#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AAK1	22848	genome.wustl.edu	37	2	69693504	69693504	+	IGR	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr2:69693504G>T	ENST00000409085.4	-	0	11345				RP11-427H3.3_ENST00000606389.2_lincRNA|AAK1_ENST00000409068.1_Intron	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1						endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						TCGCTGCTGTGGAATGAGCTG	0.522																																																	0								ENSG00000188971																																			RP11-427H3.3	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648		2.37:g.69693504G>T		Somatic	0	35	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	Q4ZFZ3|Q53RX6|Q9UPV4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409085.4	37	NULL	CCDS1893.2	2	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029171	0.54790	.	.	ENSG00000188971	ENST00000339092	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	T	0.63873	0.2548	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62789	-0.6780	5	0.44086	T	0.13	.	10.7993	0.46478	0.0948:0.0:0.9052:0.0	.	.	.	.	N	41	.	ENSP00000341274:H41N	H	-	1	0	AC114772.1	69547008	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.207000	0.65197	2.628000	0.89032	0.650000	0.86243	CAC	-	-		0.522	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000188971	protein_coding	OTTHUMT00000251847.4	G	NM_014911	-		69693504	-1	no_errors	ENST00000339092	ensembl	human	known	74_37	rna	SNP	1.000	T
TP63	8626	genome.wustl.edu	37	3	189604233	189604233	+	Missense_Mutation	SNP	A	A	G	rs369453583		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr3:189604233A>G	ENST00000264731.3	+	11	1489	c.1400A>G	c.(1399-1401)aAc>aGc	p.N467S	TP63_ENST00000392461.3_Missense_Mutation_p.N373S|TP63_ENST00000320472.5_Missense_Mutation_p.N467S|TP63_ENST00000382063.4_Missense_Mutation_p.N382S|TP63_ENST00000456148.1_Missense_Mutation_p.N369S|TP63_ENST00000449992.1_Missense_Mutation_p.N288S|TP63_ENST00000354600.5_Missense_Mutation_p.N373S|TP63_ENST00000392460.3_Missense_Mutation_p.N467S|TP63_ENST00000392463.2_Missense_Mutation_p.N373S|TP63_ENST00000440651.2_Missense_Mutation_p.N463S	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	467					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CCACCTCTGAACAAAATGAAC	0.488										HNSCC(45;0.13)																																							0								ENSG00000073282	A	SER/ASN,SER/ASN,SER/ASN,SER/ASN	0,4406		0,0,2203	141.0	118.0	126.0		1400,1118,1118,1400	3.3	1.0	3		126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	TP63	NM_003722.4,NM_001114981.1,NM_001114980.1,NM_001114978.1	46,46,46,46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign,benign,benign	467/681,373/462,373/587,467/556	189604233	1,13005	2203	4300	6503	TP63	SO:0001583	missense	0			-	HGNC	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1400A>G	3.37:g.189604233A>G	ENSP00000264731:p.Asn467Ser	Somatic	0	104	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	84	13.27	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.N467S	ENST00000264731.3	37	c.1400	CCDS3293.1	3	.	.	.	.	.	.	.	.	.	.	A	10.88	1.474768	0.26511	0.0	1.16E-4	ENSG00000073282	ENST00000264731;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D	0.99680	-6.05;-6.3;-6.28;-6.05;-6.38;-6.04;-6.27;-6.29;-6.38;-6.04	5.98	3.3	0.37823	.	0.145674	0.64402	D	0.000007	D	0.98223	0.9412	L	0.39898	1.24	0.34463	D	0.702002	B;B;B;B;B;B	0.18013	0.0;0.0;0.015;0.011;0.015;0.025	B;B;B;B;B;B	0.24701	0.002;0.007;0.055;0.037;0.053;0.024	D	0.99973	1.2076	9	.	.	.	-11.6314	6.5092	0.22212	0.6985:0.0:0.3015:0.0	.	288;467;373;373;467;467	Q9H3D4-10;Q9H3D4-7;Q9H3D4-4;Q9H3D4-2;Q9H3D4-3;Q9H3D4	.;.;.;.;.;P63_HUMAN	S	467;467;467;463;382;373;373;373;288;369	ENSP00000264731:N467S;ENSP00000317510:N467S;ENSP00000376253:N467S;ENSP00000394337:N463S;ENSP00000371495:N382S;ENSP00000346614:N373S;ENSP00000376256:N373S;ENSP00000376254:N373S;ENSP00000387839:N288S;ENSP00000389485:N369S	.	N	+	2	0	TP63	191086927	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.507000	0.53371	1.089000	0.41292	-0.332000	0.08345	AAC	-	NULL		0.488	TP63-001	KNOWN	basic|CCDS	protein_coding	TP63	protein_coding	OTTHUMT00000343865.1	A	NM_003722	-		189604233	+1	no_errors	ENST00000264731	ensembl	human	known	74_37	missense	SNP	1.000	G
SERPINB6	5269	genome.wustl.edu	37	6	2948672	2948672	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr6:2948672C>T	ENST00000380520.1	-	6	2985	c.991G>A	c.(991-993)Gca>Aca	p.A331T	SERPINB6_ENST00000380546.3_Missense_Mutation_p.A331T|SERPINB6_ENST00000380524.1_Missense_Mutation_p.A331T|SERPINB6_ENST00000380539.1_Missense_Mutation_p.A331T|SERPINB6_ENST00000335686.5_Missense_Mutation_p.A331T|SERPINB6_ENST00000380529.1_Missense_Mutation_p.A331T			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	331					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	GTGGCGGCTGCAGCCTCCGTG	0.577																																																	0								ENSG00000124570						41.0	42.0	42.0					6																	2948672		2203	4300	6503	SERPINB6	SO:0001583	missense	0			-	HGNC	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.991G>A	6.37:g.2948672C>T	ENSP00000369891:p.Ala331Thr	Somatic	0	35	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.A331T	ENST00000380520.1	37	c.991	CCDS4479.1	6	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796528	0.70567	.	.	ENSG00000124570	ENST00000380524;ENST00000380520;ENST00000335686;ENST00000380529;ENST00000380539;ENST00000380546;ENST00000440670	D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	5.16	4.27	0.50696	Serpin domain (3);	0.148825	0.64402	N	0.000011	D	0.86785	0.6016	M	0.78637	2.42	0.58432	D	0.999999	P	0.40000	0.698	P	0.50934	0.654	D	0.88234	0.2905	10	0.56958	D	0.05	.	14.4308	0.67249	0.1492:0.8508:0.0:0.0	.	331	P35237	SPB6_HUMAN	T	331;331;331;331;331;331;147	ENSP00000369896:A331T;ENSP00000369891:A331T;ENSP00000338358:A331T;ENSP00000369901:A331T;ENSP00000369912:A331T;ENSP00000369919:A331T	ENSP00000338358:A331T	A	-	1	0	SERPINB6	2893671	1.000000	0.71417	0.004000	0.12327	0.020000	0.10135	4.754000	0.62191	1.473000	0.48159	0.551000	0.68910	GCA	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.577	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB6	protein_coding	OTTHUMT00000043422.1	C		-		2948672	-1	no_errors	ENST00000335686	ensembl	human	known	74_37	missense	SNP	0.903	T
ST3GAL5	8869	genome.wustl.edu	37	2	86090503	86090503	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr2:86090503A>G	ENST00000377332.3	-	2	296	c.188T>C	c.(187-189)tTa>tCa	p.L63S	ST3GAL5_ENST00000393805.1_Missense_Mutation_p.L35S|ST3GAL5_ENST00000484728.1_5'UTR|ST3GAL5_ENST00000525834.2_Missense_Mutation_p.L63S|ST3GAL5_ENST00000393808.3_Missense_Mutation_p.L40S	NM_003896.3	NP_003887.3	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 5	63					carbohydrate metabolic process (GO:0005975)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	lactosylceramide alpha-2,3-sialyltransferase activity (GO:0047291)|neolactotetraosylceramide alpha-2,3-sialyltransferase activity (GO:0004513)|sialyltransferase activity (GO:0008373)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15						GTCTTTTAATAACAAGCTGGG	0.488																																																	0								ENSG00000115525						148.0	138.0	141.0					2																	86090503		2203	4300	6503	ST3GAL5	SO:0001583	missense	0			-	HGNC	AB018356	CCDS1986.2, CCDS42705.1	2p11.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000115525	ENSG00000115525	2.4.99.9	"""Sialyltransferases"""	10872	protein-coding gene	gene with protein product		604402	"""sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase)"""	SIAT9		9822625	Standard	NM_003896		Approved	ST3GalV, SIATGM3S	uc002sqq.1	Q9UNP4	OTTHUMG00000130171	ENST00000377332.3:c.188T>C	2.37:g.86090503A>G	ENSP00000366549:p.Leu63Ser	Somatic	0	116	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	78	35.77	B3KM82|D6W5L9|O94902|Q53QU1|Q6NZX4|Q6YFL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.L63S	ENST00000377332.3	37	c.188	CCDS1986.2	2	.	.	.	.	.	.	.	.	.	.	A	13.57	2.276810	0.40294	.	.	ENSG00000115525	ENST00000393808;ENST00000393805;ENST00000377332;ENST00000455892;ENST00000525834	T;T;T;T;T	0.62105	0.91;0.94;0.79;0.38;0.05	5.53	5.53	0.82687	.	0.560423	0.16465	N	0.213240	T	0.68174	0.2972	L	0.27053	0.805	0.33557	D	0.59693	D;D;D;D	0.89917	1.0;1.0;0.964;0.961	D;D;P;P	0.79784	0.993;0.993;0.726;0.804	T	0.76138	-0.3069	10	0.87932	D	0	-12.1202	12.3493	0.55139	1.0:0.0:0.0:0.0	.	63;63;63;40	G3V199;B7Z9J0;Q9UNP4;Q9UNP4-3	.;.;SIAT9_HUMAN;.	S	40;35;63;35;63	ENSP00000377397:L40S;ENSP00000377394:L35S;ENSP00000366549:L63S;ENSP00000401375:L35S;ENSP00000433607:L63S	ENSP00000306247:L63S	L	-	2	0	ST3GAL5	85944014	0.909000	0.30893	0.973000	0.42090	0.297000	0.27493	4.987000	0.63857	2.224000	0.72417	0.528000	0.53228	TTA	-	pirsf_Sialyl_trans		0.488	ST3GAL5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ST3GAL5	protein_coding	OTTHUMT00000252486.1	A	NM_003896	-		86090503	-1	no_errors	ENST00000377332	ensembl	human	known	74_37	missense	SNP	0.979	G
EXOC3L1	283849	genome.wustl.edu	37	16	67220479	67220479	+	Missense_Mutation	SNP	G	G	T	rs75613564	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr16:67220479G>T	ENST00000314586.6	-	8	1606	c.1366C>A	c.(1366-1368)Ctg>Atg	p.L456M	KIAA0895L_ENST00000561621.1_5'Flank|KIAA0895L_ENST00000563831.2_5'Flank|EXOC3L1_ENST00000562887.1_5'Flank|KIAA0895L_ENST00000290881.7_5'Flank|KIAA0895L_ENST00000563902.1_5'Flank	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	456					exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						AATGTGCCCAGTTCTGACAGT	0.547																																																	0								ENSG00000179044						126.0	118.0	121.0					16																	67220479		2198	4300	6498	EXOC3L1	SO:0001583	missense	0			-	HGNC	AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1366C>A	16.37:g.67220479G>T	ENSP00000325674:p.Leu456Met	Somatic	0	46	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.00	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec6	p.L456M	ENST00000314586.6	37	c.1366	CCDS10832.1	16	.	.	.	.	.	.	.	.	.	.	G	5.489	0.275296	0.10403	.	.	ENSG00000179044	ENST00000314586;ENST00000545725;ENST00000314553	T;T	0.07114	3.22;3.22	5.44	2.29	0.28610	.	0.167475	0.48767	N	0.000162	T	0.15825	0.0381	L	0.47716	1.5	0.36168	D	0.848605	D;D;D	0.89917	1.0;0.995;0.981	D;D;P	0.91635	0.999;0.966;0.832	T	0.24190	-1.0167	10	0.22109	T	0.4	-8.0619	6.0241	0.19646	0.1629:0.0:0.6862:0.1509	.	353;353;456	F5H4W1;B7Z6U0;Q86VI1	.;.;EX3L1_HUMAN	M	456;353;358	ENSP00000325674:L456M;ENSP00000439910:L353M	ENSP00000325008:L358M	L	-	1	2	EXOC3L1	65777980	1.000000	0.71417	0.961000	0.40146	0.380000	0.30137	2.469000	0.45110	0.236000	0.21180	0.305000	0.20034	CTG	-	pfam_Sec6		0.547	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L1	protein_coding	OTTHUMT00000268827.2	G	NM_178516	-		67220479	-1	no_errors	ENST00000314586	ensembl	human	known	74_37	missense	SNP	1.000	T
TDRD7	23424	genome.wustl.edu	37	9	100235889	100235889	+	Missense_Mutation	SNP	A	A	G			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr9:100235889A>G	ENST00000355295.4	+	11	2355	c.2060A>G	c.(2059-2061)gAg>gGg	p.E687G	TDRD7_ENST00000540902.1_Missense_Mutation_p.E36G|TDRD7_ENST00000422139.2_Missense_Mutation_p.E613G	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	687					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				CGTAAGATAGAGGACTACTTC	0.383																																																	0								ENSG00000196116						137.0	118.0	125.0					9																	100235889		2203	4300	6503	TDRD7	SO:0001583	missense	0			-	HGNC	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.2060A>G	9.37:g.100235889A>G	ENSP00000347444:p.Glu687Gly	Somatic	0	77	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	87	18.69	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.E687G	ENST00000355295.4	37	c.2060	CCDS6725.1	9	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221419	0.79464	.	.	ENSG00000196116	ENST00000355295;ENST00000422139;ENST00000540902	T;T;T	0.28454	2.94;2.94;1.61	4.27	4.27	0.50696	Maternal tudor protein (1);	0.050408	0.85682	D	0.000000	T	0.46776	0.1410	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.971	T	0.41752	-0.9491	10	0.52906	T	0.07	-28.0812	13.2082	0.59809	1.0:0.0:0.0:0.0	.	36;687	Q8NHU6-3;Q8NHU6	.;TDRD7_HUMAN	G	687;613;36	ENSP00000347444:E687G;ENSP00000413608:E613G;ENSP00000440717:E36G	ENSP00000347444:E687G	E	+	2	0	TDRD7	99275710	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.709000	0.91379	2.158000	0.67659	0.528000	0.53228	GAG	-	pfam_Tudor		0.383	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD7	protein_coding	OTTHUMT00000053322.1	A	NM_014290	-		100235889	+1	no_errors	ENST00000355295	ensembl	human	known	74_37	missense	SNP	1.000	G
DMTF1	9988	genome.wustl.edu	37	7	86783765	86783765	+	5'UTR	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr7:86783765G>T	ENST00000394703.5	+	0	353				DMTF1_ENST00000394702.3_Intron|DMTF1_ENST00000432937.2_Intron|AC005076.5_ENST00000433446.1_RNA|DMTF1_ENST00000413276.2_Intron|AC005076.5_ENST00000446309.1_RNA|DMTF1_ENST00000580710.1_3'UTR|DMTF1_ENST00000411766.2_Intron|DMTF1_ENST00000331242.7_Intron	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1						cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					CATATTCTGCGTGAATCTCTT	0.388																																																	0								ENSG00000135164																																			DMTF1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.-211G>T	7.37:g.86783765G>T		Somatic	0	59	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394703.5	37	NULL	CCDS5601.1	7																																																																																			-	-		0.388	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	DMTF1	protein_coding	OTTHUMT00000334025.5	G	NM_021145	-		86783765	+1	no_errors	ENST00000580710	ensembl	human	known	74_37	rna	SNP	0.000	T
ZNF174	7727	genome.wustl.edu	37	16	3458760	3458760	+	Silent	SNP	G	G	T	rs553598485		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr16:3458760G>T	ENST00000268655.4	+	3	1650	c.1065G>T	c.(1063-1065)acG>acT	p.T355T	ZNF174_ENST00000571936.1_Silent_p.T355T	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	355					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						GACCCTACACGTGCGGAGAGT	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19072	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000103343						52.0	59.0	57.0					16																	3458760		2197	4300	6497	ZNF174	SO:0001819	synonymous_variant	0			-	HGNC	U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.1065G>T	16.37:g.3458760G>T		Somatic	0	40	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q53Y68|Q9BQ34	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.T355	ENST00000268655.4	37	c.1065	CCDS10504.1	16																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.527	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF174	protein_coding	OTTHUMT00000251510.1	G	NM_003450	-		3458760	+1	no_errors	ENST00000268655	ensembl	human	known	74_37	silent	SNP	0.000	T
CORO7	79585	genome.wustl.edu	37	16	4411430	4411430	+	Missense_Mutation	SNP	G	G	A	rs200682379	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr16:4411430G>A	ENST00000251166.4	-	17	1764	c.1619C>T	c.(1618-1620)aCg>aTg	p.T540M	CORO7-PAM16_ENST00000572274.1_5'Flank|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.T540M|CORO7_ENST00000574025.1_Missense_Mutation_p.T455M|CORO7_ENST00000537233.2_Missense_Mutation_p.T522M|CORO7_ENST00000423908.2_3'UTR|CORO7_ENST00000539968.1_Missense_Mutation_p.T320M	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	540					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						ATTCTGCAGCGTGGGCAGTGC	0.672													G|||	4	0.000798722	0.0015	0.0	5008	,	,		17565	0.0		0.0	False		,,,				2504	0.002																0								ENSG00000103426						50.0	53.0	52.0					16																	4411430		2196	4297	6493	CORO7-PAM16	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.1619C>T	16.37:g.4411430G>A	ENSP00000251166:p.Thr540Met	Somatic	0	133	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	75	34.78	B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1900,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T540M	ENST00000251166.4	37	c.1619	CCDS10513.1	16	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	28.3	4.910114	0.92107	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	T;T	0.66995	-0.24;-0.24	5.11	5.11	0.69529	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.118903	0.56097	D	0.000025	T	0.82089	0.4961	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.985;0.95;0.968;0.999;0.985	D	0.84173	0.0435	10	0.66056	D	0.02	-4.8731	18.1341	0.89612	0.0:0.0:1.0:0.0	.	455;522;320;540;521	P57737-2;B4DFD6;B3KUH7;P57737;B4DKU9	.;.;.;CORO7_HUMAN;.	M	540;455;320	ENSP00000251166:T540M;ENSP00000446221:T320M	ENSP00000251166:T540M	T	-	2	0	CORO7	4351431	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	9.739000	0.98837	2.373000	0.80994	0.561000	0.74099	ACG	-	smart_WD40_repeat,pfscan_WD40_repeat_dom		0.672	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7-PAM16	protein_coding	OTTHUMT00000251628.2	G	NM_024535	rs200682379		4411430	-1	no_errors	ENST00000572467	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC35G1	159371	genome.wustl.edu	37	10	95658334	95658334	+	Missense_Mutation	SNP	A	A	G	rs542280075		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr10:95658334A>G	ENST00000427197.1	+	2	246	c.185A>G	c.(184-186)aAg>aGg	p.K62R	SLC35G1_ENST00000371408.3_Missense_Mutation_p.K61R	NM_001134658.1|NM_153226.2	NP_001128130.1|NP_694958.1	Q2M3R5	S35G1_HUMAN	solute carrier family 35, member G1	62					calcium ion export from cell (GO:1990034)|cytosolic calcium ion homeostasis (GO:0051480)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TCAGAAGCCAAGAAGAAAGCA	0.383													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19547	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000176273						210.0	190.0	197.0					10																	95658334		2203	4300	6503	SLC35G1	SO:0001583	missense	0			-	HGNC	AK091309	CCDS7432.1, CCDS44459.1	10q23.33	2013-05-22	2011-08-03	2011-08-03	ENSG00000176273	ENSG00000176273		"""Solute carriers"""	26607	protein-coding gene	gene with protein product			"""transmembrane protein 20"""	TMEM20		21569384	Standard	NM_153226		Approved	FLJ33990, C10orf60	uc001kjg.2	Q2M3R5	OTTHUMG00000018779	ENST00000427197.1:c.185A>G	10.37:g.95658334A>G	ENSP00000400932:p.Lys62Arg	Somatic	0	66	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	29	35.56	Q86YG5|Q8NBA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DMT	p.K62R	ENST00000427197.1	37	c.185	CCDS44459.1	10	.	.	.	.	.	.	.	.	.	.	A	16.48	3.134909	0.56828	.	.	ENSG00000176273	ENST00000371408;ENST00000427197	T;T	0.78481	-1.16;-1.18	5.73	5.73	0.89815	.	0.363813	0.30959	N	0.008533	T	0.72748	0.3499	L	0.41824	1.3	0.40227	D	0.977803	P;B;B	0.52316	0.952;0.035;0.027	P;B;B	0.44422	0.449;0.014;0.019	T	0.71955	-0.4436	10	0.25106	T	0.35	.	16.3123	0.82883	1.0:0.0:0.0:0.0	.	45;62;61	B7ZKP0;Q2M3R5;Q2M3R5-2	.;S35G1_HUMAN;.	R	61;62	ENSP00000360462:K61R;ENSP00000400932:K62R	ENSP00000360462:K61R	K	+	2	0	SLC35G1	95648324	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.238000	0.65366	2.308000	0.77769	0.533000	0.62120	AAG	-	NULL		0.383	SLC35G1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC35G1	protein_coding		A	NM_153226	-		95658334	+1	no_errors	ENST00000427197	ensembl	human	known	74_37	missense	SNP	1.000	G
TRAK2	66008	genome.wustl.edu	37	2	202284069	202284069	+	Intron	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr2:202284069G>A	ENST00000332624.3	-	2	520				TRAK2_ENST00000451703.1_5'UTR|TRAK2_ENST00000430254.1_Intron	NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2						protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						gtccaaggctgcttttctgct	0.388																																																	0								ENSG00000115993																																			TRAK2	SO:0001627	intron_variant	0			-	HGNC	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.91+1070C>T	2.37:g.202284069G>A		Somatic	0	42	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000332624.3	37	NULL	CCDS2347.1	2																																																																																			-	-		0.388	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAK2	protein_coding	OTTHUMT00000256284.3	G	NM_015049	-		202284069	-1	no_errors	ENST00000451703	ensembl	human	putative	74_37	rna	SNP	0.450	A
BPIFC	254240	genome.wustl.edu	37	22	32843215	32843215	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr22:32843215A>T	ENST00000397452.1	-	4	468	c.358T>A	c.(358-360)Ttc>Atc	p.F120I	BPIFC_ENST00000534972.1_5'UTR|BPIFC_ENST00000432451.2_5'UTR|BPIFC_ENST00000300399.3_Missense_Mutation_p.F120I			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	120						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										GGAGACTCGAACCCCCAGTCT	0.448																																																	0								ENSG00000184459						138.0	119.0	126.0					22																	32843215		2203	4300	6503	BPIFC	SO:0001583	missense	0			-	HGNC	AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.358T>A	22.37:g.32843215A>T	ENSP00000380594:p.Phe120Ile	Somatic	0	91	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	56	37.08	A2RRF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.F120I	ENST00000397452.1	37	c.358	CCDS13906.1	22	.	.	.	.	.	.	.	.	.	.	A	10.16	1.274915	0.23307	.	.	ENSG00000184459	ENST00000397452;ENST00000300399	T;T	0.05081	3.5;3.5	5.87	-8.49	0.00931	.	0.570310	0.18956	N	0.126524	T	0.01489	0.0048	N	0.02142	-0.665	0.51233	D	0.999916	B	0.02656	0.0	B	0.01281	0.0	T	0.45804	-0.9236	10	0.13853	T	0.58	-5.9574	7.1646	0.25683	0.2179:0.1707:0.0:0.6114	.	120	Q8NFQ6	BPIFC_HUMAN	I	120	ENSP00000380594:F120I;ENSP00000300399:F120I	ENSP00000300399:F120I	F	-	1	0	BPIFC	31173215	0.000000	0.05858	0.001000	0.08648	0.765000	0.43378	-1.431000	0.02432	-1.199000	0.02666	-0.339000	0.08088	TTC	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N		0.448	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BPIFC	protein_coding	OTTHUMT00000129029.2	A	NM_174932	-		32843215	-1	no_errors	ENST00000300399	ensembl	human	known	74_37	missense	SNP	0.001	T
NOL4L	140688	genome.wustl.edu	37	20	31099150	31099150	+	Splice_Site	SNP	C	C	G			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr20:31099150C>G	ENST00000201961.2	-	4	636	c.417G>C	c.(415-417)caG>caC	p.Q139H	C20orf112_ENST00000375677.1_Splice_Site_p.Q11H|C20orf112_ENST00000375678.3_Splice_Site_p.Q98H			Q96MY1	NOL4L_HUMAN		222						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(5)|lung(5)	15						GCCGCCTTACCTGCTCCTGGG	0.552																																																	0								ENSG00000197183																																			C20orf112	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000201961.2:c.417+1G>C	20.37:g.31099150C>G		Somatic	0	81	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	61	23.75	Q5JYB7|Q6P0Y4|Q9BR34|Q9NQF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q139H	ENST00000201961.2	37	c.417		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.8|22.8	4.335567|4.335567	0.81801|0.81801	.|.	.|.	ENSG00000197183|ENSG00000197183	ENST00000419612|ENST00000375677;ENST00000375678;ENST00000201961;ENST00000375673	.|.	.|.	.|.	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|.	.|.	.|.	.|.	T|T	0.54208|0.54208	0.1844|0.1844	N|N	0.22421|0.22421	0.69|0.69	0.50039|0.50039	D|D	0.999845|0.999845	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.48703|0.48703	-0.9012|-0.9012	5|5	.|.	.|.	.|.	.|.	17.6368|17.6368	0.88124|0.88124	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	P|H	52|11;98;139;57	.|.	.|.	A|Q	-|-	1|3	0|2	C20orf112|C20orf112	30562811|30562811	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.913000|0.913000	0.54294|0.54294	7.154000|7.154000	0.77437|0.77437	2.641000|2.641000	0.89580|0.89580	0.561000|0.561000	0.74099|0.74099	GCC|CAG	-	NULL		0.552	C20orf112-002	KNOWN	basic|appris_candidate_longest	protein_coding	C20orf112	protein_coding	OTTHUMT00000078629.3	C		-	Missense_Mutation	31099150	-1	no_errors	ENST00000201961	ensembl	human	known	74_37	missense	SNP	1.000	G
PRH2	5555	genome.wustl.edu	37	12	11082885	11082885	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr12:11082885G>A	ENST00000396400.3	+	2	120	c.82G>A	c.(82-84)Gtt>Att	p.V28I	PRH2_ENST00000381847.3_Missense_Mutation_p.V28I|PRR4_ENST00000536668.1_Intron	NM_001110213.1	NP_001103683.1	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 2	28	Inhibits hydroxyapatite formation, binds to hydroxyapatite and calcium.					extracellular space (GO:0005615)				breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	13						CCAAGAAGACGTTCCCTTGGT	0.383																																																	0								ENSG00000134551						171.0	160.0	163.0					12																	11082885		2203	4300	6503	PRH2	SO:0001583	missense	0			-	HGNC		CCDS8636.1	12p13.2	2012-10-02				ENSG00000134551			9367	protein-coding gene	gene with protein product	"""parotid proline-rich protein"", ""acidic salivary proline-rich protein, HaeIII type, 2"""	168790				3009472	Standard	NM_005042		Approved	Pr	uc001qzi.4	P02810		ENST00000396400.3:c.82G>A	12.37:g.11082885G>A	ENSP00000379682:p.Val28Ile	Somatic	0	77	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	40	24.53	A2VCM0|A3KN66|A5D902|B2RMW2|Q4VBP2|Q53XA2|Q6P2F6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V28I	ENST00000396400.3	37	c.82	CCDS8636.1	12	.	.	.	.	.	.	.	.	.	.	G	2.058	-0.416161	0.04766	.	.	ENSG00000134551	ENST00000381847;ENST00000396400;ENST00000256972	T;T	0.15017	2.46;2.46	0.647	-1.29	0.09288	.	.	.	.	.	T	0.07188	0.0182	L	0.34521	1.04	0.09310	N	1	P;P	0.49253	0.692;0.921	B;B	0.26969	0.044;0.075	T	0.21724	-1.0237	8	0.87932	D	0	.	.	.	.	.	28;28	P02810;Q68D45	PRPC_HUMAN;.	I	28	ENSP00000371271:V28I;ENSP00000379682:V28I	ENSP00000256972:V28I	V	+	1	0	PRH2	10974152	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-3.026000	0.00640	-1.135000	0.02895	0.194000	0.17425	GTT	-	NULL		0.383	PRH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRH2	protein_coding	OTTHUMT00000400231.1	G	NM_001110213	-		11082885	+1	no_errors	ENST00000381847	ensembl	human	known	74_37	missense	SNP	0.000	A
ANP32BP1	646791	genome.wustl.edu	37	15	75614908	75614908	+	RNA	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr15:75614908G>A	ENST00000564205.1	-	0	126									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		GGATGGGGGAGAGGCATCCTG	0.667																																																	0								ENSG00000259790																																			ANP32BP1			0			-	HGNC			15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614908G>A		Somatic	0	69	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	54	22.86		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			-	-		0.667	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	pseudogene	OTTHUMT00000419801.1	G		-		75614908	-1	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	SNP	0.170	A
KLHDC7B	113730	genome.wustl.edu	37	22	50986680	50986680	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr22:50986680C>T	ENST00000395676.2	+	1	219	c.85C>T	c.(85-87)Ccc>Tcc	p.P29S	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	29										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCCGTGGGTCCCAGCACTTC	0.622																																																	0								ENSG00000130487						50.0	53.0	52.0					22																	50986680		692	1591	2283	KLHDC7B	SO:0001583	missense	0			-	HGNC	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.85C>T	22.37:g.50986680C>T	ENSP00000379034:p.Pro29Ser	Somatic	0	88	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	58	30.95		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,smart_Kelch_1	p.P29S	ENST00000395676.2	37	c.85	CCDS14097.2	22	.	.	.	.	.	.	.	.	.	.	C	12.50	1.958041	0.34565	.	.	ENSG00000130487	ENST00000395676	D	0.88201	-2.35	3.63	0.0014	0.14046	.	.	.	.	.	T	0.76521	0.3999	N	0.24115	0.695	0.09310	N	1	B	0.25312	0.123	B	0.17979	0.02	T	0.60924	-0.7166	9	0.25751	T	0.34	.	4.3524	0.11162	0.0:0.5854:0.1883:0.2262	.	29	Q96G42	KLD7B_HUMAN	S	29	ENSP00000379034:P29S	ENSP00000379034:P29S	P	+	1	0	KLHDC7B	49333546	0.000000	0.05858	0.002000	0.10522	0.013000	0.08279	0.699000	0.25586	0.215000	0.20761	0.485000	0.47835	CCC	-	NULL		0.622	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	protein_coding	OTTHUMT00000317089.2	C	NM_138433	-		50986680	+1	no_errors	ENST00000395676	ensembl	human	known	74_37	missense	SNP	0.004	T
ZNF607	84775	genome.wustl.edu	37	19	38189646	38189646	+	Silent	SNP	T	T	C			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr19:38189646T>C	ENST00000355202.4	-	5	1981	c.1386A>G	c.(1384-1386)tcA>tcG	p.S462S	ZNF607_ENST00000395835.3_Silent_p.S461S|CTD-2528L19.4_ENST00000586606.2_Intron	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			TAACAAGATATGAGGCACAAC	0.403																																																	0								ENSG00000198182						98.0	99.0	99.0					19																	38189646		2203	4300	6503	ZNF607	SO:0001819	synonymous_variant	0			-	HGNC	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.1386A>G	19.37:g.38189646T>C		Somatic	0	76	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	74	24.49	F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S462	ENST00000355202.4	37	c.1386	CCDS33006.1	19																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.403	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF607	protein_coding	OTTHUMT00000459502.2	T	NM_032689	-		38189646	-1	no_errors	ENST00000355202	ensembl	human	known	74_37	silent	SNP	0.053	C
CEP290	80184	genome.wustl.edu	37	12	88496697	88496697	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr12:88496697T>C	ENST00000552810.1	-	26	3252	c.2909A>G	c.(2908-2910)aAt>aGt	p.N970S	CEP290_ENST00000309041.7_Missense_Mutation_p.N972S|CEP290_ENST00000547691.2_Missense_Mutation_p.N30S|CEP290_ENST00000397838.3_Missense_Mutation_p.N30S	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	970					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						AGTCAGTTCATTGTACTGTTT	0.358																																																	0								ENSG00000198707						98.0	91.0	93.0					12																	88496697		1843	4100	5943	CEP290	SO:0001583	missense	0			-	HGNC	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2909A>G	12.37:g.88496697T>C	ENSP00000448012:p.Asn970Ser	Somatic	0	88	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	51	32.89	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N972S	ENST00000552810.1	37	c.2915	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	T	11.38	1.621564	0.28889	.	.	ENSG00000198707	ENST00000547691;ENST00000552810;ENST00000309041;ENST00000397838	T;T;T;T	0.63255	0.48;-0.03;-0.03;0.48	4.81	2.31	0.28768	.	0.092409	0.64402	D	0.000001	T	0.46718	0.1407	L	0.31926	0.97	0.31852	N	0.62215	B	0.10296	0.003	B	0.15870	0.014	T	0.47586	-0.9106	10	0.29301	T	0.29	.	9.4315	0.38612	0.0:0.1516:0.0:0.8484	.	970	O15078	CE290_HUMAN	S	30;970;972;30	ENSP00000446905:N30S;ENSP00000448012:N970S;ENSP00000308021:N972S;ENSP00000380938:N30S	ENSP00000308021:N972S	N	-	2	0	CEP290	87020828	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.137000	0.50562	0.643000	0.30638	0.459000	0.35465	AAT	-	NULL		0.358	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	protein_coding	OTTHUMT00000406344.1	T	NM_025114	-		88496697	-1	no_errors	ENST00000309041	ensembl	human	known	74_37	missense	SNP	1.000	C
BCHE	590	genome.wustl.edu	37	3	165548792	165548792	+	Silent	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr3:165548792G>T	ENST00000264381.3	-	2	196	c.30C>A	c.(28-30)atC>atA	p.I10I	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	10					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	AGAGAAATCTGATGCATATGA	0.333																																																	0								ENSG00000114200						38.0	36.0	37.0					3																	165548792		2203	4299	6502	BCHE	SO:0001819	synonymous_variant	0			-	HGNC	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.30C>A	3.37:g.165548792G>T		Somatic	0	52	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K7P8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.I10	ENST00000264381.3	37	c.30	CCDS3198.1	3																																																																																			-	NULL		0.333	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	protein_coding	OTTHUMT00000350254.1	G		-		165548792	-1	no_errors	ENST00000264381	ensembl	human	known	74_37	silent	SNP	0.000	T
ESPNP	284729	genome.wustl.edu	37	1	17026022	17026024	+	RNA	DEL	GGC	GGC	-			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:17026022_17026024delGGC	ENST00000492551.1	-	0	1424_1426					NR_026567.1				espin pseudogene																		CTCGGGCAGGggcggcggcggcg	0.803																																																	0								ENSG00000268869																																			ESPNP			0				HGNC	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17026031_17026033delGGC		Somatic	0	19	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			-	-		0.803	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	pseudogene	OTTHUMT00000326311.1	GGC				17026024	-1	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	DEL	1.000:1.000:0.992	-
CTNS	1497	genome.wustl.edu	37	17	3560153	3560153	+	Intron	SNP	T	T	C			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr17:3560153T>C	ENST00000046640.3	+	9	1274				CTNS_ENST00000414524.2_Intron|CTNS_ENST00000441220.2_Intron|CTNS_ENST00000381870.3_Intron|RP11-235E17.6_ENST00000575741.1_RNA	NM_004937.2	NP_004928.2	O60931	CTNS_HUMAN	cystinosin, lysosomal cystine transporter						adult walking behavior (GO:0007628)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|cellular amino acid metabolic process (GO:0006520)|cognition (GO:0050890)|glutathione metabolic process (GO:0006749)|grooming behavior (GO:0007625)|L-cystine transport (GO:0015811)|lens development in camera-type eye (GO:0002088)|long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	L-cystine transmembrane transporter activity (GO:0015184)			NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)	10				COAD - Colon adenocarcinoma(5;0.0829)	L-Cystine(DB00138)	ACCTCACCTTTGACAGAAGAC	0.602																																																	0								ENSG00000262903																																			RP11-235E17.6	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AJ222967	CCDS11031.1, CCDS32530.1	17p13	2011-06-07	2011-06-07		ENSG00000040531	ENSG00000040531			2518	protein-coding gene	gene with protein product		606272	"""cystinosis, nephropathic"""			9537412, 15128704	Standard	NM_004937		Approved	CTNS-LSB, PQLC4	uc002fwa.3	O60931	OTTHUMG00000090693	ENST00000046640.3:c.681+64T>C	17.37:g.3560153T>C		Somatic	0	37	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	11	60.71	D3DTJ5|Q8IZ01|Q9UNK6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000046640.3	37	NULL	CCDS11031.1	17																																																																																			-	-		0.602	CTNS-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ENSG00000262903	protein_coding	OTTHUMT00000317696.1	T	NM_004937	-		3560153	-1	no_errors	ENST00000575741	ensembl	human	known	74_37	rna	SNP	0.000	C
GBA	2629	genome.wustl.edu	37	1	155206233	155206233	+	Missense_Mutation	SNP	A	A	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:155206233A>T	ENST00000327247.5	-	9	1259	c.1027T>A	c.(1027-1029)Tat>Aat	p.Y343N	GBA_ENST00000428024.3_Missense_Mutation_p.Y256N|GBA_ENST00000536770.1_Missense_Mutation_p.Y230N|GBA_ENST00000427500.3_Missense_Mutation_p.Y294N|GBA_ENST00000493842.1_5'Flank|GBA_ENST00000368373.3_Missense_Mutation_p.Y343N|AL713999.1_ENST00000401290.1_RNA	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	343			Y -> C (in GD; type 2; 16% of normal activity; increases susceptibility to proteolytic degradation).		carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	CCATGAACATATTTAGCTGCT	0.507									Gaucher disease type I																																								0								ENSG00000177628						70.0	61.0	64.0					1																	155206233		2203	4300	6503	GBA	SO:0001583	missense	0	Familial Cancer Database	glucocerebrosidase insufficiency	-	HGNC	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.1027T>A	1.37:g.155206233A>T	ENSP00000314508:p.Tyr343Asn	Somatic	0	113	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	63	30.00	A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_30,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_30	p.Y343N	ENST00000327247.5	37	c.1027	CCDS1102.1	1	.	.	.	.	.	.	.	.	.	.	.	18.16	3.561769	0.65538	.	.	ENSG00000177628	ENST00000427500;ENST00000428024;ENST00000368373;ENST00000327247;ENST00000536770;ENST00000536555;ENST00000402928	D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29	3.67	2.53	0.30540	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.091144	0.45361	D	0.000363	D	0.99515	0.9827	M	0.93420	3.415	0.58432	D	0.999994	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.99;0.964;0.994	D	0.99593	1.0976	10	0.87932	D	0	.	5.3866	0.16222	0.8654:0.0:0.1346:0.0	.	294;230;343	B7Z5G2;F5H241;P04062	.;.;GLCM_HUMAN	N	294;256;343;343;230;300;328	ENSP00000402577:Y294N;ENSP00000397986:Y256N;ENSP00000357357:Y343N;ENSP00000314508:Y343N;ENSP00000445560:Y230N	ENSP00000314508:Y343N	Y	-	1	0	GBA	153472857	1.000000	0.71417	0.997000	0.53966	0.936000	0.57629	6.040000	0.70980	0.591000	0.29711	0.397000	0.26171	TAT	-	pfam_Glyco_hydro_30,superfamily_Glycoside_hydrolase_SF		0.507	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GBA	protein_coding	OTTHUMT00000087204.1	A	NM_000157	-		155206233	-1	no_errors	ENST00000327247	ensembl	human	known	74_37	missense	SNP	0.998	T
TSNAX	7257	genome.wustl.edu	37	1	231700641	231700641	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:231700641G>A	ENST00000366639.4	+	6	1021	c.863G>A	c.(862-864)gGc>gAc	p.G288D	TSNAX-DISC1_ENST00000602962.1_Intron	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	288					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				CAAGAAGAGGGCATTTCTTAG	0.318																																																	0								ENSG00000116918						68.0	69.0	69.0					1																	231700641		2203	4300	6503	TSNAX	SO:0001583	missense	0			-	HGNC	X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.863G>A	1.37:g.231700641G>A	ENSP00000355599:p.Gly288Asp	Somatic	0	47	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B1APC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Translin,superfamily_Translin	p.G288D	ENST00000366639.4	37	c.863	CCDS1596.1	1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.260972	0.59431	.	.	ENSG00000116918	ENST00000366639	.	.	.	5.67	5.67	0.87782	.	0.242902	0.49305	D	0.000159	T	0.60521	0.2275	L	0.47716	1.5	0.38565	D	0.949817	B	0.26400	0.148	B	0.24701	0.055	T	0.61441	-0.7062	9	0.72032	D	0.01	.	20.113	0.97915	0.0:0.0:1.0:0.0	.	288	Q99598	TSNAX_HUMAN	D	288	.	ENSP00000355599:G288D	G	+	2	0	TSNAX	229767264	1.000000	0.71417	0.996000	0.52242	0.821000	0.46438	8.695000	0.91298	2.828000	0.97474	0.650000	0.86243	GGC	-	NULL		0.318	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSNAX	protein_coding	OTTHUMT00000095267.2	G	NM_005999	-		231700641	+1	no_errors	ENST00000366639	ensembl	human	known	74_37	missense	SNP	1.000	A
DNM1P34	729809	genome.wustl.edu	37	15	75594814	75594814	+	RNA	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr15:75594814G>A	ENST00000567292.1	-	0	492							Q6PK57	DMP34_HUMAN	DNM1 pseudogene 34							microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GTGCACGCACGTTGTTGATCA	0.587																																																	0								ENSG00000260357																																			DNM1P34			0			-	HGNC	AJ576251		15q24.2	2013-04-25			ENSG00000260357	ENSG00000260357			35181	pseudogene	pseudogene				DNM1DN8@			Standard	NG_009143		Approved	DNM1DN8-1, DNM1DN8-5	uc002azx.1	Q6PK57	OTTHUMG00000172673		15.37:g.75594814G>A		Somatic	0	177	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	124	32.61		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567292.1	37	NULL		15																																																																																			-	-		0.587	DNM1P34-001	KNOWN	basic	processed_transcript	DNM1P34	pseudogene	OTTHUMT00000419799.1	G	NG_009143	-		75594814	-1	no_errors	ENST00000567292	ensembl	human	known	74_37	rna	SNP	0.989	A
GATA3	2625	genome.wustl.edu	37	10	8105992	8105992	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr10:8105992C>A	ENST00000346208.3	+	4	1267	c.812C>A	c.(811-813)aCc>aAc	p.T271N	GATA3_ENST00000461472.1_Intron|GATA3_ENST00000379328.3_Missense_Mutation_p.T272N			P23771	GATA3_HUMAN	GATA binding protein 3	271					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GCAACCTCGACCCCACTGTGG	0.552			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																	Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0								ENSG00000107485						163.0	119.0	133.0					10																	8105992		2203	4300	6503	GATA3	SO:0001583	missense	0			-	HGNC	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.812C>A	10.37:g.8105992C>A	ENSP00000341619:p.Thr271Asn	Somatic	0	98	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	25	48.98	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.T272N	ENST00000346208.3	37	c.815	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.120304	0.94385	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99875	-7.4;-7.4	5.39	5.39	0.77823	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (5);	0.000000	0.85682	D	0.000000	D	0.99912	0.9958	H	0.96048	3.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.96217	0.9157	10	0.87932	D	0	-16.7366	19.165	0.93553	0.0:1.0:0.0:0.0	.	271;272	P23771;P23771-2	GATA3_HUMAN;.	N	272;271	ENSP00000368632:T272N;ENSP00000341619:T271N	ENSP00000341619:T271N	T	+	2	0	GATA3	8145998	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	7.818000	0.86416	2.519000	0.84933	0.655000	0.94253	ACC	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA		0.552	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	protein_coding	OTTHUMT00000046719.1	C	NM_001002295	-		8105992	+1	no_errors	ENST00000379328	ensembl	human	known	74_37	missense	SNP	1.000	A
SDF4	51150	genome.wustl.edu	37	1	1164253	1164255	+	5'UTR	DEL	ATC	ATC	-			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	ATC	ATC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:1164253_1164255delATC	ENST00000360001.6	-	0	181_183				SDF4_ENST00000545427.1_5'UTR|SDF4_ENST00000263741.7_5'UTR|SDF4_ENST00000459994.2_5'UTR			Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4						calcium ion-dependent exocytosis (GO:0017156)|cerebellum development (GO:0021549)|fat cell differentiation (GO:0045444)|response to ethanol (GO:0045471)|UV protection (GO:0009650)|zymogen granule exocytosis (GO:0070625)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|late endosome (GO:0005770)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		CCTGGCTCCAATCCAATCCCCGG	0.67																																																	0								ENSG00000078808																																			SDF4	SO:0001623	5_prime_UTR_variant	0				HGNC		CCDS12.1, CCDS30553.1	1p36.33	2013-01-10			ENSG00000078808	ENSG00000078808		"""EF-hand domain containing"""	24188	protein-coding gene	gene with protein product	"""calcium binding protein"""	614282				9254016, 8609160	Standard	NM_016176		Approved	Cab45	uc001adh.4	Q9BRK5	OTTHUMG00000001812	ENST00000360001.6:c.-82GAT>-	1.37:g.1164253_1164255delATC		Somatic	0	18	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	B1AME5|B1AME6|B2RDF1|B4DSM1|Q53G52|Q53HQ9|Q8NBQ3|Q96AA1|Q9NZP7|Q9UN53	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000360001.6	37	NULL	CCDS30553.1	1																																																																																			-	-		0.670	SDF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDF4	protein_coding	OTTHUMT00000005064.1	ATC	NM_016176			1164255	-1	no_errors	ENST00000459994	ensembl	human	known	74_37	rna	DEL	0.002:0.000:0.000	-
F2R	2149	genome.wustl.edu	37	5	76028937	76028937	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr5:76028937G>T	ENST00000319211.4	+	2	1152	c.887G>T	c.(886-888)tGt>tTt	p.C296F		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	296					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	ATCATTCGATGTCTTAGCTCT	0.488																																																	0								ENSG00000181104						155.0	152.0	153.0					5																	76028937		2203	4300	6503	F2R	SO:0001583	missense	0			-	HGNC	M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.887G>T	5.37:g.76028937G>T	ENSP00000321326:p.Cys296Phe	Somatic	0	57	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	59	31.40	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thrmbn_rcpt,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.C296F	ENST00000319211.4	37	c.887	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249558	0.59212	.	.	ENSG00000181104	ENST00000319211	T	0.36157	1.27	4.71	3.83	0.44106	GPCR, rhodopsin-like superfamily (1);	0.216732	0.48767	D	0.000180	T	0.49201	0.1543	L	0.41236	1.265	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.42481	-0.9449	10	0.33141	T	0.24	-20.7161	15.4151	0.74960	0.0:0.1394:0.8606:0.0	.	296	P25116	PAR1_HUMAN	F	296	ENSP00000321326:C296F	ENSP00000321326:C296F	C	+	2	0	F2R	76064693	1.000000	0.71417	0.171000	0.22900	0.958000	0.62258	3.917000	0.56424	1.332000	0.45431	0.561000	0.74099	TGT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thrmbn_rcpt		0.488	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	protein_coding	OTTHUMT00000254068.2	G		-		76028937	+1	no_errors	ENST00000319211	ensembl	human	known	74_37	missense	SNP	0.757	T
OR6C1	390321	genome.wustl.edu	37	12	55714741	55714741	+	Missense_Mutation	SNP	C	C	T	rs143845104		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr12:55714741C>T	ENST00000379668.2	+	1	396	c.358C>T	c.(358-360)Cgc>Tgc	p.R120C		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						GTCCTATGACCGCTATGTGGC	0.398																																																	0								ENSG00000205330	C	CYS/ARG	0,4404		0,0,2202	47.0	48.0	48.0		358	3.7	0.9	12	dbSNP_134	48	2,8598	2.2+/-6.3	0,2,4298	yes	missense	OR6C1	NM_001005182.1	180	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	120/313	55714741	2,13002	2202	4300	6502	OR6C1	SO:0001583	missense	0			-	HGNC	AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	ENST00000379668.2:c.358C>T	12.37:g.55714741C>T	ENSP00000368990:p.Arg120Cys	Somatic	0	92	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	63	33.68	B2RNM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R120C	ENST00000379668.2	37	c.358	CCDS31818.1	12	.	.	.	.	.	.	.	.	.	.	c	16.59	3.164636	0.57476	0.0	2.33E-4	ENSG00000205330	ENST00000379668	T	0.77358	-1.09	4.62	3.71	0.42584	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000010	T	0.78240	0.4252	M	0.85041	2.73	0.51233	D	0.999914	B	0.28783	0.222	B	0.26094	0.066	T	0.80837	-0.1204	10	0.62326	D	0.03	.	12.0225	0.53352	0.0:0.9119:0.0:0.0881	.	120	Q96RD1	OR6C1_HUMAN	C	120	ENSP00000368990:R120C	ENSP00000368990:R120C	R	+	1	0	OR6C1	54001008	0.112000	0.22096	0.895000	0.35142	0.706000	0.40770	0.623000	0.24447	2.387000	0.81309	0.455000	0.32223	CGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.398	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C1	protein_coding	OTTHUMT00000398152.1	C	NM_001005182	rs143845104		55714741	+1	no_errors	ENST00000379668	ensembl	human	known	74_37	missense	SNP	1.000	T
ACO2	50	genome.wustl.edu	37	22	41916174	41916174	+	Splice_Site	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr22:41916174G>T	ENST00000216254.4	+	9	1054		c.e9-1		ACO2_ENST00000396512.3_Splice_Site|ACO2_ENST00000466237.1_Splice_Site	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial						cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						TGTTTCTTCAGCTGAAGCCAC	0.567																																																	0								ENSG00000100412						64.0	54.0	57.0					22																	41916174		2203	4300	6503	ACO2	SO:0001630	splice_region_variant	0			-	HGNC	AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.1033-1G>T	22.37:g.41916174G>T		Somatic	0	55	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9-1	ENST00000216254.4	37	c.1033-1	CCDS14017.1	22	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436269	0.83885	.	.	ENSG00000100412	ENST00000541439;ENST00000544234;ENST00000216254;ENST00000396512	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5211	0.90952	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACO2	40246120	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.344000	0.97050	2.453000	0.82957	0.561000	0.74099	.	-	-		0.567	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO2	protein_coding	OTTHUMT00000259151.1	G	NM_001098	-	Intron	41916174	+1	no_errors	ENST00000216254	ensembl	human	known	74_37	splice_site	SNP	1.000	T
XRRA1	143570	genome.wustl.edu	37	11	74656098	74656099	+	5'UTR	INS	-	-	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr11:74656098_74656099insT	ENST00000340360.6	-	0	291_292				XRRA1_ENST00000527087.1_5'UTR|XRRA1_ENST00000533598.1_5'UTR|XRRA1_ENST00000321448.8_Intron|AP001992.1_ENST00000578538.1_RNA	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						CCTTAACTTCCTTTTTTTTTTG	0.371																																																	0								ENSG00000166435																																			XRRA1	SO:0001623	5_prime_UTR_variant	0				HGNC	AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.-41->A	11.37:g.74656108_74656108dupT		Somatic	0	42	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340360.6	37	NULL	CCDS44680.1	11																																																																																			-	-		0.371	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	protein_coding	OTTHUMT00000384715.1	-	NM_182969			74656099	-1	no_errors	ENST00000524430	ensembl	human	known	74_37	rna	INS	0.997:0.998	T
TCIRG1	10312	genome.wustl.edu	37	11	67818126	67818126	+	Silent	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr11:67818126G>A	ENST00000265686.3	+	19	2517	c.2409G>A	c.(2407-2409)ctG>ctA	p.L803L	RP11-802E16.3_ENST00000534517.1_RNA|RP11-802E16.3_ENST00000526897.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA|TCIRG1_ENST00000530802.1_Intron|CHKA_ENST00000533728.1_5'Flank|TCIRG1_ENST00000532635.1_Silent_p.L587L	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	803					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						CCCTGCGGCTGCACTGGTGAG	0.627																																																	0								ENSG00000110719						93.0	87.0	89.0					11																	67818126		2200	4294	6494	TCIRG1	SO:0001819	synonymous_variant	0			-	HGNC	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2409G>A	11.37:g.67818126G>A		Somatic	0	85	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	O75877|Q8WVC5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_V-ATPase_116kDa_su	p.L803	ENST00000265686.3	37	c.2409	CCDS8177.1	11																																																																																			-	pfam_V-ATPase_116kDa_su		0.627	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCIRG1	protein_coding	OTTHUMT00000394305.1	G	NM_006019	-		67818126	+1	no_errors	ENST00000265686	ensembl	human	known	74_37	silent	SNP	1.000	A
PODXL2	50512	genome.wustl.edu	37	3	127379364	127379369	+	In_Frame_Del	DEL	GAAGAG	GAAGAG	-	rs200281996	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	GAAGAG	GAAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr3:127379364_127379369delGAAGAG	ENST00000342480.6	+	3	532_537	c.493_498delGAAGAG	c.(493-498)gaagagdel	p.EE171del		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	171	Glu-rich.				leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						agaggaggaagaagaggaagaggaag	0.553														37	0.00738818	0.0212	0.0014	5008	,	,		22508	0.005		0.0	False		,,,				2504	0.0031																0								ENSG00000114631			61,4203		1,59,2072						-4.8	0.4			53	3,8251		1,1,4125	no	coding	PODXL2	NM_015720.2		2,60,6197	A1A1,A1R,RR		0.0363,1.4306,0.5113				64,12454				PODXL2	SO:0001651	inframe_deletion	0				HGNC	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.493_498delGAAGAG	3.37:g.127379370_127379375delGAAGAG	ENSP00000345359:p.Glu171_Glu172del	Somatic	NA	NA	NA		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UVY4|Q8WUV6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CD34/Podocalyxin	p.EE168in_frame_del	ENST00000342480.6	37	c.493_498	CCDS3044.1	3																																																																																			-	NULL		0.553	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PODXL2	protein_coding	OTTHUMT00000356638.1	GAAGAG	NM_015720			127379369	+1	no_errors	ENST00000342480	ensembl	human	known	74_37	in_frame_del	DEL	0.461:0.426:0.115:0.869:0.885:0.889	-
CNN2	1265	genome.wustl.edu	37	19	1036080	1036080	+	Intron	SNP	G	G	C			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr19:1036080G>C	ENST00000263097.4	+	5	753				CNN2_ENST00000562958.2_Silent_p.G135G|CNN2_ENST00000606983.1_Intron|CNN2_ENST00000348419.3_Intron|CNN2_ENST00000565096.2_Intron|AC011558.5_ENST00000585757.1_RNA	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2						actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGATCTAGGGTCCCTGGCTG	0.677																																																	0								ENSG00000064666						15.0	16.0	15.0					19																	1036080		2202	4298	6500	CNN2	SO:0001627	intron_variant	0			-	HGNC	D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.391-49G>C	19.37:g.1036080G>C		Somatic	0	64	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	66	15.19	A5D8U8|A6NFI4|D6W5X9|Q92578	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Calponin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin,prints_Calponin	p.G135	ENST00000263097.4	37	c.405	CCDS12053.1	19																																																																																			-	superfamily_CH-domain		0.677	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN2	protein_coding	OTTHUMT00000420293.3	G	NM_004368	-		1036080	+1	no_errors	ENST00000562958	ensembl	human	novel	74_37	silent	SNP	0.002	C
PTGES	9536	genome.wustl.edu	37	9	132501706	132501707	+	3'UTR	INS	-	-	ACACAT	rs1134680|rs137962222|rs35042232|rs3884098|rs367837009		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr9:132501706_132501707insACACAT	ENST00000340607.4	-	0	676_677				PTGES_ENST00000481476.1_De_novo_Start_OutOfFrame	NM_004878.4	NP_004869.1	O14684	PTGES_HUMAN	prostaglandin E synthase						acute inflammatory response (GO:0002526)|arachidonic acid metabolic process (GO:0019369)|chronic inflammatory response (GO:0002544)|cyclooxygenase pathway (GO:0019371)|negative regulation of cell proliferation (GO:0008285)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|response to calcium ion (GO:0051592)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)	glutathione binding (GO:0043295)|prostaglandin-E synthase activity (GO:0050220)			lung(1)|skin(1)	2		Ovarian(14;0.00556)				Aacatacacacacacatacaca	0.525																																																	0								ENSG00000148344																																			PTGES	SO:0001624	3_prime_UTR_variant	0				HGNC	AF010316	CCDS6927.1	9q34.3	2008-07-21			ENSG00000148344	ENSG00000148344			9599	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase 1-like 1"", ""tumor protein p53 inducible protein 12"", ""p53-induced gene 12"", ""microsomal prostaglandin E synthase-1"", ""glutathione S-transferase 1-like 1"", ""MGST1-like 1"""	605172		MGST1L1		9305847, 10091672	Standard	NM_004878		Approved	MGST-IV, PIG12, MGST1-L1, TP53I12	uc004byi.3	O14684	OTTHUMG00000020791	ENST00000340607.4:c.*184->ATGTGT	9.37:g.132501707_132501712dupACACAT		Somatic	NA	NA	NA		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14900|Q5SZC0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340607.4	37	NULL	CCDS6927.1	9																																																																																			-	-		0.525	PTGES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES	protein_coding	OTTHUMT00000054599.2	-	NM_004878			132501707	-1	no_errors	ENST00000481476	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACACAT
TJP1	7082	genome.wustl.edu	37	15	29996494	29996494	+	Missense_Mutation	SNP	C	C	G			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr15:29996494C>G	ENST00000346128.6	-	27	5558	c.5084G>C	c.(5083-5085)aGt>aCt	p.S1695T	TJP1_ENST00000356107.6_Missense_Mutation_p.S1695T|TJP1_ENST00000545208.2_Missense_Mutation_p.S1615T|TJP1_ENST00000400011.2_Missense_Mutation_p.S1619T	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1695	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CACCAAAGGACTCAGCAGTGT	0.507																																					Melanoma(77;681 1843 6309 6570)												0								ENSG00000104067						46.0	49.0	48.0					15																	29996494		1991	4192	6183	TJP1	SO:0001583	missense	0			-	HGNC		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.5084G>C	15.37:g.29996494C>G	ENSP00000281537:p.Ser1695Thr	Somatic	0	49	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	49	14.04	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_ZU5,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin-like,prints_ZonOcculS1,prints_ZonOcculdens	p.S1695T	ENST00000346128.6	37	c.5084	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	C	20.7	4.041233	0.75732	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.63913	-0.07;-0.07	5.18	4.26	0.50523	ZU5 (3);	0.039599	0.85682	D	0.000000	T	0.79592	0.4472	M	0.80982	2.52	0.80722	D	1	B;P;P;B	0.48407	0.379;0.91;0.545;0.011	P;D;D;B	0.76071	0.898;0.987;0.969;0.19	T	0.82112	-0.0618	10	0.87932	D	0	.	13.5479	0.61715	0.0:0.9246:0.0:0.0754	.	1688;1615;1695;1619	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	T	1695;1619;1695;1615;1615	ENSP00000281537:S1695T;ENSP00000382890:S1619T	ENSP00000281537:S1695T	S	-	2	0	TJP1	27783786	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	7.818000	0.86416	1.177000	0.42855	0.467000	0.42956	AGT	-	pfam_ZU5,smart_ZU5,pfscan_ZU5		0.507	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	protein_coding	OTTHUMT00000268237.3	C	NM_003257	-		29996494	-1	no_errors	ENST00000346128	ensembl	human	known	74_37	missense	SNP	1.000	G
FGF5	2250	genome.wustl.edu	37	4	81209881	81209881	+	3'UTR	SNP	A	A	G			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr4:81209881A>G	ENST00000312465.7	+	0	3088				FGF5_ENST00000503413.1_3'UTR|FGF5_ENST00000456523.3_3'UTR	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5						cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						GAAGGGAAAGATAATAATGAT	0.333																																																	0								ENSG00000138675																																			FGF5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.*2055A>G	4.37:g.81209881A>G		Somatic	0	24	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	13	38.10	B2R554|O75846|Q3Y8M3|Q8NF90	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000312465.7	37	NULL	CCDS34021.1	4																																																																																			-	-		0.333	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	protein_coding	OTTHUMT00000252627.2	A		-		81209881	+1	no_errors	ENST00000503413	ensembl	human	known	74_37	rna	SNP	0.004	G
TNRC18	84629	genome.wustl.edu	37	7	5430009	5430011	+	Intron	DEL	AAG	AAG	-	rs34840801|rs368909449|rs377539951|rs373103246		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr7:5430009_5430011delAAG	ENST00000430969.1	-	4	836				TNRC18_ENST00000399537.4_Intron|TNRC18_ENST00000399434.2_In_Frame_Del_p.L124del	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aaaaaaaaaaaaGCCAGCATCCT	0.547																																																	0								ENSG00000182095																																			TNRC18	SO:0001627	intron_variant	0				HGNC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.487+104CTT>-	7.37:g.5430009_5430011delAAG		Somatic	0	29	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A8MX41|Q96JH1|Q96K91	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.L124in_frame_del	ENST00000430969.1	37	c.372_370	CCDS47534.1	7																																																																																			-	NULL		0.547	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	protein_coding		AAG				5430011	-1	no_errors	ENST00000399434	ensembl	human	putative	74_37	in_frame_del	DEL	0.694:0.670:0.633	-
MUC17	140453	genome.wustl.edu	37	7	100677114	100677114	+	Missense_Mutation	SNP	C	C	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr7:100677114C>A	ENST00000306151.4	+	3	2481	c.2417C>A	c.(2416-2418)cCt>cAt	p.P806H		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	806	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGGAAGTCCTTTATTAACA	0.483																																																	0								ENSG00000169876						278.0	285.0	283.0					7																	100677114		2203	4300	6503	MUC17	SO:0001583	missense	0			-	HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2417C>A	7.37:g.100677114C>A	ENSP00000302716:p.Pro806His	Somatic	0	110	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	77	29.36	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.P806H	ENST00000306151.4	37	c.2417	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	0.676	-0.800140	0.02841	.	.	ENSG00000169876	ENST00000306151	T	0.03330	3.97	1.08	-2.17	0.07059	.	.	.	.	.	T	0.02083	0.0065	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.44711	-0.9310	9	0.44086	T	0.13	.	3.6154	0.08075	0.4643:0.3042:0.2315:0.0	.	806	Q685J3	MUC17_HUMAN	H	806	ENSP00000302716:P806H	ENSP00000302716:P806H	P	+	2	0	MUC17	100463834	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	1.714000	0.37961	-0.513000	0.06496	0.134000	0.15878	CCT	-	NULL		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	C	NM_001040105	-		100677114	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	SNP	0.000	A
KIAA1211	57482	genome.wustl.edu	37	4	57180682	57180682	+	Silent	SNP	C	C	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr4:57180682C>T	ENST00000504228.1	+	6	1119	c.1014C>T	c.(1012-1014)gaC>gaT	p.D338D	KIAA1211_ENST00000264229.6_Silent_p.D338D|KIAA1211_ENST00000541073.1_Silent_p.D331D			Q6ZU35	K1211_HUMAN	KIAA1211	338	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TGGAGGAGGACGCCAGGCTGG	0.701																																																	0								ENSG00000109265						4.0	5.0	5.0					4																	57180682		1925	3851	5776	KIAA1211	SO:0001819	synonymous_variant	0			-	HGNC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1014C>T	4.37:g.57180682C>T		Somatic	0	37	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	21.74	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D338	ENST00000504228.1	37	c.1014	CCDS43230.1	4																																																																																			-	NULL		0.701	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	protein_coding	OTTHUMT00000362097.2	C	NM_020722	-		57180682	+1	no_errors	ENST00000504228	ensembl	human	known	74_37	silent	SNP	0.000	T
ERICH3	127254	genome.wustl.edu	37	1	75037267	75037267	+	Missense_Mutation	SNP	G	G	C			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:75037267G>C	ENST00000326665.5	-	14	4345	c.4127C>G	c.(4126-4128)tCc>tGc	p.S1376C	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1376	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TGAAAAGGAGGAGGCTTTATT	0.512																																																	0								ENSG00000178965						123.0	123.0	123.0					1																	75037267		2203	4300	6503	C1orf173	SO:0001583	missense	0			-	HGNC																												ENST00000326665.5:c.4127C>G	1.37:g.75037267G>C	ENSP00000322609:p.Ser1376Cys	Somatic	0	34	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	37.50	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S1376C	ENST00000326665.5	37	c.4127	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654155	0.47362	.	.	ENSG00000178965	ENST00000326665	T	0.19250	2.16	5.0	3.08	0.35506	.	.	.	.	.	T	0.12263	0.0298	N	0.24115	0.695	0.09310	N	0.999999	D	0.61697	0.99	P	0.58873	0.847	T	0.07539	-1.0767	9	0.62326	D	0.03	0.7678	6.8472	0.23994	0.1645:0.1423:0.6932:0.0	.	1376	Q5RHP9	CA173_HUMAN	C	1376	ENSP00000322609:S1376C	ENSP00000322609:S1376C	S	-	2	0	C1orf173	74809855	0.036000	0.19791	0.104000	0.21259	0.782000	0.44232	1.032000	0.30178	1.099000	0.41499	0.561000	0.74099	TCC	-	NULL		0.512	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	protein_coding	OTTHUMT00000026516.1	G		-		75037267	-1	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	SNP	0.005	C
ZBED9	114821	genome.wustl.edu	37	6	28543139	28543139	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr6:28543139C>T	ENST00000452236.2	-	3	1960	c.1343G>A	c.(1342-1344)aGt>aAt	p.S448N	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						ACTGAGTTCACTGACAACCTG	0.423																																																	0								ENSG00000232040						60.0	61.0	60.0					6																	28543139		2203	4300	6503	SCAND3	SO:0001583	missense	0			-	HGNC																												ENST00000452236.2:c.1343G>A	6.37:g.28543139C>T	ENSP00000395259:p.Ser448Asn	Somatic	0	50	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.S448N	ENST00000452236.2	37	c.1343	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	C	8.350	0.830675	0.16820	.	.	ENSG00000232040	ENST00000452236	T	0.41758	0.99	2.95	-0.981	0.10269	Integrase, catalytic core (2);Ribonuclease H-like (1);	.	.	.	.	T	0.05868	0.0153	N	0.04880	-0.145	0.21604	N	0.999628	B	0.02656	0.0	B	0.04013	0.001	T	0.43065	-0.9414	9	0.15952	T	0.53	.	7.3683	0.26787	0.0:0.5268:0.0:0.4732	.	448	Q6R2W3	SCND3_HUMAN	N	448	ENSP00000395259:S448N	ENSP00000395259:S448N	S	-	2	0	SCAND3	28651118	0.000000	0.05858	0.932000	0.37286	0.989000	0.77384	-0.684000	0.05173	-0.131000	0.11578	0.563000	0.77884	AGT	-	pfam_Integrase_cat-core,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core		0.423	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	C		-		28543139	-1	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	SNP	0.954	T
CTNNA2	1496	genome.wustl.edu	37	2	80816439	80816439	+	Missense_Mutation	SNP	C	C	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr2:80816439C>T	ENST00000402739.4	+	14	2023	c.2018C>T	c.(2017-2019)gCg>gTg	p.A673V	CTNNA2_ENST00000496558.1_Missense_Mutation_p.A673V|CTNNA2_ENST00000540488.1_Missense_Mutation_p.A673V|CTNNA2_ENST00000541047.1_Missense_Mutation_p.A673V|AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000466387.1_Missense_Mutation_p.A673V|CTNNA2_ENST00000361291.4_Missense_Mutation_p.A707V|CTNNA2_ENST00000343114.3_Missense_Mutation_p.A352V|AC008067.2_ENST00000595478.1_RNA|AC008067.2_ENST00000609950.1_RNA|AC008067.2_ENST00000596887.1_RNA	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	673					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GCCATCATGGCGCAACTACCG	0.522																																																	0								ENSG00000066032						62.0	67.0	65.0					2																	80816439		2176	4287	6463	CTNNA2	SO:0001583	missense	0			-	HGNC		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2018C>T	2.37:g.80816439C>T	ENSP00000384638:p.Ala673Val	Somatic	0	103	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	33	38.89	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.A707V	ENST00000402739.4	37	c.2120		2	.	.	.	.	.	.	.	.	.	.	C	22.8	4.340632	0.81911	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	N	0.24115	0.695	0.80722	D	1	B;D;D;D	0.65815	0.427;0.995;0.974;0.974	B;P;B;B	0.58331	0.145;0.837;0.424;0.424	T	0.52155	-0.8613	9	.	.	.	.	19.9813	0.97326	0.0:1.0:0.0:0.0	.	305;673;673;673	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	V	673;673;707;673;673;673;352	ENSP00000418191:A673V;ENSP00000419295:A673V;ENSP00000355398:A707V;ENSP00000384638:A673V;ENSP00000444675:A673V;ENSP00000441705:A673V;ENSP00000341500:A352V	.	A	+	2	0	CTNNA2	80669950	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.629000	0.83207	2.726000	0.93360	0.655000	0.94253	GCG	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.522	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	protein_coding	OTTHUMT00000328511.4	C	NM_004389	-		80816439	+1	no_errors	ENST00000361291	ensembl	human	known	74_37	missense	SNP	1.000	T
DIP2A	23181	genome.wustl.edu	37	21	47924314	47924314	+	Silent	SNP	G	G	C			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr21:47924314G>C	ENST00000417564.2	+	6	717	c.696G>C	c.(694-696)gtG>gtC	p.V232V	DIP2A_ENST00000427143.2_Silent_p.V168V|DIP2A_ENST00000318711.7_Silent_p.V233V|DIP2A_ENST00000466639.1_Intron|DIP2A_ENST00000435722.3_Silent_p.V232V|DIP2A_ENST00000400274.1_Silent_p.V232V|DIP2A_ENST00000457905.3_Silent_p.V232V			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	232					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CGGGCCTCGTGGAGCATTCGT	0.517																																																	0								ENSG00000160305						58.0	58.0	58.0					21																	47924314		1941	4160	6101	DIP2A	SO:0001819	synonymous_variant	0			-	HGNC	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.696G>C	21.37:g.47924314G>C		Somatic	0	85	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	82	21.15	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.V233	ENST00000417564.2	37	c.699	CCDS46655.1	21																																																																																			-	NULL		0.517	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	protein_coding	OTTHUMT00000376736.1	G	NM_015151	-		47924314	+1	no_errors	ENST00000318711	ensembl	human	known	74_37	silent	SNP	0.036	C
PRMT2	3275	genome.wustl.edu	37	21	48083368	48083368	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr21:48083368G>A	ENST00000397637.1	+	10	2125	c.1171G>A	c.(1171-1173)Ggt>Agt	p.G391S	PRMT2_ENST00000397638.2_Missense_Mutation_p.G391S|PRMT2_ENST00000458387.2_Missense_Mutation_p.G243E|PRMT2_ENST00000451211.2_Intron|PRMT2_ENST00000355680.3_Missense_Mutation_p.G391S|PRMT2_ENST00000440086.1_Missense_Mutation_p.G289S|PRMT2_ENST00000291705.6_Intron			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	391	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		CGTGGTCACGGGTTCAGTTGT	0.552																																																	0								ENSG00000160310						185.0	149.0	161.0					21																	48083368		2203	4300	6503	PRMT2	SO:0001583	missense	0			-	HGNC	U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.1171G>A	21.37:g.48083368G>A	ENSP00000380759:p.Gly391Ser	Somatic	0	41	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	37	32.73	B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_Arg_MeTrfase,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.G391S	ENST00000397637.1	37	c.1171	CCDS13737.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	21.4|21.4	4.147963|4.147963	0.78001|0.78001	.|.	.|.	ENSG00000160310|ENSG00000160310	ENST00000458387|ENST00000355680;ENST00000397638;ENST00000397637;ENST00000440086	T|D;D;D;D	0.69685|0.96365	-0.42|-3.99;-3.99;-3.99;-3.99	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.98642|0.98642	0.9545|0.9545	H|H	0.94385|0.94385	3.53|3.53	0.80722|0.80722	D|D	1|1	B|D;D	0.18741|0.89917	0.03|1.0;0.997	B|D;D	0.23419|0.91635	0.046|0.999;0.968	D|D	0.99609|0.99609	1.0980|1.0980	9|9	.|.	.|.	.|.	-8.7749|-8.7749	16.504|16.504	0.84264|0.84264	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	243|289;391	B7U631|Q498Y5;P55345	.|.;ANM2_HUMAN	E|S	243|391;391;391;289	ENSP00000407463:G243E|ENSP00000347906:G391S;ENSP00000380760:G391S;ENSP00000380759:G391S;ENSP00000397266:G289S	.|.	G|G	+|+	2|1	0|0	PRMT2|PRMT2	46907796|46907796	1.000000|1.000000	0.71417|0.71417	0.330000|0.330000	0.25442|0.25442	0.173000|0.173000	0.22820|0.22820	6.748000|6.748000	0.74877|0.74877	2.583000|2.583000	0.87209|0.87209	0.561000|0.561000	0.74099|0.74099	GGG|GGT	-	pfam_Arg_MeTrfase		0.552	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	protein_coding	OTTHUMT00000207401.1	G	NM_001535	-		48083368	+1	no_errors	ENST00000355680	ensembl	human	known	74_37	missense	SNP	0.995	A
MMP2	4313	genome.wustl.edu	37	16	55519559	55519559	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr16:55519559G>T	ENST00000219070.4	+	5	1211	c.702G>T	c.(700-702)aaG>aaT	p.K234N	MMP2_ENST00000437642.2_Missense_Mutation_p.K184N|MMP2_ENST00000543485.1_Missense_Mutation_p.K158N|MMP2_ENST00000570308.1_Missense_Mutation_p.K158N	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	234	Collagen-binding.|Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	AGTACTGCAAGTTCCCCTTCT	0.542																																																	0								ENSG00000087245						151.0	127.0	135.0					16																	55519559		2198	4300	6498	MMP2	SO:0001583	missense	0			-	HGNC		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.702G>T	16.37:g.55519559G>T	ENSP00000219070:p.Lys234Asn	Somatic	0	77	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin-like_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A	p.K234N	ENST00000219070.4	37	c.702	CCDS10752.1	16	.	.	.	.	.	.	.	.	.	.	G	14.00	2.403639	0.42613	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.51071	0.72;0.72;0.72	4.66	3.7	0.42460	Peptidase M10, metallopeptidase (1);Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);Peptidase, metallopeptidase (1);	0.091794	0.64402	D	0.000001	T	0.37433	0.1003	L	0.52364	1.645	0.54753	D	0.999983	B;B	0.19331	0.004;0.035	B;B	0.19148	0.024;0.02	T	0.24440	-1.0160	10	0.32370	T	0.25	.	7.2714	0.26258	0.2129:0.0:0.7871:0.0	.	184;234	E9PE45;P08253	.;MMP2_HUMAN	N	234;158;184	ENSP00000219070:K234N;ENSP00000444143:K158N;ENSP00000394237:K184N	ENSP00000219070:K234N	K	+	3	2	MMP2	54077060	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	0.685000	0.25378	2.164000	0.68074	0.436000	0.28706	AAG	-	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd		0.542	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP2	protein_coding	OTTHUMT00000256913.3	G		-		55519559	+1	no_errors	ENST00000219070	ensembl	human	known	74_37	missense	SNP	1.000	T
ATF6B	1388	genome.wustl.edu	37	6	32095994	32095994	+	5'UTR	SNP	C	C	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr6:32095994C>T	ENST00000375203.3	-	0	23				ATF6B_ENST00000375201.4_5'UTR|ATF6B_ENST00000468502.1_5'UTR	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta						response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						TCTTTCCCCCCCACCCCCCAA	0.602																																																	0								ENSG00000213676						36.0	36.0	36.0					6																	32095994		2203	4300	6503	ATF6B	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.-10G>A	6.37:g.32095994C>T		Somatic	0	69	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	76	20.83	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375203.3	37	NULL	CCDS4737.1	6																																																																																			-	-		0.602	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATF6B	protein_coding	OTTHUMT00000076638.2	C		-		32095994	-1	no_errors	ENST00000468502	ensembl	human	known	74_37	rna	SNP	1.000	T
LOC100507002	100507002	genome.wustl.edu	37	17	63097118	63097118	+	lincRNA	SNP	C	C	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr17:63097118C>A	ENST00000582940.1	+	0	189																											CAATCCGGTACCAAGGCCGGC	0.612																																																	0								ENSG00000263470																																			RP11-160O5.1			0			-	Clone_based_vega_gene																													17.37:g.63097118C>A		Somatic	0	45	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000582940.1	37	NULL		17																																																																																			-	-		0.612	RP11-160O5.1-001	KNOWN	basic	lincRNA	LOC100507002	lincRNA	OTTHUMT00000445723.1	C		-		63097118	+1	no_errors	ENST00000582940	ensembl	human	known	74_37	rna	SNP	0.999	A
MRPL42	28977	genome.wustl.edu	37	12	93894747	93894748	+	Intron	INS	-	-	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr12:93894747_93894748insA	ENST00000549982.1	+	6	544				MRPL42_ENST00000361630.2_Intron|MRPL42_ENST00000552217.1_Intron|MRPL42_ENST00000393128.4_Intron|MRPL42_ENST00000552938.1_3'UTR	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42						translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						ccagtctctagaaaaaaaaaat	0.366																																																	0								ENSG00000198015																																			MRPL42	SO:0001627	intron_variant	0				HGNC	AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.384-204->A	12.37:g.93894757_93894757dupA		Somatic	0	12	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q6FID1|Q96Q48|Q9P0S1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000549982.1	37	NULL	CCDS9045.1	12																																																																																			-	-		0.366	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL42	protein_coding	OTTHUMT00000407715.1	-	NM_014050			93894748	+1	no_errors	ENST00000552938	ensembl	human	putative	74_37	rna	INS	0.002:0.008	A
ARF5	381	genome.wustl.edu	37	7	127231635	127231636	+	3'UTR	INS	-	-	T	rs543667839|rs377612947		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr7:127231635_127231636insT	ENST00000000233.5	+	0	979_980				FSCN3_ENST00000265825.5_5'Flank|FSCN3_ENST00000420086.2_5'Flank|GCC1_ENST00000497650.1_Intron|FSCN3_ENST00000478328.1_3'UTR	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5						GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						TCTGGGTTTCCTTTTTTTTTTC	0.564																																																	0								ENSG00000179562																																			GCC1	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.*283->T	7.37:g.127231645_127231645dupT		Somatic	0	39	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.95	P26437	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000000233.5	37	NULL	CCDS34745.1	7																																																																																			-	-		0.564	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	protein_coding	OTTHUMT00000059567.2	-	NM_001662			127231636	-1	no_errors	ENST00000473728	ensembl	human	known	74_37	rna	INS	0.929:0.928	T
NPAS3	64067	genome.wustl.edu	37	14	34269971	34269971	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr14:34269971G>A	ENST00000356141.4	+	12	2458	c.2458G>A	c.(2458-2460)Gcg>Acg	p.A820T	NPAS3_ENST00000551492.1_Missense_Mutation_p.A825T|NPAS3_ENST00000346562.2_Missense_Mutation_p.A788T|NPAS3_ENST00000548645.1_Missense_Mutation_p.A790T|NPAS3_ENST00000357798.5_Missense_Mutation_p.A807T			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	820					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CAGCACGGCCGCGCAGAGGGT	0.697																																																	0								ENSG00000151322						15.0	14.0	14.0					14																	34269971		2179	4279	6458	NPAS3	SO:0001583	missense	0			-	HGNC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2458G>A	14.37:g.34269971G>A	ENSP00000348460:p.Ala820Thr	Somatic	0	22	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	19.23	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pfscan_PAS,pfscan_bHLH_dom	p.A820T	ENST00000356141.4	37	c.2458	CCDS53891.1	14	.	.	.	.	.	.	.	.	.	.	G	13.34	2.209202	0.39003	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.08458	3.35;3.22;3.23;3.23;3.23;3.09	5.02	5.02	0.67125	.	0.124357	0.52532	D	0.000076	T	0.06234	0.0161	N	0.14661	0.345	0.80722	D	1	P;P;P;P	0.50710	0.78;0.672;0.78;0.938	B;B;B;B	0.37091	0.131;0.062;0.131;0.241	T	0.34354	-0.9832	10	0.72032	D	0.01	.	18.3405	0.90303	0.0:0.0:1.0:0.0	.	790;820;788;807	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	T	794;825;788;790;820;807	ENSP00000448373:A794T;ENSP00000450392:A825T;ENSP00000319610:A788T;ENSP00000448916:A790T;ENSP00000348460:A820T;ENSP00000350446:A807T	ENSP00000319610:A788T	A	+	1	0	NPAS3	33339722	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	3.645000	0.54389	2.310000	0.77875	0.484000	0.47621	GCG	-	NULL		0.697	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	protein_coding	OTTHUMT00000276645.1	G		-		34269971	+1	no_errors	ENST00000356141	ensembl	human	known	74_37	missense	SNP	0.998	A
HINFP	25988	genome.wustl.edu	37	11	119005179	119005179	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr11:119005179G>T	ENST00000350777.2	+	10	1588	c.1525G>T	c.(1525-1527)Gct>Tct	p.A509S		NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor	509	Interaction with NPAT.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						TCAAGGAATAGCTGAGGAGCC	0.572											OREG0021397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000172273						24.0	28.0	27.0					11																	119005179		2200	4295	6495	HINFP	SO:0001583	missense	0			-	HGNC	AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.1525G>T	11.37:g.119005179G>T	ENSP00000318085:p.Ala509Ser	Somatic	0	39	0.00	1492	0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A509S	ENST00000350777.2	37	c.1525	CCDS8414.1	11	.	.	.	.	.	.	.	.	.	.	G	9.821	1.185765	0.21870	.	.	ENSG00000172273	ENST00000350777	T	0.10668	2.85	5.13	2.15	0.27550	.	0.249015	0.31404	N	0.007702	T	0.07593	0.0191	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.21415	-1.0246	10	0.59425	D	0.04	-0.6804	5.2068	0.15295	0.0778:0.1773:0.6109:0.1339	.	509	Q9BQA5	HINFP_HUMAN	S	509	ENSP00000318085:A509S	ENSP00000318085:A509S	A	+	1	0	HINFP	118510389	0.892000	0.30473	0.124000	0.21820	0.250000	0.25880	1.702000	0.37836	0.286000	0.22352	-0.123000	0.14984	GCT	-	NULL		0.572	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HINFP	protein_coding	OTTHUMT00000388201.2	G	NM_015517	-		119005179	+1	no_errors	ENST00000350777	ensembl	human	known	74_37	missense	SNP	0.875	T
FOXJ2	55810	genome.wustl.edu	37	12	8205396	8205396	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr12:8205396G>A	ENST00000162391.3	+	11	2820	c.1675G>A	c.(1675-1677)Ggt>Agt	p.G559S	FOXJ2_ENST00000539192.1_3'UTR	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	559					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		GCCACCTCCTGGTGCCAATGA	0.517																																																	0								ENSG00000065970						76.0	56.0	62.0					12																	8205396		2203	4300	6503	FOXJ2	SO:0001583	missense	0			-	HGNC	AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.1675G>A	12.37:g.8205396G>A	ENSP00000162391:p.Gly559Ser	Somatic	0	35	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G559S	ENST00000162391.3	37	c.1675	CCDS8587.1	12	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373216	0.82573	.	.	ENSG00000065970	ENST00000162391	D	0.93659	-3.26	5.85	4.96	0.65561	.	0.557324	0.16322	N	0.219508	D	0.89276	0.6669	L	0.44542	1.39	0.80722	D	1	B	0.12630	0.006	B	0.11329	0.006	D	0.83954	0.0318	10	0.23891	T	0.37	.	10.6762	0.45787	0.0872:0.0:0.9128:0.0	.	559	Q9P0K8	FOXJ2_HUMAN	S	559	ENSP00000162391:G559S	ENSP00000162391:G559S	G	+	1	0	FOXJ2	8096663	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.425000	0.59875	1.485000	0.48380	0.650000	0.86243	GGT	-	NULL		0.517	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ2	protein_coding	OTTHUMT00000400088.1	G	NM_018416	-		8205396	+1	no_errors	ENST00000162391	ensembl	human	known	74_37	missense	SNP	1.000	A
MAP1S	55201	genome.wustl.edu	37	19	17838873	17838873	+	Missense_Mutation	SNP	C	C	T	rs554580208	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr19:17838873C>T	ENST00000324096.4	+	5	2831	c.2680C>T	c.(2680-2682)Cgt>Tgt	p.R894C	MAP1S_ENST00000597681.1_3'UTR|MAP1S_ENST00000544059.2_Missense_Mutation_p.R868C|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	894	Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						TGGTGGGGACCGTGCCAGCCG	0.687													C|||	2	0.000399361	0.0	0.0	5008	,	,		12593	0.0		0.0	False		,,,				2504	0.002																0								ENSG00000130479						10.0	12.0	11.0					19																	17838873		2106	4154	6260	MAP1S	SO:0001583	missense	0			-	HGNC	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2680C>T	19.37:g.17838873C>T	ENSP00000325313:p.Arg894Cys	Somatic	0	63	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	107	15.08	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R894C	ENST00000324096.4	37	c.2680	CCDS32954.1	19	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677225	0.29783	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.21361	2.01;2.01	4.66	1.18	0.20946	.	0.310579	0.22649	N	0.057354	T	0.29321	0.0730	L	0.53249	1.67	0.09310	N	0.999996	D;D	0.76494	0.999;0.999	P;P	0.57960	0.83;0.649	T	0.07693	-1.0759	10	0.87932	D	0	-21.1952	5.8195	0.18520	0.3379:0.5689:0.0:0.0933	.	868;894	B4DH53;Q66K74	.;MAP1S_HUMAN	C	894;868	ENSP00000325313:R894C;ENSP00000439243:R868C	ENSP00000325313:R894C	R	+	1	0	MAP1S	17699873	0.033000	0.19621	0.014000	0.15608	0.055000	0.15305	-0.012000	0.12699	0.130000	0.18549	-0.150000	0.13652	CGT	-	NULL		0.687	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1S	protein_coding	OTTHUMT00000466027.1	C	NM_018174	-		17838873	+1	no_errors	ENST00000324096	ensembl	human	known	74_37	missense	SNP	0.070	T
TTLL11	158135	genome.wustl.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401																0								ENSG00000175764		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				TTLL11	SO:0001652	inframe_insertion	0				HGNC	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	Somatic	NA	NA	NA		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.123in_frame_insKA	ENST00000373776.3	37	c.368_367	CCDS6834.2	9																																																																																			-	NULL		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	TTLL11	protein_coding	OTTHUMT00000053907.1	-	XM_088486			124855331	-1	no_errors	ENST00000321582	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	TGGCCT
PLEKHG5	57449	genome.wustl.edu	37	1	6529183	6529188	+	In_Frame_Del	DEL	TCCTCC	TCCTCC	-	rs201551894|rs201182604|rs386628081|rs375111412|rs113541584|rs62639695	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	TCCTCC	TCCTCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:6529183_6529188delTCCTCC	ENST00000400915.3	-	20	2397_2402	c.2331_2336delGGAGGA	c.(2329-2337)gaggaggaa>gaa	p.777_779EEE>E	PLEKHG5_ENST00000340850.5_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000377740.3_In_Frame_Del_p.798_800EEE>E|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000377748.1_In_Frame_Del_p.798_800EEE>E|PLEKHG5_ENST00000377728.3_In_Frame_Del_p.721_723EEE>E|TNFRSF25_ENST00000351959.5_5'Flank|PLEKHG5_ENST00000377737.2_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000544978.1_In_Frame_Del_p.721_723EEE>E|TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000400913.1_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000535355.1_In_Frame_Del_p.790_792EEE>E|PLEKHG5_ENST00000377725.1_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000377732.1_In_Frame_Del_p.758_760EEE>E|PLEKHG5_ENST00000537245.1_In_Frame_Del_p.800_802EEE>E	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	777	Glu-rich.			Missing (in Ref. 6; BAC77354). {ECO:0000305}.	apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		Gtcctcgccttcctcctcctcctcct	0.631																																																	0								ENSG00000171680																																			PLEKHG5	SO:0001651	inframe_deletion	0				HGNC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2331_2336delGGAGGA	1.37:g.6529189_6529194delTCCTCC	ENSP00000383706:p.Glu777_Glu778del	Somatic	NA	NA	NA		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.EE801in_frame_del	ENST00000400915.3	37	c.2405_2400	CCDS41241.1	1																																																																																			-	NULL		0.631	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	protein_coding	OTTHUMT00000002631.1	TCCTCC	NM_020631			6529188	-1	no_errors	ENST00000537245	ensembl	human	known	74_37	in_frame_del	DEL	0.152:0.271:0.391:0.513:0.634:0.754	-
DIS3L2	129563	genome.wustl.edu	37	2	232995569	232995570	+	3'UTR	INS	-	-	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr2:232995569_232995570insA	ENST00000409401.3	+	0	1017_1018				DIS3L2_ENST00000409307.1_Intron|DIS3L2_ENST00000325385.7_Intron|DIS3L2_ENST00000273009.6_Intron|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000360410.4_Intron	NM_001257282.1	NP_001244211.1			DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		aaaagtgaattaaaaaaaaaaa	0.351																																																	0								ENSG00000144535																																			DIS3L2	SO:0001624	3_prime_UTR_variant	0				HGNC	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409401.3:c.*93->A	2.37:g.232995580_232995580dupA		Somatic	0	22	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409401.3	37	NULL	CCDS58753.1	2																																																																																			-	-		0.351	DIS3L2-003	KNOWN	basic|CCDS	protein_coding	DIS3L2	protein_coding	OTTHUMT00000330976.1	-	NM_152383			232995570	+1	no_errors	ENST00000470087	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
EOMES	8320	genome.wustl.edu	37	3	27763427	27763428	+	In_Frame_Ins	INS	-	-	CGGCGC	rs368178421|rs1874198|rs3062761	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr3:27763427_27763428insCGGCGC	ENST00000295743.4	-	1	561_562	c.358_359insGCGCCG	c.(358-360)gcc>gGCGCCGcc	p.119_120insGA	EOMES_ENST00000449599.1_In_Frame_Ins_p.119_120insGA|EOMES_ENST00000461503.1_Intron|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	119	Ala-rich.		A -> G (in dbSNP:rs12715125).		brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						ggcggcggcggctgcagcggcg	0.767														2685	0.536142	0.3147	0.5274	5008	,	,		7250	0.8363		0.3837	False		,,,				2504	0.6892																0								ENSG00000163508			101,91,844		44,2,11,38,13,410						-0.4	0.1		dbSNP_102	1	316,357,1963		136,0,44,143,71,924	no	codingComplex	EOMES	NM_005442.2		180,2,55,181,84,1334	A1A1,A1A2,A1R,A2A2,A2R,RR		25.5311,18.5328,23.5566				417,448,2807				EOMES	SO:0001652	inframe_insertion	0				HGNC	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.358_359insGCGCCG	3.37:g.27763427_27763428insCGGCGC	ENSP00000295743:p.Ala119_Ala120insGlyAla	Somatic	NA	NA	NA		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.120in_frame_insGA	ENST00000295743.4	37	c.359_358	CCDS2646.1	3																																																																																			-	NULL		0.767	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	protein_coding	OTTHUMT00000252995.1	-	NM_005442			27763428	-1	no_errors	ENST00000449599	ensembl	human	known	74_37	in_frame_ins	INS	0.116:0.075	CGGCGC
ROBO3	64221	genome.wustl.edu	37	11	124750448	124750453	+	In_Frame_Del	DEL	CGGAGT	CGGAGT	-	rs55725290|rs56085444|rs71859853	byFrequency	TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	CGGAGT	CGGAGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr11:124750448_124750453delCGGAGT	ENST00000397801.1	+	27	4285_4290	c.4093_4098delCGGAGT	c.(4093-4098)cggagtdel	p.RS1367del	ROBO3_ENST00000543966.1_In_Frame_Del_p.RS130del|ROBO3_ENST00000538940.1_In_Frame_Del_p.RS1345del|ROBO3_ENST00000525482.1_3'UTR	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1367					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TGgccggagccggagtcggagtcaga	0.66														2107	0.420727	0.6664	0.2392	5008	,	,		17575	0.378		0.2883	False		,,,				2504	0.3978																0								ENSG00000154134			2069,1609		709,651,479						2.4	1.0		dbSNP_130	17	1833,5925		332,1169,2378	no	coding	ROBO3	NM_022370.3		1041,1820,2857	A1A1,A1R,RR		23.6272,43.7466,34.1203				3902,7534				ROBO3	SO:0001651	inframe_deletion	0				HGNC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.4093_4098delCGGAGT	11.37:g.124750454_124750459delCGGAGT	ENSP00000380903:p.Arg1367_Ser1368del	Somatic	NA	NA	NA		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.RS1367in_frame_del	ENST00000397801.1	37	c.4093_4098	CCDS44755.1	11																																																																																			-	NULL		0.660	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	protein_coding	OTTHUMT00000387091.1	CGGAGT	XM_370663			124750453	+1	no_errors	ENST00000397801	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.988:0.987:1.000:0.999	-
ANK1	286	genome.wustl.edu	37	8	41519192	41519192	+	Intron	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr8:41519192G>T	ENST00000347528.4	-	41	5703				ANK1_ENST00000379758.2_Intron|RP11-930P14.1_ENST00000522388.1_RNA|RP11-930P14.1_ENST00000520418.1_RNA|ANK1_ENST00000522543.1_Intron|ANK1_ENST00000265709.8_Intron|ANK1_ENST00000396942.1_Intron|ANK1_ENST00000396945.1_Intron|ANK1_ENST00000314214.8_Intron|ANK1_ENST00000289734.7_Intron|ANK1_ENST00000522231.1_Intron|MIR486_ENST00000408108.1_RNA|ANK1_ENST00000352337.4_Intron|RP11-930P14.1_ENST00000585088.1_RNA|ANK1_ENST00000457297.1_Intron	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic						axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTGCCCACCAGGGAGAAGAGA	0.592																																																	0								ENSG00000253389																																			RP11-930P14.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5619+126C>A	8.37:g.41519192G>T		Somatic	0	27	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000347528.4	37	NULL	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	G	8.951	0.968225	0.18659	.	.	ENSG00000253389	ENST00000522388;ENST00000520418	.	.	.	5.5	2.62	0.31277	.	.	.	.	.	T	0.38931	0.1059	.	.	.	0.20821	N	0.999842	.	.	.	.	.	.	T	0.36432	-0.9748	5	0.87932	D	0	.	4.5472	0.12087	0.0775:0.1345:0.5108:0.2772	.	.	.	.	H	88	.	ENSP00000428913:Q88H	Q	+	3	2	RP11-930P14.1	41638349	0.021000	0.18746	0.000000	0.03702	0.010000	0.07245	1.318000	0.33643	0.248000	0.21435	0.561000	0.74099	CAG	-	-		0.592	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000253389	protein_coding	OTTHUMT00000317297.1	G	NM_020475	-		41519192	+1	no_errors	ENST00000520418	ensembl	human	known	74_37	rna	SNP	0.016	T
ASF1A	25842	genome.wustl.edu	37	6	119222020	119222020	+	Missense_Mutation	SNP	G	G	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr6:119222020G>A	ENST00000229595.5	+	2	393	c.199G>A	c.(199-201)Gca>Aca	p.A67T	MCM9_ENST00000316316.6_Intron	NM_014034.2	NP_054753.1	Q9Y294	ASF1A_HUMAN	anti-silencing function 1A histone chaperone	67	Interaction with histone H3, CHAF1B, and HIRA.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|muscle cell differentiation (GO:0042692)|negative regulation of chromatin silencing (GO:0031936)|nucleosome assembly (GO:0006334)|osteoblast differentiation (GO:0001649)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)	p.A67T(1)		endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0633)|OV - Ovarian serous cystadenocarcinoma(136;0.188)		TCCTGTTCCCGCAGGAAGGCA	0.353																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000111875						222.0	217.0	218.0					6																	119222020		1853	4096	5949	ASF1A	SO:0001583	missense	0			-	HGNC	AF279306	CCDS47469.1	6q22.31	2013-05-01	2013-05-01		ENSG00000111875	ENSG00000111875			20995	protein-coding gene	gene with protein product		609189	"""ASF1 anti-silencing function 1 homolog A (S. cerevisiae)"""			10810093, 11042152	Standard	NM_014034		Approved	DKFZP547E2110, CIA	uc011ebn.2	Q9Y294	OTTHUMG00000015470	ENST00000229595.5:c.199G>A	6.37:g.119222020G>A	ENSP00000229595:p.Ala67Thr	Somatic	0	69	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q6IA08|Q9P014	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like	p.A67T	ENST00000229595.5	37	c.199	CCDS47469.1	6	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729854	0.89390	.	.	ENSG00000111875	ENST00000229595	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.67335	0.2882	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.57797	-0.7749	9	0.23891	T	0.37	-18.3592	20.5792	0.99380	0.0:0.0:1.0:0.0	.	67	Q9Y294	ASF1A_HUMAN	T	67	.	ENSP00000229595:A67T	A	+	1	0	ASF1A	119263719	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.873000	0.98535	0.561000	0.74099	GCA	-	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like		0.353	ASF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASF1A	protein_coding	OTTHUMT00000361910.1	G	NM_014034	-		119222020	+1	no_errors	ENST00000229595	ensembl	human	known	74_37	missense	SNP	1.000	A
RBM39	9584	genome.wustl.edu	37	20	34292643	34292643	+	Nonsense_Mutation	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr20:34292643G>T	ENST00000253363.6	-	16	1462	c.1439C>A	c.(1438-1440)tCa>tAa	p.S480*	RBM39_ENST00000361162.6_Nonsense_Mutation_p.S474*|RBM39_ENST00000528062.3_Nonsense_Mutation_p.S458*|RBM39_ENST00000407261.4_Nonsense_Mutation_p.S323*			Q14498	RBM39_HUMAN	RNA binding motif protein 39	480	Interaction with NCOA6. {ECO:0000250}.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TGCAGCAATTGATGGGCACTT	0.368																																																	0								ENSG00000131051						107.0	106.0	106.0					20																	34292643		2203	4300	6503	RBM39	SO:0001587	stop_gained	0			-	HGNC	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1439C>A	20.37:g.34292643G>T	ENSP00000253363:p.Ser480*	Somatic	0	24	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_CC1_SF	p.S480*	ENST00000253363.6	37	c.1439	CCDS13266.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.383697	0.95967	.	.	ENSG00000131051	ENST00000253363;ENST00000361162;ENST00000528062;ENST00000407261	.	.	.	4.82	4.82	0.62117	.	0.131137	0.53938	D	0.000057	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.4518	0.90707	0.0:0.0:1.0:0.0	.	.	.	.	X	480;474;458;323	.	ENSP00000253363:S480X	S	-	2	0	RBM39	33756057	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.509000	0.98002	2.667000	0.90743	0.650000	0.86243	TCA	-	smart_RRM_dom_euk,smart_RRM_dom,tigrfam_CC1_SF		0.368	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	protein_coding	OTTHUMT00000078931.2	G	NM_184237	-		34292643	-1	no_errors	ENST00000253363	ensembl	human	known	74_37	nonsense	SNP	1.000	T
FCRL5	83416	genome.wustl.edu	37	1	157491063	157491063	+	Silent	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:157491063G>T	ENST00000361835.3	-	11	2416	c.2259C>A	c.(2257-2259)gtC>gtA	p.V753V	FCRL5_ENST00000356953.4_Silent_p.V753V|FCRL5_ENST00000461387.1_5'UTR	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	753	Ig-like C2-type 8.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TGAGGGTGAGGACCGGGCGAG	0.512																																																	0								ENSG00000143297						29.0	32.0	31.0					1																	157491063		2203	4299	6502	FCRL5	SO:0001819	synonymous_variant	0			-	HGNC	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2259C>A	1.37:g.157491063G>T		Somatic	0	39	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V753	ENST00000361835.3	37	c.2259	CCDS1165.1	1																																																																																			-	pfscan_Ig-like_dom		0.512	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	protein_coding	OTTHUMT00000046263.1	G	NM_031281	-		157491063	-1	no_errors	ENST00000356953	ensembl	human	known	74_37	silent	SNP	0.916	T
IGDCC4	57722	genome.wustl.edu	37	15	65674744	65674744	+	3'UTR	SNP	T	T	A			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr15:65674744T>A	ENST00000352385.2	-	0	5565				IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTCCACCATTTaaaaaaaaaa	0.403																																																	0								ENSG00000103742																																			IGDCC4	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.*1603A>T	15.37:g.65674744T>A		Somatic	0	56	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	72	11.11	Q9HCE4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000352385.2	37	NULL	CCDS10206.1	15																																																																																			-	-		0.403	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	protein_coding	OTTHUMT00000256825.2	T	NM_020962	-		65674744	-1	no_errors	ENST00000558048	ensembl	human	known	74_37	rna	SNP	0.000	A
CCER1	196477	genome.wustl.edu	37	12	91340253	91340253	+	Intron	DEL	T	T	-	rs5799966|rs397849978		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr12:91340253delT	ENST00000548187.1	-	3	193				LINC00615_ENST00000546725.1_lincRNA			Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1																		AAAGCCTTCCttttttttttt	0.423																																																	0								ENSG00000196243																																			LINC00615	SO:0001627	intron_variant	0				HGNC	BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000548187.1:c.283-5399A>-	12.37:g.91340253delT		Somatic	0	39	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	46	14.81	Q8TC47	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000548187.1	37	NULL		12																																																																																			-	-		0.423	CCER1-001	KNOWN	basic	processed_transcript	LINC00615	protein_coding	OTTHUMT00000407141.1	T	NM_152638			91340253	+1	no_errors	ENST00000546725	ensembl	human	known	74_37	rna	DEL	0.148	-
SLCO1B1	10599	genome.wustl.edu	37	12	21331641	21331641	+	Missense_Mutation	SNP	T	T	C			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr12:21331641T>C	ENST00000256958.2	+	6	709	c.613T>C	c.(613-615)Tct>Cct	p.S205P		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	205					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	AGAAGGACATTCTTCTTTGTA	0.323																																																	0								ENSG00000134538						107.0	100.0	102.0					12																	21331641		2203	4300	6503	SLCO1B1	SO:0001583	missense	0			-	HGNC		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.613T>C	12.37:g.21331641T>C	ENSP00000256958:p.Ser205Pro	Somatic	0	101	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	72	10.00	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.S205P	ENST00000256958.2	37	c.613	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	T	10.30	1.311382	0.23821	.	.	ENSG00000134538	ENST00000256958	T	0.58506	0.33	3.71	1.16	0.20824	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.638139	0.16306	N	0.220204	T	0.75064	0.3799	M	0.93978	3.48	0.20307	N	0.999916	D	0.71674	0.998	D	0.76575	0.988	T	0.63559	-0.6610	10	0.66056	D	0.02	.	1.1099	0.01702	0.3952:0.0956:0.1573:0.3518	.	205	Q9Y6L6	SO1B1_HUMAN	P	205	ENSP00000256958:S205P	ENSP00000256958:S205P	S	+	1	0	SLCO1B1	21222908	0.030000	0.19436	0.343000	0.25615	0.366000	0.29705	0.317000	0.19487	0.111000	0.17947	0.260000	0.18958	TCT	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.323	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	protein_coding	OTTHUMT00000402070.1	T	NM_006446	-		21331641	+1	no_errors	ENST00000256958	ensembl	human	known	74_37	missense	SNP	0.090	C
MCM3	4172	genome.wustl.edu	37	6	52141140	52141140	+	Missense_Mutation	SNP	C	C	T	rs188062670		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr6:52141140C>T	ENST00000229854.7	-	9	1376	c.1300G>A	c.(1300-1302)Gcc>Acc	p.A434T	MCM3_ENST00000476448.1_5'UTR|MCM3_ENST00000596288.1_Missense_Mutation_p.A479T|MCM3_ENST00000419835.2_Missense_Mutation_p.A388T			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	434	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					CCAGCCTTGGCAATGGTCACT	0.547																																																	0								ENSG00000112118						90.0	66.0	74.0					6																	52141140		2203	4300	6503	MCM3	SO:0001583	missense	0			GMAF=0	HGNC	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1300G>A	6.37:g.52141140C>T	ENSP00000229854:p.Ala434Thr	Somatic	0	47	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_Mcm3	p.A479T	ENST00000229854.7	37	c.1435		6	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	28.8	4.950945	0.92660	.	.	ENSG00000112118	ENST00000229854;ENST00000419835	T;T	0.08634	3.07;3.07	5.13	4.2	0.49525	ATPase, AAA+ type, core (1);	0.049407	0.85682	D	0.000000	T	0.22627	0.0546	M	0.87180	2.865	0.80722	D	1	D;P	0.55800	0.973;0.883	P;P	0.59643	0.861;0.861	T	0.03008	-1.1083	10	0.87932	D	0	-19.7353	16.2553	0.82515	0.1414:0.8586:0.0:0.0	.	388;434	B4DUQ9;P25205	.;MCM3_HUMAN	T	434;388	ENSP00000229854:A434T;ENSP00000388647:A388T	ENSP00000229854:A434T	A	-	1	0	MCM3	52249099	1.000000	0.71417	0.988000	0.46212	0.995000	0.86356	4.783000	0.62403	2.669000	0.90835	0.655000	0.94253	GCC	-	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase		0.547	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	protein_coding	OTTHUMT00000470784.1	C		rs188062670		52141140	-1	no_errors	ENST00000596288	ensembl	human	known	74_37	missense	SNP	1.000	T
CELSR2	1952	genome.wustl.edu	37	1	109803769	109803769	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:109803769G>T	ENST00000271332.3	+	3	4125	c.4064G>T	c.(4063-4065)tGc>tTc	p.C1355F		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1355	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		AAGTGCGATTGCCCATCTGGA	0.627																																					NSCLC(158;1285 2011 34800 34852 42084)												0								ENSG00000143126						103.0	99.0	100.0					1																	109803769		2203	4300	6503	CELSR2	SO:0001583	missense	0			-	HGNC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.4064G>T	1.37:g.109803769G>T	ENSP00000271332:p.Cys1355Phe	Somatic	0	70	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q5T2Y7|Q92566	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.C1355F	ENST00000271332.3	37	c.4064	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570183	0.86542	.	.	ENSG00000143126	ENST00000271332	D	0.96992	-4.2	4.77	4.77	0.60923	Concanavalin A-like lectin/glucanase (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99193	0.9720	H	0.99740	4.74	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98693	1.0697	9	0.87932	D	0	.	17.9928	0.89174	0.0:0.0:1.0:0.0	.	1355	Q9HCU4	CELR2_HUMAN	F	1355	ENSP00000271332:C1355F	ENSP00000271332:C1355F	C	+	2	0	CELSR2	109605292	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.657000	0.98554	2.478000	0.83669	0.561000	0.74099	TGC	-	superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom		0.627	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	protein_coding	OTTHUMT00000033200.1	G	NM_001408	-		109803769	+1	no_errors	ENST00000271332	ensembl	human	known	74_37	missense	SNP	1.000	T
CORIN	10699	genome.wustl.edu	37	4	47645273	47645273	+	Splice_Site	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr4:47645273G>T	ENST00000273857.4	-	15	1957	c.1958C>A	c.(1957-1959)tCa>tAa	p.S653*	CORIN_ENST00000508498.1_Splice_Site_p.S514*|CORIN_ENST00000502252.1_Splice_Site_p.S586*|CORIN_ENST00000505909.1_Splice_Site_p.S616*|CORIN_ENST00000504584.1_Splice_Site_p.S616*	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	653	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						TTGGCAAAATGCTGGCATGGG	0.438																																																	0								ENSG00000145244						133.0	108.0	117.0					4																	47645273		2203	4300	6503	CORIN	SO:0001630	splice_region_variant	0			-	HGNC	AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.1958-1C>A	4.37:g.47645273G>T		Somatic	0	62	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Peptidase_S1A_corin,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_Frizzled_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Frizzled_dom,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.S653*	ENST00000273857.4	37	c.1958	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.256941	0.97417	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909;ENST00000504584	.	.	.	6.17	6.17	0.99709	.	0.301489	0.30930	N	0.008583	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	653;514;586;616;616	.	ENSP00000273857:S653X	S	-	2	0	CORIN	47340030	1.000000	0.71417	1.000000	0.80357	0.322000	0.28314	8.166000	0.89665	2.941000	0.99782	0.655000	0.94253	TCA	-	pirsf_Peptidase_S1A_corin,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.438	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	protein_coding	OTTHUMT00000216906.2	G		-	Nonsense_Mutation	47645273	-1	no_errors	ENST00000273857	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PDE4DIP	9659	genome.wustl.edu	37	1	144856959	144856959	+	Missense_Mutation	SNP	G	G	T			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr1:144856959G>T	ENST00000369354.3	-	40	6715	c.6526C>A	c.(6526-6528)Cat>Aat	p.H2176N	RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.H2176N|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.H2070N|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.H2312N|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.H2261N			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2176					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGGCGGCCATGCTTATTGGCA	0.488			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0								ENSG00000178104						58.0	56.0	57.0					1																	144856959		2203	4296	6499	PDE4DIP	SO:0001583	missense	0			-	HGNC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6526C>A	1.37:g.144856959G>T	ENSP00000358360:p.His2176Asn	Somatic	0	525	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	410	13.11	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.H2176N	ENST00000369354.3	37	c.6526	CCDS30824.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	10.21|10.21	1.287411|1.287411	0.23478|0.23478	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359|ENST00000530130	T;T;T;T;T|.	0.01369|.	4.97;5.1;5.09;5.06;5.08|.	4.48|4.48	2.53|2.53	0.30540|0.30540	.|.	.|.	.|.	.|.	.|.	T|T	0.27169|0.27169	0.0666|0.0666	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	B;P|.	0.36616|.	0.0;0.561|.	B;B|.	0.32289|.	0.001;0.143|.	T|T	0.07252|0.07252	-1.0782|-1.0782	8|5	.|.	.|.	.|.	.|.	5.4373|5.4373	0.16488|0.16488	0.0972:0.0:0.5503:0.3524|0.0972:0.0:0.5503:0.3524	.|.	2070;2176|.	Q5VU43-3;Q5VU43|.	.;MYOME_HUMAN|.	N|R	2070;2176;2176;2261;2312|252	ENSP00000327209:H2070N;ENSP00000358360:H2176N;ENSP00000358363:H2176N;ENSP00000435654:H2261N;ENSP00000358366:H2312N|.	.|.	H|S	-|-	1|3	0|2	PDE4DIP|PDE4DIP	143568316|143568316	0.372000|0.372000	0.25064|0.25064	0.998000|0.998000	0.56505|0.56505	0.991000|0.991000	0.79684|0.79684	1.189000|1.189000	0.32114|0.32114	0.427000|0.427000	0.26145|0.26145	0.449000|0.449000	0.29647|0.29647	CAT|AGC	-	NULL		0.488	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	protein_coding	OTTHUMT00000038858.2	G	NM_022359	-		144856959	-1	no_errors	ENST00000369356	ensembl	human	known	74_37	missense	SNP	0.985	T
TESK1	7016	genome.wustl.edu	37	9	35607308	35607309	+	Intron	DEL	TG	TG	-			TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr9:35607308_35607309delTG	ENST00000336395.5	+	5	787				CD72_ENST00000490239.1_5'Flank|TESK1_ENST00000498522.1_Intron|MIR4667_ENST00000578933.1_RNA	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1						cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGGGATACTATGTGTGTGTGTG	0.545																																																	0								ENSG00000107140																																			TESK1	SO:0001627	intron_variant	0				HGNC	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.538-15TG>-	9.37:g.35607318_35607319delTG		Somatic	0	36	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	Q8IXZ8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000336395.5	37	NULL	CCDS6580.1	9																																																																																			-	-		0.545	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK1	protein_coding	OTTHUMT00000052314.1	TG	NM_006285			35607309	+1	no_errors	ENST00000463897	ensembl	human	known	74_37	rna	DEL	0.001:0.001	-
CRIM1	51232	genome.wustl.edu	37	2	36583692	36583692	+	Frame_Shift_Del	DEL	G	G	-	rs145554366		TCGA-3B-A9HR-01A-11D-A387-09	TCGA-3B-A9HR-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4355e545-4c5a-46c9-9bfa-a862afc22ae2	f3905e19-7e5a-43f6-8bd5-778ea63193c5	g.chr2:36583692delG	ENST00000280527.2	+	1	624	c.257delG	c.(256-258)cggfs	p.R86fs	RP11-490M8.1_ENST00000565283.1_lincRNA	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	86	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				ACCTGCGACCGGGGGCTGCGT	0.692																																																	0								ENSG00000150938						38.0	39.0	39.0					2																	36583692		2203	4298	6501	CRIM1	SO:0001589	frameshift_variant	0				HGNC	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.257delG	2.37:g.36583692delG	ENSP00000280527:p.Arg86fs	Somatic	0	50	0.00		0.5571105212064639	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VWF_C,pfam_Antistasin-like,superfamily_Hirudin/antistatin,smart_IGFBP-like,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	p.L88fs	ENST00000280527.2	37	c.257	CCDS1783.1	2																																																																																			-	smart_IGFBP-like		0.692	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIM1	protein_coding	OTTHUMT00000216878.2	G	NM_016441			36583692	+1	no_errors	ENST00000280527	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
