAP70	SO:0001583	missense	0			-	HGNC	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.940G>A	2.37:g.98351033G>A	ENSP00000264972:p.Val314Met	Somatic	0	45	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	41	20.75	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.V314M	ENST00000264972.5	37	c.940	CCDS33254.1	2	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194446	0.38806	.	.	ENSG00000115085	ENST00000264972;ENST00000442208;ENST00000451498	T;T;T	0.73258	-0.72;-0.72;-0.73	5.41	4.54	0.55810	Protein kinase-like domain (1);	0.000000	0.45126	D	0.000382	T	0.82019	0.4946	M	0.74258	2.255	0.38736	D	0.953779	D;D	0.89917	1.0;0.999	D;P	0.70716	0.97;0.893	D	0.85306	0.1076	10	0.72032	D	0.01	.	12.2436	0.54558	0.083:0.0:0.917:0.0	.	188;314	P43403-3;P43403	.;ZAP70_HUMAN	M	314;188;7	ENSP00000264972:V314M;ENSP00000411141:V188M;ENSP00000400475:V7M	ENSP00000264972:V314M	V	+	1	0	ZAP70	97717465	1.000000	0.71417	0.763000	0.31416	0.103000	0.19146	7.597000	0.82733	1.449000	0.47699	-0.136000	0.14681	GTG	-	superfamily_Kinase-like_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70		0.602	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	protein_coding	OTTHUMT00000329278.1	G		rs200679935		98351033	+1	no_errors	ENST00000264972	ensembl	human	known	74_37	missense	SNP	0.786	A
CYFIP2	26999	genome.wustl.edu	37	5	156816277	156816277	+	Silent	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr5:156816277G>T	ENST00000521420.1	+	28	3301	c.3210G>T	c.(3208-3210)ctG>ctT	p.L1070L	CYFIP2_ENST00000347377.6_Silent_p.L1096L|CYFIP2_ENST00000377576.3_Silent_p.L1096L|CYFIP2_ENST00000435847.2_Silent_p.L795L|CYFIP2_ENST00000442283.2_3'UTR|CYFIP2_ENST00000522463.1_Silent_p.L900L|CYFIP2_ENST00000318218.6_Silent_p.L1121L|CYFIP2_ENST00000541131.1_Silent_p.L1021L					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGTCATCCTGACCCGCATTC	0.617																																																	0								ENSG00000055163						68.0	77.0	74.0					5																	156816277		2191	4291	6482	CYFIP2	SO:0001819	synonymous_variant	0			-	HGNC	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.3210G>T	5.37:g.156816277G>T		Somatic	0	68	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.L1121	ENST00000521420.1	37	c.3363		5																																																																																			-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int		0.617	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	protein_coding	OTTHUMT00000373710.1	G	NM_001037332	-		156816277	+1	no_errors	ENST00000318218	ensembl	human	known	74_37	silent	SNP	1.000	T
SLC7A14	57709	genome.wustl.edu	37	3	170198390	170198390	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr3:170198390T>C	ENST00000231706.5	-	7	1996	c.1681A>G	c.(1681-1683)Acg>Gcg	p.T561A	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	561					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			GTGTGCCCCGTCGCTGCTGTG	0.502																																																	0								ENSG00000013293						86.0	80.0	82.0					3																	170198390		2203	4300	6503	SLC7A14	SO:0001583	missense	0			-	HGNC	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1681A>G	3.37:g.170198390T>C	ENSP00000231706:p.Thr561Ala	Somatic	0	41	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	13	59.38	B3KV33|Q9HCF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom	p.T561A	ENST00000231706.5	37	c.1681	CCDS33892.1	3	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511880	0.44660	.	.	ENSG00000013293	ENST00000231706	D	0.88277	-2.36	5.6	5.6	0.85130	.	0.044070	0.85682	D	0.000000	D	0.87489	0.6190	L	0.54323	1.7	0.80722	D	1	P	0.41978	0.767	B	0.40940	0.344	D	0.87818	0.2636	10	0.48119	T	0.1	.	15.7748	0.78204	0.0:0.0:0.0:1.0	.	561	Q8TBB6	S7A14_HUMAN	A	561	ENSP00000231706:T561A	ENSP00000231706:T561A	T	-	1	0	SLC7A14	171681084	1.000000	0.71417	0.071000	0.20095	0.432000	0.31715	4.763000	0.62257	2.121000	0.65114	0.533000	0.62120	ACG	-	NULL		0.502	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	protein_coding	OTTHUMT00000352598.2	T	NM_020949	-		170198390	-1	no_errors	ENST00000231706	ensembl	human	known	74_37	missense	SNP	0.994	C
RPP25L	138716	genome.wustl.edu	37	9	34614198	34614198	+	5'Flank	DEL	A	A	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:34614198delA	ENST00000297613.4	-	0	0				RPP25L_ENST00000378959.4_5'Flank|DCTN3_ENST00000479399.1_5'UTR|DCTN3_ENST00000259632.7_Intron|DCTN3_ENST00000341694.2_Intron|DCTN3_ENST00000447983.2_Intron|DCTN3_ENST00000378913.2_3'UTR|DCTN3_ENST00000378916.4_Intron|DCTN3_ENST00000477738.2_Intron	NM_148179.2	NP_680545.1	Q8N5L8	RP25L_HUMAN	ribonuclease P/MRP 25kDa subunit-like							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CATGGAGCCTAAAAAAGATGA	0.527																																																	0								ENSG00000137100						52.0	51.0	51.0					9																	34614198		2203	4300	6503	DCTN3	SO:0001631	upstream_gene_variant	0				HGNC	BC032136	CCDS6559.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164967	ENSG00000164967			19909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 23"""	C9orf23		16998185	Standard	NM_148178		Approved	bA296L22.5, MGC29635	uc003zuv.3	Q8N5L8	OTTHUMG00000000443		9.37:g.34614198delA	Exception_encountered	Somatic	0	29	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	D3DRM5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000297613.4	37	NULL	CCDS6559.1	9																																																																																			-	-		0.527	RPP25L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN3	protein_coding	OTTHUMT00000001130.1	A	NM_148179			34614198	-1	no_errors	ENST00000479399	ensembl	human	known	74_37	rna	DEL	0.003	-
ANGPT4	51378	genome.wustl.edu	37	20	896734	896734	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr20:896734G>T	ENST00000381922.3	-	1	226	c.124C>A	c.(124-126)Cac>Aac	p.H42N	ANGPT4_ENST00000546022.1_Missense_Mutation_p.H42N	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	42					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						TAGCTACAGTGGCCGTGCTGG	0.612																																					Pancreas(181;481 2077 3259 31286 49856)												0								ENSG00000101280						113.0	107.0	109.0					20																	896734		2203	4300	6503	ANGPT4	SO:0001583	missense	0			-	HGNC	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.124C>A	20.37:g.896734G>T	ENSP00000371347:p.His42Asn	Somatic	0	36	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.H42N	ENST00000381922.3	37	c.124	CCDS13009.1	20	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536218	0.27475	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.13089	2.62;2.62	4.57	4.57	0.56435	.	0.162448	0.28996	N	0.013480	T	0.10208	0.0250	N	0.22421	0.69	0.23473	N	0.99761	B;B	0.27068	0.167;0.167	B;B	0.23275	0.045;0.045	T	0.20207	-1.0282	10	0.59425	D	0.04	.	12.7218	0.57146	0.0:0.0:1.0:0.0	.	42;42	B4E3J9;Q9Y264	.;ANGP4_HUMAN	N	42	ENSP00000371347:H42N;ENSP00000439605:H42N	ENSP00000371347:H42N	H	-	1	0	ANGPT4	844734	1.000000	0.71417	1.000000	0.80357	0.472000	0.32918	3.702000	0.54800	2.376000	0.81061	0.305000	0.20034	CAC	-	NULL		0.612	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	protein_coding	OTTHUMT00000077493.1	G	NM_015985	-		896734	-1	no_errors	ENST00000381922	ensembl	human	known	74_37	missense	SNP	1.000	T
OR5M10	390167	genome.wustl.edu	37	11	56344488	56344488	+	Missense_Mutation	SNP	G	G	A	rs535448751		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr11:56344488G>A	ENST00000526812.2	-	1	775	c.710C>T	c.(709-711)gCc>gTc	p.A237V		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						CGTAGAAAAGGCTTTGTGCCT	0.458																																																	0								ENSG00000254834						60.0	57.0	58.0					11																	56344488		1804	4034	5838	OR5M10	SO:0001583	missense	0			-	HGNC	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.710C>T	11.37:g.56344488G>A	ENSP00000436004:p.Ala237Val	Somatic	0	53	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	31	42.86	B9EIL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A237V	ENST00000526812.2	37	c.710	CCDS53630.1	11	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625199	0.46840	.	.	ENSG00000254834	ENST00000526812	T	0.00342	8.03	4.2	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00608	0.0020	M	0.86268	2.805	0.30426	N	0.777665	P	0.37398	0.593	P	0.47941	0.562	T	0.00752	-1.1581	9	0.66056	D	0.02	.	12.4252	0.55542	0.0:0.0:0.8304:0.1695	.	237	Q6IEU7	OR5MA_HUMAN	V	237	ENSP00000436004:A237V	ENSP00000436004:A237V	A	-	2	0	OR5M10	56101064	0.001000	0.12720	0.901000	0.35422	0.201000	0.24016	0.635000	0.24629	1.084000	0.41184	0.632000	0.83419	GCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.458	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M10	protein_coding	OTTHUMT00000391609.1	G	NM_001004741	-		56344488	-1	no_errors	ENST00000526812	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC5A1	6523	genome.wustl.edu	37	22	32480510	32480510	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr22:32480510C>T	ENST00000266088.4	+	8	999	c.749C>T	c.(748-750)aCc>aTc	p.T250I	SLC5A1_ENST00000543737.1_Missense_Mutation_p.T123I	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	250					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	GGCAACACCACCTTTCAGGAA	0.507																																																	0								ENSG00000100170						150.0	113.0	126.0					22																	32480510		2203	4300	6503	SLC5A1	SO:0001583	missense	0			-	HGNC		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.749C>T	22.37:g.32480510C>T	ENSP00000266088:p.Thr250Ile	Somatic	0	49	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	16	46.67	B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.T250I	ENST00000266088.4	37	c.749	CCDS13902.1	22	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373092	0.24857	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	D;D	0.89343	-2.17;-2.5	5.06	5.06	0.68205	.	0.240139	0.34959	N	0.003552	D	0.92424	0.7595	M	0.63843	1.955	0.09310	N	0.999999	P	0.49862	0.929	P	0.62649	0.905	D	0.86195	0.1615	10	0.45353	T	0.12	.	14.3161	0.66452	0.1488:0.8512:0.0:0.0	.	250	P13866	SC5A1_HUMAN	I	250;123	ENSP00000266088:T250I;ENSP00000444898:T123I	ENSP00000266088:T250I	T	+	2	0	SLC5A1	30810510	0.990000	0.36364	0.020000	0.16555	0.001000	0.01503	3.052000	0.49893	2.501000	0.84356	0.591000	0.81541	ACC	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.507	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A1	protein_coding	OTTHUMT00000075656.3	C	NM_000343	-		32480510	+1	no_errors	ENST00000266088	ensembl	human	known	74_37	missense	SNP	0.027	T
SCUBE1	80274	genome.wustl.edu	37	22	43614417	43614417	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr22:43614417G>T	ENST00000360835.4	-	15	1861	c.1735C>A	c.(1735-1737)Cag>Aag	p.Q579K		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	579					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				ATGGCGGCCTGCAGGCTCTGT	0.612																																																	0								ENSG00000159307						85.0	90.0	88.0					22																	43614417		2203	4300	6503	SCUBE1	SO:0001583	missense	0			-	HGNC		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1735C>A	22.37:g.43614417G>T	ENSP00000354080:p.Gln579Lys	Somatic	0	59	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	26	40.91	Q5R336	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.Q579K	ENST00000360835.4	37	c.1735	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	G	10.25	1.297805	0.23650	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	D	0.83914	-1.78	4.4	4.4	0.53042	.	0.116020	0.64402	N	0.000010	T	0.71719	0.3373	N	0.20986	0.625	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.66460	-0.5918	10	0.10111	T	0.7	.	17.2191	0.86952	0.0:0.0:1.0:0.0	.	579	Q8IWY4	SCUB1_HUMAN	K	579;209	ENSP00000354080:Q579K	ENSP00000354080:Q579K	Q	-	1	0	SCUBE1	41944361	1.000000	0.71417	0.976000	0.42696	0.203000	0.24098	2.442000	0.44873	2.287000	0.76781	0.558000	0.71614	CAG	-	NULL		0.612	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	protein_coding	OTTHUMT00000319582.3	G	NM_173050	-		43614417	-1	no_errors	ENST00000360835	ensembl	human	known	74_37	missense	SNP	1.000	T
CD300LB	124599	genome.wustl.edu	37	17	72527588	72527588	+	Missense_Mutation	SNP	A	A	C			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr17:72527588A>C	ENST00000392621.1	-	1	17	c.13T>G	c.(13-15)Tgc>Ggc	p.C5G	CD300LB_ENST00000314401.3_Missense_Mutation_p.C5G	NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	0					cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						TCTGGCTTGCACCTTCTGCAC	0.488																																																	0								ENSG00000178789						79.0	71.0	74.0					17																	72527588		2203	4300	6503	CD300LB	SO:0001583	missense	0			-	HGNC	AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.13T>G	17.37:g.72527588A>C	ENSP00000376397:p.Cys5Gly	Somatic	0	91	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00	Q1EG73|Q8IX40|Q8N6D1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.C5G	ENST00000392621.1	37	c.13	CCDS11700.1	17	.	.	.	.	.	.	.	.	.	.	A	5.242	0.230130	0.09969	.	.	ENSG00000178789	ENST00000314401	T	0.05447	3.44	3.94	-5.63	0.02474	.	.	.	.	.	T	0.02012	0.0063	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.45818	-0.9235	9	0.09843	T	0.71	.	0.8166	0.01103	0.2502:0.2646:0.2989:0.1863	.	5	B4DQ71	.	G	5	ENSP00000317337:C5G	ENSP00000317337:C5G	C	-	1	0	CD300LB	70039183	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.823000	0.04443	-1.435000	0.01972	0.383000	0.25322	TGC	-	NULL		0.488	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD300LB	protein_coding	OTTHUMT00000145082.2	A	NM_174892	-		72527588	-1	no_errors	ENST00000392621	ensembl	human	known	74_37	missense	SNP	0.000	C
C9orf3	84909	genome.wustl.edu	37	9	97522615	97522615	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:97522615A>G	ENST00000375315.2	+	1	550	c.550A>G	c.(550-552)Agg>Ggg	p.R184G	C9orf3_ENST00000277198.2_Missense_Mutation_p.R184G|C9orf3_ENST00000297979.5_Missense_Mutation_p.R184G	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	184					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGAGGAGTTCAGGAATCAGAT	0.493																																																	0								ENSG00000148120						107.0	99.0	102.0					9																	97522615		2203	4300	6503	C9orf3	SO:0001583	missense	0			-	HGNC	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.550A>G	9.37:g.97522615A>G	ENSP00000364464:p.Arg184Gly	Somatic	0	49	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	28	39.13	Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold	p.R184G	ENST00000375315.2	37	c.550	CCDS55328.1	9	.	.	.	.	.	.	.	.	.	.	A	13.08	2.129156	0.37533	.	.	ENSG00000148120	ENST00000277198;ENST00000297979;ENST00000375315;ENST00000427193;ENST00000424143	T;T;T;T;T	0.25250	2.61;2.59;2.8;1.81;2.37	4.82	3.65	0.41850	.	0.122077	0.53938	D	0.000044	T	0.29158	0.0725	M	0.62723	1.935	0.80722	D	1	P;D;B;D	0.57899	0.944;0.979;0.01;0.981	P;P;B;P	0.51657	0.476;0.631;0.007;0.676	T	0.17440	-1.0369	10	0.44086	T	0.13	-17.8645	0.9969	0.01469	0.496:0.1972:0.1177:0.1891	.	184;184;184;184	Q8N6M6;Q8N6M6-4;Q8N6M6-2;Q8N6M6-3	AMPO_HUMAN;.;.;.	G	184;184;184;58;7	ENSP00000277198:R184G;ENSP00000297979:R184G;ENSP00000364464:R184G;ENSP00000387736:R58G;ENSP00000402171:R7G	ENSP00000277198:R184G	R	+	1	2	C9orf3	96562436	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.244000	0.43124	0.934000	0.37316	0.460000	0.39030	AGG	-	NULL		0.493	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	protein_coding		A	NM_032823	-		97522615	+1	no_errors	ENST00000375315	ensembl	human	known	74_37	missense	SNP	0.998	G
RXRA	6256	genome.wustl.edu	37	9	137328845	137328846	+	3'UTR	INS	-	-	GATGCT	rs569673612|rs536947805	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr9:137328845_137328846insGATGCT	ENST00000481739.1	+	0	1826_1827				RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha						camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	TGCTGTTTATCGATGCTGGTTT	0.589														16	0.00319489	0.0	0.0014	5008	,	,		17195	0.0		0.007	False		,,,				2504	0.0082																0								ENSG00000186350																																			RXRA	SO:0001624	3_prime_UTR_variant	0				HGNC	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.*386->GATGCT	9.37:g.137328846_137328851dupGATGCT		Somatic	NA	NA	NA		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KY83|Q2NL52|Q2V504	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000481739.1	37	NULL	CCDS35172.1	9																																																																																			-	-		0.589	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	protein_coding	OTTHUMT00000054949.1	-	NM_002957			137328846	+1	no_errors	ENST00000356384	ensembl	human	known	74_37	rna	INS	0.001:0.011	GATGCT
FRK	2444	genome.wustl.edu	37	6	116289819	116289819	+	Frame_Shift_Del	DEL	A	A	-	rs142511122		TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr6:116289819delA	ENST00000606080.1	-	3	996	c.550delT	c.(550-552)tcafs	p.S184fs	FRK_ENST00000538210.1_Frame_Shift_Del_p.S42fs	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	184	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	TTCAGTGTTGAAAAGATTCTT	0.413																																																	0								ENSG00000111816						159.0	151.0	154.0					6																	116289819		2203	4300	6503	FRK	SO:0001589	frameshift_variant	0				HGNC	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.550delT	6.37:g.116289819delA	ENSP00000476145:p.Ser184fs	Somatic	0	143	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	77	30.63	B4DY49|Q13128|Q9NTR5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.S184fs	ENST00000606080.1	37	c.550	CCDS5103.1	6																																																																																			-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2		0.413	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRK	protein_coding	OTTHUMT00000041924.2	A	NM_002031			116289819	-1	no_errors	ENST00000606080	ensembl	human	known	74_37	frame_shift_del	DEL	0.020	-
DCAF7	10238	genome.wustl.edu	37	17	61667286	61667286	+	3'UTR	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr17:61667286G>T	ENST00000310827.4	+	0	1998				DCAF7_ENST00000577702.1_3'UTR	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7						multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						GGCATTCTGGGCTTGTAAACA	0.527																																																	0								ENSG00000136485																																			DCAF7	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.*752G>T	17.37:g.61667286G>T		Somatic	0	27	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B4E039|D3DU14|O15491|Q9DAE4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000310827.4	37	NULL		17																																																																																			-	-		0.527	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	protein_coding		G	NM_005828	-		61667286	+1	no_errors	ENST00000577702	ensembl	human	known	74_37	rna	SNP	0.543	T
KCNT2	343450	genome.wustl.edu	37	1	196285118	196285118	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:196285118G>T	ENST00000294725.9	-	21	3302	c.2387C>A	c.(2386-2388)gCt>gAt	p.A796D	KCNT2_ENST00000609185.1_Missense_Mutation_p.A722D|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000367433.5_Missense_Mutation_p.A772D|KCNT2_ENST00000367431.4_Missense_Mutation_p.A722D			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	796					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CACCATATTAGCAGCAAAAGT	0.398																																																	0								ENSG00000162687						119.0	99.0	106.0					1																	196285118		2203	4299	6502	KCNT2	SO:0001583	missense	0			-	HGNC	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2387C>A	1.37:g.196285118G>T	ENSP00000294725:p.Ala796Asp	Somatic	0	42	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.A796D	ENST00000294725.9	37	c.2387	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	G	7.755	0.704208	0.15172	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.74002	-0.8;-0.8;-0.8	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000005	T	0.53061	0.1773	N	0.04335	-0.225	0.80722	D	1	B;B;B;B;B	0.06786	0.0;0.001;0.001;0.001;0.0	B;B;B;B;B	0.08055	0.001;0.003;0.001;0.001;0.001	T	0.56044	-0.8044	10	0.02654	T	1	-11.7853	20.2245	0.98337	0.0:0.0:1.0:0.0	.	796;754;772;722;796	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	D	772;722;796	ENSP00000356403:A772D;ENSP00000356401:A722D;ENSP00000294725:A796D	ENSP00000294725:A796D	A	-	2	0	KCNT2	194551741	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.078000	0.71282	2.770000	0.95276	0.650000	0.86243	GCT	-	NULL		0.398	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	protein_coding	OTTHUMT00000086418.2	G	NM_198503	-		196285118	-1	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	SNP	1.000	T
COL22A1	169044	genome.wustl.edu	37	8	139707070	139707070	+	Splice_Site	DEL	G	G	-			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr8:139707070delG	ENST00000303045.6	-	33	3091	c.2645delC	c.(2644-2646)ccg>cg	p.P882fs	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Splice_Site_p.P882fs	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	882	Collagen-like 7.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GAGACTCACCGGTTCCCCAGG	0.602										HNSCC(7;0.00092)																																							0								ENSG00000169436						101.0	96.0	98.0					8																	139707070		2203	4300	6503	COL22A1	SO:0001630	splice_region_variant	0				HGNC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2646+1C>-	8.37:g.139707070delG		Somatic	0	56	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	B7ZMH0|C9K0G4|Q8IVT9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P882fs	ENST00000303045.6	37	c.2645	CCDS6376.1	8																																																																																			-	pfam_Collagen		0.602	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	protein_coding	OTTHUMT00000315905.2	G	XM_291257		Frame_Shift_Del	139707070	-1	no_errors	ENST00000303045	ensembl	human	known	74_37	frame_shift_del	DEL	0.770	-
SLC27A6	28965	genome.wustl.edu	37	5	128368839	128368839	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr5:128368839A>G	ENST00000262462.4	+	10	2734	c.1724A>G	c.(1723-1725)cAt>cGt	p.H575R	SLC27A6_ENST00000395266.1_Missense_Mutation_p.H575R|SLC27A6_ENST00000506176.1_Missense_Mutation_p.H575R			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	575					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		CTATTGAAGCATCAGTTGGTG	0.318																																																	0								ENSG00000113396						57.0	56.0	56.0					5																	128368839		2203	4294	6497	SLC27A6	SO:0001583	missense	0			-	HGNC	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.1724A>G	5.37:g.128368839A>G	ENSP00000262462:p.His575Arg	Somatic	0	69	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	113	20.42	Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.H575R	ENST00000262462.4	37	c.1724	CCDS4145.1	5	.	.	.	.	.	.	.	.	.	.	A	3.027	-0.200577	0.06219	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.39997	1.05;1.05;1.05	3.85	2.67	0.31697	.	0.325163	0.32918	N	0.005495	T	0.20577	0.0495	N	0.10837	0.055	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17592	-1.0364	9	.	.	.	-2.1025	9.2852	0.37753	0.1819:0.0:0.0:0.8181	.	575	Q9Y2P4	S27A6_HUMAN	R	575	ENSP00000262462:H575R;ENSP00000378684:H575R;ENSP00000421024:H575R	.	H	+	2	0	SLC27A6	128396738	0.929000	0.31497	0.118000	0.21660	0.057000	0.15508	2.715000	0.47210	0.824000	0.34613	0.477000	0.44152	CAT	-	NULL		0.318	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A6	protein_coding	OTTHUMT00000250980.1	A	NM_014031	-		128368839	+1	no_errors	ENST00000262462	ensembl	human	known	74_37	missense	SNP	0.615	G
SACS	26278	genome.wustl.edu	37	13	23910319	23910319	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr13:23910319C>T	ENST00000382292.3	-	9	7969	c.7696G>A	c.(7696-7698)Gat>Aat	p.D2566N	SACS_ENST00000402364.1_Missense_Mutation_p.D1816N|SACS_ENST00000382298.3_Missense_Mutation_p.D2566N			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2566					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TGTCTAGGATCAAACACAAAA	0.403																																																	0								ENSG00000151835						107.0	109.0	108.0					13																	23910319		2203	4299	6502	SACS	SO:0001583	missense	0			-	HGNC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.7696G>A	13.37:g.23910319C>T	ENSP00000371729:p.Asp2566Asn	Somatic	0	75	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	11	62.07	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.D2566N	ENST00000382292.3	37	c.7696	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	25.5	4.642228	0.87859	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.97752	-4.52;-4.52;-4.52	5.59	5.59	0.84812	ATPase-like, ATP-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.98520	0.9506	M	0.78456	2.415	0.58432	D	0.999996	D	0.56521	0.976	P	0.61658	0.892	D	0.99297	1.0900	10	0.66056	D	0.02	.	19.592	0.95518	0.0:1.0:0.0:0.0	.	2566	Q9NZJ4	SACS_HUMAN	N	2566;1816;2566	ENSP00000371729:D2566N;ENSP00000385844:D1816N;ENSP00000371735:D2566N	ENSP00000371729:D2566N	D	-	1	0	SACS	22808319	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.484000	0.81180	2.629000	0.89072	0.462000	0.41574	GAT	-	superfamily_HATPase_ATP-bd		0.403	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	protein_coding	OTTHUMT00000044148.3	C	NM_014363	-		23910319	-1	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	SNP	1.000	T
HP	3240	genome.wustl.edu	37	16	72093029	72093029	+	Missense_Mutation	SNP	C	C	A	rs1140430|rs386791984	byFrequency	TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr16:72093029C>A	ENST00000355906.5	+	6	442	c.384C>A	c.(382-384)aaC>aaA	p.N128K	HP_ENST00000570083.1_Missense_Mutation_p.N69K|HP_ENST00000398131.2_Missense_Mutation_p.N69K|HP_ENST00000562526.1_Missense_Mutation_p.N69K|HP_ENST00000565574.1_Intron|HP_ENST00000569639.1_Missense_Mutation_p.N69K|HP_ENST00000357763.4_Missense_Mutation_p.N164K|HPR_ENST00000356967.5_Intron	NM_005143.3	NP_005134.1	P00738	HPT_HUMAN	haptoglobin	128	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				acute-phase response (GO:0006953)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|immune system process (GO:0002376)|negative regulation of hydrogen peroxide catabolic process (GO:2000296)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of cell death (GO:0010942)|response to hydrogen peroxide (GO:0042542)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)	antioxidant activity (GO:0016209)|hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7		Renal(780;9.67e-05)|Ovarian(137;0.00327)|Hepatocellular(780;0.114)		BRCA - Breast invasive adenocarcinoma(221;0.00015)|Kidney(780;0.000529)		ACACCTTAAACAATGAGAAGC	0.473																																																	0								ENSG00000257017						120.0	128.0	126.0					16																	72093029		1743	4061	5804	HP	SO:0001583	missense	0			-	HGNC		CCDS45524.1, CCDS45525.1	16q22.2	2012-10-02			ENSG00000257017	ENSG00000257017			5141	protein-coding gene	gene with protein product		140100				11109501, 9352226	Standard	NM_005143		Approved		uc002fbr.4	P00738		ENST00000355906.5:c.384C>A	16.37:g.72093029C>A	ENSP00000348170:p.Asn128Lys	Somatic	0	107	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	58	27.50	B0AZL5|P00737|Q0VAC4|Q0VAC5|Q2PP15|Q3B7J0|Q6LBY9|Q9UC67	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,superfamily_Sushi_SCR_CCP,smart_Peptidase_S1,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.N128K	ENST00000355906.5	37	c.384	CCDS45524.1	16	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334194	0.24253	.	.	ENSG00000257017	ENST00000355906;ENST00000398131	T;T	0.48522	0.81;0.81	4.24	3.29	0.37713	Complement control module (2);Sushi/SCR/CCP (2);	0.171894	0.40144	N	0.001169	T	0.58148	0.2102	M	0.62723	1.935	0.80722	D	1	D	0.64830	0.994	D	0.64687	0.928	T	0.59857	-0.7375	10	0.66056	D	0.02	.	7.2724	0.26264	0.0:0.8817:0.0:0.1183	.	128	P00738	HPT_HUMAN	K	128;69	ENSP00000348170:N128K;ENSP00000381199:N69K	ENSP00000348170:N128K	N	+	3	2	HP	70650530	0.118000	0.22208	0.917000	0.36280	0.814000	0.46013	0.359000	0.20233	2.348000	0.79779	0.591000	0.81541	AAC	-	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.473	HP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HP	protein_coding	OTTHUMT00000421680.1	C	NM_005143	-		72093029	+1	no_errors	ENST00000355906	ensembl	human	known	74_37	missense	SNP	0.879	A
ZHX2	22882	genome.wustl.edu	37	8	123965961	123965961	+	Silent	SNP	C	C	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr8:123965961C>T	ENST00000314393.4	+	3	3046	c.2211C>T	c.(2209-2211)ctC>ctT	p.L737L		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	737					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CCAAAAAGCTCTGCGAAGAGG	0.532																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)												0								ENSG00000178764						94.0	99.0	98.0					8																	123965961		2203	4300	6503	ZHX2	SO:0001819	synonymous_variant	0			-	HGNC	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2211C>T	8.37:g.123965961C>T		Somatic	0	44	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	25	26.47		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.L737	ENST00000314393.4	37	c.2211	CCDS6336.1	8																																																																																			-	NULL		0.532	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZHX2	protein_coding	OTTHUMT00000381709.1	C	NM_014943	-		123965961	+1	no_errors	ENST00000314393	ensembl	human	known	74_37	silent	SNP	0.990	T
MKNK1	8569	genome.wustl.edu	37	1	47051606	47051606	+	Intron	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:47051606G>A	ENST00000371946.4	-	3	198				MKNK1_ENST00000545730.1_Intron|MKNK1_ENST00000371944.4_5'UTR|MKNK1_ENST00000341183.5_Intron|MKNK1_ENST00000428112.2_Intron|MKNK1_ENST00000525888.1_5'UTR|MKNK1_ENST00000371945.4_Intron|MKNK1_ENST00000465783.1_Intron	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1						extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					AAATGGTTAAGACTTTCCTTG	0.403																																																	0								ENSG00000079277						98.0	93.0	94.0					1																	47051606		876	1991	2867	MKNK1	SO:0001627	intron_variant	0			-	HGNC	AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.35-2605C>T	1.37:g.47051606G>A		Somatic	0	70	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	56	31.71	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V25	ENST00000371946.4	37	c.75	CCDS538.1	1																																																																																			-	NULL		0.403	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKNK1	protein_coding	OTTHUMT00000021897.2	G	NM_003684	-		47051606	-1	no_errors	ENST00000474868	ensembl	human	known	74_37	silent	SNP	0.611	A
ANKRD24	170961	genome.wustl.edu	37	19	4216723	4216723	+	Silent	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr19:4216723G>A	ENST00000600132.1	+	18	1842	c.1566G>A	c.(1564-1566)gaG>gaA	p.E522E	ANKRD24_ENST00000318934.4_Silent_p.E522E|ANKRD24_ENST00000262970.5_Silent_p.E612E	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	522										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		CCAGAGAAGAGGGGGCAGCCT	0.622																																																	0								ENSG00000089847						18.0	22.0	20.0					19																	4216723		2022	4167	6189	ANKRD24	SO:0001819	synonymous_variant	0			-	HGNC	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.1566G>A	19.37:g.4216723G>A		Somatic	0	27	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	O75268|O95781	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E522	ENST00000600132.1	37	c.1566	CCDS45925.1	19																																																																																			-	NULL		0.622	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD24	protein_coding	OTTHUMT00000458188.1	G	XM_114000	-		4216723	+1	no_errors	ENST00000318934	ensembl	human	known	74_37	silent	SNP	0.015	A
KCNB2	9312	genome.wustl.edu	37	8	73480416	73480416	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr8:73480416C>A	ENST00000523207.1	+	2	1035	c.447C>A	c.(445-447)aaC>aaA	p.N149K		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	149					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AACAAATGAACGAAGAACTGA	0.458																																																	0								ENSG00000182674						123.0	130.0	128.0					8																	73480416		2203	4300	6503	KCNB2	SO:0001583	missense	0			-	HGNC	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.447C>A	8.37:g.73480416C>A	ENSP00000430846:p.Asn149Lys	Somatic	0	46	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	39	45.83	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.N149K	ENST00000523207.1	37	c.447	CCDS6209.1	8	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137143	0.37728	.	.	ENSG00000182674	ENST00000523207	D	0.96885	-4.16	6.07	-6.46	0.01908	BTB/POZ fold (1);	0.713512	0.11975	U	0.511376	D	0.93148	0.7818	L	0.45137	1.4	0.29645	N	0.844401	B	0.23806	0.091	B	0.28784	0.094	T	0.76841	-0.2810	10	0.40728	T	0.16	.	17.6058	0.88037	0.0:0.3242:0.0:0.6758	.	149	Q92953	KCNB2_HUMAN	K	149	ENSP00000430846:N149K	ENSP00000430846:N149K	N	+	3	2	KCNB2	73642970	0.006000	0.16342	0.593000	0.28771	0.905000	0.53344	-1.092000	0.03366	-1.346000	0.02211	-0.794000	0.03295	AAC	-	NULL		0.458	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	protein_coding	OTTHUMT00000378998.1	C	NM_004770	-		73480416	+1	no_errors	ENST00000523207	ensembl	human	known	74_37	missense	SNP	0.175	A
LRRK1	79705	genome.wustl.edu	37	15	101554525	101554525	+	Missense_Mutation	SNP	T	T	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr15:101554525T>A	ENST00000388948.3	+	11	1783	c.1424T>A	c.(1423-1425)cTc>cAc	p.L475H	LRRK1_ENST00000284395.5_Missense_Mutation_p.L472H	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCTCAGGCCCTCATGTTCTTG	0.547																																																	0								ENSG00000154237						83.0	89.0	87.0					15																	101554525		1930	4126	6056	LRRK1	SO:0001583	missense	0			-	HGNC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1424T>A	15.37:g.101554525T>A	ENSP00000373600:p.Leu475His	Somatic	0	35	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.L475H	ENST00000388948.3	37	c.1424	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	T	15.55	2.866259	0.51588	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.81330	-1.48;-1.48	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000011	D	0.93236	0.7845	H	0.98351	4.21	0.48236	D	0.999617	D	0.89917	1.0	D	0.80764	0.994	D	0.94512	0.7719	10	0.44086	T	0.13	.	13.0194	0.58777	0.0:0.0:0.0:1.0	.	475	Q38SD2	LRRK1_HUMAN	H	475;472	ENSP00000373600:L475H;ENSP00000284395:L472H	ENSP00000284395:L472H	L	+	2	0	LRRK1	99372048	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	6.669000	0.74462	1.991000	0.58162	0.450000	0.29827	CTC	-	smart_Leu-rich_rpt_typical-subtyp		0.547	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	protein_coding	OTTHUMT00000384567.2	T	NM_024652	-		101554525	+1	no_errors	ENST00000388948	ensembl	human	known	74_37	missense	SNP	1.000	A
APLP2	334	genome.wustl.edu	37	11	129993506	129993506	+	Splice_Site	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr11:129993506G>A	ENST00000263574.5	+	7	994		c.e7-1		APLP2_ENST00000278756.7_Splice_Site|APLP2_ENST00000345598.5_Intron|APLP2_ENST00000539648.1_Intron|APLP2_ENST00000543137.1_Splice_Site|APLP2_ENST00000338167.5_Splice_Site|APLP2_ENST00000528499.1_Intron	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2						cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TTTTCACACAGCTGTCTGCTC	0.592																																																	0								ENSG00000084234						53.0	51.0	52.0					11																	129993506		2201	4297	6498	APLP2	SO:0001630	splice_region_variant	0			-	HGNC	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.923-1G>A	11.37:g.129993506G>A		Somatic	0	51	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7-1	ENST00000263574.5	37	c.923-1	CCDS8486.1	11	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996330	0.93167	.	.	ENSG00000084234	ENST00000263574;ENST00000338167;ENST00000278756;ENST00000543137	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2108	0.93753	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	APLP2	129498716	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.778000	0.95560	0.650000	0.86243	.	-	-		0.592	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APLP2	protein_coding	OTTHUMT00000386109.1	G	NM_001642	-	Intron	129993506	+1	no_errors	ENST00000263574	ensembl	human	known	74_37	splice_site	SNP	1.000	A
ZNF733P	643955	genome.wustl.edu	37	7	62752019	62752019	+	RNA	SNP	G	G	A			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr7:62752019G>A	ENST00000331425.6	-	0	1416					NR_003952.1				zinc finger protein 733, pseudogene																		ATTCTCTTATGTTGCATAAGG	0.408																																																	0								ENSG00000185037																																			ZNF733P			0			-	HGNC			7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752019G>A		Somatic	0	54	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	52	26.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			-	-		0.408	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	pseudogene	OTTHUMT00000343679.1	G		-		62752019	-1	no_errors	ENST00000331425	ensembl	human	known	74_37	rna	SNP	0.954	A
OR10T2	128360	genome.wustl.edu	37	1	158368465	158368465	+	Silent	SNP	G	G	T			TCGA-3B-A9HQ-01A-11D-A387-09	TCGA-3B-A9HQ-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5a338e82-a3d9-4fde-a778-541bd843cd68	ec67e62a-ddd3-4fce-babd-48da624ff7d0	g.chr1:158368465G>T	ENST00000334438.1	-	1	791	c.792C>A	c.(790-792)tcC>tcA	p.S264S		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					AGGCAGACTTGGACTTGGGCC	0.502																																																	0								ENSG00000186306						100.0	86.0	91.0					1																	158368465		2203	4300	6503	OR10T2	SO:0001819	synonymous_variant	0			-	HGNC	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.792C>A	1.37:g.158368465G>T		Somatic	0	63	0.00		0.6339020696200205	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	Q6IF98	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S264	ENST00000334438.1	37	c.792	CCDS30895.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.502	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10T2	protein_coding	OTTHUMT00000046371.1	G	NM_001004475	-		158368465	-1	no_errors	ENST00000334438	ensembl	human	known	74_37	silent	SNP	0.882	T
